Modified dzymes and uses thereof

Abstract

Described herein are modified DZymes and uses thereof for treating a disease or condition in a subject. The modified DZymes described herein have modified catalytic cores, wherein modifications include modified nucleotides (modified sugars and or modified bases), and modified linkages between nucleotides. The modified DZymes maintain enzymatic cleavage activity and have increased stability and decreased RNAse H activity, compared with unmodified DZymes. The DZymes may be used for targeted cleavage of an RNA transcript.

Description

P-634420-PCMODIFIED DZYMES AND USES THEREOF SEQUENCE LISTING STATEMENT

[0001] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML format copy, created on December 8, 2025, is named P-634420-PC-ST26.xml and is 7,068,483 bytes in size.BACKGROUND

[0002] The 10-23 DNA enzyme (10-23 DZyme or 10-23 DNAzyme) has been studied for more than two decades as a potential therapeutic tool by site specific RNA knockdown (KD). While the 10-23 DZyme has proven highly effective in cell-free environments, there is only limited work showing its activity in cells and animals (Silverman, S. K., Catalytic DNA: Scope, applications, and Biochemistry of Deoxyribozymes. Trends Biochem Sci, 2016. 41(7): p. 595-609.) This is in large part due to the poor metabolic stability of natural DNA to nucleases evident in biological fluids. Generating metabolically stable 10-23 DZyme is therefore a necessary milestone in order to generate 10-23 DZyme-based therapeutics.

[0003] The 10-23 DZyme is a short DNA sequence typically divided into two binding arms (often 5-12 bases long), exerting their function through Watson-Crick-Franklin base pairing with the DZyme’ s target RNA, and a catalytic core (about 15 bases long) that exert the nuclease cleavage function through an in-line nucleophilic attack on the phosphodiester bond between the two nucleotides on either side of the cleavage site. Earlier work has shown the ability to increase the catalytic activity of the 10-23 DZyme by introduction of specific chemical groups in the DZyme’ s catalytic core and by optimizing the RNA affinity of its binding arms (Nguyen, K., et al., allele-Specific RNA Knockdown with a Biologically Stable and Catalytically Efficient XNAzyme. J Am Chem Soc, 2021. 143(12): p.4519-4523; Larcher et al., (2023) DNAzymes: Expanding the Potential of Nucleic Acid Therapeutics. Nucleic Acid Ther. 33(3): 178-192.). Several chemical modifications used in the arms have indeed improved the metabolic stability of the 10-23 DZyme in some biological matrices, but to a low extent, insufficient to lead to long term RNA KD in cells or improved pharmacokinetics in animals.

[0004] A major challenge towards reaching a metabolically stable 10-23 DZyme is the incompatibility of several positions in its catalytic core with standard chemical modifications used in the oligonucleotide field. Incorporation of such modifications often leads to drastic loss of catalytic activity (Nawrot, B., et al., Mapping of the functional phosphate groups in the catalytic core of deoxyribozyme 10-23. FEBS J, 2007. 274(4): p. 1062-72.), resulting in modified DZymes inadequate for use as a therapeutic agent.P-634420-PC

[0005] The modified DZymes described herein provide unique advantages over modified DZymes known in the art, wherein the DZymes described herein act only through their inherent mechanism of action in the absence of Ribonuclease H (RNAse H) recruitment, hence allowing complete RNA target allelic discrimination. Moreover, the disclosed DZymes have enhanced stability and catalytic activity, with reduced dependance on Mg2+SUMMARY

[0006] In certain aspects, disclosed herein modified DZymes comprising modified catalytic cores, wherein these modified DZymes have improved characteristics including improved catalytic activity, improved stability, improved specificity, or reduced or absent RNAse H recruitment, or a combination thereof.

[0007] In some aspects, a modified DZyme targeting an RNA transcript, comprises in 5’ to 3’ order: (i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein said nucleotide sequence comprises at least four (4) modified nucleosides selected from (a)-(g):(a) wherein the cytidine (C) at position 3 comprises a threose nucleic acid (Ctna) or a 4’-methyl- 2’ -deoxyribose (C4me);(b) wherein the thymidine (T) at position 4 comprises a deoxyuridine (dU), a 5-fluoro-2’- deoxyuridine (U5fu), or a 2’ -fluoro (Uf);(c) wherein the C at position 7 is a 2’-NH2 (Cam);(d) wherein the T at position 8 comprises a 2’-O-methyl (Uom), a L-DNA (Tl), a Uf, an unlocked nucleic acid (Uuna), a 6-aza-2’-deoxyuridune (U6azadu), a 2’-O-methoxyethyl (Tmo), a glycol nucleic acid (Tgna), or is absent;(e) wherein the C at position 10 comprises a C4me or a 5-methylcytosine (Cmc);(f) wherein the adenosine (A) at position 11 is a 2’ -fluoro (Af); and(g) wherein the guanosine (G) at position 14 comprises a 2’-O-methoxyethyl (Gmo), a 2’-NH2 (Gam), a 2’-O-methyl (Gom), or a 2’ -fluoro (Gf); and(iii)a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0008] In a related aspect, the G at position 14 comprises a Gmo or a Gam. In a further related aspect, the T at position 8 comprises a Uom, is a Tmo, or is a Uuna. In another further related aspect, the T at position 4 comprises a dU or a U5fu. In still another further related aspect, the C at position 3 is a Ctna and the C at position 7 is a Cam. In yet another further related aspect, the T at position 4P-634420-PCcomprises a dU or a U5fu.

[0009] In another related aspect, the nucleotide sequence comprises at least five (5), six (6), or seven (7) modified nucleosides selected from (a) - (g). In addition, in another related aspect, the backbone linker phosphodiester bonds (PO) between nucleotides 10-24 of SEQ ID NO: 1 comprises modified linkers or unmodified linkers or any combination thereof.

[0010] In another aspect, a modified DZyme targeting an RNA transcript, comprises in 5’ to 3’ order: (i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein said nucleotide sequence comprises at least four (4) linker modifications selected from (a)-(g):(a) wherein the linker 3' of the guanosine (G) nucleotide at position 1 comprises a methoxy phosphonate (mop), a mesyl phosphoramidate (msl), or a phosphoryl guanidine (pg); (b) wherein the linker 3' of the thymidine (T) nucleotide at position 4 comprises a phosphoro thioate (ps) or a pg;(c) wherein the linker 3' of the adenosine (A) nucleotide at position 5 comprises a pg, a msl, a mop, or an ethoxy phosphonate (eop);(d) wherein the linker 3' of the A nucleotide at position 9 comprises a pg, msl, mop, or an eop;(e) wherein the linker 3' of the cytidine (C) nucleotide at position 10 comprises a pg, a msl, a mop, or an eop;(f) wherein the linker 3' of the A nucleotide at position 12 comprises a pg, a msl, a mop, or an eop; and(g) wherein the linker 3' of the C nucleotide at position 13 comprises a pg, a msl, a mop, or an eop; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0011] In a related aspect, the linker 3' of the G nucleotide at position 1 comprises a msl or a pg; the linker 3' of the T nucleotide at position 4 comprises a ps or a pg; the linker 3' of the A nucleotide at position 5 comprises a msl or a pg; the linker 3' of the A nucleotide at position 9 comprises a msl or a pg; the linker 3' of the C nucleotide at position 10 comprises a msl or a pg; the linker 3' of the A nucleotide at position 12 comprises a msl or a pg; and the linker 3' of the C nucleotide at position 13 comprises a msl or a pg. In a further related aspect, the linker 3' of the G nucleotide at position 1 is msl and the linker 3' of the C nucleotide at position 10 is a pg. In another further related aspect, the linker 3' of the A nucleotide at position 9 is a pg. In still another further related aspect, the linker 3' ofP-634420-PCthe G nucleotide at position 1 is a msl; the linker 3' of the T nucleotide at position 4 comprises a ps or a pg; the linker 3' of the A nucleotide at position 5 is a msl; the linker 3' of the A nucleotide at position 9 is a msl; the linker 3' of the C nucleotide at position 10 is a msl; the linker 3' of the A nucleotide at position 12 is a msl; and the linker 3' of the C nucleotide at position 13 is a msl.

[0012] In another further related aspect, the linker 3' of the G nucleotide at position 1 is a pg; the linker 3' of the T nucleotide at position 4 comprises a ps or a pg; the linker 3' of the A nucleotide at position 5 is a pg; the linker 3' of the A nucleotide at position 9 is a pg; the linker 3' of the C nucleotide at position 10 is a pg; the linker 3' of the A nucleotide at position 12 is a pg; and the linker 3' of the C nucleotide at position 13 is a pg. In still a further related aspect, the linker 3' of the A nucleotide at position 5 is a msl. In another further related aspect, the linker 3' of the A nucleotide at position 12 is a msl. In yet another further related aspect, the linker 3' of the C nucleotide at position 13 is a msl.

[0013] In a related aspect, the nucleotide sequence comprises at least five (5), at least six (6), or at least seven (7) linker modifications selected from (a) - (g). In another related aspect, the nucleoside moieties of nucleotides 10-24 of SEQ ID NO: 1 comprise modified or unmodified sugars and or bases, or any combination thereof.

[0014] In some aspects disclosed herein are modified DZyme targeting an RNA transcript, comprising in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein said nucleotide sequence comprises at least five (5) linker modifications selected from (a)-(g):(a) wherein the linker 3' of the guanosine (G) nucleotide at position 2 is a phosphoryl guanidine (pg);(b) wherein the linker 3' of the G nucleotide at position 6 is a pg;(c) wherein the linker 3' of the cytidine (C) nucleotide at position 7 is a pg;(d) wherein the linker 3' of the adenosine (A) nucleotide at position 9 is a pg;(e) wherein the linker 3' of the C nucleotide at position 10 is a pg;(f) wherein the linker 3' of the A nucleotide at position 12 is a pg;(g) wherein the linker 3' of the A nucleotide at position 15 is a pg; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0015] In a related aspect, the linker 3' of the thymidine (T) nucleotide at position 8 is a pg and / or wherein the linker 3' of the A at position 11 is a pg and / or wherein the linker 3' of the G at position 14 is a pg. In a further related aspect, the linker 3' of the C nucleotide at position 3 is a pg and / orP-634420-PCwherein the linker 3' of the C nucleotide at position 13 is a pg. In another further related aspect, the linker 3' of the T nucleotide at position 4 comprises a pg or a ps.

[0016] In another related aspect, the nucleoside moieties of nucleotides 10-24 of SEQ ID NO: 1 comprise modified or unmodified sugars and or bases or any combinations thereof.

[0017] In some aspects disclosed herein are modified DZymes targeting an RNA transcript comprising in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein said nucleotide sequence comprises modified linkers,(a) wherein the linker 3' of the guanosine (G) nucleotide at position 2 is an ethoxy phosphonate (eop);(b) wherein the linker 3' of the cytidine (C) nucleotide at position 7 is an eop;(c) wherein the linker 3' of the adenosine (A) nucleotide at position 9 is an eop; (d) wherein the linker 3' of the C nucleotide at position 10 is an eop;(e) wherein the linker 3' of the A nucleotide at position 12 is an eop; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0018] In a related aspect, the nucleoside moieties of nucleotides 10-24 of SEQ ID NO: 1 comprise modified or unmodified sugars and or bases, or any combination thereof.

[0019] In certain aspects disclosed herein, a modified DZymes targeting an RNA transcript, comprises in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1 represented as follows G, LI, X2, L2, X3, L3, X4, L4, X5, L5, G, L6, X7, L7, X8, L8, X9, L9, X10, L10, X11, L11, A, L12, X13, L13, X14, L14, X15, and L15, wherein X represents a nucleoside with or without a modified sugar moiety or a modified base or both, and L represents a phosphodiester (PO) linkage or modified linkage between nucleosides; wherein(a) L1 comprises a mesyl phosphoramidate (msl), a phosphoryl guanidine (pg), a phosphoro thioate (ps), or an ethoxy phosphonate (eop) linkage;(b) X2 comprises a G, a 2'-O-methyl modified G (Gom) or a 8-aza-7 -deazaguanosine modified G (Gsg);(c) L2 comprises a PO, a msl, a pg, a ps, or an eop linkage, wherein when X2 is a Gsg thenP-634420-PCL2 is a msl linkage;(d) X3 comprises a cytosine nucleoside (C) or a threose nucleic acid modified C (Ctna); (e) L3 comprises a PO, a msl, a ps, or a pg linkage, wherein when X3 is a Ctna L3 is a PO, a msl, or a pg linkage;(f) X4 comprises a thymine nucleoside (T), a 5-fluoro-2'-deoxyuridine (U5fu), a deoxyuridine (dU), 2'-fluoro modified U (Uf), or a 2'-NH2 modified U (Uam);(g) L4 comprises a PO, a pg, or a ps linkage;(h) X5 comprises an adenine nucleoside (A) or 4'-methyl-2'-deoxyribose A (A4me); (i) L5 comprises a PO, a msl, a ps, or a pg linkage, wherein when L5 is a ps linkage X5 is A;(j) L6 comprises a msl, a pg, a ps, or an eop linkage;(k) X7 comprises a C, a 2'-NH2 modified C (Cam), or a 2'-O-methyl (Com);(l) L7 comprises a msl, a pg, an eop, a ps, or a PO linkage, wherein when L7 is an eop or a ps linkage X7 is C;(m)X8 comprises a 2'-O-methyl Uridine (Uom), a 6-aza-2'-deoxyuridine (U6azadu), a 2'- O-methoxyethyl T (Tmo), an unlocked U (Uuna), a 2'-fluoro U (Uf), L-DNA (Tl), a glycol nucleic acid (Tgna), a l',2'-dideoxyribose (T12d) or a T, or is absent;(n) L8 comprises a PO, a msl, a pg, a eop, or a ps linkage;(o) X9 comprises an A or a 2'-Ome-arabinose A (Acar);(p) L9 comprises a msl, a pg, a PO, an eop, or a ps linkage, wherein when X9 is Acar L9 is a msl linkage, and when L9 is an eop linkage X9 is A;(q) X10 comprises a C, a 5 -methylcytosine C (Cmc), a 4'-methyl-2'-deoxyribose C (C4me), or a 5-hydroxymethlcytosine (Che);(r) L10 comprises a pg, a msl, a PO, a ps, or an eop linkage, wherein when X10 is Cmc L10 is a pg linkage, when X10 is C4me L10 is a pg linkage, and when X10 is Chc L10 is a msl linkage, and wherein when L10 is a ps linkage X10 is C and when L10 is an eop linkage X10 is C;(s) X11 comprises an A, a 2'-fluoro A (Af), or a 2'-O-methyl A (Aom);(t) L11 comprises a msl, a pg, a PO, a ps, or an eop linkage, wherein when X11 is Aom L11 is a PO linkage and when L11 is an eop linkage X11 is A;(u) L12 comprises a msl, a pg, a PO, a ps, or an eop linkage;(v) X13 comprises a C or a Cmc;(w) L13 comprises a msl, a PO, a ps, a pg, or an eop linkage, wherein when X13 is Cmc LI 3 is a msl linkage;P-634420-PC(x) X14 comprises a 2'-methoxyethyl G (Gmo), a 2’-O-methyl G (Gom), a 2'-NH2 G(Gam), a G, or a 2'-Fluoro G (Gf);(y) L14 comprises a PO, a msl, a pg, a ps, or an eop linkage, wherein when L14 is an eop linkage X14 is G;(z) X15 comprises an A, an Af, a lock nucleic acid A (Aln), a 2'-O-methoxyethyl A (Amo), an Atna, a RNA (2’ -OH) A (Ar), a or an Aom; and(aa) L15 comprises a pg, a msl, a PO, a ps, or an eop linkage, wherein when X15 is Amo L15 is a msl or pg linkage, when X15 is a Atna L15 is a PO linkage, when X15 is an Aom L15 is a PO linkage, when X15 is Ar L15 is a PO or an ps linkage, and wherein when L15 is an ps linkage X15 is A, and when L15 is an eop linkage X15 is A; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0020] In a related aspect, the modified catalytic core comprises the nucleotide sequence: G, LI, X2, L2, X3, L3, X4, L4, X5, L5, G, L6, X7, L7, X8, L8, X9, L9, X10, L10, X11, L11, A, L12, X13, L13, X14, L14, X15, and L15, wherein(a) L1 comprises a msl, pg, or a ps linkage;(b) X2 comprises a G, a Gom or a Gsg;(c) L2 comprises a pg or a msl linkage, wherein when X2 is a Gsg then L2 is a msl linkage; (d) X3 comprises a C or a Ctna;(e) L3 comprises a PO or a msl linkage, wherein when X3 is C L3 is a msl linkage;(f) X4 comprises a T, a U5fu, a dU, or a Uf;(g) L4 comprises a PO, a pg, or a ps linkage, wherein when X4 is dU L4 is a PO or a pg linkage and when X4 is Uf L4 is a PO or a pg linkage;(h) X5 comprises an A or an A4me;(i) L5 comprises a PO, a msl, a ps, or a pg linkage, wherein when L5 is a ps linkage X5 is A;(j) L6 comprises a msl, a pg, or a ps linkage;(k) X7 comprises a C or a Cam;(l) L7 comprises a msl, a pg, or a PO linkage;(m)X8 comprises a Uom, a U6azadu, a Tmo, an Uuna, a Uf, a Tl, a Tgna, a T12d, or is absent;(n) L8 comprises a PO or a msl linkage, wherein when X8 is U6azadu L8 is a msl linkage, when X8 is Tmo L8 is a msl linkage, when X8 is Tgna L8 is a PO linkage and whenP-634420-PCX8 is T12d L8 is a msl linkage;(o) X9 comprises an A or an Acar;(p) L9 comprises a msl or a pg linkage, wherein when X9 is Acar L9 is a msl linkage; (q) X10 comprises a C, a Cmc, a C4me, or a Che;(r) L10 comprises a pg or a msl linkage, wherein when X10 is Cmc L10 is a pg linkage, when X10 is C4me L10 is a pg linkage, and when X10 is Chc L10 is a msl linkage; (s) X11 comprises an Af or an A;(t) L11 comprises a msl, a pg, a PO, or a ps linkage, wherein when X11 is A L11 is pg; (u) L12 comprises a msl, a pg, or a ps linkage;(v) X13 comprises a C or a Cmc;(w) L13 comprises a msl, a pg, a PO, or a ps linkage, wherein when X13 is Cmc L13 is a msl linkage;(x) X14 comprises a Gmo, a Gam, a G, or a Gf;(y) L14 comprises a PO, a msl, a pg, or a ps linkage, wherein when X14 is G L14 is a msl linkage and when X14 is Gf L14 is a msl linkage;(z) X15 comprises an A, an Af, an Aln, an Amo, an Atna, or an Ar; and(aa) L15 comprises a pg, a msl, a PO, or a ps linkage, wherein when X15 is a Atna L15 is a PO linkage, when X15 is Ar L15 is a PO linkage, and wherein when L15 is a ps linkage XI 5 is A.

