RNA modulating oligonucleotides with improved characteristics for the treatment of neuromuscular disorders

Novel antisense oligonucleotides with abasic nucleotides target CAG repeat expansions to reduce toxic protein levels, addressing the lack of effective treatments for neuromuscular disorders by enhancing therapeutic applicability and slowing disease progression.

WO2026125419A1PCT designated stage Publication Date: 2026-06-18VICO THERAPEUTICS BV

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
VICO THERAPEUTICS BV
Filing Date
2025-12-09
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Current treatments for neuromuscular disorders such as Huntington's disease, spinocerebellar ataxia, amyotrophic lateral sclerosis, and frontotemporal dementia lack disease-modifying therapies, and existing antisense oligonucleotides (AONs) require further enhancement for improved therapeutic applicability.

Method used

Development of novel antisense oligonucleotides with specific base sequences and abasic nucleotides, such as H-(CUG)m-H, H-UG-(CUG)m-CU-H, H-G-(CUG)m-CU-H, and H-UG-(CUG)m-C-H, which are 2’-O-methyl phosphorothioate oligoribonucleotides, designed to target and reduce toxic protein levels by binding to CAG repeat expansions in neuronal cells.

🎯Benefits of technology

These oligonucleotides effectively reduce the translation rate and levels of mutant proteins, interfere with splicing, and induce exon skipping, providing a promising approach to slow or halt disease progression in neuromuscular disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000013_0001
    Figure IMGF000013_0001
  • Figure IMGF000078_0001
    Figure IMGF000078_0001
  • Figure IMGF000083_0001
    Figure IMGF000083_0001
Patent Text Reader

Abstract

The current invention provides an improved oligonucleotide and its use for treating, ameliorating, preventing, delaying and / or treating a human cis-element repeat instability associated genetic neuromuscular or neurodegenerative disorder.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] RNA modulating oligonucleotides with improved characteristics for the treatment of neuromuscular disorders

[0002] Field

[0003] The invention relates to the field of human genetics, more specifically neuromuscular disorders. The invention in particular relates to the use of antisense oligonucleotides (AONs) with improved characteristics enhancing clinical applicability as further defined herein.

[0004] Background of the invention

[0005] Neuromuscular diseases are characterized by impaired functioning of the muscles due to either muscle or nerve pathology (myopathies and neuropathies).

[0006] The neuropathies are characterized by neurodegeneration and impaired nerve control leading to problems with movement, spasticity or paralysis. Examples include Huntington's disease (HD), several types of spinocerebellar ataxia (SCA), Friedreich’s ataxia (FA), Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal dementia (FTD). A subset of neuropathies is caused by a cis-element repeat instability.

[0007] For example, HD has the prevalence of approximately 5.7 per 100,000 in Europe and North America (Pringsheim T; et al (2012), Mov. Disord., 27(9): p.1083-1091). It is caused by a CAG repeat expansion in the first exon of the HTT gene located on chromosome four resulting in a polyglutamine expansion in the encoded huntingtin protein (HTT). Expansion of these repeats results in expansion of a glutamine stretch at the N-terminal end of the 348 kDa cytoplasmic huntingtin protein. Huntingtin has a characteristic sequence of 26 or fewer glutamine amino acid residues in the normal form; the mutated huntingtin causing the disease has 36 or more residues. Individuals with CAG repeats in the range from 27 to 35 CAG repeats are not at risk of developing symptoms of HD but, because of instability in the CAG tract, may be at risk of having a child with an allele in the HD-causing range (Semaka A. et al., 2006, Clin Genet., 70:283-94). CAG repeats in the range of 36 to 39 have reduced-penetrance and may not develop symptoms. Full-penetrance HD-causing alleles contain 40 or more CAG repeats.

[0008] Many pathogenic mechanisms have been hypothesised for the apparent toxic gain-of-function of this polyglutamine-expanded protein, including abnormalities in cellular proteostasis, altered gene transcription, mitochondrial dysfunction and oxidative stress, excitotoxicity, synaptic and neuronal failure, deficient axonal transport, spread of mutant HTT from cell-to-cell in a prionlike fashion and loss of trophic support (Kuemmerle S, et al., Ann Neurol, 1999. 46(6): p. 842- 849, Moumne L, et al, Front Neurol, 2013. 4: p. 127, and Ross CA, et al., Nat Rev Neurol, 2014. 10(4): p. 204-216). Mutant HTT mRNA transcripts have also been shown to contribute to neuronal toxicity (Banez-Coronel M, et al.,. PLoS Genet, 2012. 8(2): p. e1002481). CAG repeat expansion has been shown to result in aberrantly spliced exon 1 mRNA fragments that are translated into a short exon 1 HTT protein that is toxic to neurons (Sathasivam K. et al., 2013, Proc Natl Acad Sci U S A, 110(6):2366-70). Repeat-associated non-ATG (RAN) translation of the CAG repeat in both the sense and antisense direction resulting in the formation of toxic homoploymeric proteins polyGin, polyAla, polySer, polyCys and polyLeu has also been suggested to play a role in the pathogenesis of HD (Banez-Coronel M. et al., 2015, Neuron, 88(4):667-77). Somatic CAG repeat expansion resulting in ultra long (100 to 1000) CAG repeats has been shown to occur in the brain of HD patients and is associated with drives the rate of pathogenesis (Kennedy L. et al. 2003, Human Molecular Genetics, 12(24):3359-3367).

[0009] The continuous expression of mutant huntingtin molecules in neuronal cells results in the formation of large protein deposits which eventually give rise to cell death, especially in the frontal lobes and the basal ganglia (mainly in the caudate nucleus). The severity of the disease is generally proportional to the number of extra residues.

[0010] Despite the seriously debilitating nature of neuropathies such as (HD), (SCA), (FA), (ALS) and (FTD), there is currently no approved disease-modifying treatments for such diseases.

[0011] Various symptomatic treatments are available, but their use is often limited by a plethora of adverse effects, and importantly, none are proven to alter the course of the disease. Thus, there is a high unmet medical need for effective disease-modifying therapies for patients with devastating progressive disorder such as HD.

[0012] Since the polyQ protein implicated in neuropathies such as (HD), (SCA), (FA), (ALS) and (FTD), act through a dominant gain-of-function mechanism resulting in neurotoxicity, suppression of the respective mutant protein using antisense oligonucleotides targeting CAG repeat expansions is an appealing and promising approach to slow or halt disease progression in such patients.

[0013] Preclinical data using an antisense oligonucleotide (AON) (CUG)? consisting of 2’-O-methyl phosphorothioate RNA wherein all of its cytosines have been replaced by 5-methylcytosine and represented by SEQ ID NO:1 (as described in WO 2013 / 162363) seem to suggest that this type of molecule can be applied to effectively reduce reduce toxic protein levels with expanded CAG repeats in patient-derived cells.

[0014] However, to further enhance the therapeutic applicability of AONs for treating human ciselement repeat instability associated genetic disorders as exemplified herein, there is still a need for AONs with further improved characteristics.

[0015] Summary of the invention

[0016] In a first aspect, there is provided an oligonucleotide which comprises the following base sequence represented by:

[0017] H-(CUG)m-H (SEQ ID NO:2) H-UG-(CUG)m-CU-H (SEQ ID N0:3)

[0018] H-G-(CUG)m-CU-H (SEQ ID N0:4)

[0019] H-UG-(CUG)m-C-H (SEQ ID N0:5)

[0020] H-G-(CUG)m-C-H (SEQ ID N0:6)

[0021] Bases: G=guanine; C= 5-methylcytosine; U=Uracil,

[0022] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0023] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides.

[0024] In an embodiment of this first aspect, the abasic nucleotide is located at the 5’ side of the base sequence of the oligonucleotide, at the 3’ side of said base sequence and / or within said base sequence, preferably wherein the abasic nucleotide is located within said base sequence.

[0025] In an embodiment of this first aspect, m is 7 and said oligonucleotide comprises 1 , 2 or 3 abasic nucleotides, preferably wherein the abasic nucleotide is located within said base sequence.

[0026] In an embodiment, of this first aspect, the 1 , 2 or 3 abasic nucleotides are located as follows: a) 1 , 2 or 3 abasic nucleotides are present at the 5’ side of the base sequence of the oligonucleotide defined in claim 1 , b) 1 , 2 or 3 abasic nucleotides are present at the 3’ side of the base sequence of the oligonucleotide defined in claim 1 , and\or c) 1 , 2 or 3 abasic nucleotides are present within the base sequence of the oligonucleotide defined in claim 1.

[0027] In an embodiment of this first aspect, m is 7 and the positions of the abasic nucleotides within the base sequence of the oligonucleotide are selected from:

[0028] 4, 11 and 18,

[0029] 4, 6 and 8,

[0030] 4, 5, and 6,

[0031] 10, 11 and 12 or

[0032] 16, 17 and 18.

[0033] In an embodiment of this first aspect, the 1 , 2 or 3 abasic nucleotides are located at the 5’ of the base sequence of the oligonucleotide defined above and / or 1 , 2 or 3 abasic nucleotides are located at the 3’ of the base sequence of the oligonucleotide defined above.

[0034] In an embodiment of this first aspect, m is 7. In an embodiment of this first aspect, the abasic nucleotides are at the following positions within the base sequence of the oligonucleotide defined above:

[0035] 11

[0036] 18

[0037] 4 and 11

[0038] 11 and 18

[0039] 4, 6 and 8

[0040] 4, 5 and 6

[0041] 10 , 1 1 and 12

[0042] 16, 17 and 18.

[0043] In an embodiment of this first aspect, m is 7, the abasic nucleotides are represented by X, and the base sequence of the oligonucleotide comprises, consists of or essentially consists of:

[0044] SEQ ID NO:7 : CUGCUGCUGCXGCUGCUGCUG

[0045] SEQ ID NO:8 :CUGCUGCUGCUGCUGCUXCUG

[0046] SEQ ID NO:9 : CUGXUGCUGCXGCUGCUGCUG

[0047] SEQ ID NO:10 : CUGCUGCUGCXGCUGCUXCUG

[0048] SEQ ID NO:1 1 : CUGXUXCXGCUGCUGCUGCUG

[0049] SEQ ID NO:12 : CUGXXXCUGCUGCUGCUGCUG

[0050] SEQ ID NO:13 : CUGCUGCUGXXXCUGCUGCUG

[0051] SEQ ID NO:14 : CUGCUGCUGCUGCUGXXXCUG

[0052] Bases: G=guanine; C= 5-methylcytosine; U=Uracil; X= DNA abasic nucleotide.

[0053] The oligonucleotides SEQ ID NO:7-14 are single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

[0054] In an embodiment of this first aspect,

[0055] 1 abasic nucleotide is located at the 5’ of the base sequence of the oligonucleotide defined above,

[0056] 2 abasic nucleotides are located at the 5’ of the base sequence of the oligonucleotide defined above,

[0057] 3 abasic nucleotides are located at the 5’ of the base sequence of the oligonucleotide defined above,

[0058] 1 abasic nucleotide is located at the 3’ of the base sequence of the oligonucleotide defined in above,

[0059] 2 abasic nucleotides are located at the 3’ of the base sequence of the oligonucleotide defined above and / or 3 abasic nucleotides are located at the 3’ of the base sequence of the oligonucleotide defined above.

[0060] In an embodiment of this first aspect, the base sequence of the oligonucleotide is

[0061] SEQ ID NO: 15 : XCUGCUGCUGCUGCUGCUGCUG

[0062] SEQ ID NO:16 : XXCUGCUGCUGCUGCUGCUGCUG

[0063] SEQ ID NO:17 : XXXCUGCUGCUGCUGCUGCUGCUG

[0064] SEQ ID NO:18 : CUGCUGCUGCUGCUGCUGCUGX

[0065] SEQ ID NO:19 : CUGCUGCUGCUGCUGCUGCUGXX

[0066] SEQ ID NO:20 : CUGCUGCUGCUGCUGCUGCUGXXX

[0067] Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide.

[0068] The oligonucleotides SEQ ID NQ:15-20 are single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

[0069] In an embodiment of this first aspect, the length of said oligonucleotide is from 15 to 37 nucleotides, including abasic nucleotides and nucleotides with a base.

[0070] In an embodiment of this first aspect, the oligonucleotide is a single stranded oligonucleotide.

[0071] In an embodiment of this first aspect, a nucleotide of said oligonucleotide is modified compared to an RNA oligonucleotide, preferably wherein said modification is selected from the group consisting of a modified base, a modified sugar and a modified internucleotide linkage.

[0072] In an embodiment of this first aspect, the modified base is 5-methylcytosine and / or 5- methyluracil, the modified sugar is 2-O’-methyl and / or the modified internucleotide linkage is phosphorothioate.

[0073] In an embodiment of this first aspect, the abasic nucleotide is a DNA or a RNA abasic nucleotide, preferably a RNA abasic nucleotide, more preferably a modified RNA abasic nucleotide, even more preferably a RNA nucleotide with a modified sugar, and most preferably a RNA nucleotide with a 2-O’-methyl sugar.

[0074] In an embodiment of this first aspect, said oligonucleotide comprises at least two different types of abasic nucleotides, preferably a DNA abasic and a RNA abasic nucleotide, more preferably the RNA abasic nucleotide is a 2’0-Me RNA abasic nucleotide. In an embodiment of this first aspect, said oligonucleotide is at least 90% reverse complementary with the repetitive nucleotide unit (CAG)n and / or remains in association to its target when there are up to 20% of mismatched nucleotides. said oligonucleotide is 100% reverse complementary to the target sequence and therefore does not contain any mismatch or wobbles, when the abasic nucleotides are at the 5’ end / side and / or at the 3’end / side of the oligonucleotide, said oligonucleotide comprises an internal mismatch or internal wobble base, preferably this oligonucleotide comprises up to 1 , 2, 3, 4 or up to 5 internal mismatches or internal wobbles or when the abasic nucleotide is internal or is within the base sequence of the oligonucleotide, the number of allowable mismatch or wobble and abasic nucleotide is up to 1 , 2, 3, 4 or up to 5.

[0075] In an embodiment of this first aspect, said oligonucleotide exhibits at least one of the below defined activities: reducing or silencing or decreasing the translation rate of a mutant transcript comprising a repetitive nucleotide unit (CAG)n and thus the amount of a corresponding mutant protein, interfering with the splicing of a mutant transcript (pre-mRNA) comprising a repetitive nucleotide unit (CAG)n, such as the induction of exon skipping resulting in an out-of-frame transcript and in reduced levels of in-frame transcript, and thus reducing the amount of a corresponding mutant protein and reducing or decreasing or lowering a mutant protein level.

[0076] In a second aspect, there is provided a composition comprising an oligonucleotide as defined in the first aspect, preferably said composition comprising at least one excipient that may further aid in enhancing the targeting and / or delivery of said composition and / or said oligonucleotide to a tissue and / or cell and / or into a tissue and / or cell.

[0077] In a third aspect, there is provided an oligonucleotide or a composition, for use in treating, delaying, ameliorating and / or preventing a human genetic disease associated with a human (CAG)n repeat instability associated genetic disorder, preferably wherein the human genetic disease is Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X-5 linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA).

[0078] In an embodiment of this third aspect, the oligonucleotide or the composition is for use in treating, delaying, ameliorating and / or preventing the human genetic diseases Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X-5 linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA) caused by CAG repeat expansions in the transcripts of the HTT (SEQ ID NO: 21), ATXN1 (SEQ ID NO:22), ATXN2 (SEQ ID NO: 23) ATXN3 (SEQ ID NO: 24), CACNA1A (SEQ ID NO:25), ATXN7 (SEQ ID NO: 26), PPP2R2B (SEQ ID NO: 27), TBP10 (SEQ ID NO: 28), AR (SEQ ID NO: 29) or ATN1 (SEQ ID NO: 30) genes.

[0079] In an embodiment of this third aspect, the oligonucleotide or the composition is for use wherein administration of said oligonucleotide or composition is via an intravenous, subcutaneous, intraventricular, intrathecal, intramuscular, intranasal, enteral, intravitreal, intracerebral, epidural or oral route.

[0080] In a fourth aspect, there is provided a method for treating, delaying, ameliorating and / or preventing a human genetic disease associated with a human (CAG)n repeat instability associated genetic disorder, preferably wherein the human genetic disease is Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X-5 linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA) by administering an oligonucleotide or a composition as defined earlier herein.

[0081] Description of the invention

[0082] Various features of the aspects and embodiments of this invention are further described below. It is noted that headings used throughout this specification are to assist navigation only and should not be interpreted as definitive, and that features described in different sections may be relevant for all aspects and embodiments described herein and may thus be combined as appropriate.

[0083] Oligonucleotide

[0084] In a first aspect, the invention provides an oligonucleotide which comprises the following base (or repeat) sequence (or repeat sequence) represented by:

[0085] H-(CUG )m-H (SEQ ID NO: 2)

[0086] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0087] H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6) Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0088] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0089] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides.

[0090] Within the context of the application, “m” is an integer and may be 5, 6, 7, 8 or 9 as explained above. In a preferred embodiment, m is 7.

[0091] The oligonucleotide of the invention is represented by a nucleotide sequence comprising or consisting of a sequence that binds (or is able to bind), hybridizes (or is able to hybridize), targets and / or is reverse complementary to a repetitive element in a RNA transcript having as repetitive nucleotide unit a repetitive nucleotide unit, which is (CAG)n. (SEQ ID NO:76529) The core sequence of this oligonucleotide is (CUG)m. (SEQ ID NO:76530)

[0092] Any oligonucleotide comprising UGC or GCU as repetitive nucleotide unit is also encompassed by the present invention. Depending on the length of said oligonucleotide (for example from 15 to 50 nucleotides), the given repetitive nucleotide unit may not be complete at the 5’ and / or at the 3’ side of said oligonucleotide. Each of said oligonucleotide is encompassed within the scope of said invention and is reflected by the formula chosen for the oligonucleotide of the invention listed herein:

[0093] H-(CUG )m-H (SEQ ID NO:2)

[0094] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0095] H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0096] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0097] Abasic nucleotide of the oligonucleotide

[0098] The oligonucleotide of the invention comprises an abasic nucleotide. The oliogonucleotide comprises at least 1 , 2, 3, 4, 5 or 6 abasic nucleotides. In an embodiment, the optimal number of abasic nucleotides is linked to the length of the oligonucleotide.

[0099] In an embodiment, the oligonucleotide of the invention has a length of 15 to 37 nucleotides (counting all the nucleotides present in the oligonucleotide, the ones with a base and the abasic nucleotide(s)) therefore including at least 1 , 2, 3, 4, 5 or 6 abasic nucleotides or including 1 , 2, 3, 4, 5 or 6 abasic nucleotides . In an embodiment, when the length of the oligonucleotide is from 15 to 21 nucleotides (counting all the nucleotides present in the oligonucleotide, the ones with a base and the abasic nucleotides), the number of abasic nucleotides is 1 , 2 or 3. For example the length of the oligonucleotide is at least 15 when m is 5, at least 18 when m is 6 and at least 21 when m is 7.

[0100] In an embodiment, when the length of the oligonucleotide is from 24 to 33 nucleotides (counting all the nucleotides present in the oligonucleotide, the ones with a base and the abasic nucleotides), therefore including the number of abasic nucleotides is 1 , 2, 3, 4, 5 or 6. For example the length of the oligonucleotide is at least 24 when m is 8, at least 27 when m is 9. However, the oligonucleotide may comprise additional nucleotides not being part of the “repeat sequence”, which explains that its length may be longer than 37 nucleotides. Typically the length of the oligonucleotide is up to 50 nucleotides.

[0101] The term “abasic nucleotide” is synonymous of “abasic site” or “abasic monomer”. An abasic nucleotide is a nucleotide residue or building block that lacks a nucleobase by comparison to a corresponding nucleotide residue comprising a nucleobase. Within the invention, an abasic nucleotide is thus a building block part of an oligonucleotide but lacking a nucleobase. Such abasic nucleotide may be present or linked or attached or conjugated to a free terminus of an oligonucleotide. Such abasic nucleotide may be present within the oligonucleotide.

[0102] Such abasic nucleotide may be present or linked or attached or conjugated to a free terminus of an oligonucleotide and may be present within the oligonucleotide.

[0103] An oligonucleotide as the one known in WO 2013 / 162363 (i.e. CUG)? consisting of 2’-O-methyl phosphorothioate RNA wherein all of its cytosines have been replaced by 5-methylcytosine and represented by SEQ ID NO:1 (as described in WO 2013 / 162363) acts via steric hindrance of protein synthesis of the mutant protein. Binding of such oligonucleotideto the expanded CAG repeat in the targeted (pre)messenger RNA (mRNA) transcripts sterically hinders translation and thus reduces levels of the corresponding mutant proteins, without degradation of the transcript itself (Datson N., et al., PLoS One, 2017. 12(2): p. e0171127). The oligonucleotide generally reduces levels of the WT protein to a lesser extent than mutant protein, a phenomenon referred to as allelic preference. Factors likely affecting the degree of allelic preference include the length of the CAG repeat, the length difference with the corresponding WT repeat, and the interruptions within the CAG repeat that may affect binding efficacy of the oligonucleotide.

[0104] Other mechanisms that have been proposed to play a potential role in pathogenesis of CAG repeats diseases and could be prevented / reduced by the oligonucleotide include RNA toxicity (Rue L. et al., 2016, J Clin Invest., 126(11):4319-4330), RNA translation (Banez-Coronel M. et al., 2015, Neuron, 88(4):667-77), somatic CAG repeat expansion (Kennedy L. et al. 2003, Human Molecular Genetics, 12(24):3359-3367) and formation of toxic exon 1 by aberrant splicing (Sathasivam K. et al., 2013, Proc Natl Acad Sci U S A, 110(6):2366-70).

[0105] Therefore, in an embodiment, the oligonucleotide represented by SEQ ID NO:1 is expected to exhibit at least one of the below defined activities: reducing or silencing or decreasing the translation rate of said mutant transcript and thus the amount of the corresponding mutant protein, reducing or decreasing a mutant protein level, binding to the CAG repeat in said mutant transcript and sterically hindering any resulting RNA toxicity of the repeat itself, reducing or silencing or decreasing repeat-associated non-ATG (RNA) translation of the CAG repeat and thus the corresponding amount of homopolymeric proteins polyGin, polyAla, polySer, polyCys and polyLeu), binding to ultra long (>100 to 1000) CAG repeats in said mutant transcript that are the result of somatic expansion and reducing or decreasing translation into an ultra long polyQ stretch in the corresponding mutant protein level, binding to the CAG repeat in said mutant transcript and preventing / reducing induction of aberrant splicing, thus lowering levels of a polyadenylated mRNA that is translated into a toxic protein and thus lowering levels of said toxic protein.

[0106] In an embodiment, the number and / or position / pattern of abasic nucleotide(s) in an oligonucleotide designed to target a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) might have an impact on the administration route, biostability, biodistribution, intra-tissue distribution, and cellular uptake and trafficking, binding affinity and duplex stability, bio-activity, allele selectivity, safety, cost of goods by reducing length or improving synthesis and / or purification procedures.

[0107] In an embodiment, the introduction of abasic nucleotide(s) in an oligonucleotide designed to target a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) allows to target an imperfect repetitive nucleotide unit comprising (CAG) repeats. An imperfect repetitive nucleotide unit may comprise a perfect repetitive nucleotide unit (CAG)n wherein n is an integer, is at least 2 and wherein there is at least one imperfect CAG codon (or part thereof) present at the 5’, 3’ and / or within the imperfect repetitive nucleotide unit (CAG)n(SEQ ID NO:76529). In an embodiment, the oligonucleotide of the invention comprises an abasic nucleotide(s) at each position targeting a nucleotide(s), which confer(s) the imperfection to the repetitive nucleotide unit (CAG)n (SEQ ID NO:76529).

