15-hydroxyprostaglandin dehydrogenase inhibitor and use thereof

By inhibiting the activity or expression of 15-PGDH, using 15-PGDH inhibitors such as SW033291, the problems of HFpEF and vasodilatory dysfunction have been resolved, significantly improving cardiac function and vasodilation, and achieving effective treatment and prevention of HFpEF.

WO2026124649A1PCT designated stage Publication Date: 2026-06-18FUWAI HOSPITAL CHINESE ACAD OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
FUWAI HOSPITAL CHINESE ACAD OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE
Filing Date
2025-12-12
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Currently, there is a lack of effective drug treatments for heart failure with preserved ejection fraction (HFpEF) and vasodilatory dysfunction. Existing treatment options are mostly comprehensive measures and fail to meet the needs.

Method used

By inhibiting the activity or reducing the expression of 15-hydroxyprostaglandin dehydrogenase (15-PGDH), 15-PGDH inhibitors such as SW033291 can maintain or increase the concentrations of prostaglandin E2 (PGE2) and prostaglandin I2 (PGI2), thereby improving cardiac function and vasodilatory function.

🎯Benefits of technology

It significantly improves cardiac function in patients with high heart rate and pulmonary embolism (HFpEF), increases blood circulation and perfusion, reduces cardiac remodeling, improves vasodilation, delays vascular aging, and prevents related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025142160_18062026_PF_FP_ABST
    Figure CN2025142160_18062026_PF_FP_ABST
Patent Text Reader

Abstract

A 15-hydroxyprostaglandin dehydrogenase (15-PGDH) inhibitor, the use thereof in the preparation of a drug for preventing and / or treating heart failure and / or vasodilation dysfunction, and a method for identifying a therapeutic agent for heart failure and / or vasodilation dysfunction, the method comprising contacting a candidate agent with 15-hydroxyprostaglandin dehydrogenase and determining the activity thereof.
Need to check novelty before this filing date? Find Prior Art

Description

15-Hydroxyprostaglandin dehydrogenase inhibitors and their applications Cross-reference to related applications

[0001] This application claims priority to Chinese patent application 202411845484.X, filed on December 13, 2024, entitled "15-Hydroxyprostaglandin dehydrogenase inhibitor and its application thereto," the entire contents of which are incorporated herein by reference.

[0002] All publications, patents and patent applications cited in this specification are incorporated herein by reference, as if each publication, patent and patent application had been specifically described in its entirety and separately cited herein. Technical Field

[0003] This application relates to the use of 15-hydroxyprostaglandin dehydrogenase inhibitors in the preparation of medicaments for the prevention and / or treatment of symptoms of heart failure and / or vasodilatory dysfunction, and also to a method for identifying therapeutic agents for symptoms of heart failure and / or vasodilatory dysfunction. Background Technology

[0004] Heart failure (HF) is a disease caused by impaired cardiac pumping function, resulting in the heart's inability to meet the body's basal metabolic needs. The prevalence and incidence of HF increase significantly with age. High-risk groups include the elderly over 70 years of age, with an incidence exceeding 10% and a 5-year mortality rate reaching 50%. Heart failure is classified into several types according to different classification methods, including congestive heart failure, systolic heart failure (e.g., heart failure with reduced ejection fraction / HFrEF), and diastolic heart failure (e.g., heart failure with preserved ejection fraction / HFpEF). Heart failure with preserved ejection fraction (HFpEF) is a complex type of heart disease characterized by the heart's ability to function normally during contraction but failing to relax effectively during diastole, leading to increased pressure and / or impaired filling, atrial fibrillation, and an increased risk of pulmonary hypertension. Vasodilatory dysfunction is one of the causes of HFpEF. Impaired vasomotor function prevents peripheral and coronary arteries from dilating under stress, leading to a sudden increase in arterial afterload, decreased myocardial perfusion, and forced left ventricular contraction under higher pressure with restricted diastolic relaxation. Even a small amount of blood return can cause a significant increase in left ventricular diastolic pressure, resulting in pulmonary congestion and decreased exercise tolerance, ultimately leading to heart failure with preserved ejection fraction. HFpEF is often associated with multiple comorbidities such as hypertension, obesity, and diabetes, and its incidence is gradually increasing. Patients with HFpEF often exhibit symptoms such as decreased exercise tolerance, dyspnea, and fatigue, all of which significantly impact their quality of life.

[0005] Currently, there are no specific drugs for treating high-frequency epithelial embolism (HFpEF). Treatment for HFpEF typically involves a multi-dimensional and comprehensive approach. At the lifestyle intervention level, patients are encouraged to control their weight, removing excess fat and reducing the metabolic burden on the heart through a reasonable diet and regular exercise; strict salt restriction is necessary, avoiding high-salt foods to reduce water and sodium retention; and smoking cessation and alcohol limitation are also encouraged to reduce adverse stimuli. Comorbidity management is particularly crucial. Hypertensive patients use angiotensin-converting enzyme inhibitors (ACEIs) and beta-blockers to stabilize blood pressure; diabetic patients rely on oral hypoglycemic agents and insulin for precise blood sugar control; and patients with coronary artery disease require nitrates to dilate coronary arteries, with interventional procedures and bypass surgery necessary to improve blood supply. Medications include diuretics to eliminate volume overload and relieve symptoms; angiotensin receptor-neprilysin inhibitors to regulate neuroendocrine function; and beta-blockers to reduce myocardial oxygen consumption in specific situations. Furthermore, exercise rehabilitation therapy is used to gradually improve exercise endurance, and psychological rehabilitation helps alleviate anxiety and depression.

[0006] The incidence of heart-on-pectoral dysfunction (HFpEF) is gradually increasing. Current treatments for HFpEF include beta-blockers and recently approved diabetes medications such as SGLT2 inhibitors and GLP1 agonists, but these still do not meet the needs for the prevention and treatment of HFpEF. (Application content)

[0007] The applicant of this application, through extensive experiments, unexpectedly discovered that 15-hydroxyprostaglandin dehydrogenase (15-PGDH) can serve as a target for the treatment of HFpEF and / or vasodilatory dysfunction, and based on this, completed this application.

[0008] An embodiment of the first aspect of this application provides the use of a 15-hydroxyprostaglandin dehydrogenase inhibitor (15-PGDH inhibitor) in the preparation of a medicament for the prevention and / or treatment of related diseases, including at least one of heart failure and vasodilatory dysfunction.

[0009] In this article, the term "15-hydroxyprostaglandin dehydrogenase inhibitor" or "15-PGDH inhibitor" refers to substances that can inhibit the activity of 15-PGDH or reduce its expression, including but not limited to compounds, peptides, and polynucleotides. Existing research has shown that 15-PGDH catalyzes the oxidation of the 15(S)-hydroxyl group of prostaglandin, leading to the formation of 15-keto metabolites (with significantly reduced biological activity), and is a key enzyme in the degradation of prostaglandin (PG).

[0010] According to any of the foregoing embodiments of the first aspect of this application, inhibiting the activity of 15-PGDH means inhibiting its degradation of prostaglandin E2 (PGE2); according to any of the foregoing embodiments of the first aspect of this application, inhibiting the activity of 15-PGDH means inhibiting its degradation of prostaglandin I2 (PGI2); according to any of the foregoing embodiments of the first aspect of this application, inhibiting the activity of 15-PGDH means inhibiting its degradation of both PGE2 and PGI2. In this document, PGE2 and / or PGI2 are also referred to as PGE2 / PGI2. Inhibiting the activity of 15-PGDH can inhibit the degradation of PGE2 / PGI2, maintaining or increasing the concentration of PGE2 / PGI2 in vivo.