[0021] In a further related aspect, L5 comprises a msl, a ps, or a pg linkage, wherein when L5 is a ps linkage X5 is A; L13 comprises a msl, a pg, or a ps linkage, wherein when X13 is Cmc L13 is a msl linkage; and L15 comprises a pg, a msl, a PO, or a ps linkage, wherein when X15 is an A L15 comprises a pg, a msl, or a ps linkage, when X15 is a Atna L15 is a PO linkage, when X15 is Ar L15 is a PO linkage, and wherein when L15 is a ps linkage X15 is A. In another further related aspect, L4 comprises a PO, a pg, or a ps linkage, wherein when X4 is dU L4 is a PO or a pg linkage, when X4 is T L4 is a pg or a ps linkage, and when X4 is Uf L4 is a PO or a pg linkage.

[0022] In yet another further related aspect, the modified catalytic core comprises the nucleotide sequence: G, L1, X2, L2, X3, L3, X4, L4, A, L5, G, L6, X7, Cam, X8, L8, A, L9, X10, L10, Af, L11, A, L12, X13, L13, X14, L14, X15, and L15, wherein(a) L1 comprises a msl or a ps linkage;(b) X2 comprises a G or a Gom;(c) L2 comprises a pg, a msl, or a ps linkage;(d) X3 comprises a Ctna or a C;(e) L3 comprises a PO or a msl linkage, wherein when X3 is C L3 is a msl linkage;P-634420-PC(f) X4 comprises a U5fu, a dU, or a Uf;(g) L4 comprises a PO, a pg, or a ps linkage, wherein when X4 is dU L4 is a PO or a pg linkage, and when X4 is Uf L4 is a PO or a pg linkage;(h) L5 comprises a msl or a ps linkage;(i) L6 comprises a msl, a pg, or a ps linkage;(j) L7 comprises a msl or a pg linkage;(k) X8 comprises a Uom, a U6azadu, an Uuna, a Uf, a Tl, or is absent;(l) L8 comprises a PO or a msl linkage, wherein when X8 is U6azadu L8 is a msl linkage, when X8 is Uuna L8 is a msl linkage, when X8 is a Tl L8 is a msl linkage, and when X8 is a Uf L8 is a msl linkage;(m)L9 comprises a msl or a pg linkage;(n) X10 comprises a C, a Cmc, a C4me;(o) L10 comprises a pg or a msl linkage, wherein when X10 is Cmc L10 is a pg linkage and when X10 is C4me L10 is a pg linkage;(p) L11 comprises a msl, a pg, a PO, or a ps linkage;(q) L12 comprises a msl, a pg, or a ps linkage;(r) X13 comprises a C or a Cmc;(s) L13 comprises a msl or a ps linkage, wherein when X13 is Cmc L13 is a msl linkage; (t) X14 comprises a Gmo or a Gam;(u) L14 comprises a PO, a msl, a pg, or a ps linkage;(v) X15 comprises an A, an Af, an Aln, an Amo, an Atna, or an Ar; and(w) L15 comprises a pg, a msl, a PO, or a ps linkage, wherein when X15 is a Atna L15 is a PO linkage, wherein when X15 is a Ain L15 is a PO linkage, when X15 is Ar L15 is a PO linkage, and wherein when L15 is a ps linkage X15 is A.

[0023] In another related aspect, the modified catalytic core comprises the nucleotide sequence: G, L1, X2, L2, X3, L3, X4, L4, A, L5, G, L6, X7, L7, X8, L8, A, L9, X10, L10, Af, L11, A, L12, X13, L13, X14, L14, X15, and L15, wherein(a) L1 comprises a msl or a ps linkage;(b) X2 comprises a G or a Gom;(c) L2 comprises a msl, a pg, or a ps linkage;(d) X3 comprises a Ctna or a C;(e) L3 comprises a PO or a msl linkage, wherein when X3 is C L3 is a msl linkage;(f) X4 comprises a U5fu, a dU, a Uf, or an Uam;(g) L4 comprises a PO, a pg, or a ps linkage, wherein when X4 is Uam L4 is a msl linkage;P-634420-PC(h) L5 comprises a msl or a ps linkage;(i) L6 comprises a msl, a pg, a ps linkage;(j) X7 comprises a Cam or a C;(k) L7 comprises a msl or a pg linkage, wherein when X7 is C L7 is a msl linkage;(l) X8 comprises a Uom, a U6azadu, an Uuna, an Uf, a Tl, or is absent;(m) L8 comprises a msl or a PO linkage, wherein when X8 is an Uuna L8 is a msl linkage, when X8 is an Uf L8 is a msl linkage, when X8 is Tl L8 is a msl linkage, and when X8 is a U6azadu L8 is a msl linkage;(n) L9 comprises a msl or a pg linkage;(o) X10 comprises a C, a Cmc, or a C4me;(p) L10 comprises a pg or a msl linkage, wherein when X10 is Cmc L10 is a pg linkage and when X10 is C4me L10 is a pg linkage;(q) L11 comprises a msl, a pg, a PO, or a ps linkage;(r) L12 comprises a msl, a pg, or a ps linkage;(s) X13 comprises a C or a Cmc;(t) L13 comprises a msl or a ps linkage, wherein when X13 is Cmc L13 is a msl linkage; (u) X14 comprises a Gam, a Gmo, or a G;(v) L14 comprises a msl, a pg, a PO, or a ps linkage, wherein when X14 is G L14 is a msl linkage;(w) X15 comprises an Af, an A, an Atna, an Amo, an Ain, or an Ar; and(x) L15 comprises a pg, a msl, a PO, or a ps linkage, wherein when X15 is Amo L15 is a msl or pg linkage, when X15 is a Atna L15 is a PO linkage, when X15 is Ar L15 is a PO linkage, and when X15 is Al L15 is a PO linkage.

[0024] In some aspects related to the modified DZymes disclosed herein, a first substrate-binding arm and a second substrate binding arm each independently comprise 4-18 nucleotides. In a related aspect, the nucleotide at position X-2 from XI in a first substrate-binding arm comprises an A, T, C, or G; wherein the nucleotide at position X-l is an A in the first substrate-binding arm, and the nucleotide at position A+l from X15 of the second substrate-binding arm comprises an A, T, C, or G. In a further related aspect, the linkage 3' of X-2 (L-2), 3' of X-l (L-l), and 3' of X+l (L+l) comprises a msl or a pg.

[0025] In some related aspects, a first substrate-binding arm comprises at least 1 linker modification substituting for the at least 1 terminal PO of said binding arm and said second substrate-binding arm comprises at least 1 linker modifications substituting for the at least one terminal PO of said binding arm. In further related aspects, modifications comprise a ps, a msl, or a pg linkage.P-634420-PC

[0026] In another related aspect, the first substrate-binding arm is 100% complementary to the first region of the RNA transcript or partially complementary to the first region of the RNA transcript with no more than two mismatches; and the second substrate-binding arm is 100% complementary to the second region of the RNA transcript or partially complementary to the second region of the RNA transcript with no more than two mismatches.

[0027] In another related aspect, the first substrate-binding arm comprises at least 1 modified nucleosides, said at least 1 modified nucleosides substituting for the at least one terminal nucleosides of said binding arm and said second substrate-binding arm comprises at least 1 modified nucleosides, said at least 1 modified nucleosides substituting for the at least one terminal nucleotides of said binding arm. In a further related aspect, the modified nucleosides comprise an om, a tna, a mo, a In, or a cET, or any combination thereof.

[0028] In yet another related aspect, a first substrate-binding arm further comprises at least 1 linker modification substituting for the at least one terminal POs of said binding arm and a second substratebinding arm further comprises at least 1 linker modification substituting for the at least one terminal POs of said binding arm. In a further related aspect, the modifications comprise a ps, a msl, or a pg linkage.

[0029] In another related aspect of the modified DZymes disclosed herein, the DZyme is conjugated to a carrier moiety, optionally wherein said carrier moiety comprises a penetration-enhancing moiety.

[0030] In some aspects, disclosed herein are nucleic acids comprising one or more DZymes disclosed herein.

[0031] In some aspects, a lipid nanoparticle (LNP) comprises a modified DZyme or a nucleic acid comprising a modified DZyme.

[0032] In some aspects, a pharmaceutical composition described herein comprises any of the modified DZyme disclosed or a nucleic acid comprising any of the modified DZymes disclosed or a LNP comprising a modified DZyme disclosed, and a pharmaceutically acceptable carrier.

[0033] In certain aspects, disclosed herein is a method of treating a disease or condition in a subject in need, comprising administering an effective amount of a composition comprising a modified DZyme as described herein, a conjugated DZyme as described herein, or a LNP comprising a modified DZyme, wherein said administration treats the disease or condition.

[0034] In a related aspect, a disease or condition is caused by a gene comprising at least one heterozygous single-nucleotide polymorphism (SNP), wherein said at least one heterologous SNP comprises a GU or AU sequence in the disease-causing allele and said RNA transcript encodes the disease-causing allele.

[0035] In a further related aspect, the disease or condition is Huntington’s disease, said heterozygousP-634420-PCSNP is SNP rs362307, and said DZyme cleaves an RNA transcript encoding a rs362307-U allele and does not cleave an RNA transcript encoding the rs362307-C allele.

[0036] In another further related aspect, the disease or condition comprises a cancer expressing a G12V mutation in the KRAS oncoprotein, and said DZyme cleaves an RNA transcript encoding the G12V KRAS mutation and does not cleave an RNA transcript encoding G12 KRAS.

[0037] The method according to any one of claims 59-64, wherein said treating reduces or inhibits expression of a gene associated with the disease or condition.

[0038] The method according to any one of claims 59-64, wherein said RNA transcript is associated with the disease or condition, and said administration cleaves the RNA transcript.

[0039] In certain aspects, in a method disclosed herein for treating a disease or condition in a subject, the disease or condition is caused by a gene comprising at least one heterozygous single-nucleotide polymorphism (SNP), wherein said at least one heterologous SNP comprises a pyrimidine to purine mutation 5’ to an uridine in the disease-causing allele and said RNA transcript encodes the disease causing allele, said method comprising administering an effective amount of a modified DZyme targeting an RNA transcript to a subject in need thereof, said modified DZyme comprising in 5’ to 3’ order:a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;a modified catalytic core comprising the modified catalytic core from any of claims 1-54; and a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript; wherein said administration treats the disease or condition. In a related aspect of the method, the purine is selected from a guanine or adenine.BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The subject matter regarded as a modified DZyme and uses thereof is particularly pointed out and distinctly claimed in the concluding portion of the specification. The modified DZymes, however, both as to organization and method of operation, together with objects, features, and advantages thereof, may best be understood by reference to the following detailed description when read with the accompanying drawings.

[0041] A skilled artisan would recognize that the header row of the Tables presented in the Figures, providing nucleotide and position numbers, are based on and / or include nucleotides 10-24 of the starting template sequence (SEQ ID NO: 1; dz000002), not the modifications presented for each modified DZyme or modified core. Nucleotide positions 10-24 of SEQ ID NO: 1 may in someP-634420-PCembodiments be termed G1-A15. Nucleotide positions 10-24 of SEQ ID NO: 1 (G1-A15) comprise the core of the modified DZymes disclosed herein. The sugar, base, and linkage modifications for each position are indicated with nucleoside modifications (bases or sugars or both) followed by linkage modifications. In some cases, the modifications result in a base nucleoside differing from the base nucleoside indicated in the template G1-A15 sequence.

[0042] Further, a skilled artisan would recognize that the nucleotides and positions thereof of the substrate-binding arms are identified as positions relative to the G1-A15 core, wherein for example, positions A-l, A-2, etc. represent positions of a first substrate-binding arm 5' of the G1-A15 core, wherein position A-l is directly 5' of the G1 position. Similarly, position A+l represents the first position of the second substrate-binding arm directly 3' of the A15 core position. Additional substratebinding arm positions in the header row of the Tables may be represented by an “L” for Linker or by the unmodified nucleotide (A, T, G, C) with nucleoside modifications (sugar and or base modifications) and linkage modifications presented for each modified DZyme below the header row. The skilled artisan would appreciate that in some embodiments of DZymes disclosed herein, the positions 5' of Gl, e.g., X-l and X-2, may comprise nucleotides other than adenine (A).

[0043] Figures 1A-1B - Kinetic Fluorescence Resonance Energy Transfer (FRET) assay. Figure 1A is a schematic representation of the cleavage reaction of a G12V RNA probe by a 10-23 unmodified DZyme. The G12V RNA probes has a 6-Carboxyfluorescein (FAM) fluorophore hybridized to its 5’end and a Black Hole Quencher 1 (BHQ1) quencher hybridized to its 3’ end. The fluorescence is quenched prior to cleavage. When Mg+2 is introduced to the reaction, the DZyme (Dz000002; SEQ ID NO: 1) cleaves the RNA (GUUGGAGCUGUUGGCGUAGGCA; SEQ ID NO: 821) and the fluorescence increases. The bold letters, italicized letters UGUU indicate the NRYN sequence, wherein the bold, italicized letters GU represent the RY cleavage target site. The catalytic core of the DZyme (nucleotides 10-24 of SEQ ID NO: 1) is identified by the lower-case letters, wherein the bolded, italicized letters A and A are DZyme nucleotides that are considered part of the arms (hybridize to the RNA) but affect activity in addition to their hybridization with the RNA probe (upper strand: 5’-UGUU-3' and lower strand at either end of the catalytic core: 5’-A - core - A-3'). Figure IB is a graph of the cleavage reaction as measured in the Forster resonance energy transfer (FRET) assay. DZyme: RNA ratio of 1:10, 10mM HPO₃⁻² / H₂PO₃⁻ pH=7@37°C, 10mM NaCl, 140mM KCl, 1mM MgCl₂. The plot shows the average and the interquartile range based on 184 measurements.