[0108] In an embodiment, the number and / or position / pattern of abasic nucleotide(s) in an oligonucleotide designed to target a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) has an impact on its bio-activity. This effect on the bioactivity is particularly visible when the abasic nucleotide is present within the base sequence of the oligonucleotide (see example 2, figure 4). In an embodiment, the number and / or position of abasic nucleotide(s) has an impact on at least one of the activities of the oligonucleotide listed below: reducing or silencing or decreasing the translation rate of a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) and thus the amount of a corresponding mutant protein, interfering with the splicing of a mutant transcript (pre-mRNA) comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO: 76529), such as the induction of exon skipping resulting in an out-of-frame transcript, and thus reducing the amount of in-frame transcript and thus reducing the amount of a corresponding mutant protein and reducing or decreasing or lowering a mutant protein level.

[0109] Surprisingly, in an embodiment, the introduction of abasic nucleotide(s) in an oligonucleotide designed to target a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) allows to design oligonucleotides that exhibit a similar activity as their counterpart oligonucleotides with no abasic nucleotides (same sequence and same chemistry) although their binding characteristics are not improved (Tm) or are slightly worse than the one of their counterpart oligonucleotide. Specific examples of such preferred oligonucleotides are provided later herein: SEQ ID NO: 15 , SEQ ID NO:16 and SEQ ID NO:19 .

[0110] In an embodiment, the number and / or position / pattern of abasic nucleotide(s) in an oligonucleotide designed to target a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) has a positive impact on its use for treating, delaying, ameliorating and / or preventing a genetic disease associated with (CAG)n (SEQ ID NO:76529) repeat instability.

[0111] An abasic nucleotide may be of any type known and conceivable by the skilled person, nonlimiting examples of which are depicted below:

[0112]

[0113] Herein, Ri and R2 are independently H, an oligonucleotide or other abasic nucleotide(s), provided that not both R1 and R2 are H and R1 and R2 are not both an oligonucleotide.

[0114] In some embodiments, the abasic nucleotide is a DNA or a RNA abasic nucleotide, preferably a RNA abasic nucleotide, more preferably a modified RNA abasic nucleotide, even more preferably a RNA nucleotide with a modified sugar, and most preferably a RNA nucleotide with a 2-O’-methyl sugar. Within the context of the application, a DNA abasic nucleotide is represented by X, while a 2’-O-Methyl abasic RNA nucleotide is represented by Y.

[0115] In a preferred embodiment, an abasic nucleotide is a DNA abasic nucleotide or a RNA abasic nucleotide. A RNA abasic nucleotide is preferably a 2’0-Me RNA abasic nucleotide. In one embodiment, an oligonucleotide of the invention comprises at least two different types of abasic nucleotides. For example an oligonucleotide of the invention may comprise a DNA abasic and a RNA abasic nucleotide (preferably a 2’0-Me RNA abasic nucleotide).These chemistries will be defined later on in the context of the oligonucleotide and also apply to the abasic nucleotide of the oligonucleotide of the invention. An abasic nucleotide(s) can be attached to either or both termini of the oligonucleotide. An abasic nucleotide(s) can also be introduced within the oligonucleotide. An abasic nucleotide(s) can be attached to either or both termini of the oligonucleotide and can be introduced within the oligonucleotide. In a preferred embodiment, the abasic nucleotide is present or introduced within the oligonucleotide (i.e. within the base sequence of the oligonucleotide).

[0116] In the context of the invention, abasic nucleotides are considered to be part of the nucleotide sequence of the oligonucleotide although such nucleotide does not have a base. This is the case for internal abasic nucleotides and for abasic nucleotides that are attached to the 5’ and / or 3’ end of the oligonucleotide. This nomenclature is used in the application as filed, in the sequence listing and in table 3 of the application.

[0117] Number and position of abasic nucleotides

[0118] In some embodiment, the base (or repeat) sequence of the oligonucleotide is as follows: H-(CUG )m-H (SEQ ID NO:2) H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0119] Bases: G=guanine; C=5-methylcytosine; U=Uracil. and the number of abasic nucleotides is as follows: m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides.

[0120] When an abasic nucleotide is present within the “base (or repeat) sequence” of the oligonucleotide as defined above (for example H-(CUG)m-H (SEQ ID NO:2) or H-G-(CUG)m- CU (SEQ ID NO:4)), it means that one of the nucleotide with a base initially present in said “base sequence” has been replaced by a nucleotide without a base. For example, an oligonucleotide with an abasic nucleotide could be H-CUG-CUG-CUG-CQG-CUG-H (SEQ ID NO: 31) or could be H-G-CUG-CUG-CUG-CUG-CUG-QUG-CQG-CU-H (SEQ ID NO:32) wherein Q is an abasic nucleotide.

[0121] In the context of the application, the term “the base sequence” of the oligonucleotide when referring to

[0122] H-(CUG )m-H (SEQ ID NO:2)

[0123] H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0124] H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0125] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0126] Bases: G=guanine; C=5-methylcytosine; U=Uracil. may be replaced by the term “the repeat sequence” of the oligonucleotide.

[0127] Oligonucleotides with this number of abasic nucleotides (1 to 6) and for this value of m (5 to 9) have been found to exhibit quite attractive properties (see experimental part).

[0128] In some embodiments, the abasic nucleotide is located at the 5’ side of the oligonucleotide, at the 3’ side of the oligonucleotide and / or within the “base (or repeat) sequence” of the oligonucleotide. In a preferred embodiment, the abasic nucleotide is present or introduced or located within the oligonucleotide (i.e. within the base or repeat sequence of the oligonucleotide).

[0129] Within the context of the present invention, the base (or repeat) sequence of the oligonucleotide of the invention is as follows (unless otherwise stated):

[0130] H-(CUG )m-H (SEQ ID NO:2)

[0131] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0132] H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0133] Bases: G=guanine; C=5-methylcytosine; U=Uracil;

[0134] In some embodiments, m is 5 and 1 , 2 or 3 nucleotides of the oligonucleotide are abasic nucleotides.

[0135] In some embodiments, m is 6 and 1 , 2 or 3 nucleotides of the oligonucleotide are abasic nucleotides.

[0136] In some embodiments, m is 7 and 1 , 2 or 3 nucleotides of the oligonucleotide are abasic nucleotides.

[0137] In some embodiments, the abasic nucleotides are located as follows at the 5’ side, the 3’ side and / or within the base (or repeat) sequence of the oligonucleotide: a) 1 , 2, 3, 4, 5 or 6 abasic nucleotides are present at the 5’ side of the base (or repeat) sequence of the oligonucleotide of the invention, b) 1 , 2, 3, 4, 5 or 6 abasic nucleotides are present at the 3’ side of the base (or repeat) sequence of the oligonucleotide of the invention, and / or c) 1 , 2, 3, 4, 5 or 6 abasic nucleotides are present within the base (or repeat) sequence of the oligonucleotide of the invention.

[0138] Within the context of the present invention, the base (or repeat) sequence of the oligonucleotide of the invention is as follows (unless otherwise stated):

[0139] H-(CUG )m-H (SEQ ID NO:2)

[0140] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0141] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0142] H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0143] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0144] M may be 5, 6, 7, 8 or 9.

[0145] Bases: G=guanine; C=5-methylcytosine; U=Uracil

[0146] In some embodiments, m is 7 and the abasic nucleotides are located as follows at the 5’ side, the 3’ side and / or within the base (or repeat) sequence of the oligonucleotide: a) 1 , 2 or 3 abasic nucleotides are present at the 5’ side of the base (or repeat) sequence of the oligonucleotide of the invention, b) 1 , 2 or 3 abasic nucleotides are present at the 3’ side of the base (or repeat) sequence of the oligonucleotide of the invention, and / or c) 1 , 2 or 3 abasic nucleotides are present within the base (or repeat) sequence of the oligonucleotide of the invention.

[0147] Within the context of the present invention, the base (or repeat) sequence of the oligonucleotide of the invention is as follows (unless otherwise stated):

[0148] H-(CUG )7-H (SEQ ID NO:33)

[0149] H-UG-(CUG)7-CU-H (SEQ ID NO:34)

[0150] H-G-(CUG)7-CU-H (SEQ ID NO:35)

[0151] H-UG-(CUG)7-C-H (SEQ ID NO:36)

[0152] H-G-(CUG)7-C-H (SEQ ID NO:37)

[0153] Bases: G=guanine; C=5-methylcytosine; U=Uracil;

[0154] In some embodiments, the abasic nucleotides are located as follows at the 5’ side, the 3’ side and / or within the base (or repeat) sequence of the oligonucleotide: a) 1 , 2 or 3 abasic nucleotides are present at the 5’ side of the base (or repeat) sequence of the oligonucleotide of the invention, b) 1 , 2 or 3 abasic nucleotides are present at the 3’ side of the base (or repeat) sequence of the oligonucleotide of the invention , and / or c) 1 , 2 or 3 abasic nucleotides are present within the base(or repeat) sequence of the oligonucleotide of the invention

[0155] Within the context of the present invention, the base (or repeat) sequence of the oligonucleotide of the invention is as follows (unless otherwise stated):

[0156] H-(CUG )m-H (SEQ ID NO:2)

[0157] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0158] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0159] H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0160] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0161] M may be 5, 6, 7, 8 or 9.

[0162] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0163] In some embodiments, m is 7 and the abasic nucleotides are located as follows at the 5’side, the 3’ side or within the base (or repeat) sequence of the oligonucleotide: a) 1 , 2 or 3 abasic nucleotides are present at the 5’ side of the base (or repeat) sequence of the oligonucleotide of the invention, b) 1 , 2 or 3 abasic nucleotides are present at the 3’ side of the base (or repeat) sequence of the oligonucleotide of the invention , and / or c) 1 , 2 or 3 abasic nucleotides are present within the base (or repeat) sequence of the oligonucleotide of the invention

[0164] Within the context of the present invention, the base (or repeat) sequence of the oligonucleotide of the invention is as follows (unless otherwise stated):

[0165] H-(CUG )7-H (SEQ ID NO:33)

[0166] H-UG-(CUG)7-CU-H (SEQ ID NO:34)

[0167] H-G-(CUG)7-CU-H (SEQ ID NO:35)

[0168] H-UG-(CUG)7-C-H (SEQ ID NO:36)

[0169] H-G-(CUG)7-C-H (SEQ ID NO:37)

[0170] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0171] In some embodiments, 1 , 2, 3, 4, 5 or 6 abasic nucleotides are present within the base (or repeat) sequence of the oligonucleotide of the invention.

[0172] In some embodiments, 1 , 2 or 3 abasic nucleotides are present within the base (or repeat) sequence of the oligonucleotide of the invention.

[0173] In some embodiments, m is 7 and 1 , 2 or 3 abasic nucleotides are present within the base (or repeat) sequence of the oligonucleotide of the invention.

[0174] Within the context of the present invention, the base (or repeat) sequence of the oligonucleotide of the invention is as follows (unless otherwise stated):

[0175] H-(CUG )m-H (SEQ ID NO:2) H-UG-(CUG)m-CU-H (SEQ ID N0:3)

[0176] H-G-(CUG)m-CU-H (SEQ ID N0:4)

[0177] H-UG-(CUG)m-C-H (SEQ ID N0:5)

[0178] H-G-(CUG)m-C-H (SEQ ID N0:6)

[0179] M may be 5, 6, 7, 8 or 9.

[0180] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0181] In some embodiments, the abasic nucleotides are at the following positions within the base (or repeat) sequence of the oligonucleotide:

[0182] 11

[0183] 18

[0184] 4 and 11

[0185] 11 and 18

[0186] 4, 6 and 8

[0187] 4, 5 and 6

[0188] 10 , 11 and 12

[0189] 16, 17 and 18.

[0190] Within the context of this paragraph, the base (or repeat) sequence of the oligonucleotide is as follows:

[0191] H-(CUG )m-H (SEQ ID NO:2)

[0192] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0193] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0194] H-UG-(CUG)m-C-H(SEQ ID NO:5)

[0195] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0196] M may be 5, 6, 7, 8 or 9. Preferably in these embodiments, m is 7.

[0197] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0198] In some embodiments, m is preferably 7 and the positions of the abasic nucleotides within the base (or repeat) sequence of the oligonucleotide of the invention are selected from:

[0199] 4, 11 and 18

[0200] 4, 6 and 8

[0201] 4, 5, and 6

[0202] 10, 11 and 12

[0203] 16, 17 and 18.

[0204] Within the context of this paragraph, the base (or repeat) sequence of the oligonucleotide of the invention is as follows:

[0205] H-(CUG )m-H (SEQ ID NO:2)

[0206] H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)mCU-H (SEQ ID N0:4)

[0207] H-UG-(CUG)m-C-H (SEQ ID N0:5)

[0208] H-G-(CUG)m-C-H (SEQ ID N0:6)

[0209] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0210] In some preferred embodiments, m is preferably 7 and the abasic nucleotides are at the following positions within the base (or repeat) sequence of the oligonucleotide of the invention: Position 11 , Position 18, Positions 4 and 11 , Positions 11 and 18, Positions 4, 6 and 8, Positions 4, 5 and 6, Positions 10, 11 and 12 or Positions 16, 17 and 18.

[0211] Within the context of this paragraph, the base (or repeat) sequence of the oligonucleotide of the invention is as follows:

[0212] - H-(CUG )7-H (SEQ ID NO:33)

[0213] - H-UG-(CUG)7-CU-H (SEQ ID NO:34)

[0214] - H-G-(CUG)7CU-H (SEQ ID NO:35)

[0215] - H-UG-(CUG)7-C-H (SEQ ID NO:36)

[0216] - H-G-(CUG)7-C-H (SEQ ID NO:37)

[0217] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0218] In some more preferred embodiments, m is 7, the base (or repeat) sequence of the oligonucleotide is

[0219] H-(CUG )7-H (SEQ ID NO:33) and the abasic nucleotides represented by X are at the following positions within the base (or repeat) sequence of the oligonucleotide of the invention:

[0220] Position 11 . A preferred oligonucleotide is represented by SEQ ID NO:7 : CUGCUGCUGCXGCUGCUGCUG

[0221] Position 18. A preferred oligonucleotide is represented by SEQ ID NO:8: CUGCUGCUGCUGCUGCUXCUG

[0222] Positions 4 and 11 . A preferred oligonucleotide is represented by SEQ ID NO:9: CUGXUGCUGCXGCUGCUGCUG

[0223] Positions 11 and 18. A preferred oligonucleotide is represented by SEQ ID NQ:10: CUGCUGCUGCXGCUGCUXCUG

[0224] Positions 4, 6 and 8. A preferred oligonucleotide is represented by SEQ ID NO:11 : CUGXUXCXGCUGCUGCUGCUG Positions 4, 5 and 6. A preferred oligonucleotide is represented by SEQ ID NO:12: CUGXXXCUGCUGCUGCUGCUG

[0225] Positions 10, 11 and 12. A preferred oligonucleotide is represented by SEQ ID NO:13: CUGCUGCUGXXXCUGCUGCUG

[0226] Positions 16, 17 and 18. A preferred oligonucleotide is represented by SEQ ID NO:14: CUGCUGCUGCUGCUGXXXCUG

[0227] (Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide)

[0228] The oligonucleotides SEQ ID NO:7-14 are single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

[0229] Even more preferably, m is 7, the base (or repeat) sequence of the oligonucleotide is

[0230] H-(CUG )7-H (SEQ ID NO:33) and the abasic nucleotides represented by X are at the following positions within the base (or repeat) sequence of the oligonucleotide of the invention:

[0231] Position 11 . A preferred oligonucleotide is represented by SEQ ID NO:7: CUGCUGCUGCXGCUGCUGCUG

[0232] Positions 4 and 1 1 . A preferred oligonucleotide is represented by SEQ ID NO:9: CUGXUGCUGCXGCUGCUGCUG

[0233] Positions 4, 5 and 6. A preferred oligonucleotide is represented by SEQ ID NO: 12: CUGXXXCUGCUGCUGCUGCUG

[0234] Positions 16, 17 and 18. A preferred oligonucleotide is represented by SEQ ID NO:14: CUGCUGCUGCUGCUGXXXCUG.

[0235] (Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide)

[0236] The oligonucleotides SEQ ID NOT, 9, 12, 14 are single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

[0237] The activity of these oligonucleotides is the highest as demonstrated in figure 4.

[0238] In some embodiments, the oligonucleotide comprises 1 , 2, 3, 4, 5 or 6 abasic nucleotides that are located at the 5’ of the its base (or repeat) sequence and / or it comprises 1 , 2, 3, 4, 5 or 6 abasic nucleotides that are located at the 3’ of its base (or repeat) sequence. Within the context of the present invention, the base (or repeat) sequence of the oligonucleotide of the invention is as follows (unless otherwise stated):

[0239] H-(CUG )m-H (SEQ ID NO:2)

[0240] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0241] H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0242] M may be 5, 6, 7, 8 or 9. Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0243] In some embodiments, the oligonucleotide comprises 1 , 2 or 3 abasic nucleotides that are located at the 5’ of its base (or repeat) sequence and / or it comprises 1 , 2 or 3 abasic nucleotides that are located at the 3’of its base (or repeat) sequence. Within the context of the present invention, the base (or repeat) sequence of the oligonucleotide of the invention is as follows (unless otherwise stated):

[0244] H-(CUG )m-H (SEQ ID NO:2)

[0245] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0246] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0247] H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0248] M may be 5, 6, 7, 8 or 9.

[0249] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0250] In a preferred embodiment, the oligonucleotide comprises 1 , 2 or 3 abasic nucleotides that are located at the 5’ of its base (or repeat) sequence and / or it comprises 1 , 2 or 3 abasic nucleotides that are located at the 3’ of its base (or repeat) sequence and m is 7.

[0251] In some preferred embodiments, m is 7, and the oligonucleotide comprises:

[0252] 1 abasic nucleotide is located at the 5’ of its base (or repeat) sequence,

[0253] 2 abasic nucleotides are located at the 5’ of its base (or repeat) sequence,

[0254] 3 abasic nucleotides are located at the 5’ of its base (or repeat) sequence,

[0255] 1 abasic nucleotide is located at the 3’ of its base (or repeat) sequence,

[0256] 2 abasic nucleotide are located at the 3’ of its base (or repeat) sequence or

[0257] 3 abasic nucleotide are located at the 3’ of its base (or repeat) sequence.

[0258] Within the context of this paragraph, the base (or repeat) sequence of the oligonucleotide of the invention is as follows:

[0259] - H-(CUG )7-H (SEQ ID NO:33)

[0260] - H-UG-(CUG)7-CU-H (SEQ ID NO34)

[0261] - H-G-(CUG)7CU-H (SEQ ID NO:35)

[0262] - H-UG-(CUG)7-C-H (SEQ ID NO:36)

[0263] - H-G-(CUG)7-C-H (SEQ ID NO:37)

[0264] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0265] In some preferred embodiments, m is 7, the base (or repeat) sequence of the oligonucleotide is

[0266] H-(CUG )7-H (SEQ ID NO:33) and the oligonucleotide comprises: 1 abasic nucleotide is located at the 5’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO: 15: XCUGCUGCUGCUGCUGCUGCUG

[0267] 2 abasic nucleotides are located at the 5’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO: 16: XXCUGCUGCUGCUGCUGCUGCUG

[0268] 3 abasic nucleotides are located at the 5’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO:17: XXXCUGCUGCUGCUGCUGCUGCUG

[0269] 1 abasic nucleotide is located at the 3’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO:18: CUGCUGCUGCUGCUGCUGCUGX

[0270] 2 abasic nucleotide are located at the 3’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO:19: CUGCUGCUGCUGCUGCUGCUGXX

[0271] 3 abasic nucleotide are located at the 3’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NQ:20:

[0272] CUGCUGCUGCUGCUGCUGCUGXXX

[0273] (Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide)

[0274] The oligonucleotides SEQ ID NQ:15-20 are single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

[0275] Surprisingly, three of these oligonucleotides with m is 7 and with a base (or repeat) sequence of the oligonucleotide being H-(CUG )7-H (SEQ ID NO:33) clearly outperform their counterpart oligonucleotide without abasic nucleotide:

[0276] 1 abasic nucleotide is located at the 5’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO: 15: XCUGCUGCUGCUGCUGCUGCUG

[0277] 2 abasic nucleotides are located at the 5’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO:16: XXCUGCUGCUGCUGCUGCUGCUG

[0278] 2 abasic nucleotide are located at the 3’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO:19: CUGCUGCUGCUGCUGCUGCUGXX

[0279] (Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide)

[0280] The oligonucleotides SEQ ID NO:15, 16, 19 are single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides. General definition of oligonucleotide

[0281] An oligonucleotide is known in the art to be a polymeric molecule, such as a DNA and / or RNA molecule, typically a single-stranded DNA and / or RNA molecule, consisting of repeating monomers. The monomeric units are typically nucleotides (RNA nucleotides or DNA nucleotides) or modified nucleotides (“nucleotide analogs”). The most common naturally occurring nucleotides in RNA are adenosine monophosphate (A), cytidine monophosphate (C), guanosine monophosphate (G), and uridine monophosphate (U). These consist of a pentose sugar ribose, a 5’-li nked phosphate group which is linked via a phosphate ester, and a 1 ’-linked base. A nucleotide without a phosphate group is known as a nucleoside. The most common naturally occurring nucleotides in DNA are deoxyadenosine monophosphate (A), deoxycytidine monophosphate (C), deoxyguanosine monophosphate (G), and deoxythymidine monophosphate (T). These consist of a pentose sugar 2’-deoxyribose, a 5’-linked phosphate group which is linked via a phosphate ester, and a 1 ’-linked base. The abbreviations A, C, G, T and U as used herein may be used to refer to a nucleobase (or base), a corresponding nucleoside, or a corresponding nucleotide. The term “nucleotide” as used herein includes both naturally occurring nucleotides as well as nucleotide analogs (described in more detail later herein), unless indicated otherwise. An abasic nucleotide which is present in the oligonucleotide of the invention may be considered a nucleotide analogue. The term “oligonucleotide” as used herein encompasses salt forms of an oligonucleotide or that possess a ionizable group. An ionizable group may be a base or acid and may be charged or neutral. An ionizable group may be present as ion pair with an appropriate counterion that carries opposite charges. Non-limiting examples of cationic counterions include sodium, potassium, cesium, Tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium and tetraalkylammonium.. Non-limiting examples of anionic counterions are chloride, bromide, iodide, lactate, mesylate, besylate, triflate, acetate, trifluoroacetate, dichloroacetate, tartrate, lactate and citrate. Examples of counterions have been described (e.g. Kumar, Pharm. Technol., 2008, 3, 128). In some embodiments, an oligonucleotide as described herein is an oligonucleotide salt, for example a sodium salt.

[0282] In an embodiment, the oligonucleotide is chirally pure as described in WO2014 / 010250.

[0283] In some embodiments, oligonucleotides described herein are non-naturally occurring oligonucleotides. For example, they may comprise at least one modified sugar, modified base, or modified linkage as described in more detail later herein. The presence of modifications, including linkage, sugar, and base modifications, may provide the oligonucleotide with attractive properties such as improved stability and resistance properties to degradation by exonucleases. Furthermore, the presence of modifications may improve safety, bio-distribution, stability, cellular uptake, intracellular trafficking, target binding affinity, duplex stability, and immunogenicity compared to an oligonucleotide consisting of non-modified DNA and / or nonmodified RNA nucleotides.