[0011] According to any of the foregoing embodiments of the first aspect of this application, inhibiting the activity of 15-PGDH means reducing the expression of 15-PGDH thereby reducing its degradation of substrates (e.g., prostaglandins). According to any of the foregoing embodiments of the first aspect of this application, reducing the expression of 15-PGDH is achieved by reducing its mRNA; according to any of the foregoing embodiments of the first aspect of this application, reducing the expression of 15-PGDH is achieved by reducing its protein synthesis.

[0012] The term "heart failure" (HF) also simply referred to as heart failure, has the meaning understood by those of ordinary skill in the art in this article. Heart failure is a clinical syndrome characterized by initial myocardial damage (such as myocardial infarction, excessive hemodynamic load, inflammation, etc.) caused by various reasons, leading to changes in myocardial structure and function, and further resulting in cardiac systolic and diastolic dysfunction, where the blood pumped by the heart cannot meet the tissue requirements. According to the time and speed of the onset of heart failure, it can be divided into chronic heart failure and acute heart failure; according to the left ventricular ejection fraction (LVEF) level examined by echocardiography at the initial assessment of the patient, heart failure can be divided into three basic types: heart failure with reduced ejection fraction (HFrEF) (LVEF ≤ 40%), heart failure with mildly reduced ejection fraction (HFmrEF) (40% < LVEF < 50%), and heart failure with preserved ejection fraction (HFpEF) (LVEF ≥ 50%).

[0013] Heart failure with preserved ejection fraction (HFpEF) is generally considered to be chronic heart failure, and its causes, symptoms, and treatment methods are different from those of acute heart failure. Clinically, the treatment goals of acute heart failure are different from those of chronic heart failure. Acute heart failure requires rapid symptom relief, while chronic heart failure focuses more on long-term disease management. According to the "National Heart Failure Guidelines 2023", when acute heart failure occurs, the most commonly used treatment drugs include diuretics, sodium nitroprusside, positive inotropic drugs, etc. The mechanisms of action of these drugs mainly improve heart failure symptoms by reducing the preload and afterload of the heart, and they are usually not used for the long-term treatment of chronic heart failure. Some drugs used in the treatment of chronic heart failure, such as β-blockers, are usually not used for the initial treatment of acute heart failure because they may exacerbate symptoms of hypotension and reduced cardiac output.

[0014] Current research shows that HFpEF may be triggered when chronic diseases damage the heart and other organ systems of the body, such as HFpEF caused by hypertension, obesity, diabetes, etc.

[0015] In this article, the term "vasodilation dysfunction" refers to a pathological condition in which blood vessels fail to dilate normally to meet the blood perfusion needs of tissues or organs. Vasodilation dysfunction can occur in blood vessels in different locations, such as the coronary arteries, cerebral arteries, renal arteries, limb arteries, extremities, and microvessels in organs such as the eyes and kidneys. Corresponding vasodilation dysfunctions include coronary artery vasodilation dysfunction, cerebral artery vasodilation dysfunction, renal artery vasodilation dysfunction, limb artery vasodilation dysfunction, and diabetic vascular disease. Diseases associated with vasodilation dysfunction include high-frequency epithelial embolism (HFpEF), myocardial infarction, coronary heart disease, coronary microvascular disease, non-coronary obstructive ischemic cardiomyopathy, non-obstructive coronary myocardial infarction, diabetic cardiomyopathy, coronary microvascular spasm, hypertensive cardiomyopathy and coronary artery spasmodic angina, ischemic stroke, transient ischemic attack, peripheral artery disease, diabetic retinopathy, diabetic nephropathy, cerebral and nervous system microvascular diseases, and other microvascular diseases. Vasodilatory dysfunction is also a typical characteristic of aging. Improving vasodilatory dysfunction can delay vascular aging and overall aging, and prevent various age-related diseases.

[0016] According to any of the foregoing embodiments of the first aspect of this application, symptoms of vasodilatory dysfunction exist in vascular aging; symptoms of vasodilatory dysfunction exist in an aging body; symptoms of vasodilatory dysfunction exist in aging-related organs.

[0017] According to any of the foregoing embodiments of the first aspect of this application, the 15-PGDH inhibitor is used to prepare a drug for the prevention and / or treatment of heart failure, such as the prevention and / or treatment of HFpEF. According to any of the foregoing embodiments of the first aspect of this application, the 15-PGDH inhibitor is used to prepare a drug for the prevention and / or treatment of symptoms of vasodilatory dysfunction, such as the prevention and / or treatment of coronary artery vasodilatory dysfunction, femoral artery vasodilatory dysfunction, etc.

[0018] According to any of the foregoing embodiments of the first aspect of this application, the 15-PGDH inhibitor may be SW033291, (+)-SW209415, SW222746, AZD2423, nafazatrom, ML147 (CID-3245059), ML148 (CID-3243760), ML149 (CID-2331284), HW201877, MF-300, 15-PGDH-IN-1, MF-PGDH-008, (R)-SW033291, 15-PGDH-IN-4, 15-PGDH-IN-3, 15-PGDH-IN-2, 15-PGDH-IN-1, 15-epi-PGE1, etc. Other 15-PGDH inhibitors known in the prior art are also applicable to this application, for example, they can be obtained by referring to the website https: / / www.medchemexpress.cn / Targets / 15-PGDH.html.

[0019] The chemical name of SW033291 is 2-(butylsulfinyl)-4-phenyl-6-(2-thienyl)thieno[2,3-b]pyridine-3-amine, and the CAS number is 459147-39-8. (R)-SW033291 is the chiral molecule of SW033291.

[0020] The chemical name of AZD2423 is 4-[(2R)-4-tert-butylpiperazine-2-carbonyl]-N-(4-chloro-3-fluorophenyl)piperazine-1-carboxamide, and the CAS number is 1229603-37-5.

[0021] Nafazatrom has the chemical name 5-methyl-2-(2-naphthyl-2-oxyethyl)-4H-pyrazole-3-one and the CAS number 59040-30-1.

[0022] The chemical name of ML147 (CID-3245059) is 5-(2-amino-4-chloro-5-benzenesulfonamide)-1H-tetrazole, and the CAS number is 82212-14-4.

[0023] The chemical name of ML148 (CID-3243760) is 1-(3-methylphenyl)-1H-benzimidazol-5-yl-1-piperidinemethyl ketone, and the CAS number is 451496-96-1.

[0024] The chemical name of ML149 (CID-2331284) is 4-[(2R)-2-(4-chlorophenyl)-4,5-dihydro-1H-imidazol-5-yl]-N-(4-fluorophenyl)butyramide, and the CAS number is 1143-44-6.

[0025] The chemical name of 15-PGDH-IN-1 is 4-[(1R,3S)-3-({6-[4-(trifluoromethyl)phenyl]thiopheno[3,2-d]pyrimidin-4-yl}amino)cyclohexyl]benzoic acid, and the CAS number is 2247233-21-4.

[0026] The chemical name of 15-epi-PGE1 is 15-epio-prostaglandin E1 ((15R)-prostaglandin E1), and the CAS number is 23433-05-8.

