Use of ncapg2 for treating and diagnosing infertility and subfertility

Abstract

The present invention relates to a use, of NCAPG2 for the treatment and diagnosis of infertility and subfertility, for improving the possibility of pregnancy. A composition comprising NCAPG2 protein or a gene encoding the protein, according to one aspect, improves the quality of oocytes and reduces the occurrence of chromosomal abnormalities and aneuploidy during meiosis, and thus can be effectively used for improving the possibility of pregnancy and preventing or treating infertility or subfertility.

Description

Uses of NCAPG2 for the Treatment and Diagnosis of Infertility and Subfertility

[0001] The present invention relates to the use of Ncapg2 to improve pregnancy potential for the treatment and diagnosis of infertility and subfertility.

[0002] Recently, along with the aging society, infertility is on the rise as the age of mothers giving birth increases. Furthermore, pregnancy rates are significantly declining due to increased stress experienced by women resulting from environmental pollution caused by industrialization and their increased participation in the workforce. Mammalian eggs mature through meiosis to become fertilizable; during this process, the precise alignment of chromosomes and the structural stability of the centromere and pericentromeric region must be maintained. However, if this process fails to occur normally in aged eggs, chromosomal missegregation occurs, leading to aploidy. This can result in reduced fertilization rates, embryonic development failure, and ultimately infertility or subfertility. In other words, female reproductive capacity declines with age and is closely linked to the deterioration of egg quality.

[0003] Generally, infertility problems caused by ovulation disorders and embryo transfer failures are being resolved through in vitro fertilization (IVF), but there is currently no clear solution to improve the chances of pregnancy.

[0004] Ncapg2 (Non-SMC condensin II complex subunit G2) is a subunit of the condensin II complex and is known to play a role in the assembly and separation of chromosomes during somatic cell division along with the condensin I complex. As a result of diligent efforts by the inventors to develop a substance capable of improving pregnancy potential, it was confirmed that increasing Ncapg2, which is known to play a role in the assembly and separation of chromosomes during somatic cell division, can improve pregnancy potential, thereby completing the present invention.

[0005] One aspect provides a composition for enhancing pregnancy potential comprising an Ncapg2 protein or a gene encoding said protein.

[0006] Another aspect is to provide a pharmaceutical composition for the prevention or treatment of infertility or subfertility comprising an Ncapg2 protein or a gene encoding said protein.

[0007] Another aspect provides a method for preventing, improving, or treating infertility or subfertility, comprising the step of administering an effective amount of Ncapg2 protein or a gene encoding said protein to an individual in need thereof.

[0008] Another aspect is to provide the use of the Ncapg2 protein or the gene encoding said protein for the prevention, improvement, or treatment of infertility or subfertility.

[0009] Another aspect is to provide the use of the Ncapg2 protein or the gene encoding said protein for the manufacture of preparations for the prevention, improvement, or treatment of infertility or subfertility.

[0010] Another aspect is to provide an animal egg comprising the above-mentioned composition for enhancing the possibility of pregnancy.

[0011] Another aspect is to provide an animal model of infertility or sterility in which the gene encoding the Ncapg2 protein is knocked out specifically in oocytes.

[0012] Another aspect provides a method for evaluating the efficacy or safety of a drug for treating infertility or infertility, comprising the steps of: treating the animal model with a candidate drug; and measuring the degree of improvement in infertility or infertility or the safety of the candidate drug.

[0013] Another aspect provides a method for producing an egg with enhanced fertility potential, comprising the step of introducing the above composition into an animal egg other than a human.

[0014] Another aspect provides a composition for selecting healthy eggs comprising a preparation for measuring the level of the Ncapg2 protein or the gene encoding the protein.

[0015] Another aspect is to provide a screening kit for healthy eggs comprising the above-mentioned screening composition.

[0016] Another aspect provides a method for assessing pregnancy potential comprising the steps of: measuring the tension of tubulin during the meiotic stage of an egg separated from an individual; and comparing the tension with the tension measured in an egg separated from a normal control group of the same age.

[0017] One aspect provides a composition for enhancing pregnancy potential comprising an Ncapg2 protein or a gene encoding said protein.

[0018] The enhancement of the aforementioned fertility may refer to improving the functionality of oocytes that has been reduced by aging. Specifically, it may involve improving oocyte functionality that has been reduced due to one or more of the following causes: deterioration of oocyte quality due to aging, abnormal chromosomal alignment during meiosis, structural instability of the centromere and pericentromere regions, and / or increased occurrence of chromosomal nondisjunction and aploidy. More specifically, it may be the improvement of oocyte functionality through the restoration of Ncapg2 expression that has been reduced by aging.

[0019] The above composition comprises an Ncapg2 protein or a gene encoding it, and may further comprise a substance that increases the expression or activity of Ncapg2.

[0020] In one embodiment, the Ncapg2 protein may comprise an amino acid sequence represented by SEQ ID NO. 1 (UniProt ID: Q86XI2) or SEQ ID NO. 2 (UniProt ID: Q6DFV1), or an amino acid sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identity with the same.

[0021] In one embodiment, the Ncapg2 protein or the gene encoding the protein may be of animal origin. There are no particular restrictions on the animal, but it may preferably be a mammal.

[0022] Another aspect is to provide a composition for the prevention or treatment of infertility or subfertility comprising an Ncapg2 protein or a gene encoding said protein.

[0023] In this specification, the term "prevention" refers to any act of suppressing or delaying a disease by administering the composition of the present invention to an individual. For preventive benefits, the composition may be administered to a subject at risk of developing a specific disease, condition, or symptom, or to a subject reporting one or more physiological symptoms of a disease, even if the disease, condition, or symptom has not yet appeared.

[0024] In this specification, the term "treat" refers to any act of administering the composition of the present invention to an individual to improve or benefit from the symptoms of a disease. As used herein, "treat," "alleviate," or "improvement" may be used interchangeably. A therapeutic benefit means any therapeutically significant improvement of one or more diseases, conditions, or symptoms under treatment, or an effect thereon.

[0025] In this specification, the terms "infertility" or "subfertility" refer to a condition in which a problem occurs in the normal progression of the process of pregnancy and such problem persists for a long period due to some cause, and a condition in which pregnancy is not achieved within one year despite normal marital relations. Infertility refers to a condition in which the possibility of pregnancy is very low or virtually impossible, while subfertility refers to a condition in which pregnancy is possible but achieving pregnancy is more difficult than normal, i.e., a state of reduced fertility.

[0026] In one embodiment, the infertility or infertility may be female and / or male infertility or infertility, preferably meaning female infertility or infertility.

[0027] In one embodiment, the infertility or subfertility may be infertility or subfertility caused by aging. Specifically, the infertility or subfertility may be infertility or subfertility caused by one or more of the following: deterioration of egg quality due to aging, abnormal chromosomal alignment during meiosis, structural instability of the centromere and pericentromere regions, and / or increased occurrence of chromosomal nondisjunction and aploidy.

[0028] The above composition for the prevention or treatment of infertility or subfertility may be a pharmaceutical composition.

[0029] The above composition comprises, based on the total weight of the composition, 0.00001 wt% to 80 wt%, for example, 0.00001 wt% to 60 wt%, 0.00001 wt% to 40 wt%, 0.00001 wt% to 30 wt%, 0.00001 wt% to 20 wt%, 0.00001 wt% to 10 wt%, 0.00001 wt% to 5 wt%, 0.05 wt% to 60 wt%, 0.05 wt% to 40 wt%, 0.05 wt% to 30 wt%, 0.05 wt% to 20 wt%, 0.05 wt% to 10 wt%, 0.05 wt% to 5 wt%, 0.1 wt% to 60 wt%, 0.1 wt% to 40 wt%, 0.1 wt% to It may contain 30 wt%, 0.1 wt% to 20 wt%, 0.1 wt% to 10 wt%, or 0.1 wt% to 5 wt% of a compound or a salt thereof.