[0284] When a structural formula or chemical name or sequence of an oligonucleotide is understood by the skilled person to have chiral centers, yet no chirality is indicated, for each chiral center individual reference is made to all three of either the racemic mixture, the pure R enantiomer, and the pure S enantiomer.

[0285] In some embodiments, oligonucleotides described herein are isolated oligonucleotides. The term “isolated” refers to the separation of a compound from other components present during its production. “Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not substantially interfere with the fundamental activity, and that may be present, for example, due to incomplete purification, or the addition of stabilizers. In the context of oligonucleotides, the term “isolated” may refer to a molecule that is separated from sequences with which it is immediately contiguous in a naturally occurring sequence. For example, an “isolated” oligonucleotide may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector. In the context of oligonucleotides, the term “isolated” may also refer to synthetic oligonucleotides, i.e. chemically synthesized oligonucleotides.

[0286] Chemical synthesis of oligonucleotides is routine in the art and provides rapid and inexpensive access to custom-made oligonucleotides of a desired sequence and a desired chemistry. The most common method is solid-phase synthesis using phosphoramidite chemistry. Reference is made to “Synthesis of Therapeutic Oligonucleotides”. Eds: Satoshi Obika, Mitsuo Sekine. Springer; 1st ed. 2018, Singapore, incorporated herein by reference. Thus, in some embodiments, an oligonucleotide as described herein may be a synthetic oligonucleotide.

[0287] Sugar of the oligonucleotide

[0288] The sugar connects the base and the phosphate, and is therefore often referred to as the scaffold of the nucleotide. A modification in the pentose sugar is therefore often referred to as a scaffold modification. A sugar modification may therefore be called a scaffold modification. For severe modifications, the original pentose sugar might be replaced in its entirety by another moiety that similarly connects the base and the phosphate. Preferred sugars and scaffolds and modified sugars and scaffolds including artificial sugars and scaffolds are described later herein.

[0289] As described above, oligonucleotides as described above may comprise “natural” sugars or scaffolds as well as modified sugars or scaffolds (including artifical sugars or scaffolds). Combinations of distinct modified or artificial sugars or scaffolds within one molecule are encompassed. The same holds for abasic nucleotide of the oligonucleotide.

[0290] Oligonucleotides of this invention may comprise RNA nucleotides (and modified RNA nucleotides or RNA nucleotide analogs), DNA nucleotides (and modified DNA nucleotides or DNA nucleotide analogs), and combinations thereof. In some embodiments, an oligonucleotide as described herein comprises both RNA nucleotides or modifications thereof and DNA nucleotides or modifications thereof. The same holds for abasic nucleotides of the oligonucleotide.

[0291] In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, or 5 DNA nucleotides or modifications thereof and the remainder RNA nucleotides or modifications thereof. In preferred embodiments, an oligonucleotide as described herein comprises 1 or 2, preferably 2 DNA nucleotides or modifications thereof, and the remainder RNA nucleotides or modifications thereof. In other words, an oligonucleotides as described herein is an RNA oligonucleotide wherein 1 , 2, 3, 4, or 5, preferably 1 or 2, RNA nucleotides are replaced with DNA nucleotides.

[0292] In some embodiments, an oligonucleotide as described herein comprises one or more modified or articial sugars. The same holds for the abasic nucleotide of the oligonucleotide.

[0293] In preferred embodiments, an oligonucleotide as described herein comprises one or more modified or artificial sugars. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 modified sugars. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9,10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 modified or artificial sugars.

[0294] In some embodiments, all the sugars of an oligonucleotide as described herein may be modified or artificial sugars. Alternatively, an oligonucleotide as described herein may predominantly contain modified or artificial sugars. For example, all except 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 sugars may be modified or artificial sugars.

[0295] Modified or artificial sugar (or scaffold) as described herein may include a modified version of the ribosyl moiety, such as 2’-O-modified RNA such as 2’-O-alkyl or 2’-O-(substituted)alkyl e.g. 2’-O-methyl, 2’-O-(2-cyanoethyl), 2’-O-(2-methoxy)ethyl (2’-MOE), 2’-O-(2-thiomethyl)ethyl, 2’- O-butyryl, 2’-O-propargyl, 2’-O-acetalester (such as e.g. Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2’-O-allyl, 2’-O-(2S-methoxypropyl), 2’-O-(A / -(aminoethyl)carbamoyl)methyl) (2 -AECM), 2’-O-(2-carboxyethyl) and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, 12, 6457), 2’-O-(3-amino)propyl, 2’-O-(2-(dimethylamino)ethyl), 2’-O-(2- amino)ethyl, 2’-O-(3-(dimethylamino)propyl); 2’-deoxy (DNA); 2’-O-(haloalkoxy)methyl (Arai K. etal. Bioorg. Med. Chem. 2011 , 21, 6285) e.g. 2’-O-(2-chloroethoxy)methyl (MCEM), 2’-O-(2,2- dichloroethoxy)methyl (DCEM); 2’-O-alkoxycarbonyl e.g. 2’-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2’-O-[2-(A / -methylcarbamoyl)ethyl] (MCE), 2’-O-[2-(A / ,A / -dimethylcarbamoyl)ethyl] (DCME), 2’-O-[2-(methylthio)ethyl] (2’-MTE), 2’-(w-O-serinol); 2’-halo e.g. 2’-F, FANA (2’-F arabinosyl nucleic acid); 2’,4’-difluoro-2’-deoxy; carbasugar and azasugar modifications; 3’-O- substituted e.g. 3’-O-methyl, 3’-0-butyryl, 3’-O-propargyl; 4’-substituted e.g. 4’-aminomethyl-2’- O-methyl or 4’-aminomethyl-2’-fluoro; 5’-subtituted e.g. 5’-methyl or CNA (Ostergaard et al. ACS Chem. Biol. 2014, 22, 6227); and their derivatives.

[0296] Modified or artificial sugar (or scaffold) as described herein may also include include a bicyclic nucleic acid monomer (BNA) which may be a bridged nucleic acid monomer. Each occurrence of said BNA may result in a monomer that is independently chosen from the group consisting of a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, an unlocked nucleic acid (UNA) monomer (Lankjaer N et al. Bioorg. Med. Chem. 2009, 17, 5420), a xylo-LNA monomer, an a-LNA monomer, an a-L-LNA monomer, a p-D-LNA monomer, a 2’-amino-LNA monomer, a 2’-(alkylamino)-LNA monomer, a 2’-(acylamino)-LNA monomer, a 2’-A / -substituted-2’-amino-LNA monomer, a 2’-thio-LNA monomer, a (2’-O,4’-C) constrained ethyl (cEt) BNA monomer, a (2’-O,4’-C) constrained methoxyethyl (cMOE) BNA monomer, a 2’,4’-BNANC(N-H) monomer, a 2’,4’-BNANC(N-Me) monomer, a 2’,4’-BNANC(N-Bn) monomer, an ethylene-bridged nucleic acid (ENA) monomer, a carba LNA (cLNA) monomer, a 3,4-dihydro-2 / 7-pyran nucleic acid (DpNA) monomer, a 2’-C-bridged bicyclic nucleotide (CBBN) monomer, a heterocyclic-bridged BNA monomer (such as triazolyl or tetrazolyl-linked), an amido-bridged BNA monomer, an urea-bridged BNA monomer, a sulfonamide-bridged BNA monomer, a bicyclic carbocyclic nucleotide monomer, a TriNA monomer, an a-L-TriNA monomer, a bicyclo DNA (bcDNA) monomer, an abcDNA monomer, an F-bcDNA monomer, a tricyclo DNA (tcDNA) monomer, an F-tcDNA monomer, an oxetane nucleotide monomer, a locked PMO monomer derived from 2’-amino-LNA, a guanidine-bridged nucleic acid (GuNA) monomer, a spirocyclopropylene-bridged nucleic acid (scpBNA) monomer, cyclohexenyl nucleic acid (CeNA) monomer , altriol nucleic acid (ANA) monomer, hexitol nucleic acid (HNA) monomer , fluorinated HNA (F-HNA) monomer, pyranosyl-RNA (p-RNA) monomer , 3'- deoxypyranosyl-DNA (p-DNA) monomer , glycol- or glycerol-based nucleic acid (GNA) monomer, threose-based nucleic acid (TNA) monomer, acyclic threoninol-based nucleic acid (aTNA) monomer and derivatives thereof.

[0297] In another embodiment, BNA scaffold modifications for use herein include cEt (2'- O,4'-C constrained ethyl) LNA (doi: 10.1021 / ja710342q), cMOE (2'-O,4'-C constrained methoxyethyl) LNA (Seth et al., J. Org. Chem. 2010, 75, 1569-1581), 2',4'-BNANC (N-H), 2',4'-BNANC (N- Me), ethylene-bridged nucleic acid (ENA) (doi: 10.1093 / nass / l.1.241), carba LNA (cLNA) (doi: 10.1021 / jol00170g), DpNA (Osawa et al., J. Org. Chem., 2015, 80 (21), pp 10474-10481), 2'- C-bridged bicyclic nucleotide (CBBN, as in e.g. WO 2014 / 145356 (MiRagen Therapeutics)), heterocyclic-bridged LNA (as in e.g. WO 2014 / 126229 (Mitsuoka Y et al.)), amido-bridged LNA (as in e.g. Yamamoto et al. Org. Biomol. Chem. 2015, 13, 3757), urea-bridged LNA (as in e.g. Nishida et al. Chem. Commun. 2010, 46, 5283), sulfonamide-bridged LNA (as in e.g. WO 2014 / 112463 (Obika S et al.)), bicyclic carbocyclic nucleosides (as in e.g. WO 2015 / 142910 (lonis Pharmaceuticals)), TriNA (Hanessian et al., J. Org. Chem., 2013, 78 (18), pp 9064-9075), a-L-TriNA, bicyclo DNA (bcDNA) (Bolli et al., Chem Biol. 1996 Mar;3(3): 197- 206), F-bcDNA (DOI: 10.1021 / jo402690j), tricyclo DNA (tcDNA) (Murray et al., Nucl. Acids Res., 2012, Vol. 40, No. 13 6135-6143), F-tcDNA (doi: 10.1021 / acs.joc.5b00184), or an oxetane nucleotide monomer (Nucleic Acids Res. 2004, 32, 5791 -5799). In other embodiments, BNA scaffold modifications for use herein include those disclosed in WO 2011 / 097641 (ISIS / lonis Pharmaceuticals) and WO 2016 / 017422 (Osaka University).

[0298] Preferred sugar modifications include:

[0299] - 2’-O-modified RNA, more preferably 2’-O-alkyl or 2’-O-(substituted)alkyl, even more preferably 2’-O-methyl (2’-OMe) or 2’-O-(2-methoxy)ethyl (2 -MOE)

[0300] - BNA, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer, even more preferably an LNA monomer.

[0301] More preferred sugar modifications are 2’-OMe, 2 -MOE, 2’-Fluoro, and a locked nucleic acid (LNA); most preferably 2’-OMe and LNA.

[0302] Thus, in some embodiments, an oligonucleotide as described herein comprises one or more sugar modifications which are selected from the group consisting of: 2’-O-methyl, 2’-O- methoxyethyl, 2’-Fluoro, and locked nucleic acid (LNA), preferably selected from the group consisting of 2’-O-methyl and locked nucleic acid (LNA).

[0303] In one embodiment, the antisense oligonucleotide comprises BNA modifications as selected from the set consisting of:

[0304] - a single BNA scaffold modification in the monomer at the 5'-terminus,

[0305] - a single BNA scaffold modification in the monomer at the 3'-terminus,

[0306] - two BNA scaffold modifications where one is in the monomer at the 5'-terminus and the other is in the monomer at the 3 '-terminus,

[0307] - two BNA scaffold modifications, one in the monomer at the 5'-terminus and the other in the adjacent monomer,

[0308] - two BNA scaffold modifications, one in the monomer at the 3 '-terminus and the other in the adjacent monomer, and

[0309] - four BNA scaffold modifications, one in the monomer at the 5'-terminus, one in the monomer adjacent to the 5'-terminus, one in the monomer at the 3'-terminus and one in the monomer adjacent to the 3'-terminus; In an embodiment, 1 , 2, 3, 4 or 5 additional BNA scaffold modifications are present in the antisense oligonucleotide, wherein said antisense oligonucleotide comprises 2'-O- substituted RNA monomers linked by phosphorothioate backbone linkages, wherein all cytosine bases are 5-methylcytosine, optionally wherein also all uracil bases are 5- methyluracil bases.

[0310] In some embodiments, all RNA nucleotides present in an oligonucleotide of this invention have a modified ribosyl moiety as described above. Thus, the RNA nucleotides present in an oligonucleotide of this invention are preferably selected from the group consisting of: 2’-O- modified RNA, more preferably 2’-O-alkyl or 2’-O-(substituted)alkyl, even more preferably 2’-O- methyl (2’-0Me) or 2’-O-(2-methoxy)ethyl (2 -MOE), most preferably 2’-O-methyl (2’-0Me).

[0311] In some embodiments, an oligonucleotide of this invention comprises one or more sugar modifications comprising one or more BNAs, more preferably one or more CRNs or LNAs, even more preferably one or more LNAs. In preferred embodiments, the one or more BNAs (more preferably one or more CRNs or LNAs, even more preferably one or more LNA) occur at the 5’ and / or 3’ terminus of the oligonucleotide. Thus, for example, oligonucleotides of this disclosure may comprise 1 LNA at the 5’ terminus and 1 LNA at the 3’ terminus.

[0312] All the modified sugars of the oligonucleotide defined herein may also be used in the abasic nucleotide.

[0313] In some embodiments, the abasic nucleotide is a DNA or a RNA abasic nucleotide, preferably a RNA abasic nucleotide, more preferably a modified RNA abasic nucleotide, even more preferably a RNA nucleotide with a modified sugar, and most preferably a RNA nucleotide with a 2-O’-methyl sugar.

[0314] In a preferred embodiment, an abasic nucleotide is a DNA abasic nucleotide or a RNA abasic nucleotide. A RNA abasic nucleotide is preferably a 2’0-Me RNA abasic nucleotide.. In one embodiment, an oligonucleotide of the invention comprises at least two different types of abasic nucleotides. For example an oligonucleotide of the invention may comprise a DNA abasic and a RNA abasic nucleotide (preferably a 2’0-Me RNA abasic nucleotide).

[0315] The present invention encompasses the combination of the number and pattern of abasic nucleotides earlier defined herein with the combination of modified and / or artifical sugar or scaffold moieties, such as those described above, in the same molecule.

[0316] Base of the oligonucleotide A base, sometimes called a nucleobase, may be selected from one of the natural DNA or RNA nucleobases (adenine, cytosine, guanine, thymine, and uracil). A base may also be a natural base analog (“modified base”), including artificial bases. Cytosine, thymine, and uracil are pyrimidine bases, and are generally linked to the scaffold through their 1 -nitrogen. Adenine and guanine are purine bases, and are generally linked to the scaffold through their 9-nitrogen. Preferred bases and modified bases including artificial bases are described later herein.

[0317] As described above, oligonucleotides as described above may comprise “natural” nucleobases as well as modified nucleobases (including artifical bases). Combinations of distinct modified or artificial bases within one molecule are encompassed.

[0318] The term “base modification” or “modified base” as identified herein refers to the modification of a naturally occurring base in RNA (i.e. pyrimidine or purine base) or to the de novo synthesis of a base. This de novo synthesized base could be qualified as “modified” by comparison to an existing base.

[0319] If such a base is a modified base or if a base analog is being used, said modified base or base analog should preferably keep the same base pair specificity as the base it replaces. “Base pairing” refers to the binding of two bases (or nucleobases) to each other by hydrogen bonds. Specifically, a nucleobase analog replacing cytosine is capable of base pairing with guanine, a nucleobase analog replacing guanine is capable of base pairing with cytosine, a nucleobase analog replacing adenine is capable of base pairing with uracil and a nucleobase analog replacing uracil is capable of base pairing with adenine.

[0320] In preferred embodiments, an oligonucleotide as described herein comprises one or more modified or artificial bases. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 modified bases. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9,10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 modified or artificial bases.

[0321] In some embodiments, all the bases of an oligonucleotide as described herein may be modified or artificial bases (except for the abasic nucleotides which of course do not contain any bases) . Alternatively, an oligonucleotide as described herein may predominantly contain modified or artificial bases. For example, all except 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases may be modified or artificial bases.

[0322] Modified or artificial bases as used herein may include modified versions of the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine (as present in e.g. inosine), orotic acid, agmatidine, lysidine, pseudouracil, N1- methylpseudouracil, dihydrouracil, N3-uracil, N1-methyl-pseudouracil, 5-formylcytosine, 5- acetylcytosine, 5-hydroxycytosine, N6-methyladenine, 8-oxoadenine, 7-methyladenine, 1 - methylguanine, 7-methylguanine, N2,N2-dimethylguanine, N2,N2,7-trimethylguanine, N2,7- dimethylguanine, 6-amino-5-nitropyridin-2-one, 2-thiopyrimidine (e.g. 2-thiouracil, 2- thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-halouracil, 5- propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-methyluracil (thymine), 5-methylcytosine, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7- deazaguanine, 7-deazaadenine, 2,6-diaminopurine, 7-aza-2,6-diaminopurine, 8-aza-7- deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or derivatives thereof; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl- 2-aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1 -deoxyribose, 1 ,2-dideoxyribose, 1 -deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in US patent 6,683,173 (Epoch Biosciences), which is incorporated here by reference.

[0323] Preferred modified bases include 5-methylcytosine, 5-methyluracil,, cytosine analogs, and uracil analogs. A cytosine analog may be a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analog which is a pyrimidine base is pseudoisocytosine. A particular example of a cytosine analog which is a pyridine base is 6- amino-5-nitropyridin-2-one (also known as 6-amino-5-nitro-2(1 H)-pyridinone or Benner’s Z base). Particularly preferred modified bases include 5-methylcytosine, 5-methyluracil and 6- amino-5-nitropyridin-2-one.

[0324] In some embodiments, an oligonucleotide as described herein comprises one or more modified or artificial bases. In some embodiments, the one or more modified or artificial bases are selected from the group consisting of 5-methylcytosine, 5-methyluracil, cytosine analogs, and uracil analogs, preferably selected from the group consisting of 5-methylcytosine, and cytosine analogs. In some embodiments, the one or more modified or artificial bases include one or more 5-methylcytosine, 5-methyluracil and one or more cytosine analogs.

[0325] In some embodiments, oligonucleotides as described herein comprise one or more cytosine analogs. A preferred number of cytosine analogs is 1 .

[0326] In an embodiment, oligonucleotides of the invention do not comprise any hypoxanthine bases. In an embodiment, oligonucleotides of the invention do not comprise any inosine.

[0327] In some embodiments, an oligonucleotide of the invention comprises at least one base modification that increases binding affinity to target strands, increases melting temperature of the resulting duplex of said oligonucleotide with its target, and / or decreases immunostimulatory effects, and / or increases biostability, and / or improves biodistribution and / or intra-tissue distribution, and / or cellular uptake and trafficking. In an embodiment, an oligonucleotide of the invention comprises a 5-methylpyrimidine. A 5-methylpyrimidine base is selected from a 5- methylcytosine and / or a 5-methyluracil.

[0328] The terms “thymine” and “5 -methyluracil” may be interchanged throughout the application. As used herein the expression “oligonucleotide comprises a 5-methylpyrimidine” means that at least one of the cytosine nucleobases of said oligonucleotide has being modified by substitution of the hydrogen at the 5-position of the pyrimidine ring with a methyl group, i.e. a 5-substituted cytosine, and / or that at least one of the uracil nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group (i.e. a 5 -methyluracil). As used herein, the expression “the substitution of a hydrogen with a methyl group in position 5 of the pyrimidine ring” may be replaced by the expression “the substitution of a pyrimidine with a 5-methylpyrimidine,” with pyrimidine referring to only uracil, only cytosine, or both. Where an oligonucleotide of the invention has two or more such base modifications, said base modifications may be identical, for example all such modified bases in the oligonucleotide are 5-methylcytosine, or said base modifications may be combinations of different base modifications, for example the oligonucleotide may have one or more 5- methylcytosines and one or more 5-methyluracils.

[0329] In some embodiments, an oligonucleotide of the invention comprises one or more 5- methylcytosines. In some embodiments, a single 5-methylcytosine is present. In some embodiments, the one or more 5-methylcytosines comprise at least one 5-methylcytosine at the 5’ terminus. In some embodiments, the single 5-methylcytosine occurs at the 5’ terminus. Thus, oligonucleotides described herein may have a 5’ terminal residue comprising a 5- methylcytosine.

[0330] If said oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines and uracils, at least 1 , 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines and / or uracils respectively have been modified this way. Preferably all cytosines have been modified this way or replaced by 5-methylcytosine. Preferably all uracils have been modified this way or replaced by 5-methyluracil.

[0331] The present invention encompasses the combination of the number and pattern of abasic nucleotides earlier defined herein with the combination of modified and / or artifica I nucleobases such as those described above, in the same molecule.

[0332] Internucleoside linkage of the oligonucleotide A nucleotide is generally connected to neighbouring nucleotides through condensation of its 5’- phosphate moiety to the 3’-hydroxyl moiety of the neighbouring nucleotide monomer. Similarly, its 3’-hydroxyl moiety is generally connected to the 5’-phosphate of a neighbouring nucleotide monomer. This forms phosphodiester bonds. The phosphodiesters and the scaffold form an alternating copolymer. The bases are grafted to this copolymer, namely to the scaffold moieties. Because of this characteristic, the alternating copolymer formed by linked monomers of an oligonucleotide is often called the backbone of the oligonucleotide. Because the phosphodiester bonds connect neighbouring monomers together, they are often referred to as backbone linkages, internucleoside linkages or simply linkages or simply backbone. It is understood that when a phosphate group is modified so that it is instead an analogous moiety such as a phosphorothioate, such a moiety is still referred to as the “backbone linkage”, “internucleoside linkage”, or simply “linkage” or simply “backbone” of the monomer. This is referred to as a linkage modification. In general terms, the backbone of an oligonucleotide is thus comprised of alternating scaffolds and (backbone) linkages. Preferred linkages and linkage modifications including artificial linkages are described later herein.

[0333] Thus an oligonucleotide having 10 nucleotides may contain 9 linkages, linking the 10 ribose units of the 10 nucleotides together. Additionally, there may be one or more last linkage(s) present at one or both sides of the oligonucleotide, which is only connected to one nucleotide. The terms “linkage”, “internucleoside linkage”, “backbone linkage” and “backbone” are also meant to indicate such a pendant linkage. In some embodiments, at least one of the linkages in the backbone of the oligonucleotide according to the invention is modified. In some embodiments, a modifed internucleoside linkage consists of a phosphorothioate moiety, linking two ribose units. Thus, in some embodiments, at least one of the naturally occurring 3' to 5' phosphodiester moieties present in RNA is replaced by a non-natural moiety.

[0334] As described above, oligonucleotides of this invention may comprise “natural” phosphodiester linkages as well as modified linkages (including artifical linkages). Combinations of distinct modified or artificial linkages within one molecule are encompassed. The same holds for the abasic nucleotide of the oligonucleotide.

[0335] Modified or artificial linkages as disclosed herein may include modified versions of the phosphodiester present in natural DNA and RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, (R)-phosphorothioate, (S)-phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate (thioPACE), thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, and other alkyl phosphonate (such as 3’-alkylene phosphonate and 5’-alkylene phophonate, Chiral phosphonate, phosphinate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate), methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, phosphate, phosphotriester, aminoalkylphosphotriester, and their derivatives. Among these, phosphorothioate (PS) is preferred.