[0027] According to any of the foregoing embodiments of the first aspect of this application, the 15-hydroxyprostaglandin dehydrogenase inhibitor is a ribonucleic acid (RNA) agent that targets 15-hydroxyprostaglandin dehydrogenase mRNA, such as small interfering RNA.

[0028] According to any of the foregoing embodiments of the first aspect of this application, the 15-PGDH inhibitor is an amino acid sequence that targets the structure of the 15-hydroxyprostaglandin dehydrogenase protein.

[0029] An embodiment of the second aspect of this application provides a method for treating, preventing, and / or treating related diseases, comprising administering a 15-PGDH inhibitor to a subject in need of such treatment, the related diseases including at least one of heart failure and vasodilatory dysfunction.

[0030] According to any of the foregoing embodiments of the second aspect of this application, the 15-PGDH inhibitor inhibits the activity of 15-PGDH or reduces the expression of 15-PGDH.

[0031] According to any of the foregoing embodiments of the second aspect of this application, the 15-PGDH inhibitor increases the levels of prostaglandin E2 (PGE2) and / or prostaglandin I2 (PGI2).

[0032] According to any of the foregoing embodiments of the second aspect of this application, heart failure is HFpEF.

[0033] According to any of the foregoing embodiments of the second aspect of this application, the 15-PGDH inhibitor increases the blood circulation perfusion of the subject; according to any of the foregoing embodiments of the second aspect of this application, the 15-PGDH inhibitor prevents or reduces cardiac remodeling in the subject.

[0034] According to any of the foregoing embodiments of the second aspect of this application, symptoms of vasodilatory dysfunction exist in diseases selected from the following: HFpEF, myocardial infarction, coronary heart disease, coronary microvascular disease, non-coronary occlusive ischemic cardiomyopathy (INOCA), non-obstructive coronary myocardial infarction (MINOCA), diabetic cardiomyopathy, coronary microvascular spasm, hypertensive cardiomyopathy, coronary artery spasmodic angina, ischemic stroke, peripheral vascular disease, diabetic retinopathy, diabetic nephropathy, cerebral and nervous system microvascular diseases, and other microvascular diseases.

[0035] According to any of the foregoing embodiments of the second aspect of this application, symptoms of vasodilatory dysfunction exist in vascular aging; symptoms of vasodilatory dysfunction exist in an aging body; symptoms of vasodilatory dysfunction exist in aging-related organs.

[0036] According to any of the foregoing embodiments of the second aspect of this application, the 15-PGDH inhibitor is selected from SW033291, (+)-SW209415, SW222746, AZD2423, nafazatrom, ML147 (CID-3245059), ML148 (CID-3243760), ML149 (CID-2331284), HW201877, MF-300, 15-PGDH-IN-1, MF-PGDH-008, (R)-SW033291, 15-PGDH-IN-4, 15-PGDH-IN-3, 15-PGDH-IN-2, 15-PGDH-IN-1, and 15-epi-PGE1.

[0037] According to any of the foregoing embodiments of the second aspect of this application, the 15-PGDH inhibitor is a ribonucleic acid (RNA) agent that targets 15-hydroxyprostaglandin dehydrogenase mRNA.

[0038] According to any of the foregoing embodiments of the second aspect of this application, the ribonucleic acid agent is small interfering RNA (siRNA).

[0039] According to any of the foregoing embodiments of the second aspect of this application, the 15-PGDH inhibitor is an amino acid sequence that targets the structure of the 15-hydroxyprostaglandin dehydrogenase protein.

[0040] The term "cardiac remodeling" refers to changes in the size or shape of the heart that occur due to heart disease or injury. Adverse cardiac remodeling is generally considered a determinant of the clinical course of heart failure. In patients with heart failure with post-extension ejection fraction (HFpEF), some exhibit concentric hypertrophy of the myocardium, with normal or near-normal left ventricular size, but increased left ventricular mass or relative thickening of the ventricular wall.

[0041] An embodiment of the third aspect of this application provides a method for identifying a therapeutic agent for a relevant disease, comprising: contacting a candidate reagent with 15-PGDH; determining the activity of the 15-PGDH; wherein the relevant disease includes at least one of heart failure and vasomotor dysfunction; the activity of 15-PGDH refers to the activity of 15-PGDH in degrading PGE2 and / or PGI2, or the expression level of 15-PGDH; and in the case of reduced 15-PGDH activity, the candidate reagent is identified as a therapeutic agent for heart failure and / or coronary vasomotor dysfunction.

[0042] According to any of the foregoing embodiments of the third aspect of this application, the method is performed in vitro; according to any of the foregoing embodiments of the third aspect of this application, the contact between the candidate reagent and the 15-PGDH is performed in a cell-free system; according to any of the foregoing embodiments of the third aspect of this application, the contact between the candidate reagent and 15-PGDH is performed by contacting the candidate reagent with cells expressing 15-PGDH.

[0043] Embodiments of the fourth aspect of this application provide a method for treating, preventing, and / or treating related diseases, comprising administering to a subject in need an activator capable of increasing PGE2 and / or PGI2 levels; the related diseases include at least one of heart failure and vasodilatory dysfunction. According to any of the foregoing embodiments of the fourth aspect of this application, the activator is PTGES (prostaglandin Esynthase) and / or PTGIS (prostaglandin I2 synthase). According to any of the foregoing embodiments of the fourth aspect of this application, the activator is an expression vector carrying an expression vector encoding the PTGES protein; according to any of the foregoing embodiments of the fourth aspect of this application, the activator is an expression vector carrying an expression vector encoding the PTGIS protein; according to any of the foregoing embodiments of the fourth aspect of this application, the activator is an expression vector carrying both PTGES and PTGIS proteins. According to any of the foregoing embodiments of the fourth aspect of this application, the vector is a viral vector, such as an AAV (Adeno-associated virus) vector.

[0044] In this application, different implementation schemes can be combined according to actual needs to achieve the purpose of this application. Attached Figure Description

[0045] Figure 1 shows the improvement of cardiac function in HFpEF mice by inhibiting 15-PGDH. A, Mouse heart rate statistics; B, Mouse ejection fraction statistics; C, Statistics on the ratio of peak diastolic velocity through the mitral valve to peak diastolic velocity at the root of the mitral valve annulus (E / E'); D, Statistics on left ventricular myocardial weight; E, Statistics on hind limb blood perfusion in mice; F, Statistics on cardiac blood perfusion in mice; G, Levels of PGE2 metabolite (PGE-M) in the urine of HFpEF mice.

[0046] Figure 2 shows that overexpression of mPTGES-1 / PTGIS significantly improved heart failure symptoms in patients with high heart failure (HFpEF). A, Ejection fraction statistics in mice; B, Ratio of peak diastolic velocity through the mitral valve to peak diastolic velocity at the root of the mitral valve annulus in mice (E / E'); C, Myocardial work index statistics; D, Ratio of heart weight to body weight in mice; E, Myocardial perfusion statistics in mice; F, Running distance statistics in mice; G, Ratio of lung weight to body weight in mice; H, Diastolic curves of coronary arteries in mice dependent on acetylcholine concentration; I, Diastolic curves of femoral arteries in mice dependent on acetylcholine concentration; J, Diastolic curves of coronary arteries in mice dependent on nitroprusside concentration; K, Diastolic curves of femoral arteries in mice dependent on nitroprusside concentration.

