Oceanobacillus sp. strain having idebenone producing capacity and high antioxidant capacity

Abstract

Disclosed is an Oceanobacillus sp. strain having idebenone producing capacity and high antioxidant capacity, pertaining to the field of microbial strains. Oceanobacillus sp. Y-3 is obtained by screening from black mud in the Yuncheng Salt Lake, Shanxi Province. It not only has high free radical scavenging capacity and relatively strong iron ion reducing capacity, exhibiting high antioxidant activity, but also has idebenone producing capacity. The strain has great application potential in the fields of health products and cosmetics.

Description

A strain of Bacillus aquaticus with the ability to produce idebenone and high antioxidant capacity Technical Field

[0001] This invention relates to a strain of Bacillus aquatilis with the ability to produce idebenone and high antioxidant capacity, belonging to the field of microbial strains. Background Technology

[0002] Free radicals, as clusters of atoms or molecules with unpaired electrons produced during metabolism, play an important role in signal transduction under physiological conditions. However, when free radicals accumulate excessively in the body, they attack cellular structures, leading to a series of oxidative stress reactions such as DNA damage, lipid peroxidation, and protein denaturation, thereby triggering various diseases. Therefore, finding effective methods to eliminate free radicals in the body is of great significance for maintaining human health.

[0003] Currently, free radical scavenging is mainly achieved through two mechanisms: first, through the body's naturally occurring antioxidant enzyme system, such as superoxide dismutase (SOD); and second, through exogenous intake of substances with antioxidant activity, such as vitamins, minerals, and certain natural products. However, with age and individual differences, the activity of antioxidant enzymes in the body gradually decreases, and the absorption and utilization efficiency of traditional antioxidants also has certain limitations. Therefore, developing new and highly efficient free radical scavengers has become a current research hotspot.

[0004] Idebenone, a highly effective antioxidant, possesses a benzoquinone group in its structure that efficiently captures and scavenges free radicals, thereby protecting cells from oxidative stress damage. In the biomedical field, idebenone has been widely used to treat neurological and cardiovascular diseases and improve skin health. In cosmetics and skincare products, idebenone also plays a role in scavenging free radicals, inhibiting lipid peroxidation, suppressing inflammation, and inhibiting DNA damage, significantly improving skin condition. However, the chemical synthesis of idebenone is not only costly but may also pollute the environment. Therefore, finding a sustainable and environmentally friendly method for producing idebenone is particularly important.

[0005] In the field of microbiology, probiotics such as lactic acid bacteria and bifidobacteria are widely used in food fermentation, pharmaceuticals, and health products due to their excellent bioactivity and safety. Recent studies have shown that some lactic acid bacteria and bifidobacteria strains possess strong antioxidant capabilities, scavenging free radicals in the body and protecting cells from oxidative damage. However, although many probiotics have been proven to have antioxidant activity, the free radical scavenging abilities vary significantly among different strains. Relatively few strains can efficiently scavenge multiple free radicals, and no existing technology for producing idebenone by microorganisms has been publicly disclosed or reported. Therefore, screening and isolating strains with higher free radical scavenging capabilities and the ability to produce idebenone is of great significance for developing novel functional products applicable to various fields such as food, health products, and cosmetics. Summary of the Invention

[0006] To address the aforementioned issues, this invention screened a strain of Bacillus aquatilis Y-3 from the black mud of Yuncheng Salt Lake in Shanxi Province. This bacterium possesses highly efficient free radical scavenging and antioxidant capabilities, as well as the ability to produce idebenone. Furthermore, this invention comprehensively identified the bacterium through physiological and biochemical analyses and phenotypic characterization, aiming to lay a foundation for the development of new and highly efficient free radical scavengers from a microbiological perspective, and to provide new ideas and strain resources for the development of pharmaceuticals, cosmetics, and health products.

[0007] The first objective of this invention is to provide a strain of Oceanobacillus sp. Y-3 with the ability to produce idebenone and high antioxidant capacity. It is taxonomically named Oceanobacillus sp. Y-3 and was deposited at the China Center for Type Culture Collection on November 5, 2024, with accession number CCTCC NO: M 20242434.

[0008] The novel *Oceanobacillus* sp. (CCTCC NO: M 20242434) of this invention, possessing idebenone-producing ability and high antioxidant capacity, has the following characteristics:

[0009] (1) Colony characteristics: The colonies are orange-red round colonies, opaque, with a raised center, and the edges of the colonies are neat and the size and shape are stable;

[0010] (2) Morphological characteristics: Gram-positive bacteria, without flagella, the bacterial cells are short rod-shaped, with a length range of 1.5 to 1.8 μm and a width range of 0.3 to 0.4 μm;

[0011] (3) Growth characteristics: It can tolerate salinity of 0-5%; the optimal growth temperature is 30℃; the growth pH range is 6.5-9.0, and the optimal growth pH range is 7.0-7.2; it can use starch, glucose, sucrose, maltose and other sugars as the sole carbon source for growth;

[0012] (4) Physiological and biochemical characteristics: positive for catalase, starch hydrolysis, cellulose decomposition, glucose oxidation and fermentation, negative for protease, positive for esterase, and positive for indole; it belongs to facultative anaerobic bacteria and grows well under both aerobic and anaerobic conditions.

[0013] (5) Antioxidant properties:

[0014] a. It can effectively scavenge DPPH free radicals, ABTS cationic free radicals, and hydroxyl free radicals, exhibiting strong antioxidant capacity: When the concentration of *Bacillus oryzae* CCTCC NO: M 20242434 cell lysate is higher than 12 mg / mL, the scavenging rate of DPPH free radicals reaches over 90%; when the concentration of *Bacillus oryzae* CCTCC NO: M 20242434 cell lysate is higher than 10 mg / mL, the scavenging rate of ABTS cationic free radicals reaches over 90%; preferably, when the concentration of the cell lysate is 20 mg / mL, the scavenging rate of ABTS cationic free radicals reaches over 99%; the scavenging rate of hydroxyl free radicals by anhydrous ethanol intracellular extract at a concentration of 10 mg / mL reaches 72.23%;

[0015] b. It has a strong iron ion reducing ability. When the concentration of Oceanobacillus sp. CCTCC NO: M 20242434 bacterial lysate is 16 mg / mL, the FRAP value is 4.28 mmol / L.