[0030] The statement that the above composition "comprising" the Ncapg2 protein or the gene encoding said protein means that the Ncapg2 protein or the gene encoding said protein of this specification is added to an extent capable of producing the effects mentioned above, and means that it includes formulation in various forms by adding various components as auxiliary components for drug delivery and stabilization, etc.

[0031] The pharmaceutical composition of the present invention may be in any form suitable for the intended method of administration. In the pharmaceutical composition of the present invention, "administration" means introducing a specific substance to a patient by any appropriate method, and the route of administration of said pharmaceutical composition may be administered through any general route as long as the drug can reach the target tissue. Administration may be administered by methods known in the art, such as, for example, ocular local administration (e.g., periocular (e.g., subtenon's), subconjunctival, intraocular, intravitreal, anterior chamber, subretinal, supracorbital, and retroocular administration), intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, local administration, intranasal administration, intrapulmonary administration, rectal administration, etc., but is not limited thereto. Additionally, it may be administered by any device capable of delivering the active ingredient to target cells, and it is preferable that the route of administration be determined according to the type of disease to which it is applied.

[0032] The above administration is 0.00001 mg to 1,000 mg of the composition according to one embodiment per individual per day, for example, 0.00001 mg to 500 mg, 0.00001 mg to 100 mg, 0.00001 mg to 50 mg, 0.00001 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or It may be administered 10 mg to 25 mg.

[0033] However, the dosage may vary depending on factors such as the formulation method, method of administration, patient's age, body weight, gender, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity, and a person skilled in the art may appropriately adjust the dosage by considering these factors. The frequency of administration may be once a day or two or more times within the range of clinically acceptable side effects, and the administration site may be one or two or more sites, and the total duration of administration may be from 1 to 30 days per treatment, administered daily or at intervals of 2 to 5 days. If necessary, the same treatment may be repeated after the appropriate time. For animals other than humans, the dosage may be the same as that for humans per kg, or an amount calculated by converting the above dosage based on, for example, the ratio of organ (e.g., heart) volume between the target animal and humans (e.g., average value).

[0034] The pharmaceutical composition of the present invention may be used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, or parenteral formulations such as suspensions, emulsions, lyophilized preparations, topical preparations, suppositories, sterile injectable solutions, and implantable preparations, which are formulated according to conventional methods. In addition to the active ingredient, the pharmaceutical composition may further include pharmaceutically acceptable excipients that can be used for formulation.

[0035] The above excipients comprise a carrier, a vehicle, a diluent, a solvent, e.g., a monohydric alcohol, e.g., ethanol, isopropanol, and a polyhydric alcohol, e.g., glycerol, and an edible oil, e.g., soybean oil, coconut oil, olive oil, safflower oil, cottonseed oil, an oily ester, e.g., ethyl oleate, isopropyl myristate; It may include one or more selected from the group consisting of binders, adjuvants, solubilizers, thickeners, stabilizers, disintegrants, lubricants, buffers, emulsifiers, wetting agents, suspending agents, sweeteners, coloring agents, flavoring agents, coating agents, preservatives, antioxidants, processing agents, drug delivery modifiers and enhancers, such as calcium phosphate, magnesium stearate, talc, monosaccharides, disaccharides, starch, gelatin, cellulose, methylcellulose, sodium carboxymethylcellulose, dextrose, hydroxypropyl-β-cyclodextrin, polyvinylpyrrolidone, low-melting point waxes, ion exchange resins, etc., but is not limited thereto.

[0036] The above carrier is one that is commonly used in formulations and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0037] The pharmaceutical composition of the present invention being formulated into an oral administration form may be, for example, a tablet, a pill, a hard or soft capsule, a liquid, a suspension, an emulsifier, a syrup, a granule, an elixir, etc. Depending on the conventional composition of each formulation, such oral administration formulations may include, in addition to the active ingredient, a diluent such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine, or a pharmaceutically acceptable carrier such as silica, talc, stearic acid and its magnesium or calcium salt and / or polyethylene glycol.

[0038] When the above oral formulation is a tablet, it may include a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine, and in some cases, it may include a disintegrant such as starch, agar, alginic acid or its sodium salt, a boiling mixture and / or an absorbent, a coloring agent, a flavoring agent or a sweetener, etc.

[0039] The fact that the pharmaceutical composition of the present invention is formulated in the form of a parenteral administration formulation may mean that it is administered by a method of administration such as subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. In this case, in order to formulate the pharmaceutical composition into the parenteral administration formulation, the active ingredient is mixed in water with a stabilizer or a buffer to prepare a solution or suspension, and such a solution or suspension may be prepared in a unit dosage form in an ampoule or vial.

[0040] In addition, the above pharmaceutical composition may be sterilized or further include adjuvants such as preservatives, stabilizers, hydrating agents or emulsification promoters, salts and / or buffers for osmotic pressure regulation, and further include other therapeutically useful substances, and may be formulated according to conventional methods of mixing, granulation, or coating.

[0041] The content of a compound or a salt containing the same in the pharmaceutical composition of the present invention can be appropriately adjusted according to the purpose of use of the pharmaceutical composition, the form of the formulation, etc., and, for example, may be 0.001 to 99 weight %, 0.001 to 90 weight %, 0.001 to 50 weight %, 0.01 to 50 weight %, 0.1 to 50 weight %, or 1 to 50 weight % based on the total weight of the pharmaceutical composition.

[0042] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. "Pharmaceutically effective amount" means an amount sufficient to treat or prevent a disease with a reasonable benefit / risk ratio applicable to medical treatment or prevention, and may be adjusted according to factors including the type of disease of the patient, the severity of the disease, the type of active ingredient administered, the type of formulation, the age, gender, weight, health condition, diet, sensitivity, the time and method of administration of the drug, the combination of the composition or drugs used concurrently, and other factors well known in the medical field.

[0043] The pharmaceutical composition of the present invention can prevent or treat a disease in an individual by including the step of administering to the individual an amount effective for preventing or treating the disease.

[0044] The dosage of the pharmaceutical composition for the prevention or treatment of a disease according to the present invention may be in the range of 0.01 µg / kg to 10 g / kg per day, specifically in the range of 0.01 mg / kg to 1 g / kg, depending on the patient's condition, body weight, gender, age, severity of the patient, and route of administration. Administration may be performed once a day or divided into several doses. Such dosage shall not be interpreted as limiting the scope of the present invention in any aspect.

[0045] The above individual may be a mammal. The above mammal may be a human, dog, cat, cow, goat, or pig.

[0046] The terms and methods, etc. described for the above compounds and diseases also apply to the above pharmaceutical compositions.

[0047] The above composition for the prevention or treatment of infertility or subfertility may be a health functional food.

[0048] In this specification, the term "health functional food" refers to a food manufactured or processed for the purpose of health supplementation using specific ingredients as raw materials or by methods such as extraction, concentration, purification, or mixing of specific ingredients contained in food raw materials. It refers to a food designed and processed to fully exert biological regulatory functions on the body, such as biological defense, regulation of biological rhythms, and prevention and recovery from disease, through said ingredients, and may be used for the purpose of preventing or improving infertility and / or subfertility.

[0049] There are no specific restrictions on the types of the above foods. Examples of the above foods include formulations selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infusions, gum, candies, and health drinks, and include all health foods in the conventional sense.

[0050] The above-mentioned health functional food may include food-grade acceptable food additives and may include a suitable carrier commonly used in the manufacture of health functional foods.

[0051] The terms and methods, etc. described regarding the above compounds and diseases also apply equally to the above health functional foods.

[0052] The above composition for the prevention or treatment of infertility or subfertility may be a feed composition.