[0047] Figure 3 shows the exacerbation of heart failure symptoms in mice with the mPTGES-1 and PTGIS gene knockout model of HFpEF. A, mouse ejection fraction statistics; B, ratio of peak diastolic velocity through the mitral valve to peak diastolic velocity at the root of the mitral annulus (E / E'); C, ratio of heart weight to body weight; D, running distance; E, wet-to-dry weight ratio of lungs; F, cardiac perfusion statistics; G, ejection fraction statistics; H, ratio of peak diastolic velocity through the mitral valve to peak diastolic velocity at the root of the mitral annulus (E / E'); I, heart weight to body weight; J, running distance; K, wet weight of lungs; L, cardiac perfusion statistics.

[0048] Figure 4 shows the genotyping results of 15-PGDH gene knockout mice. A, Schematic diagram of DNA molecular weight standards; B, Electrophoresis diagram of PCR amplification products. Among them, mice 1, 5, and 6 are gene knockout positive mice, WT is a wild-type mouse, Water is a negative control, and M is a DNA molecular weight standard.

[0049] Figure 5 shows the phenotype of HFpEF mice improved by knocking out the HPGD gene. A, Ejection fraction statistics; B, Ratio of peak diastolic velocity through the mitral valve to diastolic velocity at the mitral valve annulus root (E / E'); C, Corrected left ventricular myocardial weight; D, Running distance of mice in the exercise fatigue test; E, Results of the intraperitoneal glucose tolerance test; F, Quantification of the area under the curve of the intraperitoneal glucose tolerance test results. Statistical methods: Unpaired Student's ttest (AC, F, n = 6-12 mice / group) and Mann-Whitney's test (D, n = 6) were used for intergroup comparisons. Data are presented as mean ± SEM, *P < 0.05, **P < 0.01.

[0050] Figure 6 shows the results of 15-PGDH transcription detection in human microvascular endothelial cells after transfection with interfering RNA.

[0051] Figure 7 shows the results of cardiac function testing in mice. A, ejection fraction statistics in mice; B, the ratio of peak diastolic velocity through the mitral valve to diastolic velocity at the root of the mitral valve annulus (E / E); the statistical method was: Unpaired Student's t-test was used between groups, ns indicates no statistical difference between the two groups, n = 9 mice / group.

[0052] Figure 8 shows the results of cardiac function testing in mice. A, ejection fraction statistics; B, the ratio of peak diastolic velocity through the mitral valve to the diastolic velocity at the root of the mitral valve annulus (E / E); the statistical method was: Unpaired Student's t-test between groups. n = 9-12 mice. Detailed Implementation

[0053] Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art.

[0054] Although the numerical ranges and parameter approximations shown in the broad scope of this application are intended to be as accurate as possible in the specific embodiments, any numerical value inherently contains a certain degree of error due to the standard deviation present in their respective measurements. Furthermore, all ranges disclosed herein should be understood to encompass any and all subranges contained therein. For example, the stated range “1 to 10” should be considered to include any and all subranges between the minimum value 1 and the maximum value 10 (inclusive); that is, all subranges beginning with a minimum value of 1 or greater, such as 1 to 6.1, and subranges ending with a maximum value of 10 or less, such as 5.5 to 10. Additionally, any references marked “incorporated herein” should be understood to be incorporated herein in their entirety.

[0055] It should also be noted that, as used herein, the singular form includes the plural form of the object it refers to, unless it is clearly and explicitly limited to a single object. The term "or" may be used interchangeably with the term "and / or" unless the context clearly indicates otherwise.

[0056] The term "object" as used in this article refers to mammals, such as humans, but can also be other animals, such as wild animals (e.g., herons, storks, cranes, etc.), livestock (e.g., ducks, geese, etc.) or laboratory animals (e.g., chimpanzees, monkeys, rats, mice, rabbits, guinea pigs, marmots, ground squirrels, etc.).

[0057] Example

[0058] The following specific embodiments further illustrate some preferred implementation methods and aspects of this application, which should not be construed as limiting its scope. Materials and Methods

[0059] 1. Materials

[0060] 1.1 Source and processing of laboratory animals or materials

[0061] Animals: C57BL / 6J mice were obtained from Beijing HFK Biotechnology Co., Ltd.; mPTGES-1 gene knockout mice (ES KO) and conditional PTGIS gene knockout mice (PTGIS) were also used. f / f The CAG-Cre tool mice, 15-PGDH gene knockout mice, and conditional 15-PGDH gene knockout mice were obtained from Cyagen Biosciences (Guangdong, China).

[0062] Conditional PTGIS knockout mice were crossed with CAG-Cre tool mice to obtain tamoxifen-induced PTGIS knockout mice (PTGIS). f / f CAG Cre Conditional 15-PGDH knockout mice were crossed with CAG-Cre tool mice to obtain tamoxifen-induced PTGIS knockout mice (PGDH). f / f CAG Cre ).

[0063] Eight-week-old male mice were fed a high-fat diet and treated with L-NAME drinking water (concentration of 0.5 g / L) to induce the development of heart failure phenotypes with preserved ejection fraction. After induction, diastolic function, motor function, and pulmonary congestion were evaluated.

[0064] 1.2 Medicines and reagents:

[0065] The high-fat feed D12492 (60% fat content) was purchased from Beijing Huafukang Biotechnology Co., Ltd.

[0066] N G -nitro- L - Arginine methyl ester (L-NAME, dissolved in water, 0.5 g / L) was purchased from Sigma Aldrich, USA;

[0067] Isoflurane was purchased from Shenzhen Ruiwode Life Technology Co., Ltd.

[0068] Tamoxifen (soluble in sunflower seed oil, 10 mg / mL) was purchased from Sigma-Aldrich, USA.

[0069] Sodium pentobarbital (P-3761, 80 mg / kg) was purchased from Sigma Aldrich, USA.

[0070] Indomethacin (Indo, intraperitoneal injection, 2 mg / kg daily), SW033291 (15-PGDH inhibitor, intraperitoneal injection, 10 mg / kg daily), acetylcholine (ACh) or sodium nitroprusside (SNP) were purchased from MedChemExpress (MCE) in the United States.

[0071] U-46619 was purchased from Cayman Company in the United States;

[0072] PTGIS overexpression virus, mPTGES-1 overexpression virus and their control virus were purchased from Cyagen (Guangzhou) Biotechnology Co., Ltd.

[0073] The PCR reaction kit (Taq DNA polymerase, Vazyme, P131) was purchased from Nanjing Novozymes Biotechnology Co., Ltd. (Vazyme International LLC).

[0074] The remaining chemical reagents, NaCl, KCl, CaCl2, MgSO4, KH2PO4, NaHCO3, NaOH, Tris, and glucose, were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0075] 1.3 Instruments

[0076] The Vevo2100 small animal ultrasound imaging system was purchased from VisualSonics, Canada.

[0077] The small animal gas anesthesia machine was purchased from Shanghai Yuyan Scientific Instruments Co., Ltd.

[0078] The small animal ventilator was purchased from Shanghai Alcot Biotechnology Co., Ltd.

[0079] The FT-200 small animal treadmill was purchased from Chengdu Taimeng Software Co., Ltd.

[0080] The PeriCam PSI laser Doppler blood flow detector system was purchased from Perimed, Sweden.

[0081] The Zeiss Stemi-305 stereomicroscope was purchased from Zeiss GmbH, Germany.