[0016] (6) It has the ability to produce idebenone.

[0017] The second objective of this invention is to provide a microbial agent containing Oceanobacillus sp. CCTCC NO: M 20242434.

[0018] In one embodiment of the present invention, the microbial agent uses Oceanobacillus sp. CCTCC NO: M 20242434 as the main microorganism.

[0019] In one embodiment of the present invention, the viable count of Oceanobacillus sp. (CCTCC NO: M 20242434) in the bacterial agent is 10. 7 ~10 9 CFU / mL.

[0020] In one embodiment of the present invention, the concentration range of Oceanobacillus sp. (CCTCC NO: M 20242434) in the bacterial agent is 10. 7 ~10 9 CFU / mL.

[0021] In one embodiment of the present invention, the bacterial agent is prepared by seed culture of Oceanobacillus sp. CCTCC NO: M 20242434 and then expanded.

[0022] In one embodiment of the present invention, the bacterial agent contains live cells of the present invention's Oceanobacillus sp. CCTCC NO: M 20242434 strain, freeze-dried Oceanobacillus sp. CCTCC NO: M 20242434 strain, immobilized Oceanobacillus sp. CCTCC NO: M 20242434 strain cells, liquid bacterial agent of the present invention's Oceanobacillus sp. CCTCC NO: M 20242434 strain, solid bacterial agent of the present invention's Oceanobacillus sp. CCTCC NO: M 20242434 strain, or Oceanobacillus sp. CCTCC NO: M 20242434 strain present invention in any other form.

[0023] In one embodiment of the present invention, the microbial agent also contains other excipients.

[0024] In one embodiment of the present invention, the bacterial agent is a highly effective scavenger of DPPH·, ·OH, and ABTS. + Microbial preparations containing free radicals, possessing high reducing power, and exhibiting strong antioxidant capacity.

[0025] A third objective of this invention is to provide a product composition with antioxidant effects, wherein the preparation method of the product composition includes: adding the bacterial cell material and / or metabolites of Bacillus oceanus CCTCC NO: M 20242434 to a product matrix to obtain the product composition.

[0026] In one embodiment of the present invention, the antioxidant effect is the ability to scavenge free radicals or the ability to reduce iron ions;

[0027] In one embodiment of the present invention, the free radical is DPPH·, ·OH, or ABTS. + At least one of the following.

[0028] A fourth object of the present invention is to provide the use of Oceanobacillus sp. CCTCC NO: M 20242434, the above-mentioned bacterial agent containing Oceanobacillus sp. CCTCC NO: M 20242434, or the above-mentioned product composition in the preparation of products having free radical scavenging ability or antioxidant function.

[0029] In one embodiment of the present invention, the product includes, but is not limited to, pharmaceuticals, health products, cosmetics, or functional foods.

[0030] In one embodiment of the present invention, the pharmaceutical product further contains pharmaceutically acceptable excipients, including but not limited to at least one of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH adjusters, antioxidants, antibacterial agents, or buffers.

[0031] In one embodiment of the present invention, the pharmaceutical product also contains other pharmaceutical ingredients with antioxidant capabilities.

[0032] In one embodiment of the present invention, the medicine includes, but is not limited to, injections, oral liquids, tablets, capsules, drops, and sprays.

[0033] In one embodiment of the present invention, the administration method includes, but is not limited to, subcutaneous injection, intravenous injection, oral administration, topical application, inhalation administration, local application, and sublingual administration.

[0034] In one embodiment of the present invention, the dosage form of the cosmetic can be formulated as a solution, topical ointment, emulsifiable foam, nourishing emollient, softening emollient, filler, soft water, emulsifiable cleanser, cosmetic base, fragrance, soap, liquid cleanser, bath product, sunscreen, sunscreen oil, suspension, emulsion, paste, gel, lotion, powder, soap, surfactant-containing cleanser, oil, foundation, emulsion foundation, wax foundation, patch, and spray.

[0035] In one embodiment of the present invention, the cosmetic also includes at least one cosmetically acceptable carrier.

[0036] In one embodiment of the present invention, the carrier may be oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, or fragrance.

[0037] A fifth object of the present invention is to provide a method for producing idebenone, the method utilizing Oceanobacillus sp. CCTCC NO: M 20242434 or an agent containing Oceanobacillus sp. CCTCC NO: M 20242434 to produce idebenone.

[0038] A sixth object of the present invention is to provide a cosmetic comprising a lysate of Oceanobacillus sp. CCTCC NO: M 20242434 or the above-described product composition.

[0039] In one embodiment of the present invention, the cosmetic is a skin care product.

[0040] In one embodiment of the present invention, the dosage form of the cosmetic can be formulated as a solution, topical ointment, emulsifiable foam, nourishing emollient, softening emollient, filler, soft water, emulsifiable cleanser, cosmetic base, fragrance, soap, liquid cleanser, bath product, sunscreen, sunscreen oil, suspension, emulsion, paste, gel, lotion, powder, soap, surfactant-containing cleanser, oil, foundation, emulsion foundation, wax foundation, patch, and spray.

[0041] In one embodiment of the present invention, the cosmetic also includes at least one cosmetically acceptable carrier.

[0042] In one embodiment of the present invention, the carrier may be oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, or fragrance. Beneficial effects:

[0043] (1) The Oceanobacillus sp. CCTCC NO: M 20242434 strain of the present invention has a high free radical scavenging ability and can efficiently scavenge DPPH free radicals, ABTS cation free radicals, and hydroxyl free radicals: the intracellular extract of Oceanobacillus sp. CCTCC NO: M 20242434 with anhydrous ethanol at a concentration of 24 mg / ml has a DPPH free radical scavenging rate of 92.81%; the intracellular extract of Oceanobacillus sp. CCTCC NO: M 20242434 with anhydrous ethanol at a concentration of 20 mg / ml has a ABTS cation free radical scavenging rate of 99.81%; and the intracellular extract of Oceanobacillus sp. with anhydrous ethanol at a concentration of 10 mg / ml has a hydroxyl free radical scavenging rate of 72.23%.