[0053] The feed composition can be prepared by adding the above compound or its salt within an appropriate effective concentration range according to various feed manufacturing methods known in the art, and can be used for the purpose of preventing or improving infertility and / or subfertility.

[0054] The term "feed" above may refer to any natural or artificial prescribed food, single meal, etc., or the components of said single meal, intended for or suitable for animals to eat, consume, and digest. The type of feed is not particularly limited, and feed commonly used in the relevant technical field may be used. Non-limiting examples of said feed include plant-based feeds such as grains, root vegetables, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products, etc.; and animal-based feeds such as proteins, inorganic substances, oils and fats, minerals, single-cell proteins, zooplankton, or food waste.

[0055] The terms and methods described for the above compounds and diseases also apply equally to the above feed compositions.

[0056] Another aspect provides a method for preventing, improving, or treating infertility or subfertility, comprising the step of administering an effective amount of Ncapg2 protein or a gene encoding said protein to an individual in need thereof.

[0057] Another aspect provides the use of the Ncapg2 protein or the gene encoding said protein for the prevention, improvement, or treatment of infertility or subfertility.

[0058] Another aspect provides the use of the Ncapg2 protein or the gene encoding said protein for the manufacture of preparations for the prevention, improvement, or treatment of infertility or subfertility.

[0059]

[0060] Another aspect provides an animal egg comprising the above composition for enhancing the possibility of pregnancy.

[0061] In one embodiment, the oocyte may be an oocyte in which an exogenous Ncapg2 protein or an exogenous gene encoding the Ncapg2 protein has been introduced, thereby enhancing the potential for pregnancy compared to before the introduction. For example, the oocyte may be an oocyte in which the stability of meiosis, the accuracy of chromosome arrangement, the maintenance of the structure of the centromere and pericentromere heterochromatin, and the stability of spindle-microtubule binding have been improved compared to before the introduction of Ncapg2. The oocyte according to the present invention may be provided as a high-quality oocyte applicable to various reproductive technologies such as assisted reproductive technology (ART), in vitro maturation (IVM), in vitro fertilization (IVF), and embryo transfer (ET).

[0062] In one embodiment, the egg may be a mammalian egg.

[0063] In one embodiment, the egg may be an egg of an animal other than a human. Specifically, the egg may be an egg of a mammal other than a human. More specifically, it may include eggs derived from various test animals or livestock, such as mice, rats, rabbits, cattle, pigs, dogs, cats, and non-human primates.

[0064]

[0065] Another aspect provides an animal model of infertility or subfertility. The animal model may be an oocyte-specific model in which the Ncapg2 protein or a gene encoding the Ncapg2 protein and / or part thereof is deleted, destroyed, inserted, knocked out, or inactivated. Methods for implementing such genetic modification include, but are not limited to, Cre-loxP systems, CRISPR / Cas family systems, siRNA or shRNA-based gene repression techniques, gene trapping techniques, etc.

[0066] The above animal model is suitable as an experimental model for simulating oocyte quality degradation, infertility, or sterility, and can be usefully utilized in fields such as studying the molecular mechanisms of oocyte meiosis, elucidating the pathophysiology of reproductive decline, and evaluating the efficacy of reproductive-related therapeutic agents and compositions. Since the above animal model can reproduce histological and cytological changes associated with oocyte aging, it has high utility as a model for exploring reproductive decline due to aging or as a preclinical evaluation model for infertility treatments.

[0067] In one embodiment, the animal is not limited to any animal that can be raised in a cage, excluding humans, and includes rodents, rabbits, and monkeys, etc., and the rodent includes, but is not limited to, mice, rats, or hamsters.

[0068]

[0069] Another aspect provides a method for evaluating the efficacy or safety of a drug for treating infertility or subfertility, comprising the following steps:

[0070] A step of treating an animal model with a candidate drug in which the gene encoding the Ncapg2 protein and / or part thereof is deleted, disrupted, inserted, knocked out, or inactivated; and

[0071] A step for measuring the degree of improvement in infertility or subfertility or the stability of a candidate drug.

[0072] The above-mentioned drug is not limited to drugs targeting infertility or subfertility, but specifically may be a drug targeting the prevention, improvement, alleviation, or treatment of one or more of the following: deterioration of egg quality due to aging, abnormal chromosomal alignment during meiosis, structural instability of the centromere and pericentromere regions, and / or increased occurrence of chromosomal nondisjunction and aploidy.

[0073] The above efficacy may include, but is not limited to, one or more of the following: therapeutic efficacy for infertility or subfertility, improvement of the fertility potential of eggs, efficacy in suppressing the recurrence of infertility or subfertility, and efficacy in extending the survival period of animal models.

[0074] Measuring the degree of improvement in infertility or infertility or the safety of the above-mentioned candidate drug may involve measuring one or more of the following compared to a control group (e.g., a group not treated with the drug): treatment of infertility or infertility, improvement of the fertility potential of eggs, suppression of the recurrence of infertility or infertility, and extension of the survival period of an animal model, but is not limited thereto.

[0075] In one embodiment, the evaluation method may be used to determine a pharmaceutically effective amount of a drug for treating infertility or subfertility. The "pharmaceutically effective amount" means an amount sufficient to treat the disease with a reasonable benefit / risk ratio applicable to medical treatment and that does not cause side effects.

[0076] In one embodiment, to evaluate the combined efficacy of the candidate drug and another drug, the candidate drug and another drug may be administered in combination to the animal model according to the present invention. In this case, the drugs administered in combination may be administered sequentially, in reverse order, or simultaneously, and may be administered as a single or multiple doses.

[0077]

[0078] Another aspect provides a method for evaluating the safety of a drug for treating infertility or subfertility, comprising the following steps:

[0079] A step of treating an animal model in which a gene encoding the Ncapg2 protein according to the present invention and / or a part thereof is deleted, destroyed, inserted, knocked out, or inactivated with a candidate drug; and

[0080] Step of measuring the stability of the candidate drug in the above animal model.

[0081] There are no restrictions on the above drugs as long as they are drugs targeting infertility or subfertility.

[0082] Measuring the above safety means measuring safety indicators of drugs commonly used in the industry, and specifically may include, but is not limited to, measuring the degree of drug side effects (e.g., nausea, vomiting, diarrhea, urticaria, rash, hair loss, numbness in the hands and feet, anaphylactic shock, respiratory distress, deterioration of renal function, deterioration of liver function, etc.).

[0083] In one embodiment, to evaluate the safety of the combination of the candidate drug and another drug, the candidate drug and another drug may be administered in combination to the animal model according to the present invention. In this case, the drugs administered in combination may be administered sequentially, in reverse order, or simultaneously, and may be administered as a single or multiple doses.

[0084] Another aspect provides a method for producing an egg with enhanced pregnancy potential, comprising the step of introducing the above composition into an animal egg.

[0085] In one embodiment, the egg may be a mammalian egg.

[0086] In one embodiment, the egg may be an egg of an animal other than a human. Specifically, the egg may be an egg of a mammal other than a human.

[0087]

[0088] Another aspect provides a composition for selecting healthy eggs, comprising a preparation for measuring the level of the Ncapg2 protein or the gene encoding the protein.

[0089] Another aspect provides a healthy egg screening kit comprising the above-mentioned screening composition.

[0090] Another aspect provides a method for selecting healthy eggs using the expression level of the Ncapg2 protein or the gene encoding said protein as an indicator.

[0091] The above composition can be usefully employed to select oocytes in which meiotic stability, chromosomal quality, epigenetic normality, etc., are maintained by measuring the expression level or activity of Ncapg2 in oocytes.

[0092] In one embodiment, the preparation may include, but is not limited to, an antibody-based preparation (e.g., an Ncapg2-specific antibody), a nucleic acid-based preparation (e.g., a primer, probe, siRNA control for detecting Ncapg2 mRNA), a protein analysis reagent, a fluorescent marker, or a combination thereof, and may include without limitation any preparation capable of measuring the level of the Ncapg2 protein or the gene encoding the protein in the egg.