[0082] The 620M microvascular tension meter was purchased from DMT, Denmark.

[0083] 2. Experimental Methods

[0084] 2.1 Echocardiography of mice

[0085] The cardiac function of mice was assessed by ultrasound, and the following cardiac function indicators were collected: ejection fraction, fractional shortening, the ratio of early filling wave (e wave) to late filling wave (e' wave) in the left atrium and left ventricle (E / E'), left ventricular myocardial mass (LV Mass AW), Teiindex, and coronary flow reserve (CFR).

[0086] Transthoracic echocardiography was performed on mice using a small animal ultrasound system equipped with an MS-400 probe and a Vevo 2100 system. Mice were shaved the day before the experiment. On the day of the experiment, mice were anesthetized by inhaling isoflurane gas. Ventricular structure was obtained and ejection fraction was calculated using short-axis M-mode scanning at the ventricular level. Diastolic function was measured using pulsed wave and mitral valve tissue Doppler imaging. All mice recovered from anesthesia without difficulty at the end of the ultrasound examination. All parameters were measured at least three times and averaged.

[0087] Coronary flow reserve (CFR) acquisition: Blood flow velocity in the proximal left coronary artery was measured using Doppler ultrasound under conditions of 1.5% (baseline) and 3.0% (congestion) isoflurane in mice. CFR is expressed as the ratio of peak blood flow velocity at congestion to peak blood flow velocity at baseline.

[0088] 2.2 Exercise fatigue test

[0089] Mice were placed on a FT-200 small animal treadmill with a 10-degree incline and warmed up for 4 minutes at a speed of 4 meters per minute. Starting at a speed of 14 meters per minute, the speed was increased by 2 meters per minute every 2 minutes until the mice reached a state of fatigue. (Fatigue was defined as the mouse not returning to the track within 10 seconds of receiving an electric shock). All mice underwent three days of running training before the formal start of this experiment.

[0090] 2.3 Detection of pulmonary edema

[0091] After anesthetizing the mice, all lung lobes were removed, other tissues were removed, the wet weight was recorded, and the mice were placed in a 60-degree oven to dry for more than 48 hours. The mice were then removed, weighed, and their weight was calculated.

[0092] 2.4 Laser Doppler flowmeter for detecting blood perfusion

[0093] Mice were first anesthetized via intraperitoneal injection of 1% sodium pentobarbital (80 mg / kg), and the depth of anesthesia was confirmed by stimulating the paw pads. PeriCam PSI laser Doppler flowmeter was used to detect blood perfusion in the heart or lower limb microcirculation of HFpEF mice. When measuring mice in different experimental groups, the size and relative position of the sampling area were kept constant, and the ambient temperature was kept constant. Blood flow in the detection area was monitored for 30 seconds using laser Doppler, and the average blood flow was recorded. Finally, the data were statistically analyzed.

[0094] Cardiac perfusion assay: Anesthetized mice were fixed in a supine position, endotracheally intubated, and immediately connected to a ventilator for ventilation. The chest rise and fall were observed to match the ventilator frequency. Next, the skin of the mouse's chest was cut open, the pectoral muscles were bluntly dissected, the fourth intercostal space on both sides of the sternum was cut, and then 2-4 ribs on each side were removed, along with the anterior chest wall, to fully expose the heart. Laser Doppler was used to measure the exposed heart.

[0095] Lower limb blood perfusion assay: Hair removal was performed on the lower limbs of mice one day in advance. Anesthetized mice were fixed in a supine position with the paws facing down. Laser Doppler was used to measure the blood flow in the thigh and toe areas of the lower limbs.

[0096] 2.5 Ex vivo blood vessel tension detection

[0097] 2.5.1 Isolation of mouse blood vessels

[0098] Mice were first anesthetized via intraperitoneal injection with 1% sodium pentobarbital (80 mg / kg). The hearts were then removed and placed in pre-cooled Krebs buffer (118.3 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.2 mM MgSO4, 1.2 mM KH2PO4, 25 mM NaHCO3, 11.1 mM glucose). Under a stereomicroscope, a segment of the main coronary artery was carefully dissected from the aortic root. The perivascular myocardium or connective tissue was carefully removed, and the segments were cut into pieces approximately 2 mm long for vascular tension testing. Similarly, under a stereomicroscope, a segment of the main femoral artery in the mouse thigh was carefully dissected, and the perivascular muscle tissue was carefully removed, and the segments were cut into pieces approximately 2 mm long for vascular tension testing.

[0099] Two tungsten wires with a diameter of 25 μm were inserted into the aforementioned 2 mm long blood vessel, and the blood vessel was fixed in the reaction tank of the 620M microvascular tension detector. 5 mL of Krebs buffer solution was added to the reaction tank, the temperature was set to 37 °C, and binary gas (95% O2-5% CO2) was introduced to allow the blood vessel to balance for 30 minutes with an initial tension of 0.

[0100] Detecting vasodilatory function

[0101] Apply an initial tension of approximately 1-1.8 mN to the blood vessel. After the blood vessel has reached equilibrium for 10 minutes, stimulate arterial contraction with a 60 mM KCl solution. After 10 minutes, wash away the KCl solution from the reaction tank and allow the blood vessel to reach equilibrium again for 10 minutes.

[0102] A vasoconstrictor (100 nM U-46619) was added to the reaction tank to stimulate vasoconstriction. Then, acetylcholine (ACh) or sodium nitroprusside (SNP) of different gradient concentrations were added sequentially at the same time intervals to induce vasodilation. The vascular tension corresponding to each concentration was recorded.

[0103] 2.6 Liquid Chromatography-Tandem Mass Spectrometry Analysis

[0104] Mouse urine was collected, and the supernatant was obtained by centrifugation. The sample was then injected into a liquid chromatograph for separation. The separated components were then introduced into a mass spectrometer, ionized, and analyzed according to their mass-to-charge ratio in a mass analyzer. Finally, the data were processed and analyzed to determine the composition.

[0105] 2.7 Intraperitoneal glucose tolerance test

[0106] After fasting for 16 hours, the tip of the mouse's tail was clipped by 1 mm, and the first blood glucose drop was discarded. The second drop was aspirated onto a test strip, and fasting blood glucose was recorded. Then, a 20% glucose solution was injected intraperitoneally at a dose of 2 g / kg. Blood glucose was measured at the tail tip at 15, 30, 45, 60, and 120 minutes, and the area under the blood glucose curve from 0 to 120 minutes was calculated. Commercially available blood glucose meters and test strips were used for blood glucose testing.

[0107] 2.8 RT-qPCR Validation

[0108] Total RNA extraction using the TRIzol method (Invitrogen), PrimeScript TM RT Master Mix (TaKaRa) was reverse transcribed into cDNA, and qPCR was performed using the SYBR Green method (Yeasen). GAPDH was used as an internal control, and the relative expression level was calculated using the 2-ΔΔCt method. The primer sequences (5'-3') were: upstream primer GGTTGTCTCCTGCGACTTCA for GAPDH, and downstream primer GGTGGTCCAGGGTTTCTTACTC for 15-PGDH. Upstream primer AGTGCGATGTGGCTGACC for 15-PGDH, and downstream primer TAATGATGCCGCCTTCACCT for 15-PGDH. Example 1: Cardioprotective effect of 15-PGDH inhibitor in a mouse HFpEF model.