[0044] (2) The Oceanobacillus sp. CCTCC NO: M 20242434 strain of the present invention has a strong iron ion reducing ability. When the concentration of Oceanobacillus sp. CCTCC NO: M 20242434 bacterial lysate is 16 mg / mL, the FRAP value is 4.28 mmol / L.

[0045] (3) The Oceanobacillus sp. CCTCC NO: M 20242434 strain of the present invention also has the ability to produce idebenone.

[0046] Therefore, Oceanobacillus sp. CCTCC NO: M 20242434 exhibits high free radical scavenging ability and total reducing power, demonstrating high antioxidant activity. Furthermore, Oceanobacillus sp. CCTCC NO: M 20242434 of this invention also possesses the ability to produce idebenone, showing great application potential in the fields of health products and cosmetics.

[0047] Preservation of biological materials:

[0048] Oceanobacillus sp. Y-3, taxonomically named Oceanobacillus sp. Y-3, was deposited on November 5, 2024, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20242434, located at Wuhan University, Wuhan, China. Attached Figure Description

[0049] Figure 1 shows the colony morphology of Oceanobacillus sp. Y-3.

[0050] Figure 2 shows the cell morphology of Oceanobacillus sp. Y-3.

[0051] Figure 3 shows the growth of Oceanobacillus sp. Y-3 at different temperatures.

[0052] Figure 4 shows the growth of Oceanobacillus sp. Y-3 under different salinities.

[0053] Figure 5 shows the growth of Oceanobacillus sp. Y-3 under different carbon sources.

[0054] Figure 6 shows the total ion chromatogram of the idebenone standard.

[0055] Figure 7 shows the primary and secondary mass spectra of the idebenone standard.

[0056] Figure 8 shows the total ion chromatogram of the sample solution.

[0057] Figure 9 shows the first-order and second-order mass spectra of the substance eluting at 4.62 min in the sample solution. Detailed Implementation

[0058] This invention is not limited to the embodiments described herein; the embodiments are merely illustrative and not intended to limit the scope of protection of this invention. Any modifications or substitutions made to the methods, steps, or conditions of this invention without departing from the spirit and essence of this invention are within the scope of this invention.

[0059] In the following examples, unless otherwise specified, all solutions mentioned use water as the solvent.

[0060] The crude salt mentioned below is from Yuncheng Salt Lake, which originates from Yuncheng Salt Lake.

[0061] The culture medium formulations described in the following examples are as follows:

[0062] 1. Crude salt liquid culture medium: 50g crude salt, 20g MgSO4·7H2O, 2.0g KCl, 3.0g sodium citrate, 0.2g anhydrous calcium chloride, 2.0g yeast extract, 10.0g peptone, add distilled water to make up to 1L, and adjust the pH to 7.0-7.2.

[0063] 2. Crude Salt Solid Culture Medium: 50g crude salt, 20g MgSO4·7H2O, 2.0g KCl, 3.0g sodium citrate, 0.2g anhydrous calcium chloride, 2.0g yeast extract, 10.0g peptone. Add distilled water to a final volume of 1L, adjust pH to 7.0-7.2, and add 15.0g agar. Autoclave at 1×105Pa, 121℃ for 30min. After cooling the medium to 50-60℃, pour approximately 15-20mL of medium into each petri dish. Allow to cool and solidify before storing for later use.

[0064] Example 1: Morphological observation of strain Y-3

[0065] 1. Source of microbial strains

[0066] The strain was isolated from black mud in the salt lake of Yuncheng, Shanxi Province. The specific isolation method is as follows:

[0067] In a clean bench, black mud was added to the coarse salt culture medium at a volume of 5% of the medium. The mixture was thoroughly shaken and incubated in a 30°C shaker incubator for 48 hours, then transferred to a 30°C incubator. Once the supernatant became turbid, the bacterial culture was diluted with sterile water to a concentration of 10.-1 10 -2 10 -3 10 -4 10 -5 10 -6 Different concentrations of diluted solutions were diluted (100 μL each) and added to crude salt solid medium. The solutions were spread evenly using a disposable spreader and allowed to dry before being incubated upside down in a 30°C incubator. Once distinct colonies appeared on the medium, they were transferred for further culture. Strains exhibiting typical characteristics such as orange-red rounded edges, neat margins, and a glossy surface were selected and streaked onto crude salt solid medium plates for isolation. The resulting orange-red Y-3 strain is the strain involved in this invention. The purified strain was stored in 20% glycerol at -80°C for later use.

[0068] 2. Cultivation characteristics and morphological features

[0069] The isolated Y-3 strain was streaked onto coarse salt solid medium and incubated at 30°C. Its colony morphology is shown in Figure 1. The colonies are orange-red, round, opaque, with a raised center, and have neat edges and stable size and shape. Gram staining of the bacterial smear revealed the bacterial morphology as shown in Figure 2. The bacterium is Gram-positive, non-flagellated, and short rod-shaped, ranging in length from 1.5 to 1.8 μm and in width from 0.3 to 0.4 μm.

[0070] 3. Growth characteristics of Oceanobacillus sp. Y-3

[0071] The Y-3 strain grows in a temperature range of 30–37℃ (Figure 3), can tolerate salinity of 0–5% (Figure 4), and has a growth pH range of 6.5–9.0, with an optimal growth pH range of 7.0–7.2. It is a facultative anaerobic bacterium that grows well under both anaerobic and aerobic conditions. It can utilize various sugars such as starch, glucose, sucrose, and maltose as its sole carbon source for growth (Figure 5).