[0336] Modified or artificial linkages as disclosed herein may also include phosphoryl guanidines, acylphosphoramidates, sulfonylphosphoramidates, phosphoramidite, phosphoramidate, N3’->P5’ phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, thioformacetyl, methylene formacetyl, alkenyl, methylenehydrazino, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamido nucleic acid (TANA); and their derivatives. Among these, phosphoryl guanidines are preferred. A preferred example of a phosphoryl guanidine internucleoside linkage is dimethylimidazolidin-2-ylidene (dmi)- phosphoramidate.

[0337] In some embodiments, an oligonucleotide as described herein comprises one or more modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or 1 1 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 10 or 11 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 10 or 11 modified or artificial internucleoside linkages.

[0338] Modified or artifical internucleoside linkages may preferably occur in the 5’ and 3’ termini of the oligonucleotides.

[0339] All the modified or artificial internucleoside linkage defined herein for the oligonucleotide may also be used in the abasic nucleotide of the oligonucleotide.

[0340] In preferred embodiments, an oligonucleotide as described herein comprises one or more artificial or modified internucleoside linkage, preferably phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 artificial or modified internucleotide linkage, preferably phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9,10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40 or 41 artificial or modified internucleotide linkage, preferably phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 1 7 artificial or modified internucleotide linkage, preferably phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 17 artificial or modified internucleotide linkage, preferably phosphorothioate internucleoside linkages.

[0341] In some embodiments, an oligonucleotide as described herein may also consist of modified or artificial internucleotide linkage, preferably phosphorothioate internucleoside linkages. This means that all internucleoside linkages in the oligonucleotide are modified or artificial, preferably are phosphorothioate internucleoside linkages. Alternatively, an oligonucleotide as described herein may predominantly contain modified or artificial internucleotide linkage, preferably phosphorothioate internucleoside linkages. For example, all except 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 internuclsoide linkages may be modified or artificial, preferably phosphorothioate internucleoside linkages.

[0342] In preferred embodiments of oligonucleotides comprising one or more phosphorothioate linkages, phosphorothioate linkages occur in the 5’ and 3’ termini of the oligonucleotides.

[0343] Thus, in some embodiments, an oligonucleotide as described herein comprises phosphorothioate internucleoside linkages between the terminal two, three, four, five, or six residues at the 5’ terminus and / or between the terminal two, three, four, five, or six residues at the 3’ terminus. Phosphorothioate linkages preferably occur both at the 5’ terminus and the 3’ terminus.

[0344] All the modified or artificial internucleotide linkages defined herein may also be used for the abasic nucleotide of the oligonucleotide.

[0345] In some embodiments, the abasic nucleotide is a DNA or a RNA abasic nucleotide, preferably a RNA abasic nucleotide, more preferably a modified RNA abasic nucleotide, even more preferably a RNA nucleotide with a modified sugar, and most preferably a RNA nucleotide with a 2-O’-methyl sugar.

[0346] The present invention encompasses the combination of the number and pattern of abasic nucleotides earlier defined herein with the combination of modified and / or artifical internucleoside linkages, such as those described above, in the same molecule.

[0347] Combination of modifications in the oligonucleotide

[0348] It is customary to combine modified and / or artifical internucleoside linkages, nucleobases and sugar or scaffold moieties, such as those described above, in the same molecule. The present invention encompasses the combination of the number and pattern of abasic nucleotides earlier defined herein with the combination of modified and / or artifical internucleoside linkages, nucleobases and sugar or scaffold moieties, such as those described above, in the same molecule.

[0349] In some embodiments, an oligonucleotide of the invention

[0350] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0351] H-(CUG )m-H (SEQ ID NO:2)

[0352] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0353] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0354] H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0355] Bases: G=guanine; C=5-methylcytosine; U=Uracil,

[0356] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0357] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) comprises a 2’-O-methyl RNA nucleotide residue, has a backbone wherein at least one phosphate moiety is replaced by a phosphorothioate moiety, comprises 50 or preferably 42 nucleotides (i.e. it comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 nucleotides).

[0358] In some embodiments, an oligonucleotide of the invention

[0359] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0360] H-(CUG )m-H (SEQ ID NO:2)

[0361] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0362] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0363] H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0364] Bases: G=guanine; C=5-methylcytosine; U=Uracil;.

[0365] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0366] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) consists of 2’-O-methyl RNA nucleotide residues and has a backbone wherein all phosphate moieties are replaced by phosphorothioate, and comprises 50 or preferably 42 nucleotides (i.e. it comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 nucleotides) and a 5-methylpyrimidine base. In an embodiment, the 5-methylpyrimidine base is selected from a 5-methylcytosine and / or a 5- methyluracil.

[0367] In some embodiments, the oligonucleotide of the invention

[0368] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0369] H-(CUG )m-H (SEQ ID NO:2)

[0370] H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0371] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0372] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0373] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) comprises a 2’-O-methyl phosphorothioate RNA nucleotide residue, or consists of 2’-O-methyl phosphorothioate RNA nucleotide residues. Such oligonucleotide comprises a 2’-O-methyl RNA residue, which is connected through a phosphorothioate linkage to the next nucleotide in the sequence. This next nucleotide may be, but not necessarily, another 2’-O-methyl phosphorothioate RNA nucleotide residue. Alternatively, such oligonucleotide consists of 2’-O- methyl phosphorothioate RNA nucleotide residues, wherein all nucleotides comprise a 2’-O- methyl moiety and a phosphorothioate moiety. Preferably, such oligonucleotide consists of 2’- O-methyl phosphorothioate RNA nucleotide residues. Such chemistry is known to the skilled person. Throughout the application, an oligonucleotide comprising a 2’-O-methyl RNA residue and a phosphorothioate linkage may be replaced by an oligonucleotide comprising a 2’-O- methyl phosphorothioate RNA nucleotide residue or an oligonucleotide comprising a 2’-O- methyl phosphorothioate RNA residue. Throughout the application, an oligonucleotide consisting of 2’-O-methyl RNA residues linked by or connected through phosphorothioate linkages or an oligonucleotide consisting of 2’-O-methyl phosphorothioate RNA nucleotide residues may be replaced by an oligonucleotide consisting of 2’-O-methyl phosphorothioate RNA.

[0374] In some embodiments, an oligonucleotide of the invention

[0375] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0376] H-(CUG )m-H (SEQ ID NO:2)

[0377] H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0378] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0379] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0380] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0381] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) comprises a 2’-O-methyl RNA nucleotide residue, has a backbone wherein at least one phosphate moiety is replaced by a phosphorothioate moiety, and comprises one or more 5- methylpyrimidine.

[0382] In some embodiments an oligonucleotide of the invention

[0383] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0384] H-(CUG )m-H (SEQ ID NO:2)

[0385] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0386] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0387] H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0388] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0389] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0390] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0391] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) comprises a modified base which is 5-methylcytosine and / or 5-methyluracil, a modified sugar which is 2-O’-methyl and / or a modified internucleotide linkage which is phosphorothioate.

[0392] In some embodiments, an oligonucleotide of the invention

[0393] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0394] H-(CUG )m-H (SEQ ID NO:2)

[0395] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0396] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0397] H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0398] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0399] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0400] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0401] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) consists of 2’-O-methyl RNA nucleotide residues and has a backbone wherein all phosphate moieties are replaced by phosphorothioate moieties, and comprises one or more 5- methylpyrimidine) and is such that it does not comprise a 2’-deoxy 2’-fluoro nucleotide (i.e. 2’- deoxy 2’-fluoro-adenosine, -guanosine, - uridine and / or -cytidine). Such oligonucleotide comprising a 2’-fluoro (2’-F) nucleotide has been shown to be able to recruit the interleukin enhancer-binding factor 2 and 3 (ILF2 / 3) and is thereby able to induce exon skipping in the targeted pre-mRNA when the oligonucleotide binds to an intronic sequence near, preferably downstream of, the exon to be skipped (Rigo F, et al, WO201 1 / 097614). In the current invention, the oligonucleotide used binds to specific (CAG)n-containing sequences within exons, does not recruit ILF2 / 3 factors and / or form heteroduplexes with RNA that are specifically recognized by ILF2 / 3 factors. The mechanism of action of the oligonucleotide of the current invention is distinct from the one of an oligonucleotide with a 2’-F nucleotide: the oligonucleotide of the invention is reducing the translation rate of a mutant transcript comprising a repetitive nucleotide unit (CAG)n in an exon, by sterically hindering translation initiation and / or elongation, and / or to disrupt the open reading frame of the mutant transcripts through specific skipping of the (CAG)n containing exon which introduces a stop codon, resulting in reduced, decreased, or lower levels of mutant protein, s

[0402] In some embodiments, oligonucleotides of the invention

[0403] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0404] H-(CUG )m-H (SEQ ID NO:2)

[0405] H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0406] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0407] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0408] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) comprise the following internucleoside linkage modifications: phosphorothioate internucleoside linkages between the terminal two, three, four, five, or six, preferably six, residues at the 5’ terminus and between the terminal two, three, four, five, or six, preferably six, residues at the 3’ terminus;

[0409] In some embodiments, oligonucleotides of the invention

[0410] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0411] H-(CUG )m-H (SEQ ID NO:2)

[0412] H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0413] H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0414] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0415] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0416] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0417] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) comprise the following sugar modifications: each RNA nucleotide is 2’-O-modified RNA, more preferably 2’-O-alkyl or 2’-O- (substituted)alkyl, even more preferably 2’-O-methyl (2’-0me) or 2’-O-(2-methoxy)ethyl (2 -MOE); at least 1 BNA at the 5’ terminus and / or at least 1 BNA at the 3’ terminus and / or at least 1 internal BNA, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA; or advantageously, a combination of the above.

[0418] In some embodiments, oligonucleotides of the invention

[0419] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0420] H-(CUG )m-H (SEQ ID NO:2)

[0421] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0422] H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0423] Bases: G=guanine; C=5-methylcytosine; U=Uracil,

[0424] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0425] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) are 2’-O-modified RNA oligonucleotides (preferably 2’-O-alkyl or 2’-O-(substituted)alkyl, even more preferably 2’-O-methyl (2’-0me) or 2’-O-(2-methoxy)ethyl (2 -MOE, most preferably 2’- O-methyl) comprising the following sugar modifications^ least 1 BNA at the 5’ terminus and / or at least 1 BNA at the 3’ terminus and / or at least 1 internal BNA, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA

[0426] In some embodiments, oligonucleotides of the invention

[0427] (i.e. comprising the following base sequence (or repeat sequence) is represented by:

[0428] H-(CUG )m-H (SEQ ID NO:2) H-UG-(CUG)m-CU-H (SEQ ID N0:3)

[0429] H-G-(CUG)m-CU-H (SEQ ID N0:4) H-UG-(CUG)m-C-H (SEQ ID N0:5) H-G-(CUG)m-C-H (SEQ ID N0:6)

[0430] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0431] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0432] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) comprise the following nucleobase modifications: a 5-methylcytosine base at the 5’ terminus.

[0433] A preferred oligonucleotide of the invention comprises or consists of an RNA molecule or a modified RNA molecule. In a preferred embodiment, an oligonucleotide is single stranded. The skilled person will understand that it is however possible that a single stranded oligonucleotide may form an internal double stranded structure. However, this oligonucleotide is still named a single stranded oligonucleotide in the context of this invention.

[0434] A single stranded oligonucleotide has several advantages compared to a double stranded siRNA oligonucleotide: (i) its synthesis is expected to be easier than two complementary siRNA strands; (ii) there is a wider range of chemical modifications possible to enhance uptake in cells, a better (physiological) stability and to decrease potential generic adverse effects; (iii) siRNAs have a higher potential for non-specific effects (including off-target genes) and exaggerated pharmacology (e.g. less control possible of effectiveness and selectivity by treatment schedule or dose) and (iv) siRNAs are less likely to act in the nucleus and cannot be directed against introns.

[0435] In this embodiment, the single stranded oligonucleotide of the invention has a mechanism of action which is thought to be distinct from the one of a corresponding double stranded oligonucleotide (siRNA) as illustrated in Liu J. et al. (Liu J. et al 2013). Liu J. et al disclose that siRNAs comprising internal abasic nucleotide(s) and targeting a repetitive nucleotide unit (CAG)n in a target transcript inhibit both mutant HTT and mutant ATX-3. This inhibition involves RNAi protein argonaute 2 (AGO2), even though the abasic substitution disrupts the catalytic cleavage of RNA target by argonaute 2. The presence of central abasic substitutions blocks the slicer function of AGO2. In an embodiment, the oligonucleotide of the invention does not recruit AGO2. In an embodiment, the oligonucleotide of the invention does not reduce the absolute amount of mutant transcripts by slicing. In an embodiment, the oligonucleotide of the invention reduces processing and / or translation of mutant proteins as explained herein. Therefore in an embodiment, the oligonucleotide of the invention is single stranded and / or does not comprise an internal abasic nucleotide. In an embodiment, the oligonucleotide of the invention does not improve allele-selectivity.

[0436] Thus, the preferred oligonucleotide according to one aspect of the invention comprises the following base sequence represented by:

[0437] H-(CUG )m-H (SEQ ID NO:2)

[0438] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0439] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0440] H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0441] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0442] Bases: G=guanine; C=5-methylcytosine; U=Uracil

[0443] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0444] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides.

[0445] In some embodiments said oligonucleotide further comprises the following modification:

[0446] (a) at least one base modification selected from 5-methylpyrimidine; and / or

[0447] (b) at least one sugar modification, which is 2’-O-methyl,

[0448] (c) at least one backbone modification, which is phosphorothioate and / or

[0449] (d) at least one of the abasic nucleotides is a modified RNA abasic nucleotide, preferably a RNA nucleotide with a 2-O’-methyl sugar.

[0450] Thus, a preferred oligonucleotide according to this aspect of the invention comprises the following base sequence represented by:

[0451] H-(CUG )m-H (SEQ ID NO:2)

[0452] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0453] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0454] H-UG-(CUG)m-C-H (SEQ ID NO:5)

[0455] H-G-(CUG)m-C-H (SEQ ID NO:6)

[0456] Bases: G=guanine; C=5-methylcytosine; U=Uracil,

[0457] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0458] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides

[0459] And: a base modification (a) and no sugar modification (b) and no backbone modification

[0460] (c), a sugar modification (b) and no base modification (a) and no backbone modification

[0461] (c), a backbone modification (c) and no base modification (a) and no sugar modification

[0462] (b).

[0463] Also oligonucleotides having none of the above-mentioned modifications are understood to be covered by the present invention, as well as oligonucleotides comprising two, i.e. (a) and (b), (a) and (c) and / or (b) and (c), or all three of the modifications (a), (b) and (c), as defined above.

[0464] In another preferred embodiment, any of the oligonucleotides as described in the previous paragraph may comprise:

[0465] (a) at least one base modification selected from 2-thiouracil, 2-thiothymine, 5- methylcytosine, 5-methyluracil, thymine,; and / or

[0466] (b) at least one sugar modification selected from 2’-O-methyl, 2’-O-(2-methoxy)ethyl, 2’- deoxy (DNA), morpholino, a bridged nucleotide or BNA, or the oligonucleotide comprises both bridged nucleotides and 2’-deoxy modified nucleotides (BNA / DNA mixmers);

[0467] (c) at least one backbone modification selected from (another) phosphorothioate or phosphordiamidate and / or

[0468] (d) at least one of the abasic nucleotides is a modified RNA abasic nucleotide, preferably a RNA nucleotide with a 2-O’-methyl sugar.

[0469] In another preferred embodiment, the oligonucleotide according to the invention is modified over its entire length with one or more of the same modification, selected from (a) one of the base modifications; and / or (b) one of the sugar modifications; and / or (c) one of the backbone modifications.

[0470] With the advent of nucleic acid mimicking technology, it has become possible to generate molecules that have a similar, preferably the same hybridization characteristics in kind not necessarily in amount as nucleic acid itself. Such functional equivalents are of course also suitable for use in the invention.

[0471] The skilled person will understand that not each sugar, base, and / or backbone may be modified the same way. Several distinct modified sugars, bases and / or backbones may be combined into one single oligonucleotide of the invention.

[0472] A person skilled in the art will also recognize that there are many synthetic derivatives of oligonucleotides.

[0473] Preferably, said oligonucleotide comprises RNA, as RNA / RNA duplexes are very stable. It is preferred that an RNA oligonucleotide comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases, exonucleases, and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, increased activity, reduced toxicity, increased intracellular transport, tissue-specificity, etc. In addition, the mRNA complexed with the oligonucleotide of the invention is preferably not susceptible to RNaseH cleavage. Preferred modifications have been identified above.

[0474] Oligonucleotides containing at least in part naturally occurring DNA nucleotides are useful for inducing degradation of DNA-RNA hybrid molecules in the cell by RNase H activity (EC.3.1 .26.4).

[0475] Naturally occurring RNA ribonucleotides or RNA-like synthetic ribonucleotides comprising oligonucleotides are encompassed herein to form double stranded RNA-RNA hybrids that act as enzyme-dependent antisense through the RNA interference or silencing (RNAi / siRNA) pathways, involving target RNA recognition through sense-antisense strand pairing followed by target RNA degradation by the RNA-induced silencing complex (RISC).

[0476] Alternatively or in addition, an oligonucleotide can interfere with the processing of precursor RNA (steric blocking, RNaseH independent processes) in particular but not limited to RNA splicing and exon skipping, by binding to a target sequence of precursor RNA and getting in the way of processes such as blocking of splice donor or splice acceptor sites or exonic or intronic splicing enhancers or silencers.

[0477] Moreover, the oligonucleotide may inhibit the binding of proteins, nuclear factors and others by steric hindrance and / or interfere with the authentic spatial folding of the target precursor RNA and / or bind itself to proteins that originally bind to the target precursor RNA, thereby interfering with RNA splicing (such as inducing exon skipping) thereby leading to the decrease in amount of the corresponding diseased protein in diseases like HD as identified later herein.

[0478] Alternatively or in addition, an oligonucleotide can interfere with the expression of messenger RNA (steric blocking, RNaseH independent processes) by binding to a target sequence of RNA transcript and getting in the way of processes such as translation initiation or elongation. Moreover, the oligonucleotide may inhibit the binding of proteins, nuclear factors and others by steric hindrance and / or interfere with the authentic spatial folding of the target RNA and / or bind itself to proteins that originally bind to the target RNA and / or interfere with the formation or elongation of the ribosomal complex, and / or have other effects on the target RNA, thereby contributing to the reduction of the translation rate of the target RNA thereby leading to the decrease in amount of the corresponding diseased protein in diseases like HD as identified later herein.

[0479] In some preferred embodiments, m is 7, the base (or repeat) sequence of the oligonucleotide is

[0480] H-(CUG )?-H (SEQ ID NO:33) and the abasic nucleotides represented by X are at the following positions within the base (or repeat) sequence of the oligonucleotide of the invention:

[0481] Position 11 . A preferred oligonucleotide is represented by SEQ ID NO:7: CUGCUGCUGCXGCUGCUGCUG Position 18. A preferred oligonucleotide is represented by SEQ ID NO:8: CUGCUGCUGCUGCUGCUXCUG

[0482] Positions 4 and 11 . A preferred oligonucleotide is represented by SEQ ID NO:9: CUGXUGCUGCXGCUGCUGCUG

[0483] Positions 11 and 18. A preferred oligonucleotide is represented by SEQ ID NQ:10: CUGCUGCUGCXGCUGCUXCUG

[0484] Positions 4, 6 and 8. A preferred oligonucleotide is represented by SEQ ID NO:11 : CUGXUXCXGCUGCUGCUGCUG

[0485] Positions 4, 5 and 6. A preferred oligonucleotide is represented by SEQ ID NO:12: CUGXXXCUGCUGCUGCUGCUG

[0486] Positions 10, 11 and 12. A preferred oligonucleotide is represented by SEQ ID NO:13: CUGCUGCUGXXXCUGCUGCUG

[0487] Positions 16, 17 and 18. A preferred oligonucleotide is represented by SEQ ID NO:14: CUGCUGCUGCUGCUGXXXCUG

[0488] (Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide)

[0489] The oligonucleotides SEQ ID NO:7-14 are single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

[0490] And said oligonucleotide may further be derived from the oligonucleotides defined above. They may comprise a 2’-O-methyl RNA nucleotide residue, has a backbone wherein at least one phosphate moiety is replaced by a phosphorothioate moiety, and comprises one or more 5- methylpyrimidine. In this preferred embodiment, at least one of the cytosines of each of these oligonucleotides has been replaced by a 5’-methyl cytosine and at least one of their uracil has been replaced by a 5’-methyl uracil.

[0491] In a preferred embodiment, each of said preferred oligonucleotide consists of 2’-O-methyl RNA nucleotide residues and has a backbone wherein all phosphate moieties are replaced by phosphorothioate moieties, and comprises one or more 5-methylpyrimidine. Even more preferably, each of their cytosines has been replaced by a 5’-methyl cytosine and / or each of their uracils by a 5’-methyl uracil.

[0492] In a preferred embodiment, at least one abasic nucleotide is a DNA abasic nucleotide ( represented by X) or a RNA abasic nucleotide. A RNA abasic nucleotide is preferably a 2’0- Me RNA abasic nucleotide (represented by Y). More preferred abasic nucleotides are DNA or 2’0-Me RNA abasic nucleotides. In one embodiment, an oligonucleotide of the invention comprises at least two different types of abasic nucleotides. For example an oligonucleotide of the invention may comprise a DNA abasic and a RNA abasic nucleotide (preferably a 2’0-Me RNA abasic nucleotide). In some preferred embodiments, m is 7, the base (or repeat) sequence of the oligonucleotide is

[0493] H-(CUG )?-H (SEQ ID NO:33) and the oligonucleotide comprises:

[0494] 1 abasic nucleotide is located at the 5’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO: 15: XCUGCUGCUGCUGCUGCUGCUG

[0495] 2 abasic nucleotides are located at the 5’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO: 16: XXCUGCUGCUGCUGCUGCUGCUG

[0496] 3 abasic nucleotides are located at the 5’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO: 17: XXXCUGCUGCUGCUGCUGCUGCUG

[0497] 1 abasic nucleotide is located at the 3’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO: 18: CUGCUGCUGCUGCUGCUGCUGX

[0498] 2 abasic nucleotide are located at the 3’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NO: 19: CUGCUGCUGCUGCUGCUGCUGXX

[0499] 3 abasic nucleotide are located at the 3’ of its base (or repeat) sequence. In an embodiment, the sequence of the oligonucleotide is SEQ ID NQ:20: CUGCUGCUGCUGCUGCUGCUGXXX

[0500] (Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide)

[0501] The oligonucleotides SEQ ID NQ:15-20 are single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

[0502] And said oligonucleotide may further be derived from the oligonucleotides defined above. They may comprise a 2’-O-methyl RNA nucleotide residue, has a backbone wherein at least one phosphate moiety is replaced by a phosphorothioate moiety, and comprises one or more 5- methylpyrimidine bases. In this preferred embodiment, at least one of the cytosines of each of these oligonucleotides has been replaced by a 5’-methyl cytosine and at least one of their uracil has been replaced by a 5’-methyl uracil.

[0503] In a preferred embodiment, each of said preferred oligonucleotide consists of 2’-O-methyl RNA nucleotide residues and has a backbone wherein all phosphate moieties are replaced by phosphorothioate moieties, and comprises one or more 5-methylpyrimidine. Even more preferably, each of their cytosine has been replaced by a 5’-methyl cytosine and / or each of their uracil by a 5’-methyl uracil.