[0044] Figures 2A-2C. - Results of walk experiments where each box represents a DZyme modified only at the indicated position with the indicated modification. All DZymes have 9 base long unmodified DNA arms targeting the KRAS G12V sequence bearing a UGUU cleavage site. Values are presented as a fold change of Kobs relative to an unmodified DNA sequence. Results are separatedP-634420-PCto Sugar modifications (Figure 2A), Linker modifications (Figure 2B) and Base modifications (Figure 2C). For linker modifications, the position indicated refers to the linker between that nucleotide and the one that follows. N > 4 for all measurements. Figures 2A-2C show the results of modifying the DZyme core (G1-A15; nucleotides 10-24 of SEQ ID NO: 1) along with modifications to sequences downstream and upstream of the core (A-2, A-l, A+l for sugar and base modifications, and A-2, A-l, A+l, G+2 for linker modifications).

[0045] Figures 3A-3B - Minimal Free Energy (MFE) structure and the Gibbs Free Energy as calculated by RNA structure Version 6.4© 1996-2021 Mathews Lab (https: / / ma.urmc.rochester.edu / ). Algorithm - RNA Single Strand Fold with software default parameters. (Figure 3A) UGUU cleavage site. (Figure 3B) UAUU cleavage site.

[0046] Figures 4A-4C - Results of walk experiments where each box represents a DZyme modified only at the indicated position with the indicated modification. All DZymes have 9 base long unmodified DNA arms targeting the KRAS G12V sequence artificially mutated to bear a UAUU cleavage site. Values presented as fold change of Kobs relative to an unmodified DNA sequence. Results are separated into Sugar modifications (Figure 4A), Linker modifications (Figure 4B), and Base modifications (Figure 4C). For linker modifications, the position indicated refers to the linker between that nucleotide and the one that follows. N > 4 for all measurements. Figures 4A-4C show the results of modifying the DZyme core nucleotides (G1-A15; nucleotides 10-24 of SEQ ID NO: 1) along with modifications to sequences downstream and upstream of the core (A-2, A-l, A+l for sugar and base modifications, and A-2, A-l, A+l, G+2 for linker modifications).

[0047] Figure 5 - Combinations of sugar modifications 2'-O-Methyl (2’-0Me or om) and 2'-O-Methoxyethyl (2’-M0E or mo) at positions G2, T8, G14, and A15 for G12V cleavage based on improved activity from single walk data. Values are presented as a fold change of Kobs relative to an unmodified DNA sequence. The data shows that the experimental fold change in activity (relative to the unmodified sequence) is not as expected from the scores obtained in the single walk data. The activity of a DZyme in the FRET assay (as shown in this figure and all figures up to Figure 11) is their calculated Kobs value described in Example 1 for the “Cell-free fluorescent cleavage assay” The expected fold change was naively calculated as the multiplication of the contribution of the various modifications at every position. N > 4 for all measurements. Note that the om sugar modification converts the thymidine at T8 to a uridine (U8; represented as Uom) when present.

[0048] DZ identifiers listed in Figure 5 provide DZyme nucleotide sequences comprising the modified catalytic core at nucleotides 10-24 (positions G1-A15; nucleotides 10-24 of SEQ ID NO: 1) flanked by unmodified 5’ and 3’ arms. The sequence identifiers for these DZymes are as follows SEQ ID NO: 437 (dz000178), SEQ ID NO: 438 (dz00098), SEQ ID NO: 439 (dz000115), SEQ ID NO:P-634420-PC440 (dzOOO138), SEQ ID NO: 64 (dz000122), SEQ ID NO: 441 (dz000073), SEQ ID NO: 442 (dz000125), SEQ ID NO: 443 (dz000156), SEQ ID NO: 97 (dz000107), SEQ ID NO: 444 (dz000112), SEQ ID NO: 445 (dz000126), SEQ ID NO: 91 (dz000105), SEQ ID NO: 446 (dz000179), SEQ ID NO: 447(dz000116), SEQ ID NO: 448 (dz000142), SEQ ID NO: 449 (dz000129), SEQ ID NO: 58 (dz000120), SEQ ID NO: 450 (dz000191), SEQ ID NO: 451 (dz00091), SEQ ID NO: 452 (dz000119), SEQ ID NO:453 (dz000182), SEQ ID NO: 454 (dz000140), SEQ ID NO: 455 (dz000209), SEQ ID NO: 65 (dz000123), SEQ ID NO: 456 (dz000195), SEQ ID NO: 457 (dz00089), SEQ ID NO: 85 (dz000103), SEQ ID NO: 1 (dz00002), and SEQ ID NO: 458 (dz000193).

[0049] Figures 6A-6E - Mesyl phosphoramidate (MsPA,, or msl) and phosphorothioate (PS or * or ps) combinations on base sequence with 2’-OMe at T8 and 2’ -MOE at G14 for G12V cleavage, based on best score according to single walk data. Values are presented as a fold change of Kobs relative to an unmodified DNA sequence. (Figure 6A) MsPA only combinations. (Figure 6B) MsPA and PS combinations. (Figure 6C) Graphical representation of the fold change of both combination results, highlighting the prevalence of the MsPA only approach. (Figure 6D) MsPA only accumulation without A-2, A-l and A+l. (Figure 6E) PS only accumulation without A-2, A-l and A+l. N > 7 for all measurements. Abbreviations: See Table 1. Note that the om sugar modification converts the thymidine at T8 to a uridine (U8) when present.

[0050] DZ identifiers and sequences provided in the tables presented in Figures 6A, 6B, 6D, and 6E provide partial DZyme nucleotide sequences comprising modified catalytic core sequences (nucleotide positions G1-A15; nucleotides 10-24 of SEQ ID NO: 1) that are flanked by 5’ and 3’ partial arm sequences with modifications downstream and upstream of the core (A-2, A-l, A+l, respectively). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002).

[0051] Modified catalytic core sequences presented in Figure 6A at nucleotides 10-24 of: SEQ ID NO: 459 (dz00098), SEQ ID NO: 460 (dz012823), SEQ ID NO: 461 (dz012824), SEQ ID NO: 462 (dz012825), SEQ ID NO: 463 (dz012826), SEQ ID NO: 464 (dz012827), SEQ ID NO: 465 (dz012828), SEQ ID NO: 466 (dz012829), SEQ ID NO: 467 (dz012830), SEQ ID NO: 468 (dz012831), SEQ ID NO: 469 (dz012832), SEQ ID NO: 470 (dz012833), SEQ ID NO: 471 (dz012834), SEQ ID NO: 472 (dz012835), SEQ ID NO: 473 (dz012836), and SEQ ID NO: 474 (dzO 12837) (Figure 6A).

[0052] Modified catalytic core sequences presented in Figure 6B at nucleotides 10-24 of: SEQ ID NO: 459 (dz00098), SEQ ID NO: 475 (dz012838), SEQ ID NO: 476 (dz012839), SEQ ID NO: 477 (dz012840), SEQ ID NO: 478 (dz012841), SEQ ID NO: 479 (dz012842), SEQ ID NO: 480 (dz012843), SEQ ID NO: 481 (dz012844), SEQ ID NO: 482 (dz012845), SEQ ID NO: 483P-634420-PC(dz012846), SEQ ID NO: 484 (dz012847), SEQ ID NO: 485 (dz012848), SEQ ID NO: 486 (dz012849), SEQ ID NO: 487 (dz012850), SEQ ID NO: 488 (dz012851), SEQ ID NO: 487 (dzO 12850), and SEQ ID NO: 489 (dzO 12852) (Figure 6B).

[0053] Modified catalytic core sequences presented in Figure 6D at nucleotides 10-24 of: SEQ ID NO: 459 (dz00098), SEQ ID NO: 490 (dz017251), SEQ ID NO: 491 (dz017252), SEQ ID NO: 492 (dz017253), SEQ ID NO: 493 (dz017254), SEQ ID NO: 495 (dz017256), SEQ ID NO: 496 (dz017257), SEQ ID NO: 497 (dz017258), SEQ ID NO: SEQ ID NO: 494 (dz017255), 498 (dz017259), SEQ ID NO: 499 (dz017260), SEQ ID NO: 500 (dz017261), SEQ ID NO: 501 (dz017262), SEQ ID NO: 502 (dz015696), and SEQ ID NO: 503 (dz017263) (Figure 6D).

[0054] Modified catalytic core sequences presented in Figure 6E at nucleotides 10-24 of: SEQ ID NO: 459 (dz00098), SEQ ID NO: 504 (dz017264), SEQ ID NO: 505 (dz017265), SEQ ID NO: 506 (dz017266), SEQ ID NO: 507 (dz017267), SEQ ID NO: 508 (dz017268), SEQ ID NO: 509 (dz017269), SEQ ID NO: 510 (dz017270), SEQ ID NO: 511 (dz017271), SEQ ID NO: 512 (dz017272), SEQ ID NO: 513 (dz017273), SEQ ID NO: 514 (dz017274), SEQ ID NO: 515 (dz017275), SEQ ID NO: 516 (dz017276), and SEQ ID NO: 517 (dz017277) (Figure 6E).

[0055] Figures 7A-7D - Backbone protection and sugar modification strategies that enhance G12V cleavage activity and core stability. (Figure 7A) Backbone modification of sugar modified positions in almost fully modified core for further stabilization. (Figure 7B) Further modification of unmodified positions in sequences presented in Figure 7A. (Figure 7C) The effect of single position modifications in the final sequences presented in Figure 6B, for further activity improvements.(Figure 7D) Combinations of modifications from Figure 7C for maximize activity. In each group “Fold Change” refers to the activity of a sequence relative to the sequence shown in the header row. N > 4 for all measurements. Abbreviations: See Table 1. Note that the “om”, “f” and “una” sugar modifications convert the thymidine at T8 to a uridine (U8) when present.

[0056] The DZ identifiers and sequences provided in the tables presented in Figures 7A-7D show modified catalytic core sequences at nucleotide positions G1-A15, nucleotides 10-24 of SEQ ID NO: 1 shown in the header row that are flanked by 5’ and 3’ partial arm sequences with modifications downstream and upstream of the core (A-2, A-l, A+l, respectively). The modified catalytic core sequences are located at nucleotides 10-24 (positions G1 to A15) of the DZyme sequences set forth in SEQ ID NO: 518 (dz010727), SEQ ID NO: 519 (dz010722), SEQ ID NO: 520 (dz010723), and SEQ ID NO: 521 (dz010724) (Figure 7A). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 518 (dz010727), SEQ ID NO: 502 (dz015696), SEQ ID NO: 521 (dz010724), SEQ ID NO: 522 (dz014649), SEQ ID NO: 523 (dz010725) and SEQ ID NO: 524 (dz010726) (Figure 7B). The modified catalytic core sequencesP-634420-PCare located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 524 (dz010726), SEQ ID NO: 525 (dz012804), SEQ ID NO: 526 (dz012805), SEQ ID NO: 527 (dz012806), SEQ ID NO: 528 (dz015429), SEQ ID NO: 529 (dz012807), SEQ ID NO: 530 (dz012808), SEQ ID NO: 531 (dz012809), SEQ ID NO: 532 (dz012810), SEQ ID NO: 533 (dz012811), SEQ ID NO: 534 (dz012812), SEQ ID NO: 535 (dz012813), SEQ ID NO: 536 (dz012814), SEQ ID NO: 537 (dz012815), SEQ ID NO: 538 (dz012816), SEQ ID NO: 539 (dz012817), SEQ ID NO: 540 (dz012818), SEQ ID NO:541 (dz012793), SEQ ID NO: 542 (dz012794), and SEQ ID NO: 543 (dz012795) (Figure 7C). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 524 (dz010726), SEQ ID NO: 544 (dz013893), SEQ ID NO: 545 (dz013894), SEQ ID NO: 546 (dz013895), SEQ ID NO: 547 (dz013896), and SEQ ID NO: 548 (dz015430) (Figure 7D).

[0057] Figures 8A-8J - T4 modification and other backbone chemistry combinations for G12V cleavage and their fold change in activity. In each group “Fold Change” refers to the activity of a sequence relative to the sequence shown in the header row. (Figure 8A) Modification of T4 using modifications that have the least effect on reducing activity compared to an unmodified T4 backbone position, based on single walk data. (Figure 8B) Incorporation of PG instead of MsPA according to single walk data. (Figure 8C) Combination of PG modifications based on single walk data and results in Figure 8B. (Figure 8D) Alternative backbones based mostly on PG or EOP. (Figure 8E) Same backbone (linkage) modifications as Figure 8C but in context of a more potent core. (Figure 8F) Comparison of top T4 modifications in context of more potent cores. (Figure 8G) Comparison of PG versus PS linkage protection at T4 (L4). (Figure 8H) The effect of deletion of T8 on activity for selected potent cores. (Figure 81) Additional chemistries for improving activity and immunogenicity - 4’-Me at A5 and CIO, 5-Me-dC at CIO and C13. (Figure 8J) Comparison of unmodified 10-23 DNAzyme and most active and fully backbone protected XNAzyme core.

[0058] The DZ identifiers and sequences provided in the tables presented in Figures 8A-8J show modified catalytic core sequences at nucleotide positions G1-A15, nucleotides 10-24 of SEQ ID NO: 1 shown in the header row that, in Figure 8D are flanked by 5’ and 3’ partial arm sequences with modifications downstream and upstream of the core (A-2, A-l, A+l, respectively). The modified catalytic core sequences are located at nucleotides 10-24 (positions G1 to A15) of the DZyme sequences set forth in the tables presented in Figures 8A-8J. N > 4 for all measurements. Abbreviations: See Table 1. Note that the “am”, “om”, “una” and “f” sugar modifications convert the thymidine at T4 and / or T8 to a uridine (U4 and / or U8) when present.