[0072] Example 2: Classification and identification of 16S rRNA and physiological and biochemical characteristics of strain Y-3

[0073] Molecular biological identification was performed on strain Y-3 from Example 1. Its 16S rRNA gene was amplified by PCR, and sequencing was performed after passing electrophoresis. The primers used for PCR were as follows: 27F primer sequence (5'-3'): AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1) and 1492R primer sequence (5'-3'): GGTTACCTTGTTACGACTT (SEQ ID NO.2).

[0074] Sequencing results showed the sequence as shown in SEQ ID NO.3. Blast sequence alignment analysis was performed on the NCBI database, and strain Y-3 was finally identified as *Oceanobacillus* sp., with a homology score of 99.73%.

[0075] The Bacillus oryzae Y-3 of this invention was deposited at the China Center for Type Culture Collection on November 5, 2024, with accession number CCTCC NO: M 20242434.

[0076] The 16S rDNA sequence of Oceanobacillus sp. Y-3 is shown below (SEQ ID NO.3):

[0077] Referring to the "Handbook of Systematic Identification of Common Bacteria", the physiological and biochemical characteristics of Oceanobacillus sp. Y-3 were detected. The results showed that Oceanobacillus sp. Y-3 was positive for catalase, starch hydrolysis, cellulose decomposition, and glucose oxidation fermentation, but negative for protease, positive for esterase, and positive for indole.

[0078] Example 3: Preparation of Oceanobacillus sp. Y-3 bacterial lysate

[0079] Fresh culture medium: 20g crude salt, 20g MgSO4·7H2O, 2.0g KCl, 3.0g sodium citrate, 0.2g anhydrous calcium chloride, 2.0g yeast extract, 10.0g peptone, add distilled water to a final volume of 1L, and adjust the pH to 7.2.

[0080] (1) Take a sample from the cryopreservation tube of Oceanobacillus sp. Y-3 and inoculate it into crude salt liquid culture medium. Place it in a shaking incubator at 30℃ (speed: 200rpm) for 3 days. When the culture medium becomes a turbid and opaque red liquid, pick a single colony and continue to inoculate it onto a crude salt solid culture medium plate. Place it in a constant temperature and humidity incubator for 4 days (30℃, humidity 70%) to activate the strain.

[0081] A single colony was picked and inoculated into an Erlenmeyer flask containing 100 mL of crude salt liquid culture medium. The flask was then incubated at 30°C in a shaking incubator (200 rpm) for 3 days. At this time, the OD value of the bacterial culture was measured. 600 =0.5, can be used as crude salt seed solution.

[0082] Add the cultured crude salt seed solution to a sterile conical flask containing 300 mL of the above fresh culture medium at a volume ratio of 10% (v / v). Incubate at 30°C in a shaking incubator (200 rpm) for at least 4 days, i.e., until the OD reaches 10000. 600 The concentration is set to 0.4-0.5 to obtain a well-cultured fermentation broth.

[0083] (2) The fermentation broth (OD) obtained in step (1) 600 The bacterial precipitate was centrifuged at 4℃ and 8000rpm for 10 min to remove the supernatant. The precipitate was washed with PBS, centrifuged again to remove the liquid phase, and then washed twice with PBS to obtain the precipitate.

[0084] The obtained precipitate was resuspended with an equal volume of anhydrous ethanol to obtain a bacterial solution. The bacterial solution was subjected to ultrasonic disruption for 3 cycles (1200W, power: 80%, time: 30min). After centrifugation at 4℃ and 8500rpm for 10min, the supernatant was collected to obtain the ethanol extract of bacterial lysate.

[0085] (3) Add an equal volume of anhydrous ethanol to the bacterial precipitate after centrifugation in step (2), and repeat the extraction process in step (2) once to obtain bacterial lysate ethanol extract-1; combine the above bacterial lysate ethanol extract-1 with the bacterial lysate ethanol extract obtained in step (2), concentrate under reduced pressure, and dry to obtain Oceanobacillus sp. Y-3 bacterial lysate, and store it in a -80℃ refrigerator for later use.

[0086] Example 4: Determination of the antioxidant activity of Oceanobacillus sp. Y-3 bacterial lysate

[0087] 1. Determination of DPPH free radical (DPPH·) scavenging ability

[0088] (1) Prepare ethanol solutions of Oceanobacillus sp. Y-3 bacterial lysate obtained in Example 3 with anhydrous ethanol at mass concentrations of 24 mg / mL, 12 mg / mL, 6.0 mg / mL, 3.0 mg / mL, 1.5 mg / mL, 0.75 mg / mL, 0.38 mg / mL and 0.19 mg / mL;

[0089] (2) Prepare a 0.3 mmol / L solution of 2,2-biphenyl-1-picrylhydrazine (DPPH) using anhydrous ethanol.

[0090] (3) Experimental group, control group and blank group were set up respectively, and the specific groups are as follows:

[0091] Experimental group: 100 μL of the ethanol solution of bacterial lysate obtained in step (1) was transferred into each well of a 96-well plate, and then 100 μL of the DPPH-ethanol solution obtained in step (2) was added. After mixing thoroughly and reacting in the dark for 30 min, the absorbance A of the mixture at 517 nm was measured. 样品 .

[0092] Control group: Same as experimental group, except that an equal volume of anhydrous ethanol was used instead of the sample solution (sample solution refers to the ethanol solution of the bacterial lysate mentioned above); the specific steps are the same as above, and the absorbance A is measured at 517 nm. 对照 .

[0093] Blank group: Same as the experimental group, except that an equal volume of anhydrous ethanol is used instead of DPPH solution. The specific steps are the same as above, and the absorbance A is measured at 517 nm. 空白 .

[0094] Each group needs to be repeated 3 times, and the results are averaged to calculate the DPPH free radical scavenging rate.

[0095] The formula for calculating the DPPH free radical scavenging rate is shown below, and the results are shown in Table 1. DPPH free radical scavenging rate / % = [1 - (A 样品 -A 空白 ) / A 对照 )]×100%

[0096] (4) Ascorbic acid solutions of 0.08 mg / mL, 0.04 mg / mL, 0.02 mg / mL, and 0.01 mg / mL were used as positive controls. Specifically, 100 μL of ascorbic acid solutions of different concentrations were transferred to each well of a 96-well plate, and then 100 μL of DPPH-ethanol solution obtained in step (2) was added. After mixing thoroughly and reacting in the dark for 30 min, the absorbance A of the mixture at 517 nm was measured. 样品-1 .