[0504] In a preferred embodiment, at least one abasic nucleotide is a DNA abasic nucleotide or a RNA abasic nucleotide. A RNA abasic nucleotide is preferably a 2’0-Me RNA abasic nucleotide. More preferred abasic nucleotides are DNA and 2’0-Me RNA abasic nucleotides. In one embodiment, an oligonucleotide of the invention comprises at least two different types of abasic nucleotides. For example an oligonucleotide of the invention may comprise a DNA abasic and a RNA abasic nucleotide (preferably a 2’0-Me RNA abasic nucleotide).

[0505] In an embodiment, the base sequence of the oligonucleotide comprises or consists of or essentially consists of any of SEQ ID NO:101 - SEQ ID NO:76520. These base sequences are designed from

[0506] H-(CUG )m-H (SEQ ID NO:76524)

[0507] H-UG-(CUG)m-CU-H (SEQ ID NO:76525)

[0508] H-G-(CUG)m-CU-H (SEQ ID NO:76526)

[0509] H-UG-(CUG)m-C-H (SEQ ID NO:76527) H-G-(CUG)m-C-H (SEQ ID NO:76528)

[0510] Bases: G=guanine; C= is cytosine or 5-methylcytosine; U=Uracil;

[0511] In the oligonucleotides comprising or consisting or essentially consisting of SEQ ID NQ:101 - SEQ ID NQ:76520, the abasic nucleotide is represented by Q and may be any abasic nucleotide, all C are cytosine or 5-methylcytosine, G is guanine.

[0512] Wherein m is 5, 6, 7, 8 or 9 and up to 3 of the nucleotides of the oligonucleotide are abasic nucleotides. The abasic nucleotide(s) may be internal or external to the base sequence of the oligonucleotide listed above.

[0513] In an embodiment, each of said oligonucleotide comprises a 2’-O-methyl RNA nucleotide residue, has a backbone wherein at least one phosphate moiety is replaced by a phosphorothioate moiety, and / or comprises one or more 5-methylpyrimidine bases. In this embodiment, at least one of the cytosines of each of these oligonucleotides has been replaced by a 5’-methyl cytosine and / or at least one of their uracils has been replaced by a 5’-methyl uracil.

[0514] In a preferred embodiment, each of said preferred oligonucleotide consists of 2’-O-methyl RNA nucleotide residues and has a backbone wherein all phosphate moieties are replaced by phosphorothioate moieties, and comprises one or more 5-methylpyrimidine. Even more preferably, each of their cytosines has been replaced by a 5’-methyl cytosine and / or each of their uracils by a 5’-methyl uracil.

[0515] In a preferred embodiment, at least one abasic nucleotide is a DNA abasic nucleotide or a RNA abasic nucleotide. A RNA abasic nucleotide is preferably a 2’0-Me RNA abasic nucleotide. More preferred abasic nucleotides are DNA and 2’0-Me RNA abasic nucleotides. In one embodiment, an oligonucleotide of the invention comprises at least two different types of abasic nucleotides. For example an oligonucleotide of the invention may comprise a DNA abasic and a RNA abasic nucleotide (preferably a 2’0-Me RNA abasic nucleotide).

[0516] In the context of this application, the following oligonucleotides of the invention are not: CUG CUG CUG CUG CUG CUG CUG QQQQ (SEQ ID NO: 76521) (C is 5-methylcytosine, Q is an abasic nucleotide, all sugars of the base sequence are 2-O’methyl sugars and all internucleotide linkages of the base sequence are phosphorothioate) This oligonucleotide is identified by SEQ ID ID NO: 220 in WO 2013 / 162363.

[0517] CUG CUG CUG CUG CUG CUG CUG QQQQ (SEQ ID NO: 76522) (C is 5-methylcytosine, C is cytosine and Q is an abasic nucleotide, all sugars of the base sequence are 2-O’methyl sugars and all internucleotide linkages of the base sequence are phosphorothioate). This oligonucleotide is identified by SEQ ID NO:221 in WO 2013 / 162363.

[0518] The present invention encompasses the combination of the number and pattern of abasic nucleotides earlier defined herein with the combination of modified and / or artifical internucleoside linkages, nucleobases and sugar or scaffold moieties, such as those described above, in the same molecule.

[0519] In some embodiments, the internucleoside linkage modifications, sugar modifications, and nucleobase modifications described above for the nucleobases of the oligonucleotide and for abasic nucleotides of the oligonucleotide are combined in the same oligonucleotide / molecule.

[0520] In some embodiments, an oligonucleotide of this invention comprises or consists of any one of SEQ ID NOs:2-6, 7-20, 33-37, 41-100, 76523. Also encompassed are oligonucleotides having a base sequence comprising or consisting of a sequence having up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 mutation(s) compared to the base sequence of any one of SEQ ID NOs: 2-6, 7-20, 33-37, 41-100, 76523 as long as the oligonucleotide comprises 1 , 2, 3, 4, 4, 5 or 6 abasic nucleotides as earlier defined herein. Mutations include additions, insertions, deletions and substitutions. Also encompassed are oligonucleotides having a base sequence comprising or consisting of a sequence having at least 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of SEQ ID NOs: 2-6, 33-37. Mutations include additions, insertions, deletions and substitutions. A preferred level of sequence identity is 80%. Another preferred level of sequence identity is 85%. Another preferred level of sequence identity is 90%. Another preferred level of sequence identity is 95%. Another preferred level of sequence identity is 97%.

[0521] In some embodiments, an oligonucleotide of this invention comprises or consists of any one of SEQ ID NOs: 101-76520. Also encompassed are oligonucleotides having a mutation compared to SEQ ID NO NO: 101 -76520 as long as the oligonucleotide still comprises at least one abasic nucleotide and / or still comprises the same number of abasic nucleotide as SEQ ID NO: 101 - 76520. Such mutation may include additions, insertions, deletions and substitutions. Also encompassed are oligonucleotides having a base sequence comprising or consisting of a sequence having at least 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of SEQ ID NOs: 7-20, 101-76520. Mutations include additions, insertions, deletions and substitutions. A preferred level of sequence identity is 80%. Another preferred level of sequence identity is 85%. Another preferred level of sequence identity is 90%. Another preferred level of sequence identity is 95%. Another preferred level of sequence identity is 97%.

[0522] Length and complementarity

[0523] The oligonucleotides of this invention

[0524] (i.e. oligonucleotide which comprises the following base sequence represented by:

[0525] H-(CUG )m-H (SEQ ID NO:2)

[0526] H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0527] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0528] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0529] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) comprise a sequence that is capable of hybridising with a region in a target transcript comprising a repetitive nucleotide unit (CAG)n. (SEQ ID NO:76529). “Hybridisation” as used herein typically refers to specific hybridisation, and excludes non-specific hybridisation. Thus, in some embodiments, the oligonucleotides of this invention comprise a sequence that is capable of specifically hybridising with a region in the target RNA molecule comprising said repetitive nucleotide unit (CAG)n. (SEQ ID NO:76529) Preferably, hybridisation is assessed under physiological conditions in a cell as described herein, more preferably in a human cell as described herein. Typically, a sequence that is capable of hybridising with a region in the target RNA molecule comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) may be a sequence that has a certain level of complementarity with the target RNA molecule. Perfect or full complementarity is not required, as long as the complementarity is sufficient to allow hybridisation, i.e. the formation of a double-stranded complex with the target RNA molecule. In some embodiments, oligonucleotides as described herein comprise a sequence that is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary with a sequence of the target RNA molecule. A preferred level of complementarity is at least 80%. Another preferred level of complementarity is at least 85%. Another preferred level of complementarity is at least 90%.

[0530] In some embodiments, oligonucleotides as described herein comprise up to 3, 2 or 1 non- complementary residues. For example, oligonucleotides as described herein may comprise 1 , 2 or 3 non-complementary residues. In the context of this application, the percentage of complementarity does not take into account the presence of abasic nucleotides in the oligonucleotide of the invention. Non-complementary residues may include both mismatches (“mismatch bases”) and wobbles (“wobble bases”). It is understood that a mismatch or mismatch base refers to a base forming a mismatch at an opposite nucleotide in the target RNA. It is understood that a wobble or wobble base refers to a base forming a wobble base pair with an opposite nucleotide in the target RNA. In some embodiments, oligonucleotides as described herein are complementary to the target sequence, preferably perfectly complementary to the target sequence, except for the presence of up to 3, 2 or 1 (for example 1 , 2 or 3) mismatches or wobble bases and for the presence of abasic nucleotides.

[0531] In an embodiment, the oligonucleotide is at least 90% reverse complementary with the repetitive nucleotide unit (CAG)n and / or remains in association to its target when there are up to 20% of mismatched nucleotides.

[0532] In an embodiment, the oligonucleotide is 100% reverse complementary to the target sequence and therefore does not contain any mismatch or wobbles. It only contains an abasic nucleotide or several abasic nucleotides as earlier described herein. As explained herein, the presence of abasic nucleotide is not taken into account in the percentage of complementarity.

[0533] In an embodiment, when the abasic nucleotides are at the 5’ end / side and / or at the 3’end / side of the oligonucleotide, said oligonucleotide may comprise an internal mismatch or internal wobble base. In an embodiment, this oligonucleotide comprises up to 1 , 2, 3, 4 or up to 5 internal mismatches or internal wobbles while having an abasic nucleotide at the 5’end and / or at the 3’end of the oligonucleotide.

[0534] In a preferred embodiment, when the abasic nucleotide is internal or is within the base sequence of the oligonucleotide, the number of allowable mismatch or wobble and abasic nucleotide is up to 1 , 2, 3, 4 or up to 5. More preferably, the number of allowable mismatch or wobble and abasic nucleotide is up to 1 , 2 or up to 3. More preferably, the number of allowable mismatch or wobble and abasic nucleotide is up to 1 . More preferably, the number of allowable mismatch or wobble and abasic nucleotide is 0. In this specific type of oligonucleotide, the number of abasic nucleotide may be taken into consideration with the number of mismatch or wobble base. In preferred embodiments, oligonucleotides described herein are thus antisense oligonucleotides (AONs or ASOs).

[0535] As shown in the examples section, advantageous effects are achieved with oligonucleotides of various lengths. Thus, the length of oligonucleotides as described herein is not particularly limited.

[0536] Typically, oligonucleotides described herein may be longer than 15 nucleotides (including the nucleobases and the abasic nucleotides). For example, an oligonucleotide as described herein may have a minimum length of 15, or 16 nucleotides (including the nucleobases and the abasic nucleotides). In some embodiments, oligonucleotides described herein may be longer than 16 nucleotides (including the nucleobases and the abasic nucleotides). For example, an oligonucleotide as described herein may have a minimum length of 15, 16, 17,18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides (including the nucleobases and the abasic nucleotides). In preferred embodiments, an oligonucleotide as described herein is longer than 29 nucleotides (including the nucleobases and the abasic nucleotides). In more preferred embodiments, an oligonucleotide as described herein is longer than 30 nucleotides, for example, it may have a minimal length of 30, 31 , 32, 33, 34, 35, 37, 38, 39, 40, 41 or 42 nucleotides (including the nucleobases and the abasic nucleotides).

[0537] Typically, oligonucleotides described herein may be shorter than 50 nucleotides (including the nucleobases and the abasic nucleotides). For example, an oligonucleotide as described herein may have a maximum length of 50, 49, 48, 47 or 46 nucleotides (including the nucleobases and the abasic nucleotides). In preferred embodiments, an oligonucleotide as described herein is shorter than 46 nucleotides (including the nucleobases and the abasic nucleotides). In more preferred embodiments, an oligonucleotide as described herein is shorter than 45 nucleotides, for example, it may have a maximum length of 45, 44, 43, 42, 41 , 40, 39, 38 or 37 nucleotides (including the nucleobases and the abasic nucleotides) .

[0538] In some embodiments, an oligonucleotide as described herein has a mimum length according to the preferences described above, and a maximum length according to the preferences described above.

[0539] In some embodiments, an oligonucleotide as described herein has a length of 15 to 37 nucleotides, preferably 20 to 30 nucleotides, more preferably 22 to 35 nucleotides. Thus, in some embodiments, an oligonucleotide as described herein has a length of 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36 or 37 nucleotides, preferably 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides (including the nucleobases and the abasic nucleotides) .

[0540] In an embodiment, an oligonucleotide as described herein has a length from 15 to 37 nucleotides, including abasic nucleotides and nucleotides with a base. Binding affinity and (bio) activity of the oligonucleotide

[0541] Binding affinity and kinetics depend on the AON’s thermodynamic properties. These are at least in part determined by the melting temperature of said oligonucleotide (Tm; calculated with e.g. the oligonucleotide properties calculator

[0542] (http: / / eu.idtdna.com / analyzer / Applications / OligoAnalyzer / ) for single stranded RNA using the basic Tm and the nearest neighbor model), and / or the free energy of the oligonucleotide-target exon complex (using RNA structure version 4.5 or RNA mfold version 3.5). If a Tm is increased, it is expected that an activity of the oligonucleotide will typically be increased, but when a Tm is too high, the AON is expected to become less sequence-specific. An acceptable Tm and free energy depend on the sequence of the oligonucleotide. Therefore, it is difficult to give preferred ranges for each of these parameters.

[0543] The inventors surprisingly found that the number and / or position / pattern of abasic nucleotide(s) in an oligonucleotide designed to target a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO: 76529) may have a positive impact on the bio-activity of the oligonucleotide of the invention (see oligonucleotides tested in example 2, figure 4).

[0544] Therefore, an oligonucleotide of the invention is expected to have at least one of the below defined activities to the same level (or at least to some extent to the same level) or preferably increased / optimized compared to the same activity of a control oligonucleotide with no abasic nucleotides: reducing or silencing or decreasing the translation rate of a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) and thus the amount of a corresponding mutant protein (activity 1), interfering with the splicing of a mutant transcript (pre-mRNA) comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529), such as the induction of exon skipping resulting in an out-of-frame transcript, and thus reducing the amount of in-frame transcript and corresponding mutant protein (activity 2) and reducing or decreasing or lowering a mutant protein level (activity 3).

[0545] A control oligonucleotide may be an oligonucleotide having the same sequence and chemistry as the oligonucleotide to be tested, the only difference being the two oligonucleotide being the absence of abasic nucleotide.

[0546] These activities may be assessed in a cell of a patient, in a tissue of a patient and / or in a patient as explained later herein. These reductions or decreases of the translation rate of said transcript or these reductions or decreases or lowerings of the mutant protein level may be assessed in a cell, in a cell of a patient, in a tissue, in a tissue of a patient and / or in a patient. In a preferred embodiment, the assessment is made in the cerebrospinal fluid of a patient. In another preferred embodiment, the assessment is made in the blood, preferably the plasma of the patient.

[0547] In this context “at least to some extent” means at least 30, 40, 50, 60, 70, 80, 90, 100% of at least one of the activities of the control oligonucleotide with no abasic nucleotide.

[0548] In the context of the invention, a mutant transcript encodes a mutant protein. A mutant transcript or mutant protein may also be called a disease-associated or disease-causing transcript (or protein). Such mutant transcript contains an extended or unstable number of repeats in a cell of a patient, in a tissue of a patient and / or in a patient.

[0549] Activity 1 :

[0550] An oligonucleotide of the invention (i.e. oligonucleotide which comprises the following base sequence represented by:

[0551] H-(CUG )m-H (SEQ ID NO:2)

[0552] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0553] H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0554] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0555] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0556] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) is considered to reduce or silence or decrease the translation rate of said mutant transcript and thus the amount of the mutant protein in a cell (preferably in a cell of a patient), in a tissue (preferably in a tissue of a patient) and / or in a patient when the reduction or decrease of the translation rate of said transcript or the decrease of said mutant protein level is at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% by comparison to the translation rate of said transcript (or by comparison to the mutant protein level) before the treatment or at the onset of the treatment. In an embodiment, said decrease is assessed at the same concentration of the oligonucleotide to be tested and the control oligonucleotide.

[0557] This activity of said oligonucleotide of the invention will be considered to have been increased / optimized compared to the same activity of an oligonucleotide having the same sequence but not having any abasic nucleotide (i.e. control oligonucleotide) when: the reduction or decrease of the translation rate of said transcript or the decrease of said mutant protein level is at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 125%, 130%, 135%,

[0558] 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 185%, 190%, 195%, 200%, 220%, 250%, 270%, 290%, 300%, 400% higher than the decrease of the translation rate of said transcript (or of said mutant protein level) induced by the control oligonucleotide. .In an embodiment, said decrease is assessed at the same concentration of the oligonucleotide to be tested and the control oligonucleotide.

[0559] In this context, a control oligonucleotide has the same sequence as the oligonucleotide of the invention. In a preferred embodiment, the control oligonucleotide has the same sequence and the same chemistry as the oligonucleotide of the invention, meaning the only difference between the two oligonucleotides is the presence / absence of abasic nucleotides.

[0560] Activity 2:

[0561] An oligonucleotide of the invention (i.e. oligonucleotide which comprises the following base sequence represented by:

[0562] H-(CUG )m-H (SEQ ID NO:2)

[0563] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0564] H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6)

[0565] Bases: G=guanine; C=5-methylcytosine; U=Uracil.

[0566] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0567] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) is considered to interfere with the splicing of a mutant transcript (pre-mRNA) comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529), such as inducing exon skipping resulting in an out-of-frame transcript, and thus reducing the amount of in-frame transcript and corresponding mutant protein in a cell (preferably in a cell of a patient), in a tissue (preferably in a tissue of a patient) and / or in a patient when the splicing modulation, such as the induction of exon skipping of said transcript is at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% and thus the decrease of said mutant protein level is at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% by comparison to the splicing modulation such as the induction of exon skipping of said transcript (or by comparison to the mutant protein level) before the treatment or at the onset of the treatment. In an embodiment, said decrease is assessed at the same concentration of the oligonucleotide to be tested and the control oligonucleotide. This activity of said oligonucleotide of the invention will be considered to have been increased / optimized compared to the same activity of an oligonucleotide having the same sequence but not having any abasic nucleotide (i.e. control oligonucleotide) when: the splicing modulation such as exon skipping of said transcript is at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 1 15%, 120%, 125%, 130%, 135%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 185%, 190%, 195%, 200%, 220%, 250%, 270%, 290%, 300%, 400% higher than the splicing modulation such as exon skipping of said transcript induced by the control oligonucleotide or the decrease of said mutant protein level is at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 185%, 190%, 195%, 200%, 220%, 250%, 270%, 290%, 300%, 400% higher than the splicing modulation such as exon skipping of said transcript (or of said mutant protein level) induced by the control oligonucleotide. . In an embodiment, said decrease is assessed at the same concentration of the oligonucleotide to be tested and the control oligonucleotide. In this context, a control oligonucleotide has the same sequence as the oligonucleotide of the invention. In a preferred embodiment, the control oligonucleotide has the same sequence and the same chemistry as the oligonucleotide of the invention, meaning the only difference between the two oligonucleotides is the presence / absence of abasic nucleotides.

[0568] Activity 3

[0569] In another embodiment, an oligonucleotide of the invention (i.e. oligonucleotide which comprises the following base sequence represented by:

[0570] H-(CUG )m-H (SEQ ID NO:2)

[0571] H-UG-(CUG)m-CU-H (SEQ ID NO:3) H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6) Bases: G=guanine; C=5-methylcytosine; U=Uracil

[0572] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0573] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) is considered to reduce or decrease or lower a mutant protein level when the mutant protein level is reduced or decreased or lowered at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% by comparison to the mutant protein level before the treatment or at the onset of the treatment. This reduction, decrease or lowering is assessed in a cell (preferably in a cell of a patient), in a tissue (preferably in a tissue of a patient) and / or in a patient.

[0574] This activity of said oligonucleotide of the invention will be considered to have been increased / optimized compared to the same activity of an oligonucleotide having the same sequence but not having any abasic nucleotide (i.e. control oligonucleotide) when: the reduction or decrease or lowering of said mutant protein is at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 1 15%, 120%, 125%, 130%, 135%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 185%, 190%, 195%, 200%, 220%, 250%, 270%, 290%, 300%, 400% higher than the decrease of the mutant protein induced by the control oligonucleotide. In an embodiment, said decrease is assessed at the same concentration of the oligonucleotide to be tested and the control oligonucleotide.

[0575] In this context, a control oligonucleotide has the same sequence as the oligonucleotide of the invention. In a preferred embodiment, the control oligonucleotide has the same sequence and chemistry as the oligonucleotide of the invention, meaning the only difference between the two oligonucleotides is the presence / absence of abasic nucleotides.

[0576] The activity of the oligonucleotide comprising the base sequences designed from

[0577] H-(CUG )m-H (SEQ ID NO:76524)

[0578] H-UG-(CUG)m-CU-H (SEQ ID NO:76525)

[0579] H-G-(CUG)m-CU-H (SEQ ID NO:76526) H-UG-(CUG)m-C-H (SEQ ID NO:76527) H-G-(CUG)m-C-H (SEQ ID NO:76528)

[0580] Bases: G=guanine; C= is cytosine or 5-methylcytosine; U=Uracil;

[0581] May be assessed a similar way as the ones derived from

[0582] H-(CUG )m-H (SEQ ID NO:2)

[0583] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0584] H-G-(CUG)m-CU-H (SEQ ID NO:4)

[0585] H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6) Bases: G=guanine; C=5-methylcytosine; U=Uracil,

[0586] The only difference being the identity of the control oligonucleotide. In a further aspect, there is provided a composition comprising an oligonucleotide as described in the previous section entitled “Oligonucleotide”. This composition preferably comprises or consists of or essentially consists of an oligonucleotide as described above.

[0587] All preferred features relating to each of these oligonucleotides have been disclosed in the section entitled “oligonucleotide”.

[0588] In a preferred embodiment, said composition is for use as a medicament. Said composition is therefore a pharmaceutical composition. A pharmaceutical composition usually comprises a pharmaceutically accepted carrier, diluent and / or excipient. In a preferred embodiment, a composition of the current invention comprises a compound as defined herein and optionally further comprises a pharmaceutically acceptable formulation, filler, preservative, solubilizer, carrier, diluent, excipient, salt, adjuvant and / or solvent. Such pharmaceutically acceptable carrier, filler, preservative, solubilizer, diluent, salt, adjuvant, solvent and / or excipient may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000. The compound as described in the invention possesses at least one ionizable group. An ionizable group may be a base or acid, and may be charged or neutral. An ionizable group may be present as ion pair with an appropriate counterion that carries opposite charge(s). Examples of cationic counterions are sodium, potassium, cesium, Tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium, and tetraalkylammonium. Examples of anionic counterions are chloride, bromide, iodide, lactate, mesylate, acetate, trifluoroacetate, dichloroacetate, and citrate. Examples of counterions have been described [e.g. Kumar L. et al, 2008, which is incorporated here in its entirety by reference].

[0589] A pharmaceutical composition may be further formulated to further aid in enhancing the stability, solubility, absorption, bioavailability, pharmacokinetics and cellular uptake of said compound, in particular formulations comprising excipients capable of forming complexes, nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or pluronics, polymersomes, colloids, microbubbles, vesicles, micelles, lipoplexes, and / or liposomes. Examples of nanoparticles include polymeric nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, protein nanoparticles and peptide nanoparticles.

[0590] A preferred composition comprises at least one excipient that may further aid in enhancing the targeting and / or delivery of said composition and / or said oligonucleotide to and / or into muscle and / or brain tissue and / or to a neuronal tissue and / or a cell. A cell may be a muscular or a neuronal cell.