[0059] The DZ identifiers and sequences provided in the tables presented in Figures 8A-8J show modified catalytic core sequences (nucleotide positions G1-A15, nucleotides 10-24 of SEQ ID NO:P-634420-PC1 template) that are flanked by 5’ and 3’ partial arm sequences with modifications downstream and upstream of the core (A-2, A-l, A+l, respectively). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 524 (dz010726), SEQ ID NO: 549 (dz012796), SEQ ID NO: 550 (dz012797), SEQ ID NO: 551 (dz012798), SEQ ID NO: 552 (dz012799), SEQ ID NO: 553 (dz012800), SEQ ID NO: 554 (dz012802), SEQ ID NO: 555 (dz012803), and SEQ ID NO: 559 (dz012800) (Figure 8A). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 524 (dz010726), SEQ ID NO: 557 (dz013898), SEQ ID NO: 558 (dz013904), SEQ ID NO: 559 (dz013899), SEQ ID NO: 560 (dz013900), SEQ ID NO:561 (dz013901), SEQ ID NO: 562 (dz013902), and SEQ ID NO: 563 (dz013903) (Figure 8B). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 498 (dz017259), SEQ ID NO: 564 (dz013905), SEQ ID NO: 565 (dz013906), SEQ ID NO: 566 (dz013907), SEQ ID NO: 502 (dz015696), SEQ ID NO: 567 (dz013908), SEQ ID NO: 503 (dz017263), and SEQ ID NO: 568 (dz013909) (Figure 8C).The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002), SEQ ID NO: 569 (dz013910), SEQ ID NO: 70 (dz013911), SEQ ID NO: 571 (dz014639), SEQ ID NO: 572 (dz014638), SEQ ID NO: 573 (dz015726), SEQ ID NO: 574 (dz014640), SEQ ID NO: 575 (dz014641), SEQ ID NO: 576 (dz014642), SEQ ID NO: 577 (dz014643), SEQ ID NO: 578 (dz016345), SEQ ID NO: 579 (dz016356), SEQ ID NO: 580 (dz016346), SEQ ID NO: 581 (dz016344), SEQ ID NO: 582 (dz016347), SEQ ID NO: 583 (dz016496), SEQ ID NO: 584 (dz016348), SEQ ID NO: 585 (dz016349), SEQ ID NO: 586 (dz016350), SEQ ID NO: 587 (dz016351), SEQ ID NO: 588 (dz016352), SEQ ID NO: 589 (dz015724), SEQ ID NO: 590 (dz015727), SEQ ID NO: 591 (dz016353), SEQ ID NO: 592 (dz016354), SEQ ID NO: 593 (dz016355), SEQ ID NO: 594 (dz016500), SEQ ID NO: 595 (dz014645), SEQ ID NO: 596 (dz015728), SEQ ID NO: 597 (dz017212), SEQ ID NO: 598 (dz017213), SEQ ID NO: 599 (dz017214), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 602 (dz017217), SEQ ID NO:603 (dz017218), SEQ ID NO: 604 (dz017219), SEQ ID NO: 605 (dz017220), SEQ ID NO: 606 (dz017221), SEQ ID NO: 607 (dz017222), SEQ ID NO: 608 (dz017223), SEQ ID NO: 609 (dz017224), SEQ ID NO: 610 (dz017225), SEQ ID NO: 611 (dz017226), SEQ ID NO: 612 (dz010252), SEQ ID NO: 613 (dz012866), and SEQ ID NO: 614 (dz012867) (Figure 8D). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002), SEQ ID NO: 547 (dz013896), SEQ ID NO: 615 (dz014632), SEQ ID NO: 616 (dz014625), SEQ ID NO: 617 (dz016343), SEQ ID NO: 618 (dz014633), SEQ ID NO: 619 (dz014631), SEQ ID NO: 620 (dz014626), SEQ ID NO: 621 (dz015705), SEQ ID NO: 622 (dz015707), SEQ ID NO: 623P-634420-PC(dz014627), SEQ ID NO: 624 (dz015704), SEQ ID NO: 625 (dz016330), SEQ ID NO: 626 (dz014629), SEQ ID NO: 627 (dz016331), and SEQ ID NO: 628 (dz016332) (Figure 8E). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002), SEQ ID NO: 623 (dz014627), SEQ ID NO: 629 (dz017608), SEQ ID NO: 630 (dz015718), SEQ ID NO: 631 (dz016338), SEQ ID NO: 632 (dz016329), SEQ ID NO: 633 (dz017610), SEQ ID NO: 634 (dz017520), SEQ ID NO: 635 (dz016337), SEQ ID NO: 636 (dz015709), SEQ ID NO: 637 (dz017609), SEQ ID NO: 638 (dz017519), SEQ ID NO: 639 (dz015710), SEQ ID NO: 640 (dz017607), SEQ ID NO: 641 (dz017517), and SEQ ID NO: 593 (dz016355) (Figure 8F). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002), SEQ ID NO: 642 (dz015711), SEQ ID NO: 643 (dz015712), SEQ ID NO: 644 (dz015716), SEQ ID NO: 645 (dz015717), SEQ ID NO: 646 (dz015731), and SEQ ID NO: 647 (dz015732) (Figure 8G). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002), SEQ ID NO: 628 (dz016332), SEQ ID NO: 648 (dz017525), SEQ ID NO: 593 (dz016355), SEQ ID NO: 649 (dz017526), SEQ ID NO: 650 (dz016388), and SEQ ID NO: 651 (dz017528) (Figure 8H). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002), SEQ ID NO: 524 (dz010726), SEQ ID NO: 528 (dz015429), SEQ ID NO: 544 (dz013893), SEQ ID NO: 548 (dz015430), SEQ ID NO: 559 (dz013899), SEQ ID NO: 652 (dz015431), SEQ ID NO: 616 (dz014625), SEQ ID NO: 653 (dz015432), SEQ ID NO: 620 (dz014626), SEQ ID NO:654 (dz016497), SEQ ID NO: 655 (dz015702), SEQ ID NO: 656 (dz016499), SEQ ID NO: 631 (dz016338), SEQ ID NO: 657 (dz017374), SEQ ID NO: 658 (dz017375), and SEQ ID NO: 659 (dz017376) (Figure 81). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002) and SEQ ID NO: 660 (dzO 17280) (Figure 8J).

[0060] Figure 9A and 9B - The table presents “Fold Change” and “Percent Drop” data for G12V-cleavage activity of optimized cores relative to the unmodified sequence at 0.5mM or O.lmM. The “Percent Drop” column quantifies activity loss when Mg2+is reduced from 1 mM to either 0.5mM (Figure 9A) or 0.1 mM (Figure 9B), while the two “Fold Change” columns list activity at each magnesium level relative to the unmodified control, together showing that engineered cores remain far more active than the unmodified sequence under low Mg2+conditions. Notably, the cores with the highest “Fold Change” at 1 mM (Figure 9A) are not the same as those that lead at 0.1 mM (Figure 9B), indicating a shift in top-performing patterns as magnesium concentration decreases. N > 4 for all measurements. - MsPA (Mesyl Phosphoramidate); am+ - 2'-Amino and PG; amA- 2'-Amino and MsPA (Mesyl Phosphoramidate); tna - TNA (Threose nucleic acid);;; -i — PG (PhosphorylP-634420-PCGuanidine); om - 2’-OMe (2'-O-methylribonucleic acid); omA- 2’-OMe (2'-O-methylribonucleic acid) and MsPA (Mesyl Phosphoramidate); mo - 2’-MOE (2'-O-Methoxy ethyl); moA- 2’-MOE (2'-O-Methoxyethyl) and MsPA (Mesyl Phosphoramidate); mo+ -2’ -MOE (2'-O-Methoxyethyl) and PG (Phosphoryl Guanidine); f - 2’-F (2'-Fluoro); f+ -2’-F (2'-Fluoro) and PG (Phosphoryl Guanidine); fA- 2-F (2'-Fluoro) and MsPA (Mesyl Phosphoramidate); mcA- 5-MethylCytosine and MsPA; mc+ - 5-MethylCytosine and PG; unaA- UNA (Unlocked Nucleic Acid) and MsPA; 5fu - 5-F-dU (5-Fluoro-2'-Deoxyuridine; also termed 5fd);. Note that the “am”, “om”, “una” and “f” sugar modifications convert the thymidine at T8 to a uridine (U8) when present.

[0061] The DZ identifiers and sequences provided in the table presented in Figure 9A and 9B show modified catalytic core sequences (nucleotide positions G1-A15). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002), SEQ ID NO: 524 (dz010726), SEQ ID NO: 547 (dz013896), SEQ ID NO: 558 (dz013904), SEQ ID NO: 565 (dz013906), SEQ ID NO: 619 (dz014631), SEQ ID NO: 615 (dz014632), SEQ ID NO: 618 (dz014633), SEQ ID NO: 661 (dz014634), SEQ ID NO: 662 (dzO 14635), SEQ ID NO: 663 (dzO 14636), and SEQ ID NO: 522 (dzO 14649) (Figure 9A). The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 1 (dz000002), SEQ ID NO: 664 (dz017531), SEQ ID NO: 658 (dz017375), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 650 (dz016388), SEQ ID NO: 627 (dz016331), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 670 (dz016387), SEQ ID NO: 671 (dz016357), and SEQ ID NO: 672 (dz016359) (Figure 9B).

[0062] Figure 10 - Active and stable cores and their fold change in activity compared to the unmodified sequence at ImM Mg+2for cleavage of G12V UGUU junction. N > 4 for all measurements. DZyme dz000002 (SEQ ID NO: 1) is the template sequence and present in the table solely for comparison purposes. The activity of dz()00002 is the reference that the modified DZymes are normalized to and the fold change measurements that are shown in the table presented in Figure 10 are relative to dz000002.

[0063] Abbreviations: # - BsPA (Busyl Phosphoramidate); PO - (phosphodiester linkage); * - PS (Phosphoro thioate); - MsPA (Mesyl Phosphoramidate); am - 2'-Amino; amA- 2'-Amino and MsPA (Mesyl Phosphoramidate); tna - TNA (Threose nucleic acid); tna+ - TNA and PG; tnaA- TNA and MsPA; 1 - L-DNA; 1A- L-DNA and MsPA; dU - deoxyuridine; dUA- deoxyuridine and MsPA (Mesyl Phosphoramidate); dU+ - deoxyuridine and PG; + - PG (Phosphoryl Guanidine); om - 2’-OMe (2'-O-methylribonucleic acid); omA- 2’-OMe (2'-O-methylribonucleic acid) and MsPA (Mesyl Phosphoramidate); om+ - 2’-OMe and PG; om* - 2’-OMe and PS; mo - 2’-MOE (2'-O-P-634420-PCMethoxy ethyl); moA- 2’-MOE (2'-O-Methoxyethyl) and MsPA (Mesyl Phosphoramidate); mo+ -2’-MOE (2'-O-Methoxyethyl) and PG (Phosphoryl Guanidine); mo* - 2’-MOE and PS; f - 2’-F (2'-Fluoro); f+ -2’-F (2'-Fluoro) and PG (Phosphoryl Guanidine); fA- 2’-F (2'-Fluoro) and MsPA (Mesyl Phosphoramidate); f* - 2’-Fluoro and PS; 12dA- l',2'-dideoxyRibose and MsPA (Mesyl Phosphoramidate); carA- 2'-OMe-arabinose and MsPA (Mesyl Phosphoramidate); hcA- 5hmC (5-hydroxymethyl Cytosine) and MsPA (Mesyl Phosphoramidate); lnA- LNA (Locked Nucleic Acid) and MsPA (Mesyl Phosphoramidate); Ind — LNA (Locked Nucleic Acid) and PG (Phosphoryl Guanidine); am+ - 2'- Amino. and PG (Phosphoryl Guanidine); 6azadu - 6-Aza-dU; 6azaduA- 6-Aza-dU and MsPA; 6-Thio-dG - (6-Thio-deoxyguanosine; 6Td); 7-deaza-8-aza-dA- (7-deaza-8azadeoxyadenosine; 78); una - UNA (Unlocked Nucleic Acid); unaA- UNA and MsPA; una+ -UNA and PG; mcA- 5-MethylCytosine and MsPA, mc+ - 5-MethylCytosine and PG; 4me - 4’-Methyl-deoxyribose; 4meA- 4’-Methyl-deoxyribose and MsPA; 4me+ - 4’-Methyl-deoxyribose and PG; 5fu - 5-F-dU (also termed 5fd); 5fu+ - 5-F-dU and PG; 5fu* - 5-F-dU and PS; - deletion; eop - EOP (Ethoxy Phosphonate); omoep - 2’-0Me and EOP; sg - Super-G (8-aza7-deazagunosine; 78); iA- deoxyinosine and PG;. Note that the “am”, “om”, “una” and “f ’ sugar modifications convert the thymidine at T4 and or T8 to a uridine (U4 and or U8) when present.

[0064] The DZ identifiers and sequences provided in the table presented in Figure 10 show modified catalytic core sequences (nucleotide positions G1-A15) that are flanked by 5’ and 3’ partial arm sequences with modifications downstream and upstream of the core (A-2, A-l, A+l, respectively). The full list of modified catalytic core sequences comprises the nucleotides at G1-A15 of the DZymes presented in the Figure 10 table. Sequence identifiers for all DZymes are provided in Table 2. A partial list of modified catalytic core sequences located at nucleotides 10-24 of the DZyme sequences is provided here. The modified catalytic core sequences are set forth at nucleotides 10-24 of the DZyme sequences in SEQ ID NO: 615 (dz014632), SEQ ID NO: 546 (dz013895), SEQ ID NO: 559 (dz013899), SEQ ID NO: 547 (dz013896), SEQ ID NO: 544 (dz013893), SEQ ID NO: 618 (dz014633), SEQ ID NO: 560 (dz013900), SEQ ID NO: 562 (dz013902), SEQ ID NO: 522 (dz014649), SEQ ID NO:545 (dz013894), SEQ ID NO: 619 (dz014631), SEQ ID NO: 523 (dz010725), SEQ ID NO: 732 (dz013916), SEQ ID NO: 526 (dz012805), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 563 (dz013903), SEQ ID NO: 663 (dz014636), SEQ ID NO: 558 (dz013904), SEQ ID NO: 561 (dz013901), SEQ ID NO: 759 (dz014654), SEQ ID NO: 533 (dz012811), SEQ ID NO: 534 (dz012813), SEQ ID NO: 530 (dz012808), SEQ ID NO: 524 (dz010726), SEQ ID NO: 534 (dz012812), SEQ ID NO: 531 (dz012809), SEQ ID NO: 734 (dz013913), SEQ ID NO: 737 (dz013915), SEQ ID NO: 739 (dz014655), SEQ ID NO: 567 (dz013908), SEQ ID NO: 537P-634420-PC(dz012815), SEQ ID NO: 532 (dz012810), SEQ ID NO: 745 (dz013917), SEQ ID NO: 525 (dz012804), SEQ ID NO: 746 (dz014653), SEQ ID NO: 757 (dz013912), SEQ ID NO: 747 (dz013914), SEQ ID NO: 748 (dz013918), SEQ ID NO: 749 (dz013919), SEQ ID NO: 750 (dz014652), SEQ ID NO: 538 (dz012816), SEQ ID NO: 536 (dz012814), SEQ ID NO: 539 (dz012817), SEQ ID NO: 763 (dz014650), SEQ ID NO: 764 (dz014651), SEQ ID NO: 556 (dz013897), SEQ ID NO: 771 (dz012819), SEQ ID NO: 540 (dz012818), SEQ ID NO: 553 (dz012800), SEQ ID NO: 845 (dz017970); SEQ ID NO: 850 (dz017971); SEQ ID NO: 851 (dz016910); SEQ ID NO: 852 (dz016906); SEQ ID NO: 853 (dz016907); SEQ ID NO: 854 (dz016426); SEQ ID NO: 855 (dz016415); SEQ ID NO: 856 (dz017532); SEQ ID NO: 857 (dz016913); SEQ ID NO: 858 (dz016417); SEQ ID NO: 859 (dz016425); SEQ ID NO: 860 (dz016427); SEQ ID NO: 861 (dz016909); SEQ ID NO: 862 (dz016915); SEQ ID NO: 863 (dz016914); SEQ ID NO: 864 (dz016908); SEQ ID NO: 865 (dz016416); SEQ ID NO: 866 (dz016413); SEQ ID NO: 867 (dz016412); SEQ ID NO: 868 (dz016912); SEQ ID NO: 869 (dz016919); SEQ ID NO: 870 (dz016411); SEQ ID NO: 871 (dz016920); SEQ ID NO: 872 (dz016418); SEQ ID NO: 873 (dz016446); SEQ ID NO: 874 (dz016916); SEQ ID NO: 875 (dz016414); SEQ ID NO: 876 (dz016444); SEQ ID NO: 877 (dz016419); SEQ ID NO: 878 (dz016432); SEQ ID NO: 879 (dz016430); SEQ ID NO: 880 (dz016922); SEQ ID NO: 881 (dz016926); SEQ ID NO: 882 (dz016410); SEQ ID NO: 883 (dz016925); SEQ ID NO: 884 (dz016924); SEQ ID NO: 885 (dz016442); SEQ ID NO: 886 (dz016911); SEQ ID NO: 887 (dz016428); SEQ ID NO: 888 (dz016445); SEQ ID NO: 889 (dz017527); SEQ ID NO: 890 (dz016447); SEQ ID NO: 891 (dz016436); SEQ ID NO: 892 (dz016434); SEQ ID NO: 893 (dz016450); SEQ ID NO: 894 (dz016921); SEQ ID NO: 895 (dz016923); SEQ ID NO: 896 (dz016443); SEQ ID NO: 897 (dz016409); SEQ ID NO: 898 (dz016440); SEQ ID NO: 899 (dz016441); SEQ ID NO: 900 (dz016431); SEQ ID NO: 901 (dz016452); SEQ ID NO: 902 (dz016448); SEQ ID NO: 903 (dz016918); SEQ ID NO: 904 (dz016420); SEQ ID NO: 905 (dz016451); SEQ ID NO: 906 (dz017537); SEQ ID NO: 907 (dz016449); SEQ ID NO: 908 (dz016429); SEQ ID NO: 909 (dz016439); SEQ ID NO: 910 (dz016917); SEQ ID NO: 911 (dz016433); SEQ ID NO: 912 (dz017529); SEQ ID NO: 913 (dz016437); SEQ ID NO: 914 (dz016421); SEQ ID NO: 915 (dz016422); SEQ ID NO: 916 (dz001619); SEQ ID NO: 917 (dz016423); SEQ ID NO: 918 (dz016453); SEQ ID NO: 919 (dz016424); SEQ ID NO: 1 (dz000002), SEQ ID NO: 568 (dz013909), SEQ ID NO: 554 (dz012802), SEQ ID NO: 549 (dz012796), SEQ ID NO: 555 (dz012803), and SEQ ID NO: 551 (dz012798).