[0093] In one embodiment, the kit may be configured with reagents, standard substances, a user manual, a control sample, and a detection device or instrument necessary to quantitatively or semi-quantitatively measure the Ncapg2 expression level in oocytes. Specifically, the kit may be configured as an immunohistochemistry kit, a qPCR-based kit, a protein interaction-based kit (e.g., a PLA kit), or a fluorescence-based screening kit.

[0094] In one embodiment, the screening method may include the steps of: (a) obtaining an egg sample; (b) measuring the expression level of Ncapg2 protein or mRNA in the egg; and (c) determining that an egg with an expression level above a reference value is a healthy egg. The reference value may be experimentally set according to age group, species, culture conditions, reproductive cycle, etc.

[0095] In one embodiment, the selection method may utilize Ncapg2 expression as a molecular indicator reflecting the normality of meiosis (MI / MII progression), chromosomal alignment stability, centromere structure, spindle composition normality, and epigenetic characteristics of the pericentromere region of the oocyte. This selection method may be helpful for quality control of germ cells, securing superior oocytes during in vitro fertilization (IVF) or in vitro maturation (IVM), improving embryonic development rates, and increasing the success rate of assisted reproductive technology (ART).

[0096]

[0097] Another aspect provides a method for assessing pregnancy potential comprising the steps of: measuring the tension of tubulin during the meiotic stage of an egg separated from an individual; and comparing the tension with the tension measured in an egg separated from a normal control group of the same age.

[0098] The above tension can be calculated using the following mathematical formula 1:

[0099] [Mathematical Formula 1]

[0100]

[0101] - R: Straight-line distance between the two endpoints of the tubulin

[0102] - L: Length of tubulin

[0103] - Lp: Persistence length of tubulin - Stiffness

[0104] - f: Value of the tension (F) applied to tubulin normalized to thermal energy (kBT),

[0105] That is, f = Tension applied to tubulin (F) / Thermal energy (kBT) = F / kBT = F / (4.11 pN nm)

[0106] Since tubulin is a polymer structure that exhibits non-linear elongation characteristics unlike general elastomers, it is suitable to interpret the measured deformation data by applying mathematical formulas based on the worm-like chain (WLC) model as described above.

[0107] The above L represents the natural length of the tubulin. Experimentally, the elongated length R can be measured by applying force after fixing or marking both ends of the microtubule. At this time, the increased value R relative to the original length L is measured under various force conditions, and the acquired LR data set is plotted on a graph. Then, by performing a nonlinear fitting on Equation 1, the sustained length (l_p) and tension (f) of the tubulin can be derived simultaneously. That is, physical characteristic variables (l_p and f) can be inversely estimated through the process of fitting the experimentally observed LR relationship to the model of Equation 1.

[0108] In one embodiment, the method for evaluating the likelihood of pregnancy may further include a step of determining that the likelihood of pregnancy of the individual is low when the tension of the tubulin is low compared to a normal control. Specifically, the method for evaluating the likelihood of pregnancy may further include a step of determining that the egg is an egg with low likelihood of pregnancy or an abnormal egg with high likelihood of infertility or subfertility when the tension of the tubulin is low compared to a normal control. Since normal eggs tend to exhibit the tension distribution and duration characteristics of a normal control, if the tension of the egg under analysis approaches the tension range or tension distribution of a normal control, the egg may be determined to be a healthy egg or an egg with high likelihood of pregnancy.

[0109] In one embodiment, the method for evaluating the likelihood of pregnancy may further include a step of quantifying, through a likelihood ratio (LR), which group the tension of the egg under analysis is more suitable for compared to the tension distribution of a normal control group. The likelihood ratio (LR) is a value obtained by dividing the likelihood observed in the tension distribution of a normal control group (e.g., L1) by the likelihood observed in the tension distribution of an NCAPG2-deleted (KO) egg (L2).

[0110] When the above LR is large, the oocyte under analysis shows a distribution more similar to the tension characteristics of a normal control group, so it can be determined as a normal oocyte, that is, an oocyte with a high probability of pregnancy. When the above LR is small, the tension value of the oocyte under analysis is more suitable to the tension pattern of an NCAPG2 deletion oocyte, so it can be determined as an abnormal oocyte, that is, an oocyte with a high probability of infertility or sterility.

[0111]

[0112] The present invention is capable of various modifications and may have various embodiments. Specific embodiments are illustrated in the drawings and described in detail in the detailed description below. However, this is not intended to limit the present invention to specific embodiments, and it should be understood that it includes all modifications, equivalents, and substitutions that fall within the spirit and scope of the present invention. In describing the present invention, detailed descriptions of related prior art are omitted if it is determined that such detailed descriptions may obscure the essence of the present invention.

[0113] A composition comprising an Ncapg2 protein according to one aspect or a gene encoding said protein can be usefully utilized to improve pregnancy potential and prevent or treat infertility and subfertility by improving the quality of eggs and reducing chromosomal abnormalities and the occurrence of aploidy during the process of meiosis.

[0114] Figure 1 is a schematic diagram of the design of a mouse with the Ncapg2 gene knocked out.

[0115] Figure 2 is Ncapg2 F / F and Ncapg2 F / FZP3 This is a graph comparing the number of offspring when mice are mated with healthy male mice.

[0116] Figure 3 shows Ncapg2 F / FZP3 This is a diagram confirming the deletion of exons 6-16 of Ncapg2 in oocytes.

[0117] Figure 4 shows Ncapg2 F / FZP3This is a diagram showing the quantitative confirmation of the Ncapg2 expression level in oocytes.

[0118] Figure 5 shows Ncapg2 F / F and Ncapg2 F / FZP3 This is an image observing the shape of an egg cell (top) and a graph comparing the length and width of chromosomes (bottom).

[0119] Figure 6 is Ncapg2 F / FZP3 This is an immunofluorescence staining image confirming the cell cycle of an egg cell.

[0120] Figure 7 shows Ncapg2 cultured for 8 hours after GVBD. F / F and Ncapg2 F / FZP3 This is a graph comparing the progression of the egg cell cycle.

[0121] Figure 8 shows Ncapg2 cultured for 16 or 18 hours after GVBD. F / F and Ncapg2 F / FZP3 This is a graph comparing the progression of the egg cell cycle.

[0122] Fig. 9 shows Ncapg2 F / F and Ncapg2 F / FZP3 This is a graph measuring the width of the chromosome plate at each stage of meiosis in an egg cell.

[0123] Figure 10 shows Ncapg2 in 9-month-old mice F / F and Ncapg2 F / FZP3 This is a graph measuring the width of the chromosome plate at each stage of meiosis in an egg cell.

[0124] Fig. 11 shows Ncapg2 in 2-month-old (left) or 9-month-old (right) mice. F / F and Ncapg2 F / FZP3 This is the result of measuring the ratio of spindle fibers with abnormal shapes in the egg.

[0125] Figure 12 shows Ncapg2 in 2-month-old or 9-month-old mice F / F and Ncapg2 F / FZP3 This is a graph comparing the tubulin rigidity (left) and tension (right) of an egg cell.

[0126] Figure 13 is an immunohistochemical image confirming the localization of Cohesin in 2-month-old mice through REC8 staining of the control and experimental groups.

[0127] Figure 14 shows Ncapg2 using the Cold treatment-whole mount technique. F / F and Ncapg2 F / FZP3 This is an immunofluorescence staining image (left) observing the periphery of the oocyte's centromere and a graph quantifying it (right).

[0128] Figure 15 shows Ncapg2 using the chromosome spreading technique. F / F and Ncapg2 F / FZP3 This is an immunofluorescence staining image observing the periphery of the oocyte's centromere.