[0109] The inventors discovered that when HFpEF model mice were treated with 15-PGDH inhibitors, the 15-PGDH inhibitors exhibited cardioprotective effects.

[0110] Eight-week-old C57BL / 6J mice were fed a high-fat diet and treated with L-NAME drinking water (concentration 0.5 g / L) to induce the phenotype of heart failure with preserved ejection fraction (Reference: Schiattatarella GG, Altamirano F, Tong D, et al. Nitrosative stress drives heart failure with preserved ejection fraction. Nature. 2019; 568(7752):351-356). At week 8 of induction, mice were intraperitoneally injected with SW033291 (SW group) to inhibit the degradation of PGE2 and PGI2, 10 mg / kg, once a day. The control group was intraperitoneally injected with an equal volume of DMSO (Veh group). The experiment was terminated after 5 weeks of treatment, and the mice were evaluated for cardiac function, blood perfusion and other indicators. After the evaluation, the mice were sacrificed, and data such as mouse body weight, heart weight, lung dry and wet weight were collected. Finally, the coronary arteries and femoral arteries of the mice were separated for vascular tension detection (see Experimental Method 2.5).

[0111] SW033291 (also abbreviated as SW in this article) is a known 15-PGDH inhibitor that can prevent 15-PGDH from converting PGE2 / PGI2 and its derivatives into inactive metabolites (Reference: Kim, Hye Jung et al. “Inhibition of 15-PGDH prevents ischemic renal injury by the PGE2 / EP4 signaling pathway mediating vasodilation, increased renal blood flow, and increased adenosine / A2A receptors.” American journal of physiology. Renal physiology vol.319,6(2020):F1054-F1066. doi:10.1152 / ajprenal.00103.2020).

[0112] The results showed that injection of SW033291 (abbreviated as SW) did not affect the heart rate of HFpEF model mice (Figure 1A) or the ejection function of the ventricles (Figure 1B). E / E' is an indicator of cardiac diastolic function; a higher ratio indicates more severe diastolic dysfunction. Compared with the Veh group, the E / E' of the SW group decreased, indicating that SW significantly improved cardiac diastolic function in HFpEF model mice (Figure 1C). Left ventricular myocardial weight is an indicator of cardiac hypertrophy (proliferation); the left ventricular myocardial weight in the SW group was less than that in the Veh group (Figure 1D), indicating that SW reduced cardiac remodeling in HFpEF model mice. SW treatment also improved blood perfusion in the heart and lower limbs of mice (Figures 1E-1F); higher blood perfusion in the heart and lower limbs indicated a more significant therapeutic effect in improving microcirculatory disturbances. These results indicate that the 15-PGDH inhibitor SW033291 can improve diastolic function, increase blood perfusion, and reduce cardiac remodeling in mice with heart failure with preserved ejection fraction, thus playing a role in treating heart failure and protecting cardiac function.

[0113] In this example, mouse urine was collected at week 5 of treatment. Liquid chromatography-tandem mass spectrometry analysis revealed that SW033291 treatment significantly increased PGE2 levels in the urine of HFpEF mice (Figure 1G). Example 2: Increasing PGE2 / PGI2 levels improves cardiac function in HFpEF model mice.

[0114] PTGES (prostaglandin E synthase) catalyzes the conversion of PGH2 to PGE2, while PTGIS (prostaglandin I2 synthase) catalyzes the conversion of PGH2 to PGI2. The mouse model results in this example show that overexpression of mPTGES-1 / PTGIS significantly improves cardiac function in HFpEF model mice. mPGES-1 (microsomal Prostaglandin E Synthase-1) is an isoenzyme in the PTGES family and participates in the synthesis of prostaglandin E2.

[0115] Eight-week-old male C57BL / 6J mice were fed a high-fat diet and treated with L-NAME in drinking water (concentration 0.5 g / L) to induce the phenotype of heart failure with preserved ejection fraction. The control group consisted of mice fed a normal diet and water. Groups). Preventive treatment involved injecting mice via the medial canthal vein one week prior to disease induction with PTGIS-overexpressing virus (ISP group), mPTGES-1-overexpressing virus (ESP group), and control virus (VP ​​group). Mice that did not develop the disease phenotype of heart failure with preserved ejection fraction were included in the control group. Group 1 consisted of healthy mice.

[0116] Treatment involved injecting mice with PTGIS-overexpressing virus (IST group) and mPTGES-1-overexpressing virus (EST group) via the medial canthal vein 7 weeks after disease induction. The viral dose for both groups was 1×10⁻⁶. 11 GC. The purpose of injecting the virus is to increase the production of PGI2 and PGE2 by overexpressing PTGIS and mPTGES-1, respectively.

[0117] After 15 weeks of induction, phenotypic evaluations were performed on mice, including diastolic function, motor function, pulmonary congestion, and cardiac perfusion. Following the evaluation, mice were euthanized, and their body weight, heart weight, and lung dry and wet weights were collected. Finally, the coronary and femoral arteries were separated for vascular tension testing.

[0118] The results are shown in Figure 2. Injection of the virus in this embodiment did not affect cardiac ejection function in the HFpEF model mice (Figure 2A). Compared to the control group, the HFpEF model mice in the VP group showed increased E / E' ratio and myocardial work index (Figures 2B-2C), indicating impaired diastolic function. A higher E / E' ratio indicates more severe diastolic dysfunction, and the Tei index is also a method for assessing diastolic function. The heart-to-body ratio in the HFpEF model mice in the VP group was significantly increased (Figure 2D), indicating cardiac remodeling. Decreased cardiac blood perfusion in the HFpEF model mice in the VP group (Figure 2E) led to insufficient blood supply to the heart. The shortened running distance in the HFpEF model mice in the VP group (Figure 2F) is also a manifestation of heart failure, indicating decreased cardiopulmonary function. An increased lung wet weight to body weight ratio (Figure 2G) and the presence of pulmonary edema indicate successful induction of heart failure with preserved ejection fraction (HFFF) in the experimental mice, demonstrating typical phenotypic characteristics of HFFF. The results of comparing the PTGIS-overexpressing virus group (ISP and IST) and the mPTGES-1-overexpressing virus group (ESP and EST) with the VP group showed that both upregulation of PTGIS or mPTGES-1 during prevention and treatment could alleviate cardiac diastolic dysfunction (Fig. 2B-C) and cardiac remodeling (Fig. 2D) in HFpEF model mice, increase cardiac blood supply (Fig. 2E) and cardiopulmonary function (Fig. 2D), and reduce pulmonary edema (Fig. 2G).

[0119] Vascular tension analysis of the isolated vessels revealed that, compared to the VP group, the PTGIS overexpressing virus groups (ISP and IST) and mPTGES-1 overexpressing virus groups (ESP and EST) exhibited greater acetylcholine-dependent vasodilation (Figures 2H-2I), but the nitroprusside-dependent vasodilation remained unchanged (Figures 2J-2K). This indicates that upregulation of PTGIS or mPTGES-1 during both preventative and therapeutic phases improves endothelium-dependent vasodilation in mice. Acetylcholine (Ach) treatment induces endothelium-dependent vasodilation, while nitroprusside (SNP) treatment induces non-endothelium-dependent vasodilation. Figures 2H-2I illustrate that overexpression of PTGIS and mPTGES-1 significantly improves endothelium-dependent vasodilation dysfunction in the coronary and femoral arteries without affecting non-endothelium-dependent vasodilation. Example 3: Reduced PGE2 / PGI2 levels exacerbated heart failure symptoms in mice with the HFpEF model.