[0065] Figure 11 - Active and stable cores and their fold change in activity compared to the unmodified sequence at ImM Mg+2for cleavage of UAUU junction. DZyme dz000002 (SEQ ID NO:P-634420-PC1) is the template sequence and present in the table solely for comparison purposes. The activity of dz000002 is the reference that the modified DZymes are normalized to and the fold change measurements that is shown in the table in Figure 11 are relative to dz000002.

[0066] N > 4 for all measurements. Abbreviations as for Figure 10. Note that the “am”, “om”, “una” and “f” sugar modifications convert the thymidine at T4 and or T8 to a uridine (U4 and or U8) when present. The DZ identifiers and sequences provided in the table presented in Figure 11 show modified catalytic cores sequences (nucleotide positions G1-A15) that are flanked by 5’ and 3’ partial arm sequences with modifications downstream and upstream of the core (A-2, A-l, A+l, respectively). The full list of modified catalytic core sequences comprises the nucleotides at G1-A15 of the DZymes presented in the Figure 11 table. Sequence identifiers for all DZymes are provided in Table 2. A partial list of modified catalytic core sequences located at nucleotides G1-A15 of the DZyme sequences is provided here. The modified catalytic core sequences are located at nucleotides 10-24 of the DZyme sequences set forth in SEQ ID NO: 759 (dz014654), SEQ ID NO: 739 (dz014655), SEQ ID NO: 732 (dz013916), SEQ ID NO: 745 (dz013917), SEQ ID NO: 748 (dz013918), SEQ ID NO: 747 (dz013914), SEQ ID NO: 757 (dz013912), SEQ ID NO: 746 (dz014653), SEQ ID NO: 737 (dz013915), SEQ ID NO: 750 (dz014652), SEQ ID NO: 559 (dz013899), SEQ ID NO: 734 (dz013913), SEQ ID NO: 546 (dz013895), SEQ ID NO: 547 (dz013896), SEQ ID NO: 615 (dz014632), SEQ ID NO: 749 (dz013919), SEQ ID NO: 763 (dz014650), SEQ ID NO: 764 (dz014651), SEQ ID NO: 562 (dz013902), SEQ ID NO: 618 (dz014633), SEQ ID NO: 544 (dz013893), SEQ ID NO:545 (dz013894), SEQ ID NO: 560 (13900), SEQ ID NO: 619 (dz014631), SEQ ID NO: 563 (dz013903), SEQ ID NO: 663 (dz014636), SEQ ID NO: 561 (dz013901), SEQ ID NO: 558 (dz013904), SEQ ID NO: 522 (dz014649), SEQ ID NO: 557 (dz013898), SEQ ID NO: 524 (dz010726), SEQ ID NO: 845 (dz017970); SEQ ID NO: 850 (dz017971); SEQ ID NO: 851 (dz016910); SEQ ID NO: 852 (dz016906); SEQ ID NO: 853 (dz016907); SEQ ID NO: 854 (dz016426); SEQ ID NO: 855 (dz016415); SEQ ID NO: 856 (dz017532); SEQ ID NO: 857 (dz016913); SEQ ID NO: 858 (dz016417); SEQ ID NO: 859 (dz016425); SEQ ID NO: 860 (dz016427); SEQ ID NO: 861 (dz016909); SEQ ID NO: 862 (dz016915); SEQ ID NO: 863 (dz016914); SEQ ID NO: 864 (dz016908); SEQ ID NO: 865 (dz016416); SEQ ID NO: 866 (dz016413); SEQ ID NO: 867 (dz016412); SEQ ID NO: 868 (dz016912); SEQ ID NO: 869 (dz016919); SEQ ID NO: 870 (dz016411); SEQ ID NO: 871 (dz016920); SEQ ID NO: 872 (dz016418); SEQ ID NO: 873 (dz016446); SEQ ID NO: 874 (dz016916); SEQ ID NO: 875 (dz016414); SEQ ID NO: 876 (dz016444); SEQ ID NO: 877 (dz016419); SEQ ID NO: 878 (dz016432); SEQ ID NO: 879 (dz016430); SEQ ID NO: 880 (dz016922); SEQ ID NO: 881 (dz016926); SEQ ID NO: 882 (dz016410); SEQ ID NO: 883 (dz016925); SEQ ID NO: 884P-634420-PC(dz016924); SEQ ID NO: 885 (dz016442); SEQ ID NO: 886 (dz016911); SEQ ID NO: 887 (dz016428); SEQ ID NO: 888 (dz016445); SEQ ID NO: 889 (dz017527); SEQ ID NO: 890 (dz016447); SEQ ID NO: 891 (dz016436); SEQ ID NO: 892 (dz016434); SEQ ID NO: 893 (dz016450); SEQ ID NO: 894 (dz016921); SEQ ID NO: 895 (dz016923); SEQ ID NO: 896 (dz016443); SEQ ID NO: 897 (dz016409); SEQ ID NO: 898 (dz016440); SEQ ID NO: 899 (dz016441); SEQ ID NO: 900 (dz016431); SEQ ID NO: 901 (dz016452); SEQ ID NO: 902 (dz016448); SEQ ID NO: 903 (dz016918); SEQ ID NO: 904 (dz016420); SEQ ID NO: 905 (dz016451); SEQ ID NO: 906 (dz017537); SEQ ID NO: 907 (dz016449); SEQ ID NO: 908 (dz016429); SEQ ID NO: 909 (dz016439); SEQ ID NO: 910 (dz016917); SEQ ID NO: 911 (dz016433); SEQ ID NO: 912 (dz017529); SEQ ID NO: 913 (dz016437); SEQ ID NO: 914 (dz016421); SEQ ID NO: 915 (dz016422); SEQ ID NO: 916 (dz001619); SEQ ID NO: 917 (dz016423); SEQ ID NO: 918 (dz016453); SEQ ID NO: 919 (dz016424); SEQ ID NO: 1 (dz000002), SEQ ID NO: 567 (dz013908), and SEQ ID NO: 568 (dz013909).

[0067] Figures 12A-12C - RNase H recruitment potential of MsPA-based and PS -based XNAzymes. (Figure 12A) Modification scheme for XNAzymes. A5G6_S witch indicates a dead core version where A5 and G6 bases were switched, resulting in an inactive core. (Figure 12B) Kinetic curves of XNAzymes without (left) and with (right) RNase H. (Figure 12C) Comparison of activity (Kobs) in the presence and absence of RNase H for both active DZs. N = 4 for all measurements.

[0068] DZ identifiers and sequences provided in the table presented in Figure 12A provide DZyme nucleotide sequences comprising modified catalytic cores (nucleotide positions G1-A15) that are flanked by 5’ and 3’ modified arm sequences downstream and upstream of the core (nucleotide positions C-7 to A-l and nucleotide positions A+l to T+8, respectively). The modified catalytic core sequences are located at nucleotides 8-22 of the DZyme sequences set forth in SEQ ID NO: 778 (dz005091), SEQ ID NO: 779 (dz007603), SEQ ID NO: 780 (dz006019), and SEQ ID NO: 781 (dz007615).

[0069] Figures 13A-13C - Metabolic stability of XNAzymes in biological matrices. (Figure 13A) Modification scheme for XNAzymes used in the experiments. (Figure 13B) XNAzymes stability in mouse liver homogenate. (Figure 13C) XNAzymes stability in SW620 cell lysate. The incubation was carried out at 37°C for the indicated time points. XNAzyme concentrations were measured using hybridization ELISA (hELISA). Results are shown as % of time point zero for each XNAzyme. N=3 for all measurements. Abbreviations are as for Figure 10 above and in Table 2. Note that the “om” and “f” sugar modification convert the thymidine at a given position, e.g., T-6, T4, T8, T+3, and or T+8 to a uridine (U) when present.

[0070] DZ identifiers and sequences provided in the table presented in Figure 13A provide DZymeP-634420-PCnucleotide sequences comprising modified catalytic core sequences (nucleotide positions G1-A15) that are flanked by 5’ and 3’ modified arm sequences downstream and upstream of the core (nucleotide positions C-7 to A-l and nucleotide positions A+l to T+8, respectively). The modified catalytic core sequences are located at nucleotides 8-22 of the DZyme sequences set forth in SEQ ID NO: 782 (dz006523), SEQ ID NO: 783 (dz005885), SEQ ID NO: 778 (dz005091), SEQ ID NO: 779 (dz007603), SEQ ID NO: 784 (dz009567), and SEQ ID NO: 785 (dz009568).

[0071] Figures 14A-14C - Metabolic stability of XNAzymes in mouse liver following subcutaneous (s.c.) administration. (Figure 14A) modification scheme for XNAzymes used in the experiment. Extracted mouse livers were subjected to XNAzyme concentration measurement using qPCR (Figure 14B) and hELISA (Figure 14C). Results are shown as % of two-hour time point for each XNAzyme. N=3 for all measurements. Abbreviations are as for Figure 10 above and in Table 2. Note that the “om” and “f” sugar modifications convert the thymidine at a given position, e.g., T-6, T4, T8, T+3, and or T+8 to a uridine (U) when present.

[0072] DZ identifiers and sequences provided in the table presented in Figure 14A provide DZyme nucleotide sequences comprising modified catalytic core sequences (nucleotide positions G1-A15) that are flanked by 5’ and 3’ modified arm sequences downstream and upstream of the core (nucleotide positions C-7 to A-l and nucleotide positions A+l to T+8, respectively). The modified catalytic core sequences are located at nucleotides 8-22 of the DZyme sequences set forth in SEQ ID NO: 778 (dz005091), SEQ ID NO: 779 (dz007603), SEQ ID NO: 784 (dz009567), and SEQ ID NO: 785 (dz009568).

[0073] Figures 15A-15H - XNAzyme-mediated intracellular RNA knockdown (KD). (Figure 15A) Allele- specific XNAzyme design targeting HTT SNP rs362307; the XNAzyme is engineered to cleave the rs362307-U allele but not the rs362307-C allele. The DZyme nucleotide sequence of presented in Figure 15A is a generic non-modified DZyme sequence for illustrative purposes. The sequence represents the template sequence of all HTT targeted DZymes before modification (5' CAAGGGCAGGCTAGCTACAACGAAGACTTCC 3'; SEQ ID NO: 939). For example, this sequence comprises the unmodified sequence presented at least for dz017417, dz016893, dz017415, and dz017414. The RNA sequence of HTT rs362307-C is set forth in SEQ ID NO: 933 (5’-GGAAGUCUGCGCCCUUG-3’). The RNA sequence of HTT rs362307-U is set forth in SEQ ID NO: 934 (5’-GGAAGUCUGt / GCCCUUG-3’). The cleavage site is denoted in bold-italic font.(Figure 15B) Chemical-modification schematics for XNAzymes used in the plasmid-based reporter experiments. (Figure 15C) Allele- specific RNA KD. Bar plots show normalized mean fluorescence intensity (MFI) + SEM. Statistics: two-way ANOVA with Tukey’s HSD; *p < 0.05, **p < 0.01, ***p < 0.001. N = 3 for all measurements. (Figure 15D) Correlation between in-vitro catalyticP-634420-PCactivity (Kobs from FRET -based cleavage assays) and cellular RNA KD, indicating that higher catalytic activity yields greater KD.. (Figure 15E) Chemical-modification schematics for XNAzymes used in the ICso experiments. (Figure 15F) Relationship between cellular potency (ICso) and Kobs for the core variants presented in the table of Figure 15E were measured at 1 mM and 0.1 mM Mg2+. (Figure 15G) Chemical-modification schematics for XNAzymes tested in GM1061A cells. (Figure 15H) Allele-specific KD of HTT rs362307 in GM1061A cells (heterozygous) measured by ddPCR with TaqMan SNP probes. The ASO reduces both alleles similarly (non-selective), whereas dz014614 shows allele- selective KD. dz015644, carrying the same modification pattern but a catalytically inactive “dead core” (A5^G6 substitution), shows no effect (n = 2).(Figure 15I) Chemical-modification schematics for XNAzymes used in the plasmid-based reporter experiments in Figure 15J. Allele- specific RNA KD in reporter plasmid system using lOnM DZ concentration. (Figure 15 J) Bar plots show normalized mean fluorescence intensity (MFI) ± SEM (N >=3). “k_obs” = observed first-order rate constant. “Kobs” = observed first-order rate constant. Note that the “om” and “f” sugar modifications convert the thymidine at a given position, e.g., T4, T8, T+5, T+6, to a uridine (U) when present.

[0074] DZ identifiers and sequences provided in the tables presented in Figure 15B, 15E, 15G, and 151 provide DZyme nucleotide sequences comprising modified catalytic core sequences (nucleotide positions G1-A15) that are flanked 5’ and 3’ by modified arm sequences downstream and upstream of the core (nucleotide positions A-7 to A-l or C-8 to A-l and nucleotide positions A+l to C+8, respectively). The modified catalytic core sequences are located at nucleotides 9-23 in each of SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), SEQ ID NO: 926 (dz017973), SEQ ID NO: 793 (dz014614), SEQ ID NO: 796 (dz013834), SEQ ID NO: 797 (dz017281), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 802 (dz017288), and SEQ ID NO: 805 (dz016265), and at nucleotides 8-22 of the DZyme sequences set forth in SEQ ID NO: 786 (dz013860), SEQ ID NO: 887 (dz013859), SEQ ID NO: 788 (dz013858), SEQ ID NO: 789 (dz013857), SEQ ID NO: 790 (dz013856), SEQ ID NO: 791 (dz013855), and SEQ ID NO: 792 (dz008804), or at nucleotides 9-23 of SEQ ID NO: 798 (dz017283), SEQ ID NO: 927 (dz017561), SEQ ID NO: 877 (dz016419), SEQ ID NO: 872 (dz016418), SEQ ID NO: 930 (dz016896), SEQ ID NO: 931 (dz016895), SEQ ID NO: 932 (dz016894), and SEQ ID NO: 794 (dz015644; negative control switch). The nucleotide sequence of the ASO_HTT molecule presented in Figure 15G is set forth in SEQ ID NO: 795.P-634420-PC

[0075] Figures 16A-16D - In vivo allele- specific knockdown of Map3k7 mRNA by XNAzymes.(Figure 16A) XNAzyme designs targeting two Map3k7 cleavage sites that confer allele specificity in BALB / c but not C57BL / 6 mice. The nucleotide sequence of the XNAzymes (DZymes) is set forth in SEQ ID NO: 822 (Map3k7_csll99; also termed Map3k7_rs50166819) and SEQ ID NOs: 823 and 824 (Map3k7_cs2488, with 9 nucleotide and 12 nucleotide long arms, respectively; also termed Map3k7_rs27730369 12-12 arms and Map3k7_rs27730369 9-9 arms, respectively). The RNA sequence of Map3k7_rs50166819-U is set forth in SEQ ID NO: 935 (5’-GUCAAAACUt / t / UGAAAAAC-3’). The RNA sequence of Map3k7_rs50166819-G comprises a mutated sequence of SEQ ID NO: 936 wherein a G replaces a U at position 10 (5’-GUCAAAACUGt / UGAAAAAC-3’). The RNA sequence of Map3k7_rs27730369-U is set forth in SEQ ID NO: 937 (5’- AGUUUACUGACUGGCGUGAGGUUGA-3’). The RNA sequence of Map3k7_rs50166819-G comprises a mutated sequence of SEQ ID NO: 938 wherein a G replaces a U at position 10 (5’- AGUUUACUGACUGt / CGUGAGGUUGA-3’). (Figure 16B) Chemicalmodification schemes for the XNAzymes and ASOs used. (Figure 16C) Physicochemical characterization of the LNP formulations (hydrodynamic diameter, PDI, encapsulation efficiency).(Figure 16D) Liver Map3k7 mRNA at 72 h post-IV dosing with LNP-XNAzyme or LNP-ASO, shown as fold change relative to vehicle. XNAzymes dz016774, dz17148, dz171460, dz15799, and dz017145 produce allele- selective knockdown, the non-targeting ASO (ION866672) shows no effect, and the Map3k7 -targeting ASO reduces both alleles (non-selectivly). Data are mean ± SEM (n = 3). Statistics: two-way ANOVA with Tukey’s HSD. Within each strain, treatments were compared to Vehicle; ns = not significant, **** = p < 0.0001.DZ IDs, names, and sequences provided in the table presented in Figure 16B, provide DZyme nucleotide sequences comprising modified catalytic core sequences (nucleotide positions G1-A15) that are flanked 5’ and 3’ by modified arm sequences downstream and upstream of the core (for Map3k7_rs50166819 nucleotide positions G-9 to A-l and nucleotide positions A+l to C+9, respectively. For Map3k7_rs27730369 either nucleotide positions T-12 to A-l and nucleotide positions A+l to T+12, respectively or nucleotide positions A-9 to A-l and nucleotide positions A+l to A+9, respectively). The modified catalytic core sequences are located at nucleotides 10-24 or 13-27 of the DZyme sequences set forth in SEQ ID NOs: 822, 823, and 824. The sequence identifiers for the modified DZymes are SEQ ID NO: 810 (dz016774), SEQ ID NO: 829 (dz017148), SEQ ID NO: 811 (dz017145), SEQ ID NO: 826 (dz017146), and SEQ ID NO: 812 (dz015779). The ASO sequences used for comparison are asoOOOOlO (mPcsk9_ION866672; SEQ ID NO: 808) and aso000027 (Map3k7_csll99; SEQ ID NO: 809).