[0129] Fig. 16 is Ncapg2 F / F and Ncapg2 F / FZP3 This is an immunofluorescence staining image observing the centromere region of an egg.

[0130] Fig. 17 shows Ncapg2 F / F and Ncapg2 F / FZP3 This is an image showing the results of MacroH2A1 staining of oocytes at different time points.

[0131] Fig. 18 is Ncapg2 F / F and Ncapg2 F / FZP3 This is an image showing the staining results of MacroH2A1 at 1 hour after GVBD of the oocyte.

[0132] Figure 19 is a figure showing the width of the elongated chromosome plate observed in control oocytes at 9 months of age.

[0133] Figure 20 is a graph comparing changes in Ncapg2 mRNA expression in 2-month-old and 9-month-old mouse oocytes.

[0134] Fig. 21 is Ncapg2 F / F and Ncapg2 F / FZP3 This is a diagram showing the measured interkinetochore distance (IKD) of the oocyte.

[0135] Figure 22 is a schematic diagram of the design of Ncapg2LSL / +, ZP3 oocytes that overexpress the Ncapg2 gene.

[0136] Figure 23 is a Western blot image confirming the interaction between MacroH2A1 and Ncapg2 in Ncapg2LSL / +, ZP3 oocytes.

[0137] Figure 24 is a PLA image confirming the interaction between MacroH2A1 and Ncapg2 in Ncapg2LSL / +, ZP3 oocytes.

[0138] Figure 25 is a schematic diagram showing the production strategy of Ncapg2 conditional deletion mice (Ncapg2-cKO, Triple loxP).

[0139] Figure 26 shows the experimental results confirming overexpression after removing the Human NCAPG2 LSL-LoxP gene cassette and STOP.

[0140] Figure 27 is a schematic diagram showing a crossover strategy for producing Ncapg2 transgene conditionally overexpressing mice.

[0141] Figure 28 is a schematic diagram of the final crossover strategy to obtain a model in which Mouse Ncapg2 is removed and Human NCAPG2 is overexpressed in oocytes.

[0142] FIG. 29 shows Ncapg2F / F_LSL / LSLNcapg2F / F_LSL / LSL_ZP3+ and Ncapg2 F / FZP3 This is a diagram confirming the chromosome structure in an egg cell.

[0143] The following examples will be explained in more detail. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

[0144]

[0145] Reference Example 1. Generation of oocyte-specific Ncapg2 gene knockout mice

[0146] To induce a knockout of the mouse Ncapg2 gene, exons 6–16 were deleted. Specifically, conditional knockout (conditional KO) mice were constructed by surrounding the corresponding region with a loxP sequence. These were crossed with Zp3-cre mice expressing Cre recombinase. Zp3-cre mice are capable of specifically recognizing and deleting the loxP sequence of the target gene in developing oocytes. Through this process, mice with the Ncapg2 gene deleted specifically in female oocytes (Ncapg2 F / FZP3 ) was secured. The production of gene-deficient mice is shown in Fig. 1.

[0147]

[0148] Reference Example 2. Collection and culture of GV oocytes (Germinal Vesicle Oocytes)

[0149] The ovaries of 8- to 12-week-old female mice were punctured with a 26-gauge needle and suspended in M2 medium (Sigma-Aldrich, M7167). 100 μM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich, I5879) was added to prevent GV oocyte maturation and germinal vesicle breakdown (GVBD). To obtain oocytes in the metaphase I (MI) stage, GVBD-induced oocytes were collected and cultured for 6 hours in M2 medium without IBMX. To increase oocyte retrieval volume, 5-10 IU of PMSG (pregnant mare's serum gonadotropin) was injected intraperitoneally 44-46 hours prior to the experiment, after which the mice were sacrificed via cervical dislocation. Follicular cells surrounding the GV oocytes were mechanically removed using a mouth pipette. Collected oocytes were covered with mineral oil (Irvine Scientific, 9305-100 mL) in M16 medium (Sigma, M7292) supplemented with 10% fetal bovine serum (FBS; ThermoFisher) and cultured at 37°C with 5% CO₂ and maximum humidity. Prometaphase oocytes were harvested 4 hours after GVBD, and metaphase oocytes 6 hours after. To spread the chromosomes, oocytes were treated with 0.5% pronase (Sigma) dissolved in M2 medium to remove the zona pellucida.

[0150]

[0151] Reference Example 3. Immunostaining

[0152] Immunostaining was performed according to previously reported methods. Oocytes were fixed with 1.6% PFA diluted in PBS at room temperature for 30 minutes. Subsequently, permeation treatment was performed using 0.25% Triton X-100 at room temperature for 15 minutes. Non-specific binding was blocked overnight at 4°C using 3% BSA in PBS (PBT) supplemented with 0.1% Triton X-100. Kinetochore was stained with human CREST serum (1:100; Antibodies Incorporated, 15-234), α-tubulin with mouse monoclonal antibody (1:500; Sigma), MacroH2A.1 with antibody (1:100; Invitrogen, MA531412), and Ncapg2 with antibody (1:100; Sigma, HPA026631). After washing three times, oocytes were incubated with a secondary antibody at room temperature for 2 hours. Alexa Fluor 488 and 594 conjugated forms (1:700, 115-545-146, Jackson ImmunoResearch) were used as the secondary antibody. To confirm stable kinetochore-microtubule (KT-MT) binding, oocytes were treated in M2 medium on ice for 14 minutes before fixation.

[0153]

[0154] Reference Example 4. Chromosome diffusion method

[0155] Chromosome spread was performed according to previously reported methods. In summary, oocytes were exposed to M2 medium containing 0.5% pronase (Sigma) for 5 minutes to remove the zona pellucida. After a short recovery period in fresh medium, oocytes were fixed in a pH 9.2 solution of 1% paraformaldehyde distilled water containing 0.15% Triton X-100 and 3 mM dithiothreitol (DTT). For optimal spread, slides were rapidly dried and then non-specific binding was blocked with a 3% BSA solution in PBS at room temperature for 1 hour. Oocytes were incubated with the primary antibody overnight at 4°C, followed by incubation with the secondary antibody for 2 hours at room temperature. Stained slides were observed using an LSM 880 laser scanning confocal microscope.

[0156]

[0157] Reference Example 5. Analysis of the number of chromosomal abnormalities in metaphase II (MII) oocytes

[0158] Female mice aged 2-3 months (young), 9 months (middle-aged), or 9-16 months (aged) were used. After collecting oocytes, the zona pellucida was removed, and the chromosomes were diffused onto a slide and labeled with CREST or CENP-A antibodies. Subsequently, the slides were reacted with a secondary antibody, mounted in DAPI antifade mounting medium, and used for analysis. The number of chromatids was determined, and if nondisjunction or precocious separation of sister chromatids was present, these were distinguished to determine the type of chromosomal abnormality (aneuploidy).

[0159]

[0160] Reference Example 6. PLA assay (Proximity Ligation Assay)

[0161] To detect whether the two proteins were within 40 nm of each other, a proximity ligation assay (DUO92101; PLA) was performed according to the manufacturer's instructions. This was done to confirm the presence of potential protein-protein interactions. Subsequently, oocytes were counterstained with DAPI and embedded in slides. The specificity of PLA was verified using negative controls containing only the MacroH2A1 antibody, the Ncapg2 antibody, or the secondary antibody. All PLA experiments were performed using oocytes obtained from age-matched individuals. Imaging was performed using a Zeiss LSM880 confocal microscope (Zeiss, Germany) and a 63x / 1.2 NA UPLSAPO oil-immersed objective lens. Zeiss BioApps software was used to measure the number of foci. Briefly, the total area of ​​each oocyte was measured, and the number of PLA spots within it was calculated. The average background signal value was calculated and averaged from oocytes treated with the Ncapg2 monoclonal antibody.