[0120] Eight-week-old male C57BL / 6J mice (WT) and mPTGES-1 knockout mice (ES KO), and conditional PTGIS knockout mice (PTGIS) were used. f / f CAG Cre ) and its control mice (PTGIS) f / fMice were fed a high-fat diet and received L-NAME drinking water (0.5 g / L) for 15 weeks to induce the phenotype of heart failure with preserved ejection fraction. After 7 weeks of treatment, conditional PTGIS knockout mice and control mice were intraperitoneally injected with tamoxifen 30 mg / kg for 3 consecutive days, followed by a 3-day break, and then another 3-day injection, which was repeated every 4 weeks thereafter. The aim was to induce PTGIS gene knockdown in conditional PTGIS knockout mice. The phenotypes of diastolic function, motor function, pulmonary edema, and cardiac perfusion were evaluated in the mice after 15 weeks of treatment. After the evaluation, the mice were sacrificed, and their body weight, heart weight, and lung dry and wet weight were collected. Finally, the coronary arteries and femoral arteries were isolated for vascular tension measurement.

[0121] The results are shown in Figure 3. During the HFpEF model induction process, compared with the control group (ES KO vs. WT; PTGIS) f / f CAG Cre Compared to PTGIS f / f Neither mPTGES-1 gene knockout nor PTGIS gene knockdown affected cardiac ejection function in mice (Fig. 3A, 3G), but weakened diastolic function (Fig. 3B, 3H), increased cardiac hypertrophy (Fig. 3D, 3E), reduced cardiopulmonary function, shortened running distance (Fig. 3C, 3I), increased pulmonary edema (Fig. 3J, 3K), and reduced cardiac blood supply (Fig. 3F, 3L). This indicates that inhibiting mPTGES-1 and PTGIS gene expression worsens cardiac and pulmonary function in mice with heart failure preserving ejection fraction. Example 4: Identification and cardiac function testing of 15-PGDH gene knockout mice.

[0122] 15-PGDH knockout mice and conditional 15-PGDH knockout mice were obtained from Cyagen Biosciences (Guangdong, China).

[0123] Ten-day-old mice were selected, and a 2 mm long tail tissue was cut from the tail end and placed in 40 mM NaOH solution at 100℃. After 10 minutes, Tris solution at pH 5.5 was added for neutralization. 1 μL of lysis buffer was used for PCR identification. Primer 1: 5'-GAGCTTCTAGTTGAGATGCTCAC-3', primer 2: 5'-ATGTACTTGACACTGCTGCTTTG-3'. Positive band length: 404 bp, wild-type band length: 1728 bp. The PCR reaction system was prepared according to the PCR reaction kit (Vazyme, P131). The PCR reaction conditions were: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 72℃ extension for 2 minutes, for 35 cycles. The products were detected by agarose gel electrophoresis (Figure 4). Example 5: Cardioprotective effect of 15-PGDH gene inhibition in mouse HFpEF model.

[0124] Eight-week-old wild-type C57BL / 6J mice (WT group) and 15-PGDH gene knockout mice (HPGD KO) were fed a high-fat diet and treated with L-NAME drinking water (concentration of 0.5 g / L) to induce the phenotype of heart failure with preserved ejection fraction (HFpEF). Cardiac function was assessed in the mice at week 8. Results showed that the genetic deletion of the HPGD gene did not affect the ejection fraction of HFpEF mice (Fig. 5A), significantly improved diastolic dysfunction (Fig. 5B), and reduced the cardiac hypertrophy index (Fig. 5C). Furthermore, compared with the WT group, the HPGD KO group showed a significantly increased running distance (Fig. 5D). Metabolic function was further assessed using an intraperitoneal glucose tolerance test. Results showed that HPGD gene deletion did not affect glucose tolerance in the HFpEF model group mice (Fig. 5E, F). These results indicate that the absence of the HPGD gene significantly improved the HFpEF phenotype in mice without affecting glucose tolerance. Example 6: Cardioprotective effect of 15-PGDH inhibitor in mouse HFpEF model

[0125] The inventors downloaded the human 15-PGDH mRNA sequence (accession number NM_000860.6) from the global public database of nucleic acid sequences (NCBI https: / / www.ncbi.nlm.nih.gov / nucleotide / ) and the mouse 15-PGDH mRNA sequence (accession number NM_008278.2). These two sequences were aligned online (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to obtain the conserved positions of the human and mouse 15-PGDH coding genes. Three siRNA sequences were designed targeting these conserved positions: siRNA1 (GCACGUGAACGGCAAAGUG), siRNA2 (GUUUGGAUUACAUGAGUAA), and siRNA3 (GGAUUCACACGCUCAGCAG). The three siRNAs and their complementary sequences were synthesized by Tsingke Biotech Co., Ltd. A negative control siRNA (si-NC) was ordered from Tsingke Biotech Co., Ltd. (Beijing, China). Through transfection reagent (Lipofectamine) TM RNAiMAX (13778030, Thermo Fisher Scientific Inc, USA) delivered siRNA into human cardiac microvascular endothelial cells. Forty-eight hours post-transfection, cells were collected and processed using RNA extraction reagent (TRIzol). TM Total RNA was extracted from cells at Thermo Fisher Scientific Inc., USA (15596026CN). Transcriptional changes of the 15-PGDH gene were analyzed using qPCR. Results showed that siRNA1 and siRNA2 significantly inhibited 15-PGDH gene transcription (Figure 6). siRNA1 and si-NC were packaged into AAV viruses to obtain AAV viruses carrying siRNA sequences. Virus packaging was performed by Cyagen Biosciences (Guangdong, China).

[0126] Eight-week-old C57BL / 6J mice were fed a high-fat diet and treated with L-NAME drinking water (concentration 0.5 g / L) to induce the phenotype of heart failure with preserved ejection fraction. At week 6 of induction, mice were injected via the medial canthal vein with AAV virus overexpressing siRNA1 (siRNA1 group) and a control virus (NC group). The viral dose for both groups was 1 × 10⁻⁶. 11GC. The purpose of injecting the virus was to continuously inhibit the production of 15-PGDH by overexpressing the 15-PGDH infection RNA. Two weeks after the virus injection, the cardiac function of the mice was evaluated (see Experimental Methods 2.1).

[0127] The results showed that injection of interfering RNA virus (siRNA1 group) did not affect the left ventricular ejection function in HFpEF model mice (Figure 7A). E / E' is an indicator of cardiac diastolic function; a higher ratio indicates more severe diastolic dysfunction. Compared with the control group, the E / E' of the siRNA1 group decreased, indicating that transcriptional inhibition of 15-PGDH with interfering RNA significantly improved cardiac diastolic function in HFpEF model mice (Figure 7B), playing a role in treating heart failure and protecting cardiac function. Example 7: Cardioprotective effect of 15-PGDH inhibitor in mouse HFpEF model.

[0128] Eight-week-old C57BL / 6J mice were fed a high-fat diet and given L-NAME in drinking water (0.5 g / L) to induce the phenotype of heart failure with preserved ejection fraction. At week 6 of induction, mice were administered the 15-PGDH inhibitor ML148 (HY-123548, MedChemExpress, Beijing, China) by gavage at 10 mg / kg once daily. The control group received an equal volume of DMSO (Vehicle group) by gavage. The experiment was terminated after two weeks of treatment, and cardiac function was evaluated in the mice (see Experimental Methods 2.1).