[0076] Figures 17A-17D - RNA-seq and bioinformatic analysis of mouse liver 3 days afterP-634420-PCintravenous (IV) delivery of XNAzymes or antisense oligonucleotides (ASOs) in LNPs. (Figure 17A) Chemical-modification schemes for the XNAzymes and ASOs used. (Figure 17B) Differentialexpression (DE) results in BALB / c liver: volcano plots for each oligo show strong, selective knockdown of the intended target by both XNAzymes with minimal changes to non-target transcripts, whereas ASOs alter a substantially larger number of genes. (Figure 17C) Functional enrichment across Hallmark gene sets (e.g., apoptosis, DNA repair, p53 pathway) indicates markedly less pathway perturbation with XNAzymes than with ASOs, consistent with a more favorable toxicology profile. (Figure 17D) Off-target analysis plotting log2 fold change versus sequence similarity (points colored by strain) shows no association for XNAzymes, while ASOs display increased regulation with higher sequence similarity.

[0077] DZ IDs, names, and sequences provided in the table presented in Figure 17A, provide DZyme nucleotide sequences comprising modified catalytic core sequences (nucleotide positions G1-A15) that are flanked 5’ and 3’ by modified arm sequences downstream and upstream of the core (for Map3k7_rs50166819 nucleotide positions G-9 to A-l and nucleotide positions A+l to C+9, respectively. For Map3k7_rs27730369 nucleotide positions A-9 to A-l and nucleotide positions A+l to A+9). The modified catalytic core sequences are located at nucleotides 10-24 or 13-27 of the DZyme sequences set forth in SEQ ID NOs: 822, 823, and 824, respectively. The sequence identifiers for the modified DZymes are SEQ ID NO: 810 (dz016774) and SEQ ID NO: 811 (dz017145). The ASO sequences used for comparison are asoOOOOlO (mPcsk9_ION866672; SEQ ID NO: 808) and aso000027 (Map3k7_csll99; SEQ ID NO: 809).

[0078] Figures 18A-18D - XNAzyme in-vivo Map3k7 RNA and Protein KD duration. (Figure 18A) modification scheme for XNAzyme and ASO used in the experiment. (Figure 18B) characterization of the LNP encapsulation of the XNAzymes and ASOs used in the study. (Figure 18C) Liver Map3k7 mRNA levels by RT-qPCR, shown as fold change vs. vehicle at 3, 6, and 12 days after IV administration of LNP-XNAzyme or LNP-ASO. Dz015779 produces sustained mRNA knockdown across all time points, whereas the Map3k7-targeting ASO shows a progressive loss of effect. Data are mean + SEM (n = 3 per time point). (Figure 18D) Liver Map3k7 (TAK1) protein quantified by automated Western blot, normalized to vehicle at 3, 6, and 12 days post-dose. Protein suppression mirrors the RNA results: Dz015779 maintains knockdown, while the ASO effect wanes over time. Data are mean + SEM (n = 2 per time point).

[0079] DZ ID, name, and sequence provided in the table presented in Figure 18A, provide the DZyme nucleotide sequence comprising modified catalytic core sequences (nucleotide positions Gl-A15) that are flanked 5’ and 3’ by modified arm sequences downstream and upstream of the core (nucleotide positions T-12 to A-l and nucleotide positions A+l to T+12, respectively). The modifiedP-634420-PCcatalytic core sequences are located at nucleotides 13-27 of the DZyme sequences set forth in SEQ ID NO: 812 (dz015779; Map3k7_cs2488). As well the ASO ID and name are provided along with the sequence, which is set forth in SEQ ID NO: 809 (aso000027; Map3k7_csl 199).DETAILED DESCRIPTION

[0080] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the modified DZymes and uses thereof disclosed herein. However, it will be understood by those skilled in the art that the modified DZymes and uses thereof, may be practiced without these specific details. In other instances, well-known methods, procedures, and components have not been described in detail so as not to obscure the DZymes described herein.

[0081] A skilled artisan would appreciate that a XNAzyme is a nucleic acid enzyme, including DNAzymes or ribozymes, that comprises un-natural (non-canonical or modified) nucleic acids. XNAzymes may comprise a combination of natural and unnatural nucleic acids. Natural nucleic acids include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), wherein the canonical base units of DNA are cytosine (C) and guanine (G) and adenosine (A) and thymine (T), and the canonical base units of RNA are C, G, a, and uracil (U). Unnatural nucleic acids may encompass nucleic acids wherein the base unit or sugar moieties, or both, have been chemically modified. In addition, a XNAzyme may encompass modifications to the phosphodiester bond that changes its molecular structure.

[0082] A skilled artisan would appreciate that the terms “nucleotide base”, “nucleotide”, “base”, and “nucleic acid base” may, in some embodiment, be used interchangeably having all the same qualities and meaning. In some embodiments, a base comprises a DNA or RNA base, or any modifications thereof, for example but not limited to the modifications provided in Table 1. Similarly, the terms “nucleoside base”, “nucleoside”, “base” and “nucleic acid base” may, in some embodiment, be used interchangeably having all the same qualities and meaning. In some embodiments, the term “nucleotide” may be used interchangeably with “nucleoside” when referring to the sugars and bases units of the nucleotide. A skilled artisan would understand from the context the molecule being referred to.

[0083] In some embodiments, the terms “modified DNAzyme”, “modified DZyme”, “DNA enzyme”, “deoxy ribozymes”, “XNAzyme” or “X-Zymes” and the like may be used interchangeably having all the same meanings and qualities. As used herein, the skilled artisan would appreciate that a XNAzyme may encompass modified DZymes comprising un-natural nucleic acids or a combination of natural and un-natural nucleic acids. In some embodiments, modified DZymes also include modified linkages between nucleic acids. In some embodiments, modified DZymes compriseP-634420-PCmodified sugars, bases, or modified linkages between nucleic acids, or any combination thereof.

[0084] In certain embodiments, disclosed herein are modified DZymes comprising an enzyme activity that acts only through their inherent mechanism of action in the absence of Ribonuclease H (RNAse H) recruitment. In some embodiments, a modified DZyme has reduced RNAse H recruitment. In some embodiments, a modified DZyme comprises a DZyme with a modified catalytic core. In some embodiments, a modified DZyme comprises an enzyme activity that cleaves only the RNA target allele. In some embodiments, a modified DZyme comprises increased stability compared with the corresponding unmodified DZyme. In some embodiments, a modified DZyme comprises increased stability under in vivo conditions compared with the corresponding unmodified DZyme. In some embodiments, a modified DZyme comprising a modified catalytic core comprises increased enzyme activity compared to a DZyme that is not similarly modified in the core. In some embodiments, a modified DZyme comprising a modified core maintains enzyme activity compared to a DZyme that is not similarly modified in the core positions.DZymes

[0085] Deoxyribozymes (“DZymes”), are single- stranded oligo-deoxyribonucleotide molecules that have the ability to recognize and catalytically cleave an RNA substrate, for example an RNA transcript, through Watson-Crick base pairing and to cleave the RNA substrate (Figure 1A). In some embodiments, an RNA substrate comprises an RNA transcript.

[0086] In some embodiments, a DZyme comprises in 5’ to 3’ order: (i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a DZyme catalytic core; and (iii) a second substrate-binding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA. Upon binding of the DZyme to the RNA transcript, the DZyme catalytic core cleaves the RNA at a position between the first and second region of the RNA transcript.

[0087] As used herein, the terms “deoxyribozyme” and “DZyme” and “DNAzyme” and “DNA enzyme” and the like may be used interchangeably having the same qualities and meaning, wherein a DZyme encompasses a single stranded oligo-deoxyribonucleotides designed to hybridize with a target RNA transcript and cleave it at a specific site, wherein the 5' and 3' arms specifically recognize and hybridize with the target RNA transcript and the catalytic core cleaves the RNA transcript at an RY (purine / pyrimidine) sequence, for example a GU sequence or an AU sequence.

[0088] A DZyme may comprise an unmodified or modified catalytic core and unmodified or modified binding arms, or any combination thereof. Modified core and binding arms nucleotide sequences may comprise combinations of modified nucleotides and or modified phosphodiester (PO) linkages between the nucleotides. Nucleotides are represented throughout using their one letterP-634420-PCabbreviations as follows: adenine (A), cytosine (C), guanine (G), and thymine (T). A modified nucleotide may comprise a modified sugar, a modified base, or a modified sugar and a modified base.

[0089] A skilled artisan would appreciate that some modifications of nucleotide sugar moieties convert a nucleotide to a nucleoside, as found in RNA. In some embodiments, certain sugar modifications convert the thymidine at a given position, to a uridine (U). The Tables showing DZyme modifications, presented in the Figures accompanying this application, include a header row showing the template nucleotides of a 10-23 catalytic core (nucleotides 10-24 of SEQ ID NO: 1; also referred to as “G1-A15”). The skilled artisan would appreciate that the nucleotide sequence of the modified DZymes presented underneath the header row may include nucleic acids that are not identical to the header sequence due to the modifications present, wherein the skilled artisan would recognize the modified nucleic acid present in a given position based on the information presented in each table.

[0090] In some embodiments, a catalytic core comprises 15 nucleotides or modified nucleotides, with or without additional modifications to the backbone linkages between the nucleotides. In some embodiments, the nucleotide sequence of a catalytic core is set forth in nucleic acids 10-24 of SEQ ID NO: 1 (Gl, G2, C3, T4, A5, G6, C7, T8, A9, CIO, All, A12, C13, G14, A15; 10-23 DZyme (dz000002; G1-A15)). In some embodiments, an unmodified DZyme catalytic core comprises SEQ ID NO: 1.

[0091] In some embodiments, a catalytic core comprises 14 orl5 nucleotides or modified nucleotides, with or without additional modifications to the backbone linkages between the nucleotides. In some embodiments, a catalytic core comprises 14 nucleotides or modified nucleotides, with or without additional modifications to the backbone linkages between the nucleotides, wherein the nucleotide at position T8 of SEQ ID NO: 1 is deleted. In some embodiments, a catalytic core comprises 15 nucleotides or modified nucleotides based on the core nucleotides of SEQ ID NO: 1, with or without additional modifications to the backbone linkages between the nucleotides, wherein the nucleotide at position T8 is substituted.

[0092] A skilled artisan would appreciate that as used herein, in some embodiments, the terms “nucleotide sequence”, “polynucleotide”, “nucleic acid sequence” and “nucleic acid molecule” and the like, may encompass a polymeric form of nucleotides, either deoxyribonucleotides or ribonucleosides, or analogs thereof. Polynucleotides may have a three-dimensional structure. In certain embodiments, a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and or modified sugars. In some embodiments, a polynucleotide may comprise modified linkages between the nucleotides. In some embodiments, a modified polynucleotide comprises a combination of modified nucleotides, modified sugars, and modified linkages. In some embodiments modifications to the nucleotide structure are introduced during theP-634420-PCsynthesis of the DZyme polymer.

[0093] In some embodiments, the terms “DZyme catalytic core”, “DNAzyme catalytic core”, “catalytic core”, and “core”, and the like, may be used interchangeably, having all the same meanings and qualities. As used herein and presented in the Figures, nucleotide positions G1-A15 comprise the DZyme catalytic core. The arm positions flanking the core are designated - A-l, A-2, etc. (5’) and A+l etc. (3’). A-l for example, is the position of the 5’ arm most proximal to the core. A+l is the position of the 3’ arm most proximal to the core.

[0094] In some embodiments, a modified DZyme comprises a modified catalytic core wherein modifications may be present in nucleotide sugar moieties, base moieties, and or the linkage between the nucleotides. In some embodiments, a modified DZyme comprises a modified catalytic core wherein modifications may be present in nucleotide sugar moieties, base moieties, and or the linkage between the nucleotides; and unmodified 5' and 3' arms. In some embodiments, a modified DZyme comprises a modified catalytic core wherein modifications may be present in nucleotide sugar moieties, base moieties, and or the linkage between the nucleotides; and modified 5' and 3' arms, wherein modifications may be present in nucleotide sugar moieties, base moieties, and or the linkage between the nucleotides. In some embodiments, a modified DZyme comprises a modified catalytic core wherein modifications may be present in nucleotide sugar moieties, base moieties, and or the linkage between the nucleotides; and a modified 5' or 3' arm, wherein modifications may be present in nucleotide sugar moieties, base moieties, and or the linkage between the nucleotides.

[0095] As used herein, the terms “modified DZyme”, “modified DNAzyme”, “DZyme”, “DNAzyme” and “XNAzyme”, may in some embodiments be used interchangeably with all the same meanings and qualities. The skilled artisan would appreciate that XNAzymes that are DZymes may encompass artificial genetic polymers with novel sugar-base-phosphate backbones that harbor unique physicochemical properties relative to natural deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

[0096] In some embodiments, a modified catalytic core comprises nucleotide sugar modification(s). In some embodiments, a modified catalytic core comprises base modification(s). In some embodiments, a modified catalytic core comprises nucleotide sugar modification(s) and base modification(s). In some embodiments, a modified catalytic core comprises modifications to the phosphodiester (PO) backbone (backbone linkage modifications). In some embodiments, a modified core comprises a fully modified backbone. In some embodiments, a modified core comprises a partially modified backbone. In some embodiments, a modified catalytic core comprises a combination of nucleotide sugar modification(s), base modification(s), and backbone linkage modifications.P-634420-PC

[0097] As used herein, the term “phosphodiester backbone”, “PO”, and “backbone” may be used interchangeably, having all the same meanings and qualities.

[0098] In some embodiments, a modified core comprises a combination of modifications comprising modified sugars and / or modified bases and / or modified backbone linkages. Table 1 below provides a list of possible modifications, the shorthand name used, and the symbol used throughout including in the Figures. This list is for exemplary purposes and should not be considered limiting. Modifications to nucleotide sugars include but are not limited to 2'-Fluoro, 4'-methyl-deoxyribose, threose nucleic acid, 2'-OMe-arabinose, unlocked nucleic acid, 2'-O-methoxyethyl, 2'-OH-arabinose, 2'-methyl-deoxyribose, 2'-O-methylribonucleic acid, RNA (2'-OH), 2'-amino, locked nucleic acid, 5’-methyl-deoxyribose, glycol nucleic acid and L-DNA. In some embodiments, a modification to a nucleotide sugar comprises a 2'-Fluor modification. In some embodiments, a modification to a nucleotide sugar comprises a 4'-methyl-deoxyribose modification. In some embodiments, a modification to a nucleotide sugar comprises a threose nucleic acid modification. In some embodiments, a modification to a nucleotide sugar comprises a 2'-OMe-arabinose modification. In some embodiments, a modification to a nucleotide sugar comprises an unlocked nucleic acid modification. In some embodiments, a modification to a nucleotide sugar comprises a 2'-O-Methoxyethyl modification. In some embodiments, a modification to a nucleotide sugar comprises a 2'-OH-arabinose modification. In some embodiments, a modification to a nucleotide sugar comprises a 2'-methyl-deoxyribose modification. In some embodiments, a modification to a nucleotide sugar comprises a 2'-O-methylribonucleic acid modification. In some embodiments, a modification to a nucleotide sugar comprises an RNA (2'-OH) modification. In some embodiments, a modification to a nucleotide sugar comprises a 2'-Amino modification. In some embodiments, a modification to a nucleotide sugar comprises a locked nucleic acid modification. In some embodiments, a locked nucleic acid may refer to modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. In some embodiments, a modification to a nucleotide sugar comprises a 5’-methyl-deoxyribose. In some embodiments, a modification to a nucleotide sugar comprises a glycol nucleic Acid. In some embodiments, a modification to a nucleotide sugar comprises a L-DNA.