[0162]

[0163] Reference Example 7. qRT-PCR analysis of oocytes

[0164] 30–40 denuded oocytes were used per reaction. The oocytes were washed with PBS / polyvinylpyrrolidone solution before lysis in TRIZOL. After cell lysis, cDNA was synthesized according to the manufacturer's instructions. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using SyBR Green (TAKARA) on a Light Cycle 96 SW 1.1 system (Roche) according to the manufacturer's instructions. Ncapg2 expression levels were normalized using GAPDH as the endogenous control gene. The relative expression levels of the condensin complex were calculated using the Δ method.

[0165]

[0166] Reference Example 8. Western blot analysis

[0167] Oocytes were lysed in LDS sample buffer at 98°C for 10 minutes. Proteins were separated by SDS-PAGE and transferred to a membrane. The membrane was blocked for non-specific binding with 5% skim milk for 30 minutes. Subsequently, the membrane was incubated overnight at 4°C with anti-Ncapg2 (1:500) and anti-β antibodies in a solution containing 2% BSA and 3% skim milk. Afterward, the membrane was washed three times with TBST for 10 minutes each and incubated with a secondary antibody conjugated with horseradish peroxidase (HRP) at room temperature for 2 hours. Finally, proteins were detected using the ECL method.

[0168]

[0169] Reference Example 9. Statistical Analysis

[0170] Graph creation and statistical analysis were performed using GraphPad Prism (GraphPad Software). Data for each group were expressed as mean ± standard deviation. The Mann-Whitney U test or Student t-test was used to compare the two groups. A p-value of less than 0.05 was considered statistically significant.

[0171]

[0172]

[0173] Experimental Example 1. Evaluation of Reproductive Capacity

[0174] Ncapg2 at 8–12 weeks of age F / F Ncapg2 obtained from mouse (control group) and Reference Example 1 F / FZP3 Mice were each mated with normal B6 males aged 8 weeks, and the number of offspring from each female was recorded after birth, and the results are shown in Figure 2.

[0175] As shown in Figure 2, when female mice of the experimental group were mated with normal males, the total number of offspring was significantly reduced compared to the control group. Based on these results, it was confirmed that the reproductive capacity of female mice is significantly reduced when the Ncapg2 gene is deleted from maternally derived eggs.

[0176]

[0177] Experimental Example 2. Confirmation of Ncapg2 gene knockout

[0178] Before investigating the function of Ncapg2, we confirmed whether oocyte-specific gene deletion performed by the method of Reference Example 1 actually induces a decrease in Ncapg2 expression. Since there was no suitable antibody to directly analyze protein levels in oocytes, gene expression was evaluated at the mRNA level.

[0179] As shown in Fig. 3, Ncapg2 F / FZP3 It was confirmed that exons 6 through 16 of Ncapg2 were successfully removed from the oocyte, resulting in the non-generation of complete mRNA of normal length. In other words, it is expected that the Ncapg2 protein will not be translated normally.

[0180] Additionally, the results of the qRT-PCR analysis in Figure 4 confirmed that Ncapg2 mRNA was not expressed in the oocytes of the experimental group, and confirmed that the Ncapg2 gene was effectively deleted in an oocyte-specific manner by Zp3-cre.

[0181]

[0182] Experimental Example 3. Morphological analysis of Ncapg2-deficient oocytes

[0183] Immunofluorescence staining was performed to confirm morphological changes in oocytes caused by Ncapg2 deletion.

[0184] As shown in Figure 5, abnormal morphology was observed in oocytes with Ncapg2 deletion, characterized by reduced chromosomal length and increased width. This confirmed that Ncapg2 deletion affects the basic morphological stability of oocytes.

[0185]

[0186] Experimental Example 4. Cell Cycle Progression Analysis

[0187] To evaluate the effect of Ncapg2 deletion on the cell cycle of meiosis, only oocytes that underwent GVBD were selected, cultured for 8 hours, and compared with a control group.

[0188] As shown in Figure 7, Ncapg2-deficient oocytes showed significantly delayed progression of meiosis compared to the control group, and a normal cell cycle could not be maintained.

[0189]

[0190] Additionally, GVBD-induced oocytes were cultured for 16 and 18 hours, and the cell cycle stages were analyzed.

[0191] As shown in Figures 6 and 8, most of the control oocytes were normally arrested at the second meiotic division stage, whereas Ncapg2-deficient oocytes remained at an earlier stage or, even if they reached the second meiotic division, exhibited an abnormal form.

[0192] From these results, it was confirmed that Ncapg2 is a gene essential for the progression of the normal meiotic cycle I.

[0193]

[0194] Experimental Example 5. Measurement of Chromosome Plate Width

[0195] To quantify changes in chromosome arrangement, the width of the chromosome plate was measured at each stage of meiosis.

[0196] As shown in Figure 9 (top), in Ncapg2-deficient oocytes, the width of the chromosome plate increased significantly compared to the control group during both meiosis I (MI) and meiosis II (MII). This indicates that abnormalities occurred in the alignment and separation processes of chromosomes.

[0197]

[0198] Additionally, when the width of the chromosome plate at the first meiotic division stage was compared and analyzed in 9-month-old mice, as shown in Figure 9 (bottom), Ncapg2-deficient oocytes had an increased width of the MI stage chromosome plate compared to the control group.

[0199]

[0200] Experimental Example 6. Analysis of Chromosome Number Abnormalities

[0201] The number of chromosomes was counted using eggs that were stopped during the second meiotic division.

[0202] As shown in Figure 10, chromosomal abnormalities (aneuploidy) were significantly increased in Ncapg2-deficient oocytes compared to normal individuals. Such chromosomal instability is expected to have a direct impact on the previously observed decrease in litter size.

[0203]

[0204] Experimental Example 7. Analysis of Spindle Fiber Characteristics

[0205] To evaluate the effect of Ncapg2 deletion on oocyte spindle structure, Ncapg2 obtained from 2-month-old and 9-month-old mice F / F and Ncapg2 F / FZP3 The proportion of abnormally shaped spindle fibers was measured in oocytes.

[0206] As shown in Figure 11, in both 2-month-old and 9-month-old mice, the proportion of spindle fibers with abnormal structures in the oocytes of the experimental group was increased compared to the control group.

[0207]

[0208] Additionally, to quantitatively identify structural abnormalities in the spindle, the physical properties of α-tubulin-based spindle microtubules were analyzed. The rigidity of the tubulin was measured using persistence length as an indicator, and the tension acting on the microtubules was calculated using Equation 1 below according to a previously reported method [Andrew Marantan, L. Mahadevan; Mechanics and statistics of the worm-like chain. Am. J. Phys. 1 February 2018; 86 (2): 86-94. https: / doi.org / 10.1119 / 1.5003376]:

[0209] [Mathematical Formula 1]

[0210]

[0211] - R: Straight-line distance between the two endpoints of the tubulin

[0212] - L: Length of tubulin

[0213] - Lp: Persistence length of tubulin - Stiffness

[0214] - f: Tension in tubulin (F) / Thermal energy (kBT) = F / kBT = F / (4.11 pN nm)

[0215] When tubulin, a linear polymer, is pulled, the change in length (elongation, R) can be measured. A graph (LR curve) showing the relationship between the original length (L) and the elongation (R) can be drawn, and the sustained length (Lp) and tension (F) can be obtained by fitting the graph to the above mathematical formula 1.

[0216] As shown in Figure 12, duration was measured to be higher in 9-month-old mice than in 2-month-old mice in both the control and experimental groups. This implies that the rigidity of microtubules generally increases with age. Additionally, in 9-month-old mice, particularly in the experimental group oocytes, the spindle tension showed a reduced pattern compared to the control group. These results demonstrate that Ncapg2 deficiency negatively affects not only simple morphological abnormalities of the spindle but also the mechanical tension that microtubules must maintain.