[0129] ML148 is a potent and selective 15-PGDH inhibitor with an IC50 value of 100%. 50 The value is 56nM. (Reference: Niesen FH, Schultz L, Jadhav A, et al. "High-affinity inhibitors of human NAD-dependent 15-hydroxyprostaglandin dehydrogenase: mechanisms of inhibition and structure-activity relationships". PLoS One. 2010; 5(11): e13719.doi:10.1371 / journal.pone.0013719).

[0130] The results showed that administration of ML148 did not affect ventricular ejection function in HFpEF model mice (Figure 8A). E / E' is an indicator of diastolic function; a higher ratio indicates more severe diastolic dysfunction. Compared to the Veh group, the E / E' ratio decreased in the ML148 group, indicating that ML148 significantly improved diastolic function in HFpEF model mice (Figure 8B). These results demonstrate that the 15-PGDH inhibitor ML148 can improve diastolic function in mice with preserved ejection fraction (FEF), playing a role in treating heart failure and protecting cardiac function.

[0131] Referring to Example 1, various cardiac function indicators of mice were tested.

[0132] All disclosures and patents mentioned in this application are incorporated herein by reference. Various modifications and variations of the methods and compositions described herein will be apparent to those skilled in the art without departing from the scope and spirit of this application. While this application has been described by way of specific preferred embodiments, it should be understood that the claimed application should not be unduly limited to these specific embodiments. In fact, various variations of the modes described herein that will be apparent to those skilled in the art are intended to be included within the scope of the appended claims.

Claims

1. Use of 1,5-hydroxyprostaglandin dehydrogenase (15-PGDH) inhibitors in the preparation of medicaments for the prevention and / or treatment of related diseases, wherein, The relevant diseases include at least one of heart failure and vasodilatory dysfunction.

2. The use according to claim 1, wherein, The 15-PGDH inhibitor inhibits the activity of 15-PGDH or reduces the expression of 15-PGDH; Optionally, the 15-PGDH inhibitor increases the levels of prostaglandin E2 (PGE2) and / or prostaglandin I2 (PGI2).

3. The use according to any one of claims 1 to 2, wherein, The heart failure mentioned is heart failure with preserved ejection fraction (HFpEF). Optionally, the symptoms of vasodilatory dysfunction are present in diseases selected from the following: HFpEF, myocardial infarction, coronary heart disease, coronary microvascular disease, non-coronary occlusive ischemic cardiomyopathy (INOCA), non-obstructive coronary myocardial infarction (MINOCA), diabetic cardiomyopathy, coronary microvascular spasm, hypertensive cardiomyopathy, coronary artery spasmodic angina, ischemic stroke, peripheral vascular disease, diabetic retinopathy, diabetic nephropathy, cerebral and nervous system microvascular diseases, and other microvascular diseases; Optionally, the symptoms of vasodilatory dysfunction are present in vascular aging; Optionally, the symptoms of vasodilatory dysfunction exist in aging organisms; Optionally, the symptoms of vasodilatory dysfunction may be present in age-related organs.

4. The use according to any one of claims 1 to 3, wherein, The 15-PGDH inhibitors are selected from SW033291, (+)-SW209415, SW222746, AZD2423, nafazatrom, ML147 (CID-3245059), ML148 (CID-3243760), ML149 (CID-2331284), HW201877, MF-300, 15-PGDH-IN-1, MF-PGDH-008, (R)-SW033291, 15-PGDH-IN-4, 15-PGDH-IN-3, 15-PGDH-IN-2, 15-PGDH-IN-1, and 15-epi-PGE1; Optionally, the 15-PGDH inhibitor is a ribonucleic acid (RNA) agent that targets 15-hydroxyprostaglandin dehydrogenase mRNA; Optionally, the ribonucleic acid agent is small interfering RNA (siRNA); Optionally, the 15-PGDH inhibitor is an amino acid sequence that targets the structure of the 15-hydroxyprostaglandin dehydrogenase protein.

5. A method for preventing and / or treating a related disease, comprising administering a 15-PGDH inhibitor to a subject in need, wherein, The relevant diseases include at least one of heart failure and vasodilatory dysfunction.

6. The method according to claim 5, wherein, The 15-PGDH inhibitor inhibits the activity of 15-PGDH or reduces the expression of 15-PGDH; Optionally, the 15-PGDH inhibitor increases the levels of PGE2 and / or PGI2; Optionally, the heart failure is HFpEF; Optionally, the 15-PGDH inhibitor increases the blood circulation perfusion of the subject; Optionally, the 15-PGDH inhibitor prevents or mitigates cardiac remodeling in the subject.

7. The method according to any one of claims 5 to 6, wherein, The symptoms of vasodilatory dysfunction are present in diseases selected from the following: HFpEF, myocardial infarction, coronary artery disease, coronary microvascular disease, non-coronary occlusive ischemic cardiomyopathy (INOCA), non-occlusive coronary myocardial infarction (MINOCA), diabetic cardiomyopathy, coronary microvascular spasm, hypertensive cardiomyopathy, coronary artery spasmodic angina, ischemic stroke, peripheral vascular disease, diabetic retinopathy, diabetic nephropathy, cerebral and nervous system microvascular diseases, and other microvascular diseases; Optionally, the symptoms of vasodilatory dysfunction are present in vascular aging; Optionally, the symptoms of vasodilatory dysfunction exist in aging organisms; Optionally, the symptoms of vasodilatory dysfunction may be present in age-related organs.

8. The method according to any one of claims 5 to 6, wherein, The 15-PGDH inhibitors are selected from SW033291, (+)-SW209415, SW222746, AZD2423, nafazatrom, ML147 (CID-3245059), ML148 (CID-3243760), ML149 (CID-2331284), HW201877, MF-300, 15-PGDH-IN-1, MF-PGDH-008, (R)-SW033291, 15-PGDH-IN-4, 15-PGDH-IN-3, 15-PGDH-IN-2, 15-PGDH-IN-1, and 15-epi-PGE1; Optionally, the 15-PGDH inhibitor is a ribonucleic acid (RNA) agent that targets 15-hydroxyprostaglandin dehydrogenase mRNA; Optionally, the ribonucleic acid agent is small interfering RNA (siRNA); Optionally, the 15-PGDH inhibitor is an amino acid sequence that targets the structure of the 15-hydroxyprostaglandin dehydrogenase protein.

9. A method for identifying a therapeutic agent for a related disease, comprising: Contact the candidate reagent with 15-PGDH. Determine the activity of the 15-PGDH. The relevant diseases include at least one of heart failure and vasodilatory dysfunction; The activity of 15-PGDH refers to the activity of 15-PGDH in degrading PGE2 and / or PGI2, or the expression level of 15-PGDH. In cases of reduced 15-PGDH activity, the candidate reagent was identified as a therapeutic agent for symptoms of heart failure and / or vasodilatory dysfunction.

10. The method according to claim 9, wherein, The method is performed in vitro; Optionally, the contact between the candidate reagent and the 15-PGDH is performed in a cell-free system; Optionally, the contact between the candidate reagent and the 15-PGDH is to contact the candidate reagent with cells, tissues, or organs expressing 15-PGDH.