[0591] In an embodiment, a composition comprises the oligonucleotide of the invention

[0592] (i.e. oligonucleotide which comprises the following base sequence represented by:

[0593] H-(CUG )m-H (SEQ ID NO:2) H-UG-(CUG)m-CU-H (SEQ ID N0:3) H-G-(CUG)m-CU-H (SEQ ID N0:4) H-UG-(CUG)m-C-H (SEQ ID N0:5) H-G-(CUG)m-C-H (SEQ ID N0:6) Bases: G=guanine; C=5-methylcytosine; U=Uracil

[0594] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0595] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides) and artificial cerebrospinal fluid as excipient. Artificial cerebrospinal fluid is a fluid that mimics the characteristics of human cerebrospinal fluid. Typically it contains 150 mM Na, 3.0 mM K, 1.4 mM Ca, 0.8 mM Mg, 1.0 mM P, 155 mM Cl (Davson, H. Physiology of the Cerebrospinal Fluid, J. & A. Churchill, Ltd., London, 1967 and Biology Data Book , Volume III, 2nd ed., Fed. Am. Soc. Exper. Biol., Washington D.C., 1974).

[0596] Many of these excipients are known in the art (e.g. see Bruno, 201 1) and may be categorized as a first type of excipient. Examples of first type of excipients include polymers (e.g. polyethyleneimine (PEI), polypropyleneimine (PPI), dextran derivatives, butylcyanoacrylate (PBCA), hexylcyanoacrylate (PHCA), poly(lactic-co-glycolic acid) (PLGA), polyamines (e.g. spermine, spermidine, putrescine, cadaverine), chitosan, poly(amido amines) (PAMAM), poly(ester amine), polyvinyl ether, polyvinyl pyrrolidone (PVP), polyethylene glycol (PEG) cyclodextrins, hyaluronic acid, colominic acid, and derivatives thereof), dendrimers (e.g. poly(amidoamine)), lipids {e.g. 1 ,2-dioleoyl-3-dimethylammonium propane (DODAP), dioleoyldimethylammonium chloride (DODAC), phosphatidylcholine derivatives [e.g 1 ,2- distearoyl-sn-glycero-3-phosphocholine (DSPC)], lyso-phosphatidylcholine derivaties [e.g. 1- stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-LysoPC)], sphingomyeline, 2-{3-[bis-(3-amino- propyl)-amino]-propylamino}-A / -ditetracedyl carbamoyl methylacetamide (RPR209120), phosphoglycerol derivatives [e.g. 1 ,2-dipalmitoyl-sn-glycero-3-phosphoglycerol sodium salt (DPPG-Na), phosphaticid acid derivatives [1 ,2-distearoyl-sn-glycero-3-phosphaticid acid, sodium salt (DSPA), phosphatidylethanolamine derivatives [e.g. dioleoylphosphatidylethanolamine (DOPE), 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine

[0597] (DSPE),2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE),], A / -[1 -(2,3- dioleoyloxy)propyl]-A / ,A / ,A / -trimethylammonium (DOTAP), N-[1-(2,3-dioleyloxy)propyl]-A / ,A / ,A / - trimethylammonium (DOTMA), 1 ,3-di-oleoyloxy-2-(6-carboxy-spermyl)-propylamid (DOSPER), (1 ,2-dimyristyolxypropyl-3-dimethylhydroxy ethyl ammonium (DMRIE), (N1 - cholesteryloxycarbonyl-3,7-diazanonane-1 ,9-diamine (CDAN), dimethyldioctadecylammonium bromide (DDAB), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), (b-L-arginyl-2,3- L-diaminopropionic acid-A / -palmityl-A / -olelyl-amide trihydrochloride (AtuFECTOI), N,N- dimethyl-3-aminopropane derivatives [e.g. 1 ,2-distearoyloxy-A / ,A / -dimethyl-3-aminopropane (DSDMA), 1 ,2-dioleyloxy-A / ,A / -dimethyl-3-aminopropane (DoDMA), 1 ,2-dilinoleyloxy-A / , / -3- dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl [1 ,3]-dioxolane (DLin-K-DMA), phosphatidylserine derivatives [1 ,2-dioleyl-sn-glycero-3-phospho-L-serine, sodium salt (DOPS)], cholesterol}proteins (e.g. albumin, gelatins, atellocollagen), and peptides (e.g. protamine, PepFects, NickFects, polyarginine, polylysine, CADY, MPG).

[0598] Another preferred composition may comprise at least one excipient categorized as a second type of excipient. A second type of excipient may comprise or contain a conjugate group as described herein to enhance targeting and / or delivery of the composition and / or of the oligonucleotide of the invention to a tissue and / or cell and / or into a tissue and / or cell, as for example muscle or neuronal tissue or cell. Both types of excipients may be combined together into one single composition as identified herein.

[0599] The skilled person may select, combine and / or adapt one or more of the above or other alternative excipients and delivery systems to formulate and deliver a compound for use in the present invention.

[0600] Such a pharmaceutical composition of the invention may be administered in an effective concentration at set times to an animal, preferably a mammal. More preferred mammal is a human being. An oligonucleotide or a composition as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and / or an organ in vivo of individuals affected by or at risk of developing a disease or condition as identified herein, and may be administered directly in vivo, ex vivo or in vitro. Administration may be via systemic and / or parenteral routes, for example intravenous, subcutaneous, intraventricular, intrathecal, intramuscular, intranasal, enteral, intravitreal, intracerebral, epidural or oral route.

[0601] Preferably, such a pharmaceutical composition of the invention may be encapsulated in the form of an emulsion, suspension, pill, tablet, capsule or soft-gel for oral delivery, or in the form of aerosol or dry powder for delivery to the respiratory tract and lungs.

[0602] In an embodiment an oligonucleotide of the invention may be used together with another compound already known to be used for the treatment of said disease. Such other compounds may be used for slowing down progression of disease, for reducing abnormal behaviors or movements, for reducing muscle tissue inflammation, for improving muscle fiber and / or neuronal function, integrity and / or survival and / or improve, increase or restore cardiac function. Examples are, but not limited to tetrabenazine, deutetrabenazine, valbenazine, a glutamate receptor antagonist, a steroid, preferably a (gluco)corticosteroid, an ACE inhibitor (preferably perindopril), an angiotensin II type 1 receptor blocker (preferably losartan), a tumor necrosis factor-alpha (TNFa) inhibitor, a TGFp inhibitor (preferably decorin), human recombinant biglycan, a source of mlGF-1 , a myostatin inhibitor, mannose-6-phosphate, dantrolene, halofuginone, an antioxidant, an ion channel inhibitor, a protease inhibitor, a phosphodiesterase inhibitor (preferably a PDE5 inhibitor, such as sildenafil or tadalafil, and / or PDE10A inhibitors and / or MP-10), L-arginine, dopamine blockers, amantadine, tetrabenazine, co-enzyme Q10, antidepressants, anti-psychotics, anti-epileptics, moodstabilizers in general, omega-3-fatty acids, creatine monohydrate, KMO inhibitors (Kynurenine mono oxigenase) such as CHDI246, or HDAC4 inhibitors such as PBT2 . Such combined use may be a sequential use: each component is administered in a distinct composition.

[0603] Alternatively each compound may be used together in a single composition.

[0604] Oligonucleotide or composition for use

[0605] An oligonucleotide of the invention (or a composition comprising this oligonucleotide) is preferably for use as a medicament for preventing delaying and / or treating a human cis-element repeat instability associated genetic disorders preferably as exemplified herein. A human cis- element repeat instability associated genetic disorders as identified herein is preferably a neuromuscular disorder. The oligonucleotide oligonucleotide according to the invention may be described as an antisense oligonucleotide (AON). An antisense oligonucleotide is an oligonucleotide which binds (or is able to bind), targets, hybridizes to (or is able to hybridize to) and / or is reverse complementary to a specific sequence of a transcript of a gene which is known to be associated with or involved in a human cis-element repeat instability associated genetic neuromuscular disorder.

[0606] Accordingly, the oligonucleotide of the invention comprises the following base sequence represented by:

[0607] H-(CUG )m-H (SEQ ID NO:2)

[0608] H-UG-(CUG)m-CU-H (SEQ ID NO:3)

[0609] H-G-(CUG)m-CU-H (SEQ ID NO:4) H-UG-(CUG)m-C-H (SEQ ID NO:5) H-G-(CUG)m-C-H (SEQ ID NO:6) Bases: G=guanine; C=5-methylcytosine; U=Uracil

[0610] Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides or

[0611] Wherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides.

[0612] This oligonucleotide is represented by a nucleotide sequence comprising or consisting of a sequence that binds (or is able to bind), hybridizes (or is able to hybridize), targets and / or is reverse complementary to a repetitive element in a RNA transcript having as repetitive nucleotide unit a repetitive nucleotide unit, which is (CAG)n(SEQ ID NO:76529). Said oligonucleotide is preferably a single stranded oligonucleotide. Although it is to be understood that an oligonucleotide of the invention binds (or is able to bind), hybridizes (or is able to hybridize), targets and / or is reverse complementary to a repetitive element present in a RNA transcript as identified above, it can not be ruled out that such oligonucleotide may also interfere with or bind (or is able to bind) or hybridize to (or is able to hybridize) a corresponding DNA, this RNA transcript is derived from.

[0613] A repeat or repetitive element or repetitive sequence or repetitive stretch is herein defined as a repetition of at least 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1000 or more, of the repetitive unit or repetitive nucleotide unit or repeat nucleotide unit (CAG)n (SEQ ID NO:76529) comprising a trinucleotide repetitive unit CAG in a transcribed gene sequence in the genome of a subject, including a human subject. Accordingly, n is an integer and may be at least 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1000 or more. In the majority of patients, a “pure” repeat or repetitive element or repetitive sequence or repetitive stretch as identified above ((CAG)n (SEQ ID NO:76529), is present in a transcribed gene sequence in the genome of said patient. However, it is also encompassed by the invention, that in some patients, the penultimate CAA codon downstream of said repeat or repetitive element or repetitive sequence or repetitive stretch as identified above is qualified as a “variant” when for example said repeat or repetitive element or repetitive sequence or repetitive stretch as identified above is extended by complete loss of interrupting (LOI) adenine nucleotides in this region (Wright GEB et al. 2019, Am J Hum Genet 104(6) : 1116-1126).

[0614] In an embodiment, the oligonucleotide of the invention comprises or consists of a sequence that binds (or is able to bind), hybridizes (or is able to hybridize), targets and / or is reverse complementary to a (CAG)n(SEQ ID NO:76529) tract in a transcript and is particularly useful for the treatment, delay, amelioration and / or prevention of the human genetic diseases Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X-linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA) caused by CAG repeat expansions in the transcripts of the HTT (SEQ ID NO: 21), ATXN1 (SEQ ID NO:22), ATXN2 (SEQ ID NO: 23) ATXN3 (SEQ ID NO: 24), CACNA1A (SEQ ID NO:25), ATXN7 (SEQ ID NO: 26), PPP2R2B (SEQ ID NO: 27), TBP (SEQ ID NO: 28), AR (SEQ ID NO: 29) or ATN1 (SEQ ID NO: 30) genes. Preferably, these genes are from human origin.

[0615] In the context of the invention, the expression “capable of’ may be replaced with “ is able to”.

[0616] In a preferred embodiment, in the context of the invention, an oligonucleotide as designed herein (or a composition comprising this oligonucleotide) is able to delay and / or cure and / or treat and / or prevent and / or ameliorate a human genetic disorder as Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X-linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA) caused by CAG repeat expansions in the transcripts of a HTT (SEQ ID NO: 21), ATXN1 (SEQ ID NO: 22), ATXN2 (SEQ ID NO: 23) ATXN3(SEQ ID NO: 24), CACNA1A (SEQ ID NO: 25), ATXN7 (SEQ ID NO: 26), PPP2R2B (SEQ ID NO: 27), TBP (SEQ ID NO: 28), AR (SEQ ID NO: 29), ATN1 (SEQ ID NO: 30) genes when this oligonucleotide is expected to have at least one of the below defined activities at the same level or preferably increased / optimized compared to the same activity of its controle oligonucleotide with no abasic nucleotides: reducing or silencing or decreasing the translation rate of a mutant transcript comprising a repetitive nucleotide unit (CAG)n (i.e. mutant transcript of a HTT, ATXN1 , ATXN2 ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR or ATN1) in a cell of a patient, in a tissue of a patient and / or in a patient and thus the amount of a corresponding mutant protein (activity 1), interfering with the splicing of a mutant transcript (pre-mRNA) comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) (i.e. mutant transcript of a HTT, ATXN1 , ATXN2 ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR or ATN1), such as the induction of exon skipping resulting in an out-of-frame transcript and reduced levels of in-frame transcript in a cell of a patient, in a tissue of a patient and / or in a patient and thus reducing the amount of a corresponding mutant protein (activity 2) and reducing or decreasing or lowering a mutant protein level (i.e. mutant HTT, ATXN1 , ATXN2 ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR or ATN1 protein) in a cell of a patient, in a tissue of a patient and / or in a patient, (activity 3).

[0617] In an embodiment, said HTT, ATXN1 , ATXN2 ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR or ATN1 genes are human genes.

[0618] A control oligonucleotide has already been defined earlier herein.

[0619] In the case of HD, an expanded CAG repeat region is present in exon 1 of the HTT gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 36 to 180 or more repetitive units comprising a CAG trinucleotide, in a transcribed sequence of the HTT gene.

[0620] In the case of SCA1 , an expanded CAG repeat region is present in exon 8 of the ATXN1 gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 41 to 83 repetitive units comprising a CAG trinucleotide, in a transcribed sequence of the ATXN1 gene.

[0621] In the case of SCA2, an expanded CAG repeat region is present in exon 1 of the ATXN2 gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 32 to 200 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the ATXN2 gene.

[0622] In the case of SCA3, an expanded CAG repeat region is present in exon 8 of the ATXN3 gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 52 to 86 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the ATXN3 gene. In the case of SCA6, an expanded CAG repeat region is present in exon 47 of the CACNA1A gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 20 to 33 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the CACNA1A gene.

[0623] In the case of SCA7, an expanded CAG repeat region is present in exon 3 of the ATXN7 gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 36 to at least 460 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the ATXN7 gene.

[0624] In the case of SCA12, an expanded CAG repeat region may be present in the 5’ untranslated region (UTR), in an intron or within an open reading frame of the PPP2R2B gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 66 to 78 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the PPP2R2B gene.

[0625] In the case of SCA17, an expanded CAG repeat region is present in exon 3 of the TBP gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 45 to 66 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the TBP gene.

[0626] In the case of ALS or FTD, an expanded CAG repeat region is present in exon 1 of the ATXN2 gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 27 to 33 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the ATXN2 gene.

[0627] In the case of SBMA, an expanded CAG repeat region is present in exon 1 of the AR gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 40 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the AR gene.

[0628] In the case of DRPLA, an expanded CAG repeat region is present in exon 5 of the ATN1 gene in the genome of a patient. An expanded CAG repeat region may be defined herein as comprising a consecutive repetition of 49 to 88 repetitive units comprising a CAG trinucleotide in a transcribed sequence of the ATN1 gene.

[0629] Throughout the invention, the term CAG repeat may be replaced by (CAG)n(SEQ ID NO:76529), and vice versa, wherein n is an integer that may be 6 to 35 when the repeat is present in exon 1 of the HTT transcript of a healthy individual, 6 to 39 when the repeat is present in exon 8 of the ATXN1 gene of a healthy individual, less than 31 when the repeat is present in exon 1 ofthe ATXN2 gene of a healthy individual, 12 to 40 when the repeat is present in exon 8 of the ATXN3 gene of a healthy individual, less than 18 when the repeat is present in exon 47 of the CACNA1A gene of a healthy individual, 4 to 17 when the repeat is present in exon 3 of the ATXN7 gene of a healthy individual, 7 to 28 when the repeat is present in the 5’UTR of the PPP2R2B gene of a healthy individual, 25 to 42 when the repeat is present in exon 3 of the TBP gene of a healthy individual, 13 to 31 when the repeat is present in exon 1 of the AR gene of a healthy individual, 12 to 40 when the repeat is present in exon 8 of the ATXN3 gene of a healthy individual, or 6 to 35 when the repeat is present in exon 5 of the ATN1 gene of a healthy individual.

[0630] Therefore, an oligonucleotide of the invention (or composition comprising said oligonucleotide) is expected to exhibit at least one of the below defined activities to some extent or have at least one of the below defined activities being increased / optimized compared to the same activity of its counterpart oligonucleotide with no abasic nucleotides: reducing or silencing or decreasing the translation rate of a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) (i.e. mutant transcript of a HTT, ATXN1 , ATXN2 ATXN3, CACNA1 A, ATXN7, PPP2R2B, TBP, AR or ATN1) in a cell of a patient, in a tissue of a patient and / or in a patient and thus the amount of a corresponding mutant protein (activity 1), interfering with the splicing of a mutant transcript (pre-mRNA) comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) (i.e. mutant transcript of a HTT, ATXN1 , ATXN2 ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR or ATN1), such as the induction of exon skipping resulting in an out-of-frame transcript in a cell of a patient, in a tissue of a patient and / or in a patient and thus reducing the amount of in-frame transcript and thus reducing the amount of a corresponding mutant protein (activity 2) and reducing or decreasing or lowering a mutant protein level (i.e. mutant HTT, ATXN1 , ATXN2 ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR or ATN1 protein) in a cell of a patient, in a tissue of a patient and / or in a patient, (activity 3).

[0631] - In an embodiment, said HTT, ATXN1 , ATXN2 ATXN3, CACNA1 A, ATXN7, PPP2R2B, TBP, AR or ATN1 genes are human genes.

[0632] A control oligonucleotide has already been defined earlier herein.

[0633] In this context “to some extent” means at least 30, 40, 50, 60, 70, 80, 90, 100% of at least one of the activities of the control oligonucleotide with no abasic nucleotide.

[0634] The further increase / optimisation of at least one of the activities of the oligonucleotide of the invention compared to the corresponding activity of its controloligonucleotide have already been defined earlier herein.

[0635] Alternatively or in combination with previous preferred embodiment, in the context of the invention, an oligonucleotide as designed herein (or composition comprising said oligonucleotide) may be able to delay and / or cure and / or treat and / or prevent and / or ameliorate a human genetic disorder as Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X- linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA) caused by CAG repeat expansions in the transcripts of the HTT, ATXN1 , ATXN2 ATXN3, CACNA1 A, ATXN7, PPP2R2B, TBP, AR or ATN1 genes when this oligonucleotide is able to alleviate one or more symptom(s) and / or characteristic(s) and / or to improve a parameter linked with or associated with Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X- linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA) in an individual.

[0636] An oligonucleotide as defined herein (or composition comprising said oligonucleotide) may be able to improve one parameter or reduce a symptom or characteristic if after at least one week, one month, six month, one year or more of treatment using a dose of said oligonucleotide of the invention as identified herein said parameter is said to have been improved or said symptom or characteristic is said to have been reduced.

[0637] Improvement in this context may mean that said parameter had been significantly changed towards a value of said parameter for a healthy person and / or towards a value of said parameter that corresponds to the value of said parameter in the same individual at the onset of the treatment.

[0638] Reduction or alleviation in this context may mean that said symptom or characteristic had been significantly changed towards the absence of said symptom or characteristic which is characteristic for a healthy person and / or towards a change of said symptom or characteristic that corresponds to the state of the same individual at the onset of the treatment.

[0639] In HD, the manifest disease period can be subdivided into five stages based on evolving changes in motor symptoms and functional capacity (Ross CA., et al, 2014, Nat Rev Neurol, 10(4): p204-216). Stage I represents the highest level of capacity and is characterised by mild or no incapacity in terms of independence in daily activities, managing personal finances and ability to maintain employment, while Stage V represents severe disability and dependence on full-time care (Shoulson I. et al., 1979, Neurology, 29: 1 -3).

[0640] The five stages also correlate with score on Unified Huntington’s Disease Rating Scale (UHDRS) including the Total Functional Capacity (TFC) Scale, with Stage I corresponding to TFC scores of 11-13 (least severe); Stage II to scores of 7-10; Stage III to scores of 3-6; Stage IV to scores of 1-2; Stage V to a score of 0 (most severe).

[0641] In this context, each of these stages may be considered as a HD parameter that could be improved using the oligonucleotide of the invention.

[0642] In this context, the total functional capacity (TFC), a validated scale or symptom progression regarding the three main symptomatic areas of HD, which may be measured by validated rating scales (Shoulson I et al., 1979, Neurology, 29:1-3) may also be considered as a group of symptoms and parameters that may be improved using the oligonucleotide of the invention. TFC specifically relates to progression of motor signs, progression of neuropsychiatric symptoms and progression of cognitive decline.

[0643] Alternatively, the cUHDRS may also be considered as a .group of symptoms and parameters that may be improved using the oligonucleotide of the invention. The cUHDRS is a multidomain measure encompassing motor, functional, and cognitive scales, all of which are independently associated with HD severity (Estevez-Fraga C. et al., 2021 , Movement Disorders 36(5):1259- 1264).

[0644] In this context, symptoms for Huntington’s Disease may be choreiform movements, progressive dementia and psychiatric manifestations (depression, psychosis, etc.). Choreiform movements consist of involuntary, rapid, irregular, jerky motor actions including facial twitching or writhing and twitching of distal extremities, and later more generalized forms that may impair gait ( Roos RA. 2010, Orphanet. J. Rare Dis., 5, 40)). Each of these symptoms may be assessed by the physician using known and described methods.

[0645] Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, or 17, X-linked spinal and bulbar muscular atrophy (SBMA) and dentatorubropallidoluysian atrophy (DRPLA) are all caused by CAG triplet repeat expansions in the coding region of the gene. Although the disease causing proteins in these diseases are different, in each case the resulting expanded stretch of glutamines results in a toxic-gain-of function of the protein and this leads to neurodegeneration. Protein aggregates are found in the nucleus and cytoplasm of cells, indicating that protein misfolding is a common feature of these disorders. A common preferred parameter is therefore the presence of protein aggregates in the nucleus and / or cytoplasm which can be monitored by in situ hybridization.

[0646] Another parameter may therefore be mutant protein aggregates that are found in the nucleus and cytoplasm of cells, indicating that protein misfolding is a common feature of such diseases. Another parameter is therefore aggregated mutant protein in the nucleus and / or cytoplasm. Such aggregates may be monitored by in situ hybridization.

[0647] An improvement of such a parameter may be the decrease in the detection of such protein aggregate. Such decrease may be at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% by comparison to the quantity or amount of protein aggregate before the onset of the treatment.

[0648] An improvement of such a parameter may be the decrease in the detection of such protein aggregate by comparison to the decrease of such parameter using a control oligonucelotide. Such decrease compared to the decrease caused by a control oligonucleotide may be at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 185%, 190%, 195%, 200%, 220%, 250%, 270%, 290%, 300%, 400% . Within the context of oligonucleotides for use, compositions for use, methods and uses according to the invention, an effective amount or therapeutically (and / or prophylactically) effective amount may be administered. Methods and uses of the invention will be later defined herein.

[0649] As used herein, an “effective amount” is an amount sufficient to exert beneficial or desired results. Accordingly, a “therapeutically effective amount” (prophylactically effective amount) is an amount that, when administered to a subject in need thereof, is sufficient to exert some therapeutic (prophylactic) effect as described herein, such as, but not limited to reducing or silencing or decreasing the translation rate of a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) and thus the amount of a corresponding mutant protein, interfering with the splicing of a mutant transcript (pre-mRNA) comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529), such as the induction of exon skipping resulting in an out-of-frame transcript and in reduced levels of in-frame transcript and thus reducing the amount of a corresponding mutant protein and reducing or decreasing or lowering a mutant protein level, compared to an untreated subject.