[0097] Control group: The specific method is the same as above, except that an equal volume of ultrapure water is used instead of ascorbic acid solution; absorbance A is measured at 517 nm. 对照-1 .

[0098] Blank group: The specific method is the same as above, except that an equal volume of ultrapure water is used instead of DPPH solution to measure absorbance A at 517 nm. 空白-1 .

[0099] A was obtained by following the methods described above. 样品-1 A 对照-1 and A 空白-1 Calculate its DPPH free radical scavenging rate.

[0100] The formula for calculating the DPPH free radical scavenging rate is shown below, and the results are shown in Table 1. DPPH free radical scavenging rate / % = [1 - (A 样品-1 -A 空白-1 ) / A 对照-1 )]×100%.

[0101] Table 1. DPPH free radical scavenging effect of Oceanobacillus sp. Y-3 bacterial lysates

[0102] 2. ABTS cationic free radical (ABTS) + • Determination of scavenging ability

[0103] (1) Preparation of solution

[0104] Potassium persulfate solution: Weigh 6.6 mg of potassium persulfate and dissolve it in 10 mL of distilled water to obtain a potassium persulfate solution with a concentration of 2.45 mmol / L;

[0105] ABTS working solution: Weigh 7.7 mg of ABTS and dissolve it in 2 mL of potassium persulfate solution. After reacting in the dark for 16 h, dilute it to prepare a 2,2'-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) working solution with an absorbance of 0.7 at 734 nm.

[0106] (2) Prepare ethanol solutions of Oceanobacillus sp. Y-3 bacterial lysate obtained in Example 3 with anhydrous ethanol at concentrations of 20 mg / mL, 10 mg / mL, 5.0 mg / mL, 2.5 mg / mL, 1.25 mg / mL, 0.63 mg / mL and 0.31 mg / mL respectively.

[0107] (3) Transfer 10 μL of the ethanol solutions of bacterial lysates of different concentrations obtained in step (2) into 96-well plates, then add 190 μL of ABTS working solution obtained in step (1). After reacting in the dark for 15 min, measure the absorbance A at 734 nm. 样品 .

[0108] Control group: Same as above, except that an equal volume of anhydrous ethanol was used instead of the sample solution (the sample solution refers to the ethanol solution of the bacterial lysate mentioned above); the absorbance A at 734 nm was measured. 对照 .

[0109] Blank group: Same as above, except that anhydrous ethanol is used instead of ABTS working solution. The specific steps are the same as above, and the absorbance A is measured at 734 nm. 空白 .

[0110] Each test group needs to be repeated 3 times, and the average result is taken to calculate the ABTS cationic free radical scavenging rate.

[0111] The formula for calculating the ABTS cationic free radical scavenging rate is as follows, and the results are shown in Table 2.

[0112] ABTS cationic radical scavenging rate / % = [1 - (A 样品 -A 空白 ) / A 对照 )]×100%.

[0113] (4) Ascorbic acid solutions of 4.0 mg / mL, 2.0 mg / mL, 0.80 mg / mL, 0.12 mg / mL, 0.10 mg / mL, 0.08 mg / mL, 0.05 mg / mL, and 0.025 mg / mL were used as positive controls. Specifically, 10 μL of each concentration of ascorbic acid solution was transferred to a 96-well plate, and then 190 μL of ABTS working solution obtained in step (1) was added. After reacting in the dark for 15 min, the absorbance A at 734 nm was measured. 样品-1 .

[0114] Control group: The specific method is the same as above, except that an equal volume of ultrapure water is used instead of ascorbic acid solution; the absorbance A at 734 nm is measured. 对照-1 .

[0115] Blank group: The specific method is the same as above, except that an equal volume of ultrapure water is used instead of DPPH solution; the absorbance A at 734 nm is measured. 空白-1 .

[0116] A was obtained by following the methods described above. 样品-1 A 对照-1 and A 空白-1 Calculate the ABTS cationic radical scavenging rate.

[0117] The formula for calculating the ABTS cationic radical scavenging rate is as follows, and the results are shown in Table 2. ABTS cationic radical scavenging rate / % = [1 - (A 样品-1 -A 空白-1 ) / A 对照-1 )]×100%.

[0118] Table 2. ABTS cationic free radical scavenging effect of Oceanobacillus sp. Y-3 bacterial lysates

[0119] 3. Determination of hydroxyl radical (·OH) scavenging ability

[0120] (1) Prepare ethanol solutions of Oceanobacillus sp. Y-3 bacterial lysate obtained in Example 3 with anhydrous ethanol at concentrations of 0.63 mg / mL, 1.25 mg / mL, 2.5 mg / mL, 5.0 mg / mL and 10 mg / mL respectively.

[0121] (2) Take 50 μL of each concentration gradient solution obtained in step (1) above, add 50 μL each of 9 mmol / L H2O2 solution, 9 mmol / L FeSO4 solution, and 9 mmol / L salicylic acid-anhydrous ethanol solution, vortex until homogeneous, and incubate in a water bath at 37℃ for 35 min. Measure the absorbance at 510 nm and record it as A. 样品 .

[0122] Blank group: The specific steps are the same as above, except that distilled water is used instead of the sample solution (the sample solution refers to the ethanol solution of the bacterial lysate mentioned above). The specific steps are the same as above, and the absorbance is measured at 510 nm, denoted as A. 空白 ;

[0123] Control group: The specific steps are the same as above, except that distilled water is used instead of H2O2 solution. The absorbance is measured at 510 nm and recorded as A. 对照 Calculate the hydroxyl radical scavenging rate.