[0217]

[0218] Experimental Example 8. Cohesion Distribution Analysis

[0219] To determine the effect of Ncapg2 deletion on the distribution of Rec8, a subunit of the meiotic-specific cohesin complex, immunostaining was performed on 2-month-old mouse oocytes.

[0220] As shown in Figure 13, compared to the control group, Rec8 in Ncapg2-deficient oocytes was not arranged normally and showed a collapsed distribution. This confirmed that Ncapg2 plays an important role in maintaining the normal position of cohesin.

[0221]

[0222] Experimental Example 9. Confirmation of the structure of the pericentromeric region

[0223] Structural changes in the pericentrochoral region of Ncapg2-deficient oocytes were confirmed as follows.

[0224] Figure 14 shows the results observed using the Cold treatment-whole mount technique, which selectively preserves and observes only microtubules stably bound to the kinetochore, and Figure 15 shows the results observed using the chromosome spreading technique, which ruptures the nuclear membrane to spread the chromosomes widely.

[0225] As shown in Figures 14 and 15, a characteristic structural abnormality in which the pericentromeric region protrudes was observed in the oocytes of the experimental group. This phenomenon was particularly pronounced during the first stage of meiosis, which implies that Ncapg2 plays an important role in maintaining structural stability in the pericentromeric region.

[0226]

[0227] Experimental Example 10. Analysis of the structure and epigenetic marker distribution of the centromeric region

[0228] Ncapg2 to evaluate the structural integrity of the centromere region F / F and Ncapg2 F / FZP3 Changes in the distribution of CENP-A, a centromere-specific epigenetic marker in oocytes, were confirmed through immunofluorescence staining.

[0229] As shown in Fig. 16, Ncapg2 F / FZP3 Although a decrease in CENP-A signaling was observed in oocytes compared to the control group, no severe changes were observed to the extent of complete collapse of the kinetochore structure. This confirmed that Ncapg2 deletion partially affects the structural integrity of the kinetochore.

[0230]

[0231] Additionally, further experiments were conducted using MacroH2A as another histone modifying protein besides CENP-A. MacroH2A has been identified as a candidate protein interacting with Ncapg2 through previous LC-MS analysis. The distribution of MacroH2A1 was analyzed over time, and the immunostaining results of MacroH2A1 at different time points are shown in Figure 17, and the results at 1 hour after GVBD are shown in Figure 18.

[0232] As shown in FIGS. 17 and 18, Ncapg2 F / FZP3In oocytes, a defect was identified in which MacroH2A1 was not sufficiently accumulated in the pericentrochore. This abnormality was most pronounced at the 1-hour mark after GVBD.

[0233] This implies that Ncapg2 may play an important role in maintaining the epigenetic structure of the perikinetochore region through interaction with MacroH2A1 during the early stages of meiosis I.

[0234]

[0235] Experimental Example 11. Confirmation of the role of Ncapg2 in aged (9-month-old) mouse oocytes

[0236] First, as it is known that oocyte quality deteriorates with increasing age, we intended to examine changes in spindle fiber and chromosome arrangement structures using 9-month-old mice. Accordingly, we performed α-tubulin immunostaining on control oocytes to observe the width of the chromosome plates.

[0237] As shown in Figure 19, it was confirmed that the structural quality of the oocytes deteriorated due to aging, as the width of the chromosome plate increased in the 9-month-old control oocytes compared to the 2-month-old ones.

[0238]

[0239] Next, mRNA expression levels in oocytes were analyzed to evaluate the possibility that Ncapg2 expression levels contribute to the quality degradation observed in aged oocytes.

[0240] As shown in Figure 20, Ncapg2 mRNA expression was reduced in aged mouse oocytes compared to young mouse oocytes, which indicated that Ncapg2 expression decreases with aging. These results suggested that reduced Ncapg2 expression may influence the chromosomal abnormalities and reduced spindle stability observed in aged oocytes.

[0241]

[0242] To more quantitatively evaluate the effect of Ncapg2 defects on the structural stability of the kinetochore and perikinetochore, the shape change of the kinetochore-microtubule adhesion site and the interkinetochore distance (IKD) were measured.

[0243] As shown in FIG. 21, Ncapg2 F / FZP3 It was confirmed that IKD values ​​in oocytes were significantly increased compared to the control group. These results indicate that Ncapg2 plays an important role in maintaining the stability of kinetochore-microtubule binding and regulating the balance of physical tension between kinetochores.

[0244]

[0245] Experimental Example 13. Analysis of MacroH2A1 Interactions in Ncapg2 Overexpressing Oocytes

[0246] To determine the function of Ncapg2 within the oocyte and whether there is a protein interaction with MacroH2A1, Ncapg2LSL / +, ZP3 mouse oocytes in which human Ncapg2 is overexpressed were prepared as shown in Fig. 22.

[0247]

[0248] First, Western blot analysis was performed to confirm whether the human Ncapg2 protein was actually expressed.

[0249] As shown in Figure 23, an increase in the expression of Ncapg2 in Ncapg2LSL / +, ZP3 oocytes was confirmed.

[0250]

[0251] Additionally, a Proximity Ligation Assay (PLA) experiment was performed to verify protein interactions between overexpressed Ncapg2 and MacroH2A1.

[0252] As shown in Figure 24, it was confirmed that MacroH2A1 and Ncapg2 interact in close physical proximity in the oocytes of Ncapg2LSL / +, ZP3 mice.

[0253]

[0254] The experimental results above confirmed that Ncapg2 plays a crucial role in maintaining chromosomal structure in oocytes, particularly in the pericentromere region where heterochromatin is concentrated. The interaction between Ncapg2 and MacroH2A1 is necessary to support the stable binding of kinetochores and microtubules; if this process is not properly carried out, it can delay the progression of meiosis and induce mis-segregation, leading to chromosomal abnormalities (aneuploidy) and reduced fertility. Furthermore, considering the tendency for Ncapg2 mRNA levels to decrease in aged oocytes, it is highly likely that Ncapg2 also contributes to the quality degradation associated with oocyte aging.

[0255]

[0256] Experimental Example 14. Mouse Mating Strategy

[0257] (1) Construction and verification of Human NCAPG2-inserted LSL (loxP-STOP-loxP) Knock-In mice

[0258] It is generally known that when a new gene is inserted into a specimen through genetic engineering, the ROSA26 chromosomal location is expressed in a relatively housekeeping style with almost no other developmental problems. Therefore, when constructing Knock-In mice to overexpress a specific gene, the strategy of inserting at the ROSA26 location has been commonly used. Based on this principle, human NCAPG2 was inserted at the ROSA26 location. A schematic diagram of a LoxP mouse with Ncapg2 Exon 6-16 deletion is shown in Fig. 25 and the sequence below (bold indicates sequence number 4 loxP), and a schematic diagram of an LSL mouse designed to overexpress Human Ncapg2 when STOP is removed is shown in Fig. 26.