[0650] An amount that is "therapeutically effective" (and / or prophylactically effective) will vary from subject to subject, depending on the age, the disease progression and overall general condition of the individual. An appropriate "therapeutically effective" (and / or prophylactically effective) amount in any individual case may be determined by the skilled person using routine experimentation, such as the methods described later herein.

[0651] In an embodiment,, an oligonucleotide of the invention is expected to have at least one of the defined activities increased / optimized compared to the same activity of its counterpart oligonucleotide with no abasic nucleotides (i.e. control oligonucleotide).

[0652] Within the context of the invention, the oligonucleotides and compositions may be administered to a subject, such as a subject in need thereof. In some embodiments, the subject (in need) can be a healthy, asymptomatic or partially symptomatic subject (for example before (full) onset of the disease). In some embodiments, the subject (in need) may suffer from or any of the symptoms thereof, or be at risk for developing Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X-linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA) caused by CAG repeat expansions or any of the symptoms thereof. In some embodiments, the subject (in need) may be a subject inflicted with Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), X-linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA) caused by CAG repeat expansions or any of the symptoms thereof.

[0653] Use

[0654] In a further aspect, there is provided the use of an oligonucleotide (or composition comprising said oligonucleotide) as described in the previous sections for use as a medicament or part of therapy, or applications in which said oligonucleotide exerts its activity intracellularly.

[0655] Preferably, an oligonucleotide or composition of the invention is for use as a medicament or part of a therapy for preventing, delaying, curing, ameliorating and / or treating a human ciselement repeat instability associated genetic disorder. A human cis-element repeat instability associated genetic disorder is preferably a neuromuscular genetic disorder, more preferably as identified earlier herein.

[0656] Method

[0657] In a further aspect, there is provided a method for preventing, treating, curing, ameliorating and / or delaying a condition or disease as defined in the previous section in an individual, in a cell, tissue or organ of said individual. The method comprising administering an oligonucleotide or a composition of the invention to said individual or a subject in the need thereof.

[0658] The method according to the invention wherein an oligonucleotide or a composition as defined herein may be suitable for administration to a cell, tissue and / or an organ in vivo of individuals affected by any of the herein defined diseases or at risk of developing said disease, and may be administered in vivo, ex vivo or in vitro. An individual or a subject in need is preferably a mammal, more preferably a human being.

[0659] In an embodiment, in a method of the invention, a concentration of an oligonucleotide or composition is ranged from 0.01 nM to 1 pM. More preferably, the concentration used is from 0.05 to 500 nM, or from 0.1 to 500 nM, or from 0.02 to 500 nM, or from 0.05 to 500 nM, even more preferably from 1 to 200 nM.

[0660] In a preferred embodiment, in a method of the invention, a concentration of an oligonucleotide or composition is ranged from ranged from 1 to 100 mg / ml, or from 10 to 60 mg / ml or from 20 to 50 mg / ml, or from 30 to 45 mg / ml or from 35 to 40 mg / ml. .

[0661] Dose ranges of an oligonucleotide or composition according to the invention are preferably designed on the basis of rising dose studies in clinical trials ( / n vivo use) for which rigorous protocol requirements exist. An oligonucleotide as defined herein may be used at a dose which is ranged from 0.01 to 200 mg / kg or 0.05 to 100 mg / kg or 0.1 to 50 mg / kg or 0.1 to 20 mg / kg, preferably from 0.5 to 10 mg / kg. In a preferred embodiment, an oligonucleotide as defined herein is used at a dose which is ranged from 1 to 100 mg or from 10 to 60 mg or from 20 to 50 mg or from 30 to 45 mg or from 35 to 40 mg. Dose ranges of an oligonucleotide or composition according to the invention may also be used at a dose which is

[0662] Ranged from 100 to 300 pg / week, 8 to 12 injections in total or

[0663] Ranged from 150 to 250 pg / week, 9 to 11 injections in total or

[0664] 200 pg / week, 11 injections in total or

[0665] Ranged from 10 to 350 pg / day during two weeks or

[0666] Ranged from 50 to 250 pg / day during two weeks or

[0667] Ranged from 100 to 200 pg / day during two weeks or

[0668] Ranged from 20 to 80 pg / day during two weeks or

[0669] Ranged from 200 to 320 pg / day during two weeks or

[0670] 320 pg / day, during two weeks or

[0671] 30 pg / day, during two weeks

[0672] .In a preferred embodiment, a dose ranges of an oligonucleotide or composition according to the invention is used at a dose which is

[0673] Ranged from 1 to 100 mg / once monthly, or

[0674] Ranged from 10 to 80 mg / once monthly, or

[0675] Ranged from 15 to 75 mg / once monthly, or

[0676] Ranged from 20 to 60 mg / once monthly, or

[0677] Ranged from 30 to 50 mg / once monthly, or

[0678] Ranged from 35 to 45 mg / once monthly, or

[0679] Ranged from 1 to 100 mg / every three months, or

[0680] Ranged from 10 to 80 mg / every three months, or

[0681] Ranged from 15 to 75 mg / every three months, or

[0682] Ranged from 20 to 60 mg / every three months, or

[0683] Ranged from 30 to 50 mg / every three months, or

[0684] Ranged from 35 to 45 mg / every three months, or

[0685] Ranged from 1 to 100 mg / every six months, or

[0686] Ranged from 10 to 80 mg / every six months, or

[0687] Ranged from 15 to 75 mg / every six months, or

[0688] Ranged from 20 to 60 mg / every six months, or

[0689] Ranged from 30 to 50 mg / every six months, or

[0690] Ranged from 35 to 45 mg / every six months, or

[0691] Ranged from 1 to 100 mg / once per twelve months, or

[0692] Ranged from 10 to 80 mg / once per twelve months, or

[0693] Ranged from 15 to 75 mg / , once per twelve months or

[0694] Ranged from 20 to 60 mg / once per twelve months, or

[0695] Ranged from 30 to 50 mg / once per twelve months, or

[0696] Ranged from 35 to 45 mg / once per twelve months.. The ranges of concentration or dose of oligonucleotide or composition as given above are preferred concentrations or doses for in vitro or ex vivo uses. The skilled person will understand that depending on the identity of the oligonucleotide used, the target cell to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration or dose of oligonucleotide used may further vary and may need to be optimised any further.

[0697] In this document and in its claims, the verb "to comprise" and its conjugations is used in its nonlimiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. The verb “to comprise” is synonymous with the verb “to have” unless otherwise indicated. In addition the verb “to consist” may be replaced by “to consist essentially of’ meaning that an oligonucleotide or a composition as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

[0698] Each embodiment as identified herein may be combined together unless otherwise indicated. All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

[0699] General information

[0700] Unless stated otherwise, all technical and scientific terms used herein have the same meaning as customarily and ordinarily understood by a person of ordinary skill in the art to which this invention belongs, and read in view of this disclosure.

[0701] Definitions

[0702] Throughout the application, the word “binds”, “targets”, “hybridizes” could be used interchangeably when used in the context of an antisense oligonucleotide which is reverse complementary to a part of a pre-mRNA as identified herein. In the context of the invention, “hybridizes” or “binds” is used under physiological conditions in a cell, preferably a human cell unless otherwise indicated.

[0703] As used herein, "hybridization" refers to the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases). For example, the natural base adenine is nucleobase complementary to the natural nucleobases thymine, 5-methyluracil and uracil which pair through the formation of hydrogen bonds. The natural base guanine is nucleobase complementary to the natural bases cytosine and 5-methyl-cytosine. Hybridization can occur under varying circumstances. In particular, hybridization of an oligonucleotide of the invention with a targeted pre-mRNA can occur under varying circumstances. Similarly, binding of an oligonucleotide of the invention to a targeted pre-mRNA can occur under varying circumstances. Preferably, said hybridization or said binding is assessed under physiological conditions in a cell, more preferably in a human cell. An oligonucleotide of the invention is preferably said to be able to bind to, or capable of binding to, or able to hybridize with, or capable of hybridizing with, when said binding or hybridization occurs under physiological conditions in a cell, preferably a human cell.

[0704] As used herein, "nucleotide" refers to a nucleoside further comprising a modified or unmodified phosphate linking group or a non-phosphate internucleoside linkage.

[0705] As used herein, “nucleotide analogue” or “nucleotide equivalent” refers to a nucleotide, which comprises at least one modification with respect to the nucleotides naturally occurring in RNA, such as A, C, G and U. Such a modification may be an internucleoside linkage modification and / or a sugar modification and / or a base modification.

[0706] As used herein, “monomer” refers to a precursor in the synthesis of an oligomeric or polymeric compound. Also the monomeric unit or residue within such an oligomeric or polymeric compound is encompassed in the term “monomer”. Thus, “monomer” and “nucleotide residue” may be used interchangeably throughout the description. Within the context of the present invention, a monomer is preferably a nucleotide.

[0707] As used herein, "nucleobase" refers to the heterocyclic base portion of a nucleoside. Nucleobases may be naturally occurring or may be modified and therefore include, but are not limited to adenine, cytosine, guanine, uracil, thymine and analogues thereof such as 5-methyl- cytosine. In certain embodiments, a nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a base of another nucleic acid.

[0708] As used herein, "Tm" means melting temperature which is the temperature at which the two strands of a duplex nucleic acid separate. Tmis often used as a measure of duplex stability or the binding affinity of an antisense compound toward a complementary RNA molecule.

[0709] As used herein, "2'-modified" or "2'-substituted" refers to a nucleoside comprising a pentose sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2'-substituents, such as allyl, amino, azido, thio, O-allyl, O-Ci- C10 alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-O-N(Rm)(Rn), or O-CH2-C(=O)- N(Rm)(Rn), wherein each Rmand Rnis, independently, H or substituted or unsubstituted C1-C10 alkyl. 2'-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and / or at the nucleobase.

[0710] As used herein, “2’-O-Me”, "2'-OMe" or "2 -OCH3" or "2'-O-methyl" each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2' position of the sugar ring.

[0711] As used herein, "MOE" or "2'-MOE" or "2'-OCH2CH2OCH3" or "2'-O-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a -OCH2CH2OCH3 group at the 2' position of the sugar ring.

[0712] As used herein, the term "adenine analogue" means a chemically-modified purine nucleobase that, when incorporated into an oligomer, is capable of forming a base pair with either a thymine or uracil of a complementary strand of RNA or DNA. Preferably, such base pair is a Watson- Crick base pair, but analogues and slight deviations thereof are also considered allowable within the context of the present invention.

[0713] As used herein, the term "uracil analogue" means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable of forming a base pair with either a adenine of a complementary strand of RNA or DNA. Preferably, such base pair is a Watson-Crick base pair, but analogues and slight deviations thereof are also considered allowable within the context of the present invention.

[0714] As used herein, the term "thymine analogue" means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable of forming a base pair with an adenine of a complementary strand of RNA or DNA. Preferably, such base pair is a Watson- Crick base pair, but analogues and slight deviations thereof are also considered allowable within the context of the present invention.

[0715] As used herein, the term "cytosine analogue" means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable of forming a base pair with a guanine of a complementary strand of RNA or DNA. For example, cytosine analogue can be a 5-methylcytosine. Preferably, such base pair is a Watson-Crick base pair, but analogues and slight deviations thereof are also considered allowable within the context of the present invention.

[0716] As used herein, the term "guanine analogue" means a chemically-modified purine nucleobase that, when incorporated into an oligomer, is capable of forming a base pair with a cytosine of a complementary strand of RNA or DNA. Preferably, such base pair is a Watson-Crick base pair, but analogues and slight deviations thereof are also considered allowable within the context of the present invention.

[0717] As used herein, the term "guanosine" refers to a nucleoside or sugar-modified nucleoside comprising a guanine or guanine analog nucleobase.

[0718] As used herein, the term "uridine" refers to a nucleoside or sugar-modified nucleoside comprising a uracil or uracil analog nucleobase. As used herein, the term "thymidine" refers to a nucleoside or sugar-modified nucleoside comprising a thymine or thymine analog nucleobase.

[0719] As used herein, the term "cytidine" refers to a nucleoside or sugar-modified nucl eoside comprising a cytosine or cytosine analog nucleobase.

[0720] As used herein, the term "adenosine" refers to a nucleoside or sugar-modified nucleoside comprising an adenine or adenine analog nucleobase.

[0721] As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

[0722] As used herein, "oligomeric compound" refers to a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound is an oligonucleotide. In certain embodiments, an oligomeric compound is a single-stranded oligonucleotide. In certain embodiments, an oligomeric compound is a double-stranded duplex comprising two oligonucleotides. In certain embodiments, an oligomeric compound is a single-stranded or double-stranded oligonucleotide comprising one or more conjugate groups and / or terminal groups.

[0723] As used herein, "conjugate" refers to an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional linking moiety or linking group to the parent compound such as an oligomeric compound. In certain embodiments, conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. In certain embodiments, conjugates are terminal groups. In certain embodiments, conjugates are attached to a 3' or 5' terminal nucleoside or to an internal nucleoside of an oligonucleotide.

[0724] As used herein, "conjugate linking group" refers to any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound. Linking groups or bifunctional linking moieties such as those known in the art are amenable to the present invention.

[0725] As used herein, "antisense compound" refers to an oligomeric compound, at least a portion of which is at least partially complementary to, or at least partially directed to, a target nucleic acid to which it hybridizes and modulates the activity, processing or expression of said target nucleic acid.

[0726] As used herein, "expression" refers to the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, splicing, post-transcriptional modification, and translation.

[0727] As used herein, "antisense oligonucleotide" refers to an antisense compound that is an oligonucleotide.

[0728] As used herein, "antisense activity" refers to any detectable and / or measurable activity attributable to the hybridization of an anti sense compound to its target nucleic acid. In certain embodiments, such activity may be an increase or decrease in an amount of a nucleic acid or protein. In certain embodiments, such activity may be a change in the ratio of splice variants of a nucleic acid or protein. Detection and / or measuring of antisense activity may be direct or indirect. In certain embodiments, antisense activity is assessed by observing a phenotypic change in a cell or animal.

[0729] As used herein, "target nucleic acid" refers to any nucleic acid molecule the expression, amount, or activity ofwhich is capable of being modulated by an antisense compound. In certain embodiments, the target nucleic acid is DNA or RNA. In certain embodiments, the target RNA is miRNA, mRNA, pre-mRNA, non-coding RNA, or natural antisense transcripts. For example, the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state,

[0730] As used herein, "target mRNA" refers to a pre-selected RNA molecule that encodes a protein. As used herein, "targeting" or "targeted to" refers to the association of an antisense compound to a particular target nucleic acid molecule or a particular region of nucleotides within a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is complementary to the target nucleic acid to allow hybridization under physiological conditions. In an embodiment, complementarity does not need to be full complementarity (100% complementarity). In an embodiment, an oligonucleotide is complementary to a target nucleic acid means that it is sufficiently reverse complementary to the target nucleic acid to allow hybridization under physiological conditions. In this context “sufficiently reverse complementary” may be at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% reverse complementary with said targeted nucleic acid molecule.

[0731] As used herein, "target site" refers to a region of a target nucleic acid that is bound by an antisense compound. In certain embodiments, a target site is at least partially within the 3' untranslated region of an RNA molecule. In certain embodiments, a target site is at least partially within the 5' untranslated region of an RNA molecule. In certain embodiments, a target site is at least partially within the coding region of an RNA molecule. In certain embodiments, a target site is at least partially within an exon of an RNA molecule. In certain embodiments, a target site is at least partially within an intron of an RNA molecule. In certain embodiments, a target site is at least partially within a miRNA target site of an RNA molecule. In certain embodiments, a target site is at least partially within a repeat region of an RNA molecule.

[0732] As used herein, "target protein" refers to a protein, the expression of which is modulated by an antisense compound. In certain embodiments, a target protein is encoded by a target nucleic acid. In certain embodiments, expression of a target protein is otherwise influenced by a target nucleic acid.

[0733] As used herein, "complementarity" in reference to nucleobases refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.

[0734] As used herein, "non-complementary" in reference to nucleobases refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

[0735] As used herein, "complementary" in reference to linked nucleosides, oligonucleotides, or nucleic acids, refers to the capacity of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid through nucleobase complementarity. In certain embodiments, an antisense compound and its target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can bond with each other to allow stable association between the antisense compound and the target. One skilled in the art recognizes that the inclusion of mismatches is possible without eliminating the ability of the oligomeric compounds to remain in association. Therefore, described herein are antisense compounds that may comprise up to about 20% nucleotides that are mismatched (i.e., are not nucleobase complementary to the corresponding nucleotides of the target). Preferably the antisense compounds contain no more than about 15%, more preferably not more than about 10%, most preferably not more than 5% or no mismatches. The remaining nucleotides are nucleobase complementary or otherwise do not disrupt hybridization (e.g., universal bases). One of ordinary skill in the art would recognize the compounds provided herein are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a target nucleic acid or reverse complementarity to a target nucleic acid. As used herein, "modulation" refers to a perturbation of amount or quality of a function or activity when compared to the function or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include perturbing splice site selection of pre-mRNA processing, resulting in a change in the amount of a particular splice-variant present compared to conditions that were not perturbed. As a further example, modulation includes perturbing translation of a protein.

[0736] As used herein, "motif refers to a pattern of modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and / or at certain linking groups of an oligomeric compound.

[0737] As used herein, "the same modifications" refer to modifications relative to naturally occurring molecules that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have "the same modification," even though the DNA nucleoside is unmodified.

[0738] As used herein, "type of modification" in reference to a nucleoside or a nucleoside of a "type" refers to the modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.

[0739] As used herein, "pharmaceutically acceptable salts" refers to salts of active compounds that retain the desired biological activity of the active compound and do not impart undesired toxicological effects thereto.

[0740] As used herein, the term "independently" means that each occurrence of a repetitive variable within a claimed oligonucleotide is selected independent of one another. For example, each repetitive variable can be selected so that (i) each of the repetitive variables are the same, (ii) two or more are the same, or (iii) each of the repetitive variables can be different.

[0741] As used herein, a zero (0) in a range indicating number of a particular unit means that the unit may be absent. For example, an oligomeric compound comprising 0-2 regions of a particular motif means that the oligomeric compound may comprise one or two such regions having the particular motif, or the oligomeric compound may not have any regions having the particular motif. In instances where an internal portion of a molecule is absent, the portions flanking the absent portion are bound directly to one another. Likewise, the term "none" as used herein, indicates that a certain feature is not present.

[0742] As used herein, "analogue" or "derivative" means either a compound or moiety similar in structure but different in respect to elemental composition from the parent compound regardless of how the compound is made. For example, an analogue or derivative compound does not need to be made from the parent compound as a chemical starting material.

[0743] The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

[0744] Legends to the figure

[0745] Figure 1 : Comparative activity of ASOs containing at least one 5’, 3’, and / or 5’+3’ abasic nucleotide in HeLa cells co-transfected with ATXN1-CAG20-hRluc (SEQ ID NO: 38) plasmids and 10nM ASO.

[0746] Figure 2 : Comparative activity of ASOs containing at least one 5’, 3’, and / or 5’+3’ abasic nucleotide in HeLa cells co-transfected with ATXN1-CAG20-hRluc (SEQ ID NO:38), ATXN1- CAG32-hRluc (SEQ ID NO:39), or ATXN1-CAG57-hRluc (SEQ ID NO: 40) plasmids and 10nM ASO.

[0747] Figure 3 : Comparative activity of ASOs containing at least one internal abasic nucleotide in HeLa cells co-transfected with ATXN1-CAG20-hRluc (SEQ ID NO:38 plasmids and 10nM ASO.

[0748] Figure 4 : Comparative activity of ASOs containing one, two, or three 5’ or 3’ terminal or internal abasic nucleotide(s) in HeLa cells co-transfected with ATXN1-CAG20-hRluc (SEQ ID NO:38) plasmids and 5-10-20 nM ASO.

[0749] Table : SEQ ID Nos of this application Examples

[0750] Example 1 Aim

[0751] The aim of this study was to investigate the effect of abasic nucleotides -incorporated internally or at the 5’ and / or 3’ termini of the oligonucleotide- on the bioactivity and alleleselectivity of a control single stranded 2’-O-methyl phosphorothioate oligonucleotide comprising the base sequence (CUG)7 wherein each cytosine is a 5-methylcytosine (i.e. control oligonucleotide SEQ ID NO: 1) and which is a wherein each in a luciferase assay with different ATXN1-CAG-hRLuc constructs transfected into HeLa cells.

[0752] Method & Materials

[0753] ASOs

[0754] ASOs targeting expanded CAG repeat stretches and containing at least one abasic nucleotide were designed (see Table 1). All ASOs were single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides comprising the base sequence (CUG)7 wherein each cytosine is a 5-methylcytosine. The abasic nucleotides were either DNA or 2’-O-methyl RNA. The ASOs were synthesized in 5 pmol scale by a MerMade 12 synthesizer (Bioautomation) using standard phosphoramidite protocols. The ASOs were cleaved and deprotected in a two- step sequence (DEA followed by cone. NH4OH treatment), purified by anion-exchange chromatography, desalted by size exclusion chromatography and lyophilized. Mass spectrometry confirmed the identity of all ASOs, and purity (determined by UPLC) was found acceptable for all (>80%).