[0099] In some embodiments, a modified nucleotide comprises a modified base, which may be, for example, a non-naturally occurring base and or a chemically modified base. Modifications to a nucleotide base include but are not limited to 8-aza-7-deazaguanosine, l',2'-dideoxyribose, deoxyuridine, 5 -hydroxymethyl cytosine, 5 -methylcytosine, deoxyinosine, N6-methyl deoxyadenosine, 2-aminopurine, 2,6-diaminopurine, 5-fluoro-2'-deoxyuridine (5-F-dU), 6-aza-2'-deoxyuridine (6-Aza-dU), 5-hydroxybutynl-2'-deoxyuridine, 7-deaza-8azadeoxyadenosine (7 -deaza-P-634420-PC8-aza-dA; 78), and 6-Thio-deoxyguanosine (6-Thio-dG; 6td). In some embodiments, a modified base comprises 8-aza-7-deazaguanosine base. In some embodiments, a modified base comprises l',2'-dideoxyRibose base. In some embodiments, a modified base comprises a deoxyuridine base. In some embodiments, a modified base comprises a 5 -hydroxymethyl cytosine base. In some embodiments, a modified base comprises a 5 -methylcytosine base. In some embodiments, a modified base comprises a deoxyinosine base. In some embodiments, a modified base comprises a N6-methyl deoxyadenosine base. In some embodiments, a modified base comprises a 2-aminopurine base. In some embodiments, a modified base comprises a 2,6-diaminopurine base. In some embodiments, a modified base comprises a 5-F-dU base. In some embodiments, a modified base comprises a 6-Aza-dU base. In some embodiments, a modified base comprises a 7-deaza-8-aza-dA base. In some embodiments, a modified base comprises a 6-Thio-dG base.

[0100] Modification to backbone linkages include but are not limited to ethoxy phosphonate, mesyl phosphoramidate, phosphorothioate, methoxy phosphonate, phosphoryl guanidine, busyl phosphoramidate, and 2’ -5’ linked DNA. In some embodiments, a modified linkage comprises an ethoxy phosphonate linkage. In some embodiments, a modified linkage comprises a mesyl phosphoramidate linkage. In some embodiments, a modified linkage comprises a phosphorothioate linkage. In some embodiments, a modified linkage comprises a methoxy Phosphonate linkage. In some embodiments, a modified linkage comprises a phosphoryl guanidine linkage. In some embodiments, a modified linkage comprises a busyl phosphoramidate. In some embodiments, a modified linkage comprises a 2’ -5’ linked DNA.

[0101] In some embodiments, the context of a modified nucleotide and or linker affects the catalytic activity of the DZyme core. For example, a single modification present in a DZyme core lacking any further modifications may result in the DZyme having a certain level of activity and stability while that same modification within the context of a fully or partially modified core may lead to the DZyme having a different level of activity and stability, improving or not improving these properties.

[0102] In some embodiments, a modified DZyme comprising a modified core maintains RNA nuclease cleavage activity compared with a DZyme comprising an unmodified core. In some embodiments, a modified DZyme comprising a modified core has increased RNA nuclease cleavage activity compared with a DZyme comprising an unmodified core. In some embodiments, a modified DZyme comprising a modified core maintains stability compared with a DZyme comprising an unmodified core. In some embodiments, a modified DZyme comprising a modified core has increased stability compared with a DZyme comprising an unmodified core. In some embodiments, a modified DZyme comprising a modified core has decreased potential to recruit RNAse H compared with a DZyme comprising an unmodified core. In some embodiments, a modified DZyme comprising aP-634420-PCmodified core can completely abrogate recruitment of RNAse H compared with a DZyme comprising an unmodified core. In some embodiments, a modified DZyme comprising a modified core has reduced recruitment of RNAse H, compared with a DZyme comprising an unmodified core.

[0103] In some embodiments of a modified DZyme disclosed herein, modifications within the first and second substrate-binding arms may influence the RNA nuclease cleavage activity compared with a DZyme comprising unmodified first and second substrate-binding arms. In some embodiments of a modified DZyme disclosed herein, modifications within the first and second substrate-binding arms may influence the stability of the modified DZyme compared with a DZyme comprising unmodified first and second substrate-binding arms. In some embodiments of a modified DZyme disclosed herein, modifications the first and second substrate-binding arms may influence the potential to recruit RNAse H activity compared with a DZyme comprising unmodified first and second substrate-binding arms. In some embodiments of a modified DZyme disclosed herein, modifications within the first and second substrate-binding arms may influence the RNA nuclease cleavage activity of, the stability of, and / or the potential to recruit RNAse H activity of the DZyme compared with a In some embodiments of a modified DZyme disclosed herein, modifications within the first and second substrate-binding arms may influence the RNA nuclease cleavage activity compared with a DZyme comprising unmodified first and second substrate-binding arms.

[0104] In some embodiments, a modified DZyme disclosed herein comprising modified first and second substrate-binding arms has increased RNA nuclease cleavage activity compared with a DZyme comprising unmodified first and second substrate-binding arms. In some embodiments, a modified DZyme disclosed herein comprising modified first and second substrate-binding arms maintains RNA nuclease cleavage activity compared with a DZyme comprising unmodified first and second substrate-binding arms. In some embodiments, a modified DZyme disclosed herein comprising modified first and second substrate-binding arms has increased stability compared with a DZyme comprising unmodified first and second substrate-binding arms. In some embodiments, a modified DZyme disclosed herein comprising modified first and second substrate-binding arms has decreased RNAse H activity compared with a DZyme comprising unmodified first and second substrate-binding arms. In some embodiments, a modified DZyme disclosed herein comprising modified first and second substrate-binding arms has increased or maintained RNA nuclease cleavage activity, increased stability, or decreased RNAse H activity, or any combination thereof, compared with a DZyme comprising unmodified first and second substrate-binding arms.

[0105] In some embodiments of a modified DZyme disclosed herein comprising modified first and second substrate-binding arms, modifications to the arms may encompass nucleotide sugar modifications, nucleotide base modifications, or backbone linkage modifications, or anyP-634420-PCcombinations thereof. In some embodiments, modifications to the first and or second substratebinding arms comprise nucleotide sugar modifications. In some embodiments, modifications to the first and or second substrate-binding arms comprise nucleotide based modifications. In some embodiments, modifications to the first and or second substrate-binding arms comprise backbone linkage modifications between the arm nucleotides and / or arm-core interface nucleotides. In some embodiments, modifications to the first and or second substrate-binding arms comprise nucleotide base modifications and backbone linkage modifications between the arm nucleotides and / or armcore interface nucleotides. In some embodiments, modifications to the first and or second substratebinding arms comprise nucleotide sugar modifications and backbone linkage modifications between the arm nucleotides and / or arm-core interface nucleotides. In some embodiments, modifications to the first and or second substrate-binding arms comprise nucleotide base modifications, nucleotide sugar modifications, and backbone linkage modifications between the arm nucleotides and / or armcore interface nucleotides.

[0106] In some embodiments, a modified DZyme comprises in 5’ to 3’ order: (i) a 5’ arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a modified DZyme catalytic core; and (iii) a 3’ arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the mRNA. In some embodiments, a modified DZyme comprises a modified 5' arm, a modified 3' arm, or modified 5' and 3' arms.

[0107] Table 1 provides nomenclature for modifications described herein, along with the shorthand name and symbol used in many of the tables and figures. Table 1 also provides if these modifications comprise sugar, base, or backbone modifications. In some embodiments of the modified DZyme, any of the modifications listed in Table 1 or combinations thereof, may be included in the core sequence of a modified DZyme disclosed herein. In some embodiments of the modified DZyme, any of the modifications listed in Table 1 or combinations thereof, may be included in the modified 5' and / or 3' arms of a modified DZyme disclosed herein.

[0108] Table 1: Modification Descriptions and matching shorthand and symbols.Shortcut Description Symbol Typel',2'-dideoxy Ribose 12d Base2'-5' 2'-5'-linked DNA 25 Linker2, 6-Diaminopurine da Base2-Aminopurine ap Base2'-Amino am Sugar2'-F 2'-Fluoro f Sugar2'-Me 2 ’-Methyl 2me Sugar2'-MOE 2'-O-Methoxyethyl mo Sugar2'-OH-arabinose b SugarP-634420-PC2'-OMe 2'-O-Methyl om Sugar2'-OMe-arabinose car Sugar4'-Me 4 ’ -Methy 1-2' -Deoxyribo se 4me Sugar5'-Me 5 ’ -Methy 1-2' -Deoxyribo se 5 me Sugar5-F-dU 5 -Fluoro-2'-Deoxyuridine 5fu or 5fd Base5hmC 5 -Hydroxymethyl Cytosine he Base5-Me-dC 5 -Methy Icy to sine me Base6azadu or6-Aza-dU 6-Aza-2'-Deoxyuridine 6azad Base6-Thio-dG 6-Thio-deoxyguanosine 6td Base7-deaza- 7-deaza-8-aza-dA 8 azadeoxy adeno sine 78 BaseBsPA Busyl Phosphoramidate # or bsl Linker224 '-Constrained-2 '-O- cEt Ethyl SugarDeoxy Inosine i BasedU or d orDeoxyUridine Ud BaseEOP Ethoxy Phosphonate ep or eop Linker(S)-GNA (S) Glycol Nucleic Acid gna or Sgna SugarL-DNA 1 SugarLNA Locked Nucleic Acid In SugarMsPA Mesyl PhosphoramidateAor msl LinkerMOP or MP Methoxy Phosphonate mop LinkerN6-Methyldeoxy Adeno sine m6a BasePG Phosphoryl Guanidine + or pg LinkerPS Phosphorothioate * or ps LinkerRNA r Sugar8-aza-7- Super G deazadeoxyguano sine sg or 78 BaseTNA Threose nucleic acid tna SugarUNA Unlocked Nucleic acid una Sugar

[0109] A skilled artisan would appreciate that the “om” “am”, “una”, “5fu”, “6azadu”, and “f ’ modifications when directed to a thymine containing nucleotide convert the thymine (T) to uridine (U).

[0110] As used herein, in some embodiments the terms “5fu” and “5fd” may be used interchangeably having all the same meanings and qualities. As used herein, in some embodiments the terms “sg” and “78” may be used interchangeably having all the same meanings and qualities. As used herein, in some embodiments, the terms “dU” and “d” and “Ud” may be used interchangeably having all the same meanings and qualities. As used herein, in some embodiments the terms “gna” or “Sgna” may be used interchangeably having all the same meanings and qualities, wherein the “S” refers to the SynP-634420-PCconformation of the nucleotide. As used herein, in some embodiments the terms “ep” and “eop” may be used interchangeably having all the same meanings and qualities. As used herein, in some embodiments the terms “A” and “msl” may be used interchangeably having all the same meanings and qualities. As used herein, in some embodiments the terms “+” and “pg” may be used interchangeably having all the same meanings and qualities. As used herein in some embodiments the terms and “ps” may be used interchangeably having all the same meanings and qualities.

[0111] As used throughout and in the Figures, every position of a modified core (positions G1-A15) has the potential for two-three modifications (e.g. sugar and or base + linker). Nucleotide modifications may comprise sugar modifications, base modifications, or linker modifications, or any combination thereof. In the nomenclature used throughout and, in the Figures, a nucleoside modification, if any, will be followed by a linker modification, if any. Modifications are always downstream to the recited nucleoside. For example, in the sequence ‘AGmo*CA’, the A is not modified, and the downstream linker is a PO (no modification), the G is modified with a 2’ -MOE and there is a linkage modification wherein there is a ps bond between the G and the C.

[0112] In some embodiments, a DZyme comprises a modified DZyme comprising in 5’ to 3’ order: (i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a modified DZyme catalytic core; and (iii) a second substrate-binding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the mRNA, wherein the modified DZyme catalytic core comprises modifications of the sequence set forth in nucleic acids 10-24 of SEQ ID NO: 1. In some embodiments, comparisons of activity of a modified DZyme with a non-modified DZyme comprise comparisons of the modified DZyme with a DZyme having a catalytic core set forth in nucleotides 10-24 of SEQ ID NO: 1.

[0113] In some embodiments, a modified nucleotide targeting an RNA transcript comprises a nucleotide with a modified sugar moiety or with a modified base or with a modified backbone, or any combination thereof. In some embodiments, a modified nucleotide comprises any of the nucleotide modifications disclosed in Table 1 or combinations thereof.

[0114] In some embodiments, a modified DZyme comprises a modified SEQ ID NO: 1 catalytic core comprising any of the sugar and or base modifications provided in Table 1 or combinations thereof. In some embodiments, a modified DZyme targeting an RNA transcript comprises in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein said nucleotide sequence comprises at least four (4) modified nucleosides selectedP-634420-PCfrom (a)-(g) (DZyme Core I):(a) wherein the cytidine (C) at position 3 comprises a threose nucleic acid (Ctna) or a 4 ’-methyl-2’ -deoxyribose (C4me);(b) wherein the thymidine (T) at position 4 comprises a deoxyuridine (dU), a 5- fluoro-2’-deoxyuridine (U5fu), or a 2’-fluoro (Uf);(c) wherein the C at position 7 is a 2’-NH2 (Cam);(d) wherein the T at position 8 comprises a 2’-O-methyl (Uom), a L-DNA (Tl), a Uf, an unlocked nucleic acid (Uuna), a 6-aza-2’-deoxyuridune (U6azadu), a 2’- O-methoxyethyl (Tmo), a glycol nucleic acid (Tgna), or is absent;(e) wherein the C at position 10 comprises a C4me or a 5 -methylcytosine (Cmc); (f) wherein the adenosine (A) at position 11 is a 2’ -fluoro (Af); and (g) wherein the guanosine (G) at position 14 comprises a 2’-O-methoxyethyl (Gmo), a 2’-NH2 (Gam), a 2’-O-methyl (Gom), or a 2’-fluoro (Gf); and (iii) a second substrate-binding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0115] In some embodiments of the modified DZyme comprising DZyme Core I, the G at position 14 comprises a Gmo or a Gam (DZyme Core II). In some embodiments of the modified DZyme comprising DZyme Core I or DZyme Core II, the T at position 8 comprises a Uom, or a Tmo, or is a Uuna (DZyme Core III). In some embodiments of the modified DZyme comprising DZyme Core I or DZyme Core II or DZyme Core III, the T at position 4 comprises a dU or a U5fu (DZyme Core IV). In some embodiments of the modified DZyme comprising DZyme Core I or DZyme Core II, the C at position 3 is a Ctna and the C at position 7 is a Cam (DZyme Core V).In some embodiments of the modified DZyme comprising DZyme Core I or DZyme Core II or DZyme Core V, the T at position 4 comprises a dU or a U5fu (DZyme Core VI).

[0116] In some embodiments of a modified DZyme comprising any of DZyme Core I-DZyme Core VI, the core sequence comprises at least 4, at least 5, at least 6, or at least seven modified nucleosides selected from (a)-(g) above. In some embodiments of a modified DZyme comprising any of DZyme Core I-DZyme Core VI, the core sequence comprises at least 5 modified nucleosides selected from (a)-(g) above. In some embodiments of a modified DZyme comprising any of DZyme Core I-DZyme Core VI, the core sequence comprises at least 6 modified nucleosides selected from (a)-(g) above. In some embodiments of a modified DZyme comprising any of DZyme Core I-DZyme Core VI, the core sequence comprises at least seven modified nucleosides selected from (a)-(g) above. In addition, in some embodiments, the backbone linkerP-634420-PCphosphodiester bonds (PO) between the nucleotides of any of DZyme COREs I- VI, comprise modified linkers or unmodified linkers or any combination thereof.