[0124] Each experiment was repeated in triplicate, and the average value was taken. The formula for calculating the hydroxyl radical scavenging rate is as follows, and the results are shown in Table 3. Hydroxyl radical scavenging rate / % = [A] 空白 -(A 样品 -A 对照 )] / A 空白 ×100%.

[0125] (3) Ascorbic acid solutions with concentrations of 0.84 mg / mL, 0.42 mg / mL, 0.21 mg / mL, 0.10 mg / mL, and 0.05 mg / mL were used as positive controls. Specifically, 50 μL of each of the above ascorbic acid solutions was added to 50 μL each of 9 mmol / L H₂O₂ solution, 9 mmol / L FeSO₄ solution, and 9 mmol / L salicylic acid-anhydrous ethanol solution. The mixture was vortexed and incubated in a water bath at 37°C for 35 min. The absorbance was measured at 510 nm and recorded as A. 样品-1 .

[0126] Blank group: The specific steps are the same as above, except that an equal volume of ultrapure water is used instead of ascorbic acid solution. The specific steps are the same as above, and the absorbance is measured at 510 nm, denoted as A. 空白-1 ;

[0127] Control group: The specific steps are the same as above, except that an equal volume of ultrapure water is used instead of H2O2 solution. The specific steps are the same as above, and the absorbance is measured at 510 nm, denoted as A. 对照-1 Calculate the hydroxyl radical scavenging rate.

[0128] A was obtained by following the methods described above. 样品-1 A 对照-1 and A 空白-1 Calculate the hydroxyl radical scavenging rate.

[0129] Each experiment was repeated in triplicate, and the average value was taken. The formula for calculating the hydroxyl radical scavenging rate is as follows, and the results are shown in Table 3. Hydroxyl radical scavenging rate / % = [A] 空白-1 -(A 样品-1 -A 对照-1 )] / A 空白-1 ×100%.

[0130] Table 3. Hydroxyl radical scavenging effect of Oceanobacillus sp. Y-3 bacterial lysates

[0131] As can be seen from Tables 1, 2 and 3, the ethanol solution of Oceanobacillus sp. Y-3 bacterial lysate has a high scavenging effect on DPPH free radicals, ABTS cation free radicals and hydroxyl free radicals.

[0132] 4. Determination of Ferrous Reducing Power (FRAP)

[0133] (1) Preparation of TPTZ working solution

[0134] The TPTZ working solution was prepared by mixing 25 mL of acetate buffer (pH = 3.6), 2.5 mL of 10 mmol / L 2,4,6-tripyridyltriazine (TPTZ) solution, and 2.5 mL of 20 mmol / L ferric chloride solution.

[0135] (2) Prepare ethanol solutions of Oceanobacillus sp. Y-3 bacterial lysate obtained in Example 3 with anhydrous ethanol at concentrations of 16 mg / mL, 8.0 mg / mL, 4.0 mg / mL, 3.0 mg / mL, 2.0 mg / mL, 1.0 mg / mL, 0.50 mg / mL and 0.25 mg / mL respectively.

[0136] (3) Add 10 μL of the ethanol solution of bacterial cell lysate obtained in step (2) and 190 μL of TPTZ working solution obtained in step (1) to a 96-well plate, respectively. Shake the plate for 10 seconds using an enzyme-linked immunosorbent assay (ELISA) reader, incubate at 37°C for 10 minutes, and measure the absorbance at 593 nm. The absorbance is A. 样品 .

[0137] Control group: The specific steps are the same as above, except that acetate buffer is used instead of TPTZ working solution, and the absorbance is measured at a wavelength of 593 nm, which is A. 对照 .

[0138] Blank group: The specific steps are the same as above, except that anhydrous ethanol is used instead of the sample solution (the sample solution refers to the ethanol solution of the bacterial lysate mentioned above). The specific steps are the same as above, and the absorbance A is measured at 593 nm. 空白 .

[0139] Each experimental group needs to be repeated 3 times, and the results are averaged.

[0140] Ferrous sulfate standard solutions with concentrations ranging from 0.1 to 1 mmol / L were prepared, and their absorbance was measured under the same conditions. A standard curve was plotted with ferrous sulfate concentration on the x-axis and absorbance on the y-axis, yielding the regression equation: y = 0.675x + 0.019(R²). 2 =0.999). The iron-reducing capacity of the sample was calculated based on the regression equation and expressed as the equivalent concentration of ferrous ions (FRAP value) in mmol / L.

[0141] y = A 样品 -A 对照 -A 空白 Substituting this into the equation, we obtain the value of x, which is the FRAP value.

[0142] (4) Ascorbic acid solutions with concentrations of 11 mg / mL, 5.5 mg / mL, 1.38 mg / mL, 0.69 mg / mL, 0.34 mg / mL, 0.02 mg / mL, and 0.01 mg / mL were used as positive controls. Specifically, 10 μL of the above ascorbic acid solution and 190 μL of TPTZ working solution obtained in step (1) were added sequentially to a 96-well plate, shaken for 10 s using an enzyme-linked immunosorbent assay (ELISA) reader, incubated at 37℃ for 10 min, and the absorbance was measured at a wavelength of 593 nm. The absorbance was A. 样品-1 .

[0143] Control group: The specific steps are the same as above, except that acetate buffer is used instead of TPTZ working solution, and the absorbance is measured at a wavelength of 593 nm, which is A. 对照-1 .

[0144] Blank group: The specific steps are the same as above, except that an equal volume of ultrapure water is used instead of ascorbic acid solution. The specific steps are the same as above, and the absorbance A is measured at 593 nm. 空白-1 .

[0145] A was obtained by following the methods described above. 样品-1 A 对照-1 and A 空白-1 ,

[0146] Each experimental group needs to be repeated 3 times, and the results are averaged.

[0147] Ferrous sulfate standard solutions with concentrations ranging from 0.1 to 1 mmol / L were prepared, and their absorbance was measured under the same conditions. A standard curve was plotted with ferrous sulfate concentration on the x-axis and absorbance on the y-axis, yielding the regression equation: y = 0.675x + 0.019(R²). 2 =0.999). The iron-reducing capacity of the sample was calculated based on the regression equation and expressed as the equivalent concentration of ferrous ions (FRAP value) in mmol / L.