[0755] Table 1 : List of ASOs tested, including their sequence and chemistry

[0756] ASO

[0757] Sequence 5’ a 3’

[0758] SEQ ID NO

[0759] 1 CUGCUGCUGCUGCUGCUGCUG

[0760] 15 XCUGCUGCUGCUGCUGCUGCUG

[0761] 41 YCUGCUGCUGCUGCUGCUGCUG

[0762] 16 XXCUGCUGCUGCUGCUGCUGCUG

[0763] 42 YYCUGCUGCUGCUGCUGCUGCUG

[0764] 17 XXXCUGCUGCUGCUGCUGCUGCUG

[0765] 43 YYYCUGCUGCUGCUGCUGCUGCUG

[0766] 44 XXXXCUGCUGCUGCUGCUGCUGCUG

[0767] 45 YYYYCUGCUGCUGCUGCUGCUGCUG

[0768] 46 XXXXXCUGCUGCUGCUGCUGCUGCUG

[0769] 47 YYYYYCUGCUGCUGCUGCUGCUGCUG

[0770] 48 XXXXXXXCUGCUGCUGCUGCUGCUGCUG YYYYYYYCUGCUGCUGCUGCUGCUGCUG

[0771] XXXXXXXXXCUGCUGCUGCUGCUGCUGCUG

[0772] YYYYYYYYYCUGCUGCUGCUGCUGCUGCUG

[0773] XXXXXXXXXXXCUGCUGCUGCUGCUGCUGCUG

[0774] YYYYYYYYYYYCUGCUGCUGCUGCUGCUGCUG

[0775] XXXXXXXXXXXXXCUGCUGCUGCUGCUGCUGCUG

[0776] YYYYYYYYYYYYYCUGCUGCUGCUGCUGCUGCUG

[0777] XXXXXXXXXXXXXXXCUGCUGCUGCUGCUGCUGCUG

[0778] YYYYYYYYYYYYYYYCUGCUGCUGCUGCUGCUGCUG

[0779] CUGCUGCUGCUGCUGCUGCUGX

[0780] CUGCUGCUGCUGCUGCUGCUGY

[0781] CUGCUGCUGCUGCUGCUGCUGXX

[0782] CUGCUGCUGCUGCUGCUGCUGYY

[0783] CUGCUGCUGCUGCUGCUGCUGXXX

[0784] CUGCUGCUGCUGCUGCUGCUGYYY

[0785] CUGCUGCUGCUGCUGCUGCUGXXXX

[0786] CUGCUGCUGCUGCUGCUGCUGYYYY

[0787] CUGCUGCUGCUGCUGCUGCUGXXXXX

[0788] CUGCUGCUGCUGCUGCUGCUGYYYYY

[0789] CUGCUGCUGCUGCUGCUGCUGXXXXXXX

[0790] CUGCUGCUGCUGCUGCUGCUGYYYYYYY

[0791] CUGCUGCUGCUGCUGCUGCUGXXXXXXXXX

[0792] CUGCUGCUGCUGCUGCUGCUGYYYYYYYYY

[0793] CUGCUGCUGCUGCUGCUGCUGXXXXXXXXXXX

[0794] CUGCUGCUGCUGCUGCUGCUGYYYYYYYYYYY

[0795] CUGCUGCUGCUGCUGCUGCUGXXXXXXXXXXXXX

[0796] CUGCUGCUGCUGCUGCUGCUGYYYYYYYYYYYYY

[0797] CUGCUGCUGCUGCUGCUGCUGXXXXXXXXXXXXXXX

[0798] CUGCUGCUGCUGCUGCUGCUGYYYYYYYYYYYYYYY

[0799] XCUGCUGCUGCUGCUGCUGCUGX

[0800] YCUGCUGCUGCUGCUGCUGCUGY

[0801] XXCUGCUGCUGCUGCUGCUGCUGXX

[0802] YYCUGCUGCUGCUGCUGCUGCUGYY

[0803] XXXCUGCUGCUGCUGCUGCUGCUGXXX

[0804] YYYCUGCUGCUGCUGCUGCUGCUGYYY

[0805] XXXXCUGCUGCUGCUGCUGCUGCUGXXXX

[0806] YYYYCUGCUGCUGCUGCUGCUGCUGYYYY

[0807] XXXXXCUGCUGCUGCUGCUGCUGCUGXXXXX

[0808] YYYYYCUGCUGCUGCUGCUGCUGCUGYYYYY

[0809] XXXXXXXCUGCUGCUGCUGCUGCUGCUGXXXXXXX

[0810] Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide, Y= 2’-O-methyl RNA abasic nucleotide. hATXN1-hRluc plasmids

[0811] The coding sequence of human ATXN1 exon 8 was cloned with either 20 CAG repeats (SEQ ID NO:38) (738 bp downstream of start codon), 32 CAG repeats (SEQ ID NO:39) (774 bp downstream start codon), or 57 CAG repeats (SEQ ID NQ:40) (849 bp downstream of start codon) in the PsiCheck2 plasmid (Promega, C8021), in frame with the downstream Renilla luciferase coding sequence. The original start codon of Renilla luciferase was removed. The plasmids also contained the Iuc2 (firefly luciferase) reporter gene.

[0812] Cells and transfection HeLa cells were seeded in 96-well plates (~ 12,500 cells per well) 24 hours prior to transfection. Each well contained 100 pl Proliferation Medium (DMEM (ThermoFisher, 41965047) supplemented with 10% FBS, 1% Pen / Strep, and 1% Glutamax). For transfection the medium was replaced by 37.5 pl Pen / Strep-free Proliferation Medium. The cells were first transfected with ASOs at final concentrations of 5, 10, or 20 nM (in triplicate), with 0.2 pl Lipofectamine 2000 (ThermoFisher, 11668019) in 37.5 pl Opti-mem (ThermoFisher, 31985062) per well. Each plate included a reference ASO (SEQ ID NO:1) and six non-treated (NT) wells. After 4-hour incubation at 37°C and 5% CO2, the medium was replaced by 37.5p I Pen / Strep-free Proliferation Medium. The cells were then transfected with 40 ng hATXNI- hRIuc plasmid (with either 20, 32 or 57 CAG repeats) and 0.2pl of Lipofectamine 2000 in 37.5pl Opti-mem. The plates were incubated for an additional 24 hours at 37°C and 5% CO2.

[0813] Luciferase assay

[0814] Plates were removed from the incubator and cooled down to room temperature before adding 75 pl Dual Gio per well (Promega, part of kit E2980). Luminescence of firefly luciferase was measured after 15 minutes using the BioTek Synergy H1 plate reader. Subsequently, 75pl of Stop and gio (Promega, part of kit E2980) was added to each well and luminescence of Renilla luciferase was measured after a 15 minutes incubation at room temperature. The Renilla to firefly luminescence ratio was determined for each well, and normalization was performed relative to the six NT wells. The mean ratio of the six NT wells was set at 100%. The ratio for each well was expressed as a percentage of this reference point. Finally, the mean and standard deviation were calculated for each triplicate.

[0815] Results

[0816] ASOs with an increasing number (from 1 to 15) of DNA or 2’0-Me RNA abasic nucleotides at the 5’, or 3’, or 5’ and 3’ termini were tested for their activity (i.e. inhibition of Renilla luciferase expression) in a dual Renilla to firefly ratio luciferase assay wherein ATXN1-CAG20-hRluc (SEQ ID NO: 38) plasmids were co-transfected with 5, 10, 20 nM ASO in HeLa cells. The results of a selection of ASOs with DNA abasic nucleotides at 10 nM are shown in Figure 1. All ASOs, even those with up to 15 abasic nucleotides 5’ or 3’, were able to effectively bind to the CAG repeat stretch and inhibit Renilla luciferase expression. Compared to the control oligonucleotide SEQ ID NO: 1 the ASOs with up to three 5’ or 3’ abasic nucleotides were similarly active. ASOs with more than 5 abasics (5’ or 3’) showed reduced activity compared to the control oligonucleotide represented by SEQ ID NO: 1 . When abasic nucleotides were added to both 5’ and 3’ termini the bioactivity was further decreased. The oligonucleotide SEQ ID NO:93 (with 30 abasic terminal nucleotides in total) showed minimal activity. In general, the impact of 3’ abasic nucleotides seemed less than that of 5’ abasic nucleotides. ASOs with 2’0-Me RNA abasic nucleotides showed similar patterns as ASOs with DNA abasic nucleotides, albeit with typically lower expression inhibitory efficiencies. The observed differences between ASOs were similar at 5 or 20 nM. As abasic nucleotides have been reported to improve allele-selective inhibition of both mutant huntingtin and mutant ataxin-3 proteins by RNAi duplexes (Liu et al 2013), we also compared the activity of a small selection of ASOs with abasic nucleotides at the 5’, or 3’, or 5’ and 3’ termini in the luciferase assay with plasmids with an increasing number of CAG repeats (20, 32 or 57 CAG repeats). Figure 2 shows the results for ASOs with DNA abasic nucleotides at 10 nM. As expected the control oligonucleotide represented by SEQ ID NO:1 showed an increased activity on plasmids with increased number of CAG repeats. The ASOs with 5’, 3’ or 5’+3’ abasic nucleotides showed a similar allele-selective trend, but the addition of abasic nucleotides did not unambiguously improve the allele-selective inhibition of SEQ ID NO:1 in this dual luciferase assay.

[0817] Finally, ASOs with internal DNA abasic nucleotides were tested in the dual luciferase assay wherein ATXN1-CAG20-hRluc (SEQ ID NO:38) plasmids were co-transfected with 10 nM ASO in HeLa cells (Figure 3). All ASOs tested with less than seven internal abasics were active and showed a decreased Renilla luciferase expression. The ASOs with in total seven internal abasic nucleotides dispersed over the sequence were inactive (SEQ ID NO:99, NO:100, and NO:76523). The presence of one or two abasic nucleotides had a minor impact on the activity of the ASOs compared to the activity of the control oligonucleotide represented by SEQ ID NO:1 , although a position-effect was observed which may have been due to the position (towards 5’, 3’ or central) and / or the specific base substitution of a G, U or C. SEQ ID NO:7 with only one abasic nucleotide in the centre of the sequence (a U substitution) even showed a small increase in activity compared to the one of the control oligonucleotide represented by SEQ ID NO 1 . When a stretch of three abasics was incorporated, substituting one CUG repeat, the position towards 5’ (SEQ ID NO:12) or 3’ (SEQ ID NO:14) also seemed to increase activity compared to the one of the control oligonucleotide represented by SEQ ID NO:1. When positioned centrally however such abasic CUG substitution seemed to decrease activity (SEQ ID NO:13).

[0818] Conclusion

[0819] Depending on the number and position (substituting a C, G, A, or U), inclusion of abasic nucleotides in ASOs may reduce melting temperature (Tm) and thus binding affinity / stability. This may impact their bioactivity. It is also shown that abasic nucleotides improve allele- selective inhibition of both mutant huntingtin and mutant ataxin-3 proteins in RNAi duplexes (Liu et al 2013). Both aspects (bioactivity and allele-selectivity) are addressed in this study. Based on results of a dual luciferase assay using plasmids with ATXN1 -CAG repeat constructs, it appears that oligonucleotides derived from the control oligonucleotide represented by SEQ ID NO: 1 with abasic nucleotides incorporated internally or at the 5’ and / or 3’ termini can be active and reduce protein expression. The impact of abasic nucleotides on their efficiency relative to the one of the control oligonucleotide represented by SEQ ID NO:1 depends on the number and position of the abasic nucleotides.

[0820] Example 2

[0821] Here also as in example 1 , all ASOs were single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides comprising the base sequence (CUG)7 wherein each cytosine is a 5- methylcytosine. The abasic nucleotides were either DNA or 2’-O-methyl RNA.

[0822] Table 2: List of ASOs tested, including their sequence and chemistry

[0823] Bases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide. hATXN1-hRluc

[0824] The coding sequence of human ATXN1 exon 8 was cloned with 20 CAG repeats (738 bp downstream of start codon) (SEQ ID NO:38) in the PsiCheck2 plasmid (Promega, C8021), in frame with the downstream Renilla luciferase coding sequence. The original start codon of Renilla luciferase was removed. The plasmid also contained the Iuc2 (firefly luciferase) reporter gene.

[0825] Cells and transfection

[0826] HeLa cells were seeded in 96-well plates (~ 12,500 cells per well) 24 hours prior to transfection. Each well contained 100 pl Proliferation Medium (DMEM (ThermoFisher, 41965047) supplemented with 10% FBS, 1 % Pen / Strep, and 1 % Glutamax). For transfection the medium was replaced by 37.5 pl Pen / Strep-free Proliferation Medium. The cells were first transfected with ASOs at final concentrations of 5, 10, or 20 nM (in triplicate), with 0.2 pl Lipofectamine 2000 (ThermoFisher, 11668019) in 37.5 pl Opti-mem (ThermoFisher, 31985062) per well. Each plate included a reference ASO VO659 (SEQ ID NO:1) and six non-treated (NT) wells. After 4- hour incubation at 37°C and 5% CO2, the medium was replaced by 37.5pl Pen / Strep-free Proliferation Medium. The cells were then transfected with 40 ng hATXN1 -hRluc plasmid (with either 20, 32 or 57 CAG repeats) and 0.2pl of Lipofectamine 2000 in 37.5pl Opti-mem. The plates were incubated for an additional 24 hours at 37°C and 5% CO2.

[0827] Luciferase assay

[0828] Plates were removed from the incubator and cooled down to room temperature before adding 75 pl Dual Gio per well (Promega, part of kit E2980). Luminescence of firefly luciferase was measured after 15 minutes using the BioTek Synergy H1 plate reader. Subsequently, 75pl of Stop and gio (Promega, part of kit E2980) was added to each well and luminescence of Renilla luciferase was measured after a 15 minutes incubation at room temperature. The Renilla to firefly luminescence ratio was determined for each well. For cross-plate and -transfection comparison of ASOs the Relative Response Ratio (RRR) was calculated.

[0829] (ratio AON x @ y nM ) — (negative control ratio) - - - (ratio VO659 @ y nM) — (negative control ratio)

[0830] The mean ratio of the six NT wells was utilized as the negative control ratio. RRR was determined for each well. Subsequently, the mean and standard deviation were calculated for each set of triplicates.

[0831] Results and Conclusion

[0832] ASOs with one, two or three 5’ or 3’ terminal or internal DNA abasic nucleotides were tested for their activity (i.e. inhibition of Renilla luciferase expression) in a dual Renilla to firefly ratio luciferase assay wherein ATXN1 -CAG20-hRluc plasmids were co-transfected with 5, 10, 20 nM ASO in HeLa cells. The results of a selection of ASOs with DNA abasic nucleotides are shown in Figure 4. All ASOs with one, two, or three 5’ or 3’ terminal or internal abasic nucleotides were able to effectively bind to the CAG repeat stretch and inhibit Renilla luciferase expression. Whereas the ASOs with 3’ abasics were similarly active as the oligonucleotide with SEQ ID NO:1 , the ASOs with 5’ abasic nucleotides seemed less active than the oligonucleotide with SEQ ID NO:1. Surprisingly, the ASOs with internal abasic nucleotides all showed a higher activity than the one of the oligonucleotide of SEQ ID NO:1.

[0833] Conclusion

[0834] Inclusion of abasic nucleotides in ASOs is anticipated to reduce melting temperature (Tm) and negatively impact binding affinity / stability and thus bioactivity. However, our results show that ASOs derived from SEQ ID NO:1 with one, two or three 3’ terminal or internal abasic nucleotides can be similarly and even more active than the oligonucleotide with SEQ ID NO:1 . List of references

[0835] Datson NA, Gonzalez-Barriga A, Kourkouta E, Weij R, van de Giessen J, Mulders S, Kontkanen O, Heikkinen T, Lehtimaki K, van Deutekom JC. The expanded CAG repeat in the huntingtin gene as target for therapeutic RNA modulation throughout the HD mouse brain. PLoS One. 2017 Feb 9;12(2):e0171127. doi: 10.1371 / journal.pone.0171127. PMID: 28182673; PMCID: PMC5300196.

[0836] Kourkouta E, Weij R, Gonzalez-Barriga A, Mulder M, Verheul R, Bosgra S, Groenendaal B, Puolivali J, Toivanen J, van Deutekom JCT, Datson NA. Suppression of Mutant Protein Expression in SCA3 and SCA1 Mice Using a CAG Repeat-Targeting Antisense Oligonucleotide. Mol Ther Nucleic Acids. 2019 Sep 6;17:601-614. doi: 10.1016 / j.omtn.2019.07.004. Epub 2019 Jul 19. PMID: 31394429; PMCID: PMC6695277.

[0837] Liu J, Pendergraff H, Narayanannair KJ, Lackey JG, Kuchimanchi S, Rajeev KG, Manoharan M, Hu J, Corey DR. RNA duplexes with abasic substitutions are potent and allele-selective inhibitors of huntingtin and ataxin-3 expression. Nucleic Acids Res. 2013 Oct;41 (18):8788- 801. doi: 10.1093 / nar / gkt594. Epub 2013 Jul 24. PMID: 23887934; PMCID: PMC3794577.

Claims

85Claims1 . An oligonucleotide which comprises the following base sequence represented by:H-(CUG )m-H (SEQ ID NO:2)H-UG-(CUG)m-CU-H (SEQ ID NO:3)H-G-(CUG)m-CU-H (SEQ ID NO:4)H-UG-(CUG)m-C-H (SEQ ID NO:5)H-G-(CUG)m-C-H (SEQ ID NO:6)Bases: G=guanine; C=5-methylcytosine; U=Uracil,Wherein m is 5, 6 or 7 and 1 , 2 or 3 of the nucleotides of the oligonucleotide are abasic nucleotides orWherein m is 8 or 9 and 1 , 2, 3, 4, 5 or 6 of the nucleotides of the oligonucleotide are abasic nucleotides.

2. An oligonucleotide according to claim 1 , wherein the abasic nucleotide is located at the 5’ side of the base sequence of the oligonucleotide, at the 3’ side of said base sequence and / or within said base sequence, preferably wherein the abasic nucleotide is located within said base sequence.

3. An oligonucleotide according to any one of the preceding claims, wherein m is 7 and said oligonucleotide comprises 1 , 2 or 3 abasic nucleotides, preferably wherein the abasic nucleotide is located within said base sequence.

4. An oligonucleotide according to anyone of the preceding claims, preferably according to claim 3, wherein the abasic nucleotides are located as follows: a) 1 , 2 or 3 abasic nucleotides are present at the 5’ side of the base sequence of the oligonucleotide defined in claim 1 , b) 1 , 2 or 3 abasic nucleotides are present at the 3’ side of the base sequence of the oligonucleotide defined in claim 1 , and\or c) 1 , 2 or 3 abasic nucleotides are present within the base sequence of the oligonucleotide defined in claim 1 .

5. An oligonucleotide according to claim 4, wherein m is 7 and the positions of the abasic nucleotides within the base sequence of the oligonucleotide are selected from:4, 11 and 18,4, 6 and 8,4, 5, and 6,10, 11 and 12 or8616, 17 and 18.

6. An oligonucleotide according to claim 4, wherein 1 , 2 or 3 abasic nucleotides are located at the 5’ of the base sequence of the oligonucleotide defined in claim 1 and / or 1 , 2 or 3 abasic nucleotides are located at the 3’ of the base sequence of the oligonucleotide defined in claim 1.

7. An oligonucleotide according to claim 6, wherein m is 7.

8. An oligonucleotide according to claim 7, wherein the abasic nucleotides are at the following positions within the base sequence of the oligonucleotide defined in claim 1 :11 184 and 1111 and 184, 6 and 84, 5 and 610 , 11 and 1216, 17 and 18.

9. An oligonucleotide according to claim 8, wherein m is 7, the abasic nucleotides are represented by X, and the base sequence of the oligonucleotide comprises, consists of or essentially consists of:- SEQ ID NO:7: CUGCUGCUGCXGCUGCUGCUG- SEQ ID NO:8:CUGCUGCUGCUGCUGCUXCUG- SEQ ID NO:9: CUGXUGCUGCXGCUGCUGCUG- SEQ ID NO:10: CUGCUGCUGCXGCUGCUXCUG- SEQ ID NO:11 : CUGXUXCXGCUGCUGCUGCUG- SEQ ID NO:12: CUGXXXCUGCUGCUGCUGCUG- SEQ ID NO:13: CUGCUGCUGXXXCUGCUGCUG- SEQ ID NO:14: CUGCUGCUGCUGCUGXXXCUGBases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide, the oligonucleotides SEQ ID NO:7-14 being single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

10. An oligonucleotide according to claim 6, wherein1 abasic nucleotide is located at the 5’ of the base sequence of the oligonucleotide defined in claim 1872 abasic nucleotides are located at the 5’ of the base sequence of the oligonucleotide defined in claim 13 abasic nucleotides are located at the 5’ of the base sequence of the oligonucleotide defined in claim 11 abasic nucleotide is located at the 3’ of the base sequence of the oligonucleotide defined in claim 12 abasic nucleotides are located at the 3’ of the base sequence of the oligonucleotide defined in claim 1 and / or3 abasic nucleotides are located at the 3’ of the base sequence of the oligonucleotide defined in claim 1 .11 . An oligonucleotide according to claim 10, wherein the base sequence of the oligonucleotide is- SEQ ID NO: 15: XCUGCUGCUGCUGCUGCUGCUG- SEQ ID NO:16: XXCUGCUGCUGCUGCUGCUGCUG- SEQ ID NO:17: XXXCUGCUGCUGCUGCUGCUGCUG- SEQ ID NO:18: CUGCUGCUGCUGCUGCUGCUGX- SEQ ID NO:19: CUGCUGCUGCUGCUGCUGCUGXX- SEQ ID NO:20: CUGCUGCUGCUGCUGCUGCUGXXXBases: G=guanine; C=5-methylcytosine; U=Uracil; X= DNA abasic nucleotide, the oligonucleotides SEQ ID NQ:15-20 being single-stranded 2’-O-methyl phosphorothioate oligoribonucleotides.

12. An oligonucleotide according to any one of the preceding claims, wherein1) the length of said oligonucleotide is from 15 to 37 nucleotides, including abasic nucleotides and nucleotides with a base,2) said oligonucleotide is a single stranded oligonucleotide and / or3) a nucleotide of said oligonucleotide is modified compared to an RNA oligonucleotide, preferably wherein said modification is selected from the group consisting of a modified base, a modified sugar and a modified internucleotide linkage.

13. An oligonucleotide according to claim 12, wherein the modified base is 5-methylcytosine and / or 5-methyluracil, the modified sugar is 2-O’-methyl and / or the modified internucleotide linkage is phosphorothioate.

14. An oligonucleotide according to any one of the preceding claims, wherein881) the abasic nucleotide is a DNA or a RNA abasic nucleotide, preferably a RNA abasic nucleotide, more preferably a modified RNA abasic nucleotide, even more preferably a RNA nucleotide with a modified sugar, and most preferably a RNA nucleotide with a 2-O’-methyl sugar,2) said oligonucleotide comprises at least two different types of abasic nucleotides, preferably a DNA abasic and a RNA abasic nucleotide, more preferably the RNA abasic nucleotide is a 2’0-Me RNA abasic nucleotide,3)said oligonucleotide is- 100% reverse complementary to the target sequence and therefore does not contain any mismatch or wobbles,- when the abasic nucleotides are at the 5’ end / side and / or at the 3’end / side of the oligonucleotide, said oligonucleotide comprises an internal mismatch or internal wobble base, preferably this oligonucleotide comprises up to 1 , 2, 3, 4 or up to 5 internal mismatches or internal wobbles or- when the abasic nucleotide is internal or is within the base sequence of the oligonucleotide, the number of allowable mismatch or wobble and abasic nucleotide is up to 1 , 2, 3, 4 or up to 5 and / or4) said oligonucleotide exhibits at least one of the below defined activities: reducing or silencing or decreasing the translation rate of a mutant transcript comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529) and thus the amount of a corresponding mutant protein, interfering with the splicing of a mutant transcript (pre-mRNA) comprising a repetitive nucleotide unit (CAG)n (SEQ ID NO:76529), such as the induction of exon skipping resulting in an out-of-frame transcript and in reduced levels of in-frame transcript, and thus reducing the amount of a corresponding mutant protein and reducing or decreasing or lowering a mutant protein level.

15. A composition comprising an oligonucleotide as defined in any one of the preceding claims, preferably said composition comprising at least one excipient that may further aid in enhancing the targeting and / or delivery of said composition and / or said oligonucleotide to a tissue and / or cell and / or into a tissue and / or cell.

16. An oligonucleotide according to any one of claims 1 to 14 or a composition according to claim 15, for use in treating, delaying, ameliorating and / or preventing a human genetic disease associated with a human (CAG)n (SEQ ID NO:76529) repeat instability associated genetic disorder, preferably wherein the human genetic disease is Huntington’s disease (HD), spinocerebellar ataxia (SCA) type 1 , 2, 3, 6, 7, 12 or 17, amyotrophic lateral sclerosis (ALS),89 frontotemporal dementia (FTD), X-5 linked spinal and bulbar muscular atrophy (SBMA) and / or dentatorubropallidoluysian atrophy (DRPLA), preferably wherein said human genetic disease is caused by CAG repeat expansions in the transcripts of the HTT (SEQ ID NO: 21), ATXN1 (SEQ ID NO:22), ATXN2 (SEQ ID NO: 23) ATXN3 (SEQ ID NO: 24), CACNA1A (SEQ ID NO:25), ATXN7 (SEQ ID NO: 26), PPP2R2B (SEQ ID NO: 27), TBP10 (SEQ ID NO: 28), AR (SEQ ID NO: 29) or ATN1 (SEQ ID NO: 30) genes.

17. An oligonucleotide or a composition for use according to claim 16, wherein administration of said oligonucleotide or composition is via an intravenous, subcutaneous, intraventricular, intrathecal, intramuscular, intranasal, enteral, intravitreal, intracerebral, epidural or oral route.