[0259] <Fig. 25; loxP(new) region>

[0260] 8701>gtttatttatagtctccaaattgtggtaaaatgagtgctgtcatggtagttgcttccagactcacaattactaggcgctttatgtgtttataacggtatt>8800

[0261] 8701>gtttatttatagtctccaaattgtggtaaaatgagtgctgtcatggtagttgcttccagactcacaattactaggegctttatgtgtttataacggtatt>8800

[0262] 8801>caggcatctgtgggtaattattagcatattattaacaattattgagctttatgtttcaaaaagcaatagtttttatattcactatgttatttgctttgat>8900

[0263] 8801>caggcatctgtgggtaattattagcatattattaacaattattgagctttatgtttcaaaaagcaatagtttttatattcactatgttatttgctttgat>8900

[0264] 8901>ttttttttccacctttgagcctagacctgaagctaccacactgagcttgtagtggattggtggttagagcctgtcc------------------------>8976

[0265] 8901>ttttttttccacctttgagcctagacctgaagctaccacactgagcttgtagtggattggtggttagagcctgtccATAACTTCGTATAATGTATGCTAT>9000

[0266] 8977>----------tggtgggggtagagttgtagtgatagcaagatgtgttaatatgaggcttccaggtctaaagttctctgttttgtaagtattggtattcca>9066

[0267] 9001>ACGAAGTTATtggtgggggtagagttgtagtgatagcaagatgtgttaatatgagqcttccaggtctaaagttctctgttttgtaagtattggtattcca>9100

[0268] 9067>taaatgatggataaaagtatttggcaaattaaactgatatttgcctagctaggtcttgtataagtcatagtactctgaacttttgtgtatatgagtgccc>9166

[0269] 9101>taaatgatggataaaagtatttggcaaattaaactgatatttgectagctaggtcttgtataagtcatagtactctgaacttttgtgtatatgagtgocc>9200

[0270] In the PCR results related to ROSA26, the system was designed so that a specific additional band would form when the NCAPG2 gene was inserted due to the additional sequence present in the insertion vector. To confirm whether human NCAPG2 was accurately inserted into the ROSA26 region, PCR was performed using the left primer set (blue) and the right primer set (red), respectively, as shown in Figure 26. Since bands of the expected size were detected in both types of PCR, it was finally confirmed that the human NCAPG2 gene was accurately inserted into the ROSA26 location.

[0271]

[0272] (2) Oocyte-specific mouse NCAPG2 deletion + human NCAPG2 overexpression (Oocyte-specific KO / OE) mouse crossover strategy

[0273] To specifically remove the mouse NCAPG2 gene only from oocytes and simultaneously overexpress the human NCAPG2 gene, a stepwise mating strategy using a conditional gene removal (floxed allele) and a Cre-induced overexpression system (LoxP-STOP-LoxP= LSL) was performed.

[0274] First, mice with mouse Ncapg2 exons 6-16 (floxed allele, Ncapg2^F / F) surrounded by a loxP site were crossed with mice (R26^LSL-hNCAPG2 / LSL-hNCAPG2) loaded with a Cre-activating human NCAPG2 gene at the Rosa26 locus. This LSL (loxP-STOP-loxP) cassette blocks transgene expression until it is removed by Cre recombinase. Among the offspring obtained from the cross, heterozygous individuals of Ncapg2^F / +; R26^LSL-hNCAPG2 / +* were crossed again to obtain homozygous individuals of Ncapg2^F / F; R26^LSL-hNCAPG2 / LSL-hNCAPG2*. Subsequently, these mice were crossed with Zp3-Cre male mice that express Cre specifically in oocytes to create conditions in which Cre recombinase is expressed only in oocytes. Schematic diagrams of the crossover strategy are shown in Figures 27 and 28.

[0275] The finally generated Ncapg2^F / F; LSL / LSL; Zp3-Cre positive female mice (oocyte-specific Cre expression) simultaneously induce the following two genetic changes in the oocytes:

[0276] - Exons 6-16 of the mouse Ncapg2 gene are removed by Cre, resulting in the deletion of mouse Ncapg2 in oocytes.

[0277] - Simultaneously, the Rosa26 LSL cassette was removed, and human NCAPG2 was overexpressed in oocytes.

[0278] Through this strategy, we established a mouse model in which mouse NCAPG2 is removed and human NCAPG2 is expressed only in oocytes without affecting somatic cells or other germ cells.

[0279]

[0280] Experimental Example 15. Confirmation of recovery of chromosomal structural abnormalities in Ncapg2-deficient oocytes

[0281] Using a mouse model produced by crossbreeding in Experimental Example 14, the effect of mouse Ncapg2 deletion on chromosomal structure during oocyte meiosis was confirmed, and whether human NCAPG2 could replace that function was evaluated.

[0282] To induce superovulation, PMSG (Pregnant Mare Serum Gonadotropin) was injected intraperitoneally into the aforementioned female mice. After injection, oocytes were retrieved from the ovaries, transferred to maturation medium to induce GVBD, and cultured for 4 hours. For chromosome morphology analysis, ZP (zona pelucidda, the thick glycoprotein extracellular matrix of the oocyte) was removed using Pronase (0.5% in M2). The oocytes from which ZP had been removed were transferred to a slide containing approximately 2 μL of fixative and air-dried for 5 minutes to spread the chromosomes on the slide. Subsequently, the slide was washed with 1× PBS for 10 minutes and mounted with an anti-fade solution containing DAPI. Finally, the chromosomal structure was observed using a fluorescence microscope.

[0283] As a result, as shown in Figure 29, a severe chromosomal stretching phenotype was observed in Ncapg2 KO oocytes, which was confirmed by long and elongated chromosomal signals in DAPI staining. In contrast, in Ncapg2 cKO (cKO+cTG) oocytes expressing the human NCAPG2 transgene, stretching was significantly reduced, and the chromosomes were observed in a shorter and more condensed form. This clearly demonstrated partial structural recovery when compared to the normal control group. This indicates that Ncapg2 plays an important role in contributing to the structural stability of the pericentromeric region and confirms that reconstitution is possible due to the high homology of the Ncapg2 gene between mouse and human.

[0284]

[0285] In summary, Ncapg2 functions as a key regulatory factor involved in chromosomal arrangement, epigenetic protein loading, and the maintenance of microtubule binding stability during the meiotic division of an egg cell. A composition containing Ncapg2 according to one embodiment of the present invention can be usefully utilized to improve pregnancy potential and prevent or treat infertility by improving egg cell quality and reducing chromosomal abnormalities and aploidy during meiosis.

[0286]

[0287] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

1. A composition for enhancing pregnancy potential comprising an Ncapg2 protein or a gene encoding said protein.

2. A composition for promoting pregnancy potential according to claim 1, wherein the Ncapg2 protein comprises an amino acid sequence represented by SEQ ID NO.

1.

3. A composition for enhancing pregnancy potential according to claim 1, wherein the Ncapg2 protein or the gene encoding the protein is of animal origin.

4. A pharmaceutical composition for the prevention or treatment of infertility or subfertility, comprising an Ncapg2 protein or a gene encoding said protein.

5. An egg of an animal other than a human, comprising a composition for promoting the potential for pregnancy according to any one of claims 1 to 3.

6. An animal model of infertility or sterility in which the gene encoding the Ncapg2 protein is knocked out specifically in oocytes.

7. A step of treating an animal model of infertility or subfertility according to claim 6 with a candidate drug; and A step of measuring the extent to which the above candidate drug improves infertility or subfertility. A method for evaluating the efficacy of a drug for treating infertility or subfertility, comprising 8. A step of treating an animal model of infertility or infertility according to Claim 6 with a drug for treating infertility or infertility; and Step of measuring the safety of the drug in the above animal model A method for evaluating the safety of a drug for treating infertility or subfertility, comprising 9. A method for producing an egg with enhanced fertility, comprising the step of introducing a composition for enhancing fertility according to any one of claims 1 to 3 into an animal egg excluding humans.

10. A composition for selecting healthy eggs comprising a preparation for measuring the level of Ncapg2 protein or a gene encoding said protein.

11. A healthy egg screening kit comprising the composition of claim 10.

12. A step of measuring the tension of tubulin during the meiotic stage of an egg separated from an individual; and A method for assessing pregnancy potential comprising the step of comparing the above tension with the tension measured in an egg isolated from a normal control group of the same age.

13. A method for assessing pregnancy potential according to claim 12, further comprising the step of determining that the likelihood of pregnancy of the individual is low when the tension of the tubulin is low compared to a normal control group.

Images