[0148] y = A 样品-1 -A 对照-1 -A 空白-1 Substituting this into the equation, we obtain the value of x, which is the FRAP value.

[0149] The results are shown in Table 4.

[0150] Table 4. Iron reducing power of Oceanobacillus sp. Y-3 bacterial lysates

[0151] As shown in Table 4, when the concentration of the ethanol solution of Oceanobacillus sp. somatic lysate is 16 mg / mL, its FRAP value is 4.28 mmol / L, which is close to the highest FRAP value of vitamin C (4.68 mmol / L), proving that Oceanobacillus sp. somatic lysate has a high reducing ability.

[0152] Example 5: Qualitative analysis of the ability of Oceanobacillus sp. Y-3 to produce idebenone

[0153] Qualitative and quantitative analysis of idebenone in Oceanobacillus sp. Y-3 bacterial lysates was performed using ultra-high performance liquid chromatography-tandem quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF / MS).

[0154] Liquid chromatography conditions: Column: ACQUITY UPLC BEH C 18Column (2.1 mm × 100 mm, 1.7 μm); mobile phase: A is 0.1% formic acid-water solution, B is acetonitrile; gradient elution program is shown in Table 5, flow rate is 0.3 mL / min; diode array (PDA) detector; column temperature 45 °C; injection volume 5.0 μL.

[0155] Table 5 Gradient elution program

[0156] Mass spectrometry conditions: positive ion mode, electrospray ionization source, multiple reaction monitoring mode, ion source temperature 100℃, capillary voltage 3.5kV, cone voltage 20V, desolvation gas temperature 400℃, IMS gas flow rate 24mL / min, collision energy 6 / 20eV.

[0157] The total ion chromatogram of the idebenone standard solution is shown in Figure 6. The peak at 4.62 min is idebenone. Its first-order mass spectrum (TOF MS) and second-order mass spectrum (TOF MS / MS) are shown in Figure 7. The maximum proton number m / z is 339.2154, which is [M+H]. + Ion peak.

[0158] A series of standard working solutions of 12.5, 25, 50, 62.5, and 125 μg / L prepared from idebenone standard solutions were injected and analyzed. A regression equation was plotted with idebenone concentration as the x-axis and peak area as the y-axis. Analysis under the above chromatographic conditions showed that, within the range of 12.5–125 μg / L, the peak area exhibited a good linear relationship with the mass concentration: Y = 4.5168X – 4.2582(R² / L). 2 =0.9986). The content of idebenone in the sample was then calculated using the aforementioned standard curve.

[0159] Following step (1) of Example 3, 500 mL of cultured Oceanobacillus sp. Y-3 fermentation broth was obtained, and then processed according to steps (2) to (3) of Example 3 to finally obtain 65.6 mg of Oceanobacillus sp. Y-3 cell lysate. 1 mL of methanol was added for ultrasonic reconstitution, and the supernatant was collected after centrifugation at 8000-9000 rpm to obtain the sample to be tested. Using the above chromatographic and mass spectrometric conditions, the sample to be tested was injected into the chromatograph for chromatographic separation; the chromatographic effluent was directly introduced into the mass spectrometer for detection, and idebenone was qualitatively and quantitatively analyzed by mass spectrometry.

[0160] The total ion chromatogram of the Oceanobacillus sp. Y-3 bacterial lysate solution is shown in Figure 8. The first-order mass spectrum (TOF MS) and second-order mass spectrum (TOF MS / MS) of the peak at 4.62 min are shown in Figure 9. The maximum proton number m / z is 339.2187, which is [M+H].+ Ion peaks. Comparing Figures 8 and 9 with Figures 6 and 7, it can be seen that the elution time of the substance in the sample at 4.62 min is consistent with that of the idebenone standard, and [M+H]... + The ion peak was consistent with that of the idebenone standard, therefore the substance eluting at 4.62 min was identified as idebenone, and the Oceanobacillus sp. Y-3 bacterial lysate solution contained idebenone.

[0161] Example 6: Quantitative analysis of the ability of Oceanobacillus sp. Y-3 to produce idebenone

[0162] Fresh culture medium: 20g crude salt, 20g MgSO4·7H2O, 2.0g KCl, 3.0g sodium citrate, 0.2g anhydrous calcium chloride, 2.0g yeast extract, 10.0g peptone, add distilled water to a final volume of 1L, and adjust the pH to 7.2.

[0163] (1) Preparation of seed solution:

[0164] Samples were taken from the cryopreservation tubes of the obtained Oceanobacillus sp. Y-3 strain and inoculated into crude salt liquid culture medium. The culture was placed in a shaking incubator at 30°C (200 rpm) for 3 days. When the culture medium turned into a turbid and opaque red liquid, single colonies were picked and inoculated onto crude salt solid culture medium plates. The plates were then incubated in a constant temperature and humidity incubator for 4 days (30°C, 70% humidity) to activate the strain.

[0165] A single colony was picked and inoculated into an Erlenmeyer flask containing 100 mL of crude salt liquid culture medium. The flask was then incubated at 30°C in a shaking incubator (200 rpm) for 3 days. At this time, the OD value of the bacterial culture was measured. 600 =0.5, can be used as crude salt seed solution;

[0166] (2) The prepared crude salt seed solution was added to a sterile Erlenmeyer flask containing 300 mL of the above fresh culture medium (salinity 2%, pH 7.2) at a volume ratio of 10% (v / v). The flask was then incubated at 30°C in a shaking incubator (200 rpm) for 5 days. OD 600 The concentration was set to 0.7–0.8 to obtain a well-cultured fermentation broth.

[0167] (3) The obtained fermentation broth (OD) 600 The bacterial precipitate was centrifuged at 4℃ and 8000rpm for 10 min to remove the supernatant. The precipitate was washed with PBS, centrifuged again to remove the liquid phase, and then washed twice with PBS to obtain the precipitate.

[0168] The obtained precipitate was resuspended with an equal volume of anhydrous ethanol to obtain a bacterial solution. The bacterial solution was subjected to ultrasonic disruption for 3 cycles (1200W, power: 80%, time: 30min). After centrifugation at 4℃ and 8500rpm for 10min, the supernatant was collected to obtain the ethanol extract of bacterial lysate.

[0169] (4) Add an equal volume of anhydrous ethanol to the bacterial precipitate after centrifugation in step (3), and repeat the extraction process in step (3) once to obtain bacterial lysate ethanol extract-1; combine the above bacterial lysate ethanol extract-1 with the bacterial lysate ethanol extract obtained in step (3), concentrate under reduced pressure, and then make up to 1 mL with methanol.

[0170] (5) The content of idebenone in the ethanol extract of Oceanobacillus sp. Y-3 bacterial lysate obtained in step (4) was determined to be 81.4 μg / L by applying the determination method and standard curve of Example 5.

[0171] Since the freeze-dried mass of Oceanobacillus sp. Y-3 is 0.1809 g, the calculated idebenone production capacity of Oceanobacillus sp. Y-3 strain is 0.45 μg / g.

[0172] Example 7: Application of Bacillus aquaticus CCTCC NO: M 20242434 in the preparation of emulsions

[0173] This embodiment provides an emulsion composition with the following formulation:

[0174] 1. Aqueous phase: Water, glycerin, hydrolyzed sodium hyaluronate, xanthan gum, carbomer, and methylparaben are mixed and heated to 80°C, then stirred until dissolved and homogeneous;

[0175] 2. Oil phase: Cetyl alcohol, glyceryl stearate / PEG-100 stearate, caprylic / capric triglyceride, triglyceride (ethylhexanoate), shea butter. Heat the above ingredients to 80℃ and stir until dissolved and homogeneous.

[0176] 3. After mixing the aqueous phase and oil phase, homogenize and emulsify for 5 minutes. After emulsification, add the Oceanobacillus sp. Y-3 bacterial lysate prepared in Example 3 and stir until homogeneous.

[0177] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A strain of Oceanobacillus sp. Y-3, characterized in that, The Oceanobacillus sp. Y-3 was deposited at the China Center for Type Culture Collection on November 5, 2024, with accession number CCTCC NO: M 20242434.

2. A microbial inoculant, characterized in that, The microbial agent contains Bacillus aquaticus CCTCC NO: M 20242434 as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The microbial agent uses Bacillus oceanicus CCTCC NO: M 20242434 as the main microorganism.

4. The microbial agent according to claim 2, characterized in that, The microbial inoculant contains live cells of Bacillus oceanicus strain CCTCC NO: M 20242434, freeze-dried dried cells of Bacillus oceanicus strain CCTCC NO: M 20242434, immobilized cells of Bacillus oceanicus strain CCTCC NO: M 20242434, liquid inoculant of Bacillus oceanicus strain CCTCC NO: M 20242434, solid inoculant of Bacillus oceanicus strain CCTCC NO: M 20242434, or Bacillus oceanicus strain CCTCC NO: M 20242434 in any other form.

5. A product composition with antioxidant properties, characterized in that, The product composition is prepared by adding the bacterial cell material and / or metabolites of Bacillus oceanicus CCTCC NO: M 20242434 as described in claim 1 to a product matrix to obtain the product composition.

6. The product composition according to claim 5, characterized in that, The antioxidant effect is described as having the ability to scavenge free radicals or the ability to reduce iron ions.

7. The product composition according to claim 6, characterized in that, The free radicals are DPPH·, ·OH, and ABTS. + At least one of the following.

8. The use of Bacillus aquaticus CCTCC NO: M 20242434 of claim 1, a bacterial agent containing Bacillus aquaticus CCTCC NO: M 20242434 of claim 1, or the product composition of claim 4 in the preparation of products having free radical scavenging ability or antioxidant function.

9. The application according to claim 8, characterized in that, The products mentioned include, but are not limited to, pharmaceuticals, health products, cosmetics, or functional foods.

10. The application according to claim 9, characterized in that, The product also contains pharmaceutically, food, or health supplement-acceptable excipients.

11. The application according to claim 9, characterized in that, The drug also contains pharmaceutically acceptable excipients, including but not limited to at least one of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH adjusters, antioxidants, antibacterial agents, or buffers.

12. The application according to claim 9, characterized in that, The medicines include, but are not limited to, injections, oral liquids, tablets, capsules, pellets, and sprays.

13. The application according to claim 9, characterized in that, The administration methods of the drug include, but are not limited to, subcutaneous injection, intravenous injection, oral administration, topical application, inhalation, local application, and sublingual administration.

14. A method for preparing idebenone via biological means, characterized in that, The method involves fermenting idebenone using the Bacillus oceanicus CCTCC NO: M 20242434 as described in claim 1 or an inoculum containing the Bacillus oceanicus CCTCC NO: M 20242434.

15. A cosmetic product, characterized in that, The cosmetic comprises the bacterial lysate of Bacillus aureus CCTCC NO: M 20242434 as described in claim 1 or the product composition as described in claim 4.

16. The cosmetic product according to claim 15, characterized in that, The cosmetics mentioned are skincare products.

17. The cosmetic product according to claim 16, characterized in that, The dosage forms of the cosmetics can be solutions, topical ointments, emulsions, moisturizing agents, softening agents, fillers, soft water, emulsions, cosmetic bases, fragrances, soaps, liquid cleansers, bath products, sunscreens, sunblock oils, suspensions, emulsions, pastes, gels, lotions, powders, soaps, surfactant-containing cleansers, oils, foundations, emulsion foundations, wax foundations, patches, and sprays.

18. The cosmetic product according to claim 17, characterized in that, The cosmetic also contains at least one cosmetically acceptable carrier.

19. The cosmetic product according to claim 18, characterized in that, The carrier can be oil, water, surfactant, humectant, lower alcohol, thickener, chelating agent, pigment, preservative, or fragrance.

Images