[0117] In some embodiments, a modified DZyme disclosed herein comprises a modified catalytic core of DZyme CORE I comprising nucleotides 9-23 of any of SEQ ID NO: 793 (dz014614), SEQ ID NO: 797 (dz017281), SEQ ID NO: 798 (dz017283), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 801 (dz016261), SEQ ID NO: 802 (dz017288), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 805 (dz016265), SEQ ID NO: 806 (dz016259), and SEQ ID NO: 807 (dz017417); or comprising nucleotides 8-22 of any of SEQ ID NO: 887 (dz013859), and SEQ ID NO: 788 (dz013858). In other embodiments, a modified DZyme comprising a modified catalytic core of DZyme CORE I comprises nucleotides 10-24 of any of SEQ ID NO: 584 (dz016348), SEQ ID NO: 591 (dz016353), SEQ ID NO: 664 (dz017531), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 580 (dz016346), SEQ ID NO: 605 (dz017220), SEQ ID NO: 599 (dz017214), SEQ ID NO: 658 (dz017375), SEQ ID NO: 604 (dz017219), SEQ ID NO: 597 (dz017212), SEQ ID NO: 587 (dz016351), SEQ ID NO:603 (dz017218), SEQ ID NO: 610 (dz017225), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 607 (dz017222), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 653 (dz015432), SEQ ID NO: 585 (dz016349), SEQ ID NO: 586 (dz016350), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 650 (dz016388), SEQ ID NO: 674 (dz016365), SEQ ID NO: 627 (dz016331), SEQ ID NO: 608 (dz017223), SEQ ID NO: 675 (dz016362), SEQ ID NO: 676 (dz016364), SEQ ID NO: 677 (dz016498), SEQ ID NO: 667 (dz017533), SEQ ID NO: 590 (dz015727), SEQ ID NO: 589 (dz015724), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 620 (dz014626), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 583 (dz016496), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 625 (dz016330), SEQ ID NO: 578 (dz016345), SEQ ID NO: 592 (dz016354), SEQ ID NO: 573 (dz015726), SEQ ID NO:654 (dz016497), SEQ ID NO: 680 (dz016490), SEQ ID NO: 548 (dz015430), SEQ ID NO: 681 (dz016366), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 632 (dz016329), SEQ ID NO: 593 (dz016355), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 609 (dz017224), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 685 (dz015706), SEQ ID NO: 672 (dz016359), SEQ ID NO: 686 (dz017535), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 602 (dz017217), SEQ ID NO: 631 (dz016338), SEQ ID NO: 546 (dz013895), SEQ ID NO: 623P-634420-PC(dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 638 (dz017519), SEQ ID NO: 690 (dz017539), SEQ ID NO: 648 (dz017525), SEQ ID NO: 574 (dz014640), SEQ ID NO: 691 (dz016393), SEQ ID NO: 579 (dz016356), SEQ ID NO: 693 (dz015925), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 572 (dz014638), SEQ ID NO: 661 (dz014634), SEQ ID NO: 615 (dz014632), SEQ ID NO: 694 (dz016363), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 547 (dz013896), SEQ ID NO: 662 (dz014635), SEQ ID NO: 639 (dz015710), SEQ ID NO: 618 (dz014633), SEQ ID NO:698 (dz016489), SEQ ID NO: 699 (dz015714), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 702 (dz015697), SEQ ID NO:703 (dz016333), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 706 (dz014978), SEQ ID NO: 707 (dz015715), SEQ ID NO: 708 (dz015924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 545 (dz013894), SEQ ID NO: 710 (dz016491), SEQ ID NO: 619 (dz014631), SEQ ID NO: 711 (dz016386), SEQ ID NO: 588 (dz016352), SEQ ID NO: 712 (dz014979), SEQ ID NO: 713 (dz015926), SEQ ID NO: 714 (dz015927), SEQ ID NO: 715 (dz016401), SEQ ID NO: 617 (dz016343), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 663 (dz014636), SEQ ID NO: 621 (dz015705), SEQ ID NO: 721 (dz014974), SEQ ID NO: 722 (dz016342), SEQ ID NO: 723 (dz016391), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 728 (dz016395), SEQ ID NO: 595 (dz014645), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 731 (dz016495), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO: 739 (dz014655), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 744 (dz014971), SEQ ID NO: 746 (dz014653), SEQ ID NO: 751 (dz015713), SEQ ID NO: 756 (dz015701), SEQ ID NO: 759 (dz014654), SEQ ID NO: 646 (dz015731), SEQ ID NO: 762 (dz016438), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), and SEQ ID NO: 645 (dz015717).

[0118] The design and characterization of the substrate binding arms are provided herein and in the Examples. In certain instances of the Examples unmodified arms are provided in order that the different modified cores may be analyzed and compared. In other instances, in the Example’s, partially modified arms are provided. A skilled artisan would appreciate that modified or unmodifiedP-634420-PC5’ and 3’ arms could be used to flank the modified DZyme core sequences described herein, wherein the arms function to target the modified DZyme core to the RNA target sequences and the catalytic core’s function is to cleave the RNA target sequences.

[0119] One skilled in the art based on the knowledge in the art and the disclosure herein, would clearly understand how to design 5' and 3' arms accompanying a modified catalytic core disclosed herein, and comprised in a modified DZyme. The skilled artisan would appreciate the need to identify an RNA transcript target and the regions on the RNA transcript wherein the first and second substratebinding arms need to bind to. The skilled artisan would appreciate that the nucleotide sequences of the first and second substrate-binding arms need to be complementary or partially complementary to the regions of the RNA transcript that surround the GU or AU cleavage site. The skilled artisan would then select a modified DZyme catalytic core with GU or AU cleavage function, as disclosed herein. In some embodiments, a modified DZyme catalytic core is capable of cleaving a RY cleavage site. In some embodiments, a modified DZyme catalytic core is capable of cleaving a GU cleavage site. In some embodiments, a modified DZyme catalytic core is capable of cleaving an AU cleavage site. In some embodiments, a modified DZyme catalytic core is capable of cleaving a GU and AU cleavage site.

[0120] The terms "complementary" or "complementarity, " as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base pairing. For example, the sequence " A — G — T" binds to the complementary sequence " T — C — A." Complementarity between two single- stranded molecules may be "partial, " such that only some of the nucleic acids bind, or it may be "complete, " such that total complementarity exists between the single stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of the hybridization between the nucleic acid strands.

[0121] In some embodiments, the first substrate-binding arm is 100% complementary to the first region of the RNA transcript. In some embodiments, the first substrate-binding arm is partially complementary to the first region of the RNA transcript. In some embodiments, the first substratebinding arm is partially complementary to the first region of the RNA transcript, with no more than four mismatches. In some embodiments, the first substrate-binding arm is partially complementary to the first region of the RNA transcript with 1, 2, 3, or 4 mismatches.

[0122] In some embodiments, the second substrate-binding arm is 100% complementary to the second region of the RNA transcript. In some embodiments, the second substrate-binding arm is partially complementary to the second region of the RNA transcript. In some embodiments, the second substrate-binding arm is partially complementary to the second region of the RNA transcript, with no more than four mismatches. In some embodiments, the second substrate-binding arm isP-634420-PCpartially complementary to the second region of the RNA transcript with 1, 2, 3, or 4 mismatches.

[0123] In some embodiments, the first substrate-binding arm is 100% complementary to the first region of the RNA transcript and the second substrate-binding arm is 100% complementary to the second region of the RNA transcript or comprises 1, 2, 3, or 4 mismatches with the second region of the RNA transcript. In some embodiments, the first substrate-binding arm is partially complementary to the first region of the RNA transcript and the second substrate-binding arm is 100% complementary to the second region of the RNA transcript or comprises 1, 2, 3, or 4 mismatches with the second region of the RNA transcript. In some embodiments, the first substrate-binding arm is partially complementary to the first region of the RNA transcript, with no more than four mismatches and the second substrate-binding arm is 100% complementary to the second region of the RNA transcript or comprises 1, 2, 3, or 4 mismatches with the second region of the RNA transcript. In some embodiments, the first substrate-binding arm is partially complementary to the first region of the RNA transcript comprising 1, 2, 3, or 4 mismatches and the second substrate-binding arm is 100% complementary to the second region of the RNA transcript or comprises 1, 2, 3, or 4 mismatches with the second region of the RNA transcript.

[0124] In certain embodiments, a DZyme comprising a modified catalytic core of DZyme CORE1 and targeting the HTT rs362307 mutant allele comprises a modified DZyme as set forth in any of SEQ ID NO: 793 (dz014614), SEQ ID NO: 797 (dz017281), SEQ ID NO: 798 (dz017283), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 801 (dz016261), SEQ ID NO: 802 (dz017288), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 805 (dz016265), SEQ ID NO: 806 (dz016259), SEQ ID NO: 807 (dz017417), SEQ ID NO: 887 (dz013859), and SEQ ID NO: 788 (dz013858).

[0125] In other embodiments, a DZyme comprising a modified catalytic core of DZyme CORE1 and targeting the KRAS G12V mutant allele comprises a modified DZyme as set forth in any of SEQ ID NO: 584 (dz016348), SEQ ID NO: 591 (dz016353), SEQ ID NO: 664 (dz017531), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 580 (dz016346), SEQ ID NO: 605 (dz017220), SEQ ID NO: 599 (dz017214), SEQ ID NO: 658 (dz017375), SEQ ID NO: 604 (dz017219), SEQ ID NO: 597 (dz017212), SEQ ID NO: 587 (dz016351), SEQ ID NO:603 (dz017218), SEQ ID NO: 610 (dz017225), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 607 (dz017222), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 653 (dz015432), SEQ ID NO: 585 (dz016349), SEQ ID NO: 586 (dz016350), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 650 (dz016388), SEQ ID NO: 674 (dz016365), SEQ ID NO: 627 (dz016331), SEQ ID NO: 608 (dz017223), SEQ ID NO: 675 (dz016362), SEQ ID NO: 676P-634420-PC(dz016364), SEQ ID NO: 677 (dz016498), SEQ ID NO: 667 (dz017533), SEQ ID NO: 590 (dz015727), SEQ ID NO: 589 (dz015724), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 620 (dz014626), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 583 (dz016496), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 625 (dz016330), SEQ ID NO: 578 (dz016345), SEQ ID NO: 592 (dz016354), SEQ ID NO: 573 (dz015726), SEQ ID NO:654 (dz016497), SEQ ID NO: 680 (dz016490), SEQ ID NO: 548 (dz015430), SEQ ID NO: 681 (dz016366), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 632 (dz016329), SEQ ID NO: 593 (dz016355), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 609 (dz017224), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 685 (dz015706), SEQ ID NO: 672 (dz016359), SEQ ID NO: 686 (dz017535), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 602 (dz017217), SEQ ID NO: 631 (dz016338), SEQ ID NO: 546 (dz013895), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 638 (dz017519), SEQ ID NO: 690 (dz017539), SEQ ID NO: 648 (dz017525), SEQ ID NO: 574 (dz014640), SEQ ID NO: 691 (dz016393), SEQ ID NO: 579 (dz016356), SEQ ID NO: 693 (dz015925), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 572 (dz014638), SEQ ID NO: 661 (dz014634), SEQ ID NO: 615 (dz014632), SEQ ID NO: 694 (dz016363), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 547 (dz013896), SEQ ID NO: 662 (dz014635), SEQ ID NO: 639 (dz015710), SEQ ID NO: 618 (dz014633), SEQ ID NO:698 (dz016489), SEQ ID NO: 699 (dz015714), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 702 (dz015697), SEQ ID NO:703 (dz016333), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 706 (dz014978), SEQ ID NO: 707 (dz015715), SEQ ID NO: 708 (dz015924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 545 (dz013894), SEQ ID NO: 710 (dz016491), SEQ ID NO: 619 (dz014631), SEQ ID NO: 711 (dz016386), SEQ ID NO: 588 (dz016352), SEQ ID NO: 712 (dz014979), SEQ ID NO: 713 (dz015926), SEQ ID NO: 714 (dz015927), SEQ ID NO: 715 (dz016401), SEQ ID NO: 617 (dz016343), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 663 (dz014636), SEQ ID NO: 621 (dz015705), SEQ ID NO: 721 (dz014974), SEQ ID NO: 722 (dz016342), SEQ ID NO: 723P-634420-PC(dz016391), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 728 (dz016395), SEQ ID NO: 595 (dz014645), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 731 (dz016495), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO: 739 (dz014655), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 744 (dz014971), SEQ ID NO: 746 (dz014653), SEQ ID NO: 751 (dz015713), SEQ ID NO: 756 (dz015701), SEQ ID NO: 759 (dz014654), SEQ ID NO: 646 (dz015731), SEQ ID NO: 762 (dz016438), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), and SEQ ID NO: 645 (dz015717).

[0126] In some embodiments, there are at least four (4) modified backbone linkers within the catalytic core sequence. In some embodiments, the at least 4 modified linkers comprise any combination or multiples of a 25, an eop, a msl, a mop, a pg, a bsl, or a ps linkage. In some embodiments, the at least 4 modified backbone linkers are selected from an eop, a msl, a mop, a pg, a bsl, or a ps linkage. In some embodiments, the catalytic core further comprises at least 4 nucleoside modifications (base and or sugar modifications). In some embodiments, the catalytic core further comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside modifications between the core nucleotides.

[0127] In some embodiments, a modified DZyme comprises a modified SEQ ID NO: 1 catalytic core (nucleotides 10-24) comprising any of the backbone modifications provided in Table 1 or combinations thereof. In some embodiments, a modified DZyme targeting an RNA transcript comprises in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein said nucleotide sequence comprises at least four (4) linker modifications selected from (a)-(g) (DZyme Core VII):(a) wherein the linker 3' of the guanosine (G) nucleotide at position 1 comprises a methoxy phosphonate (mop), a mesyl phosphoramidate (msl), or a phosphoryl guanidine (pg);(b) wherein the linker 3' of the thymidine (T) nucleotide at position 4 comprises a phosphorothioate (ps) or a pg;(c) wherein the linker 3' of the adenosine (A) nucleotide at position 5 comprises a pg, a msl, a mop, or an ethoxy phosphonate (eop);P-634420-PC(d) wherein the linker 3' of the A nucleotide at position 9 comprises a pg, msl, mop, or an eop;(e) wherein the linker 3' of the cytidine (C) nucleotide at position 10 comprises a pg, a msl, a mop, or an eop;(f) wherein the linker 3' of the A nucleotide at position 12 comprises a pg, a msl, a mop, or an eop; and(g) wherein the linker 3' of the C nucleotide at position 13 comprises a pg, a msl, a mop, or an eop; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0128] In some embodiments of the modified DZyme comprising DZyme Core VII,(a) the linker 3' of the G nucleotide at position 1 comprises a msl or a pg;(b) the linker 3' of the T nucleotide at position 4 comprises a ps or a pg;(c) the linker 3' of the A nucleotide at position 5 comprises a msl or a pg;(d) the linker 3' of the A nucleotide at position 9 comprises a msl or a pg;(e) the linker 3' of the C nucleotide at position 10 comprises a msl or a pg;(f) the linker 3' of the A nucleotide at position 12 comprises a msl or a pg; and (g) the linker 3' of the C nucleotide at position 13 comprises a msl or a pg; (DZyme Core VIII).

[0129] In some embodiments of the modified DZyme comprising DZyme Core VII or DZyme Core VIII, the linker 3' of the G nucleotide at position 1 is msl and the linker 3' of the C nucleotide at position 10 is a pg (DZyme Core IX). In some embodiments of the modified DZyme comprising DZyme Core VII - DZyme Core IX, the linker 3' of the A nucleotide at position 9 is a pg (DZyme Core X).

[0130] In some embodiments of the modified DZyme comprising DZyme Core VII,(a) the linker 3' of the G nucleotide at position 1 is a msl;(b) the linker 3' of the T nucleotide at position 4 comprises a ps or a pg;(c) the linker 3' of the A nucleotide at position 5 is a msl;(d) the linker 3' of the A nucleotide at position 9 is a msl;(e) the linker 3' of the C nucleotide at position 10 is a msl;(f) the linker 3' of the A nucleotide at position 12 is a msl;(g) the linker 3' of the C nucleotide at position 13 is a msl; (DZyme Core XI).

[0131] In other embodiments of the modified DZyme comprising DZyme Core VII,P-634420-PC(a) the linker 3' of the G nucleotide at position 1 is a pg;(b) the linker 3' of the T nucleotide at position 4 comprises a ps or a pg;(c) the linker 3' of the A nucleotide at position 5 is a pg;(d) the linker 3' of the A nucleotide at position 9 is a pg;(e) the linker 3' of the C nucleotide at position 10 is a pg;(f) the linker 3' of the A nucleotide at position 12 is a pg;(g) the linker 3' of the C nucleotide at position 13 is a pg; (DZyme Core XII).

[0132] In some embodiments of the modified DZyme comprising DZyme Core VII-DZyme Core X, the linker 3' of the A nucleotide at position 5 is a msl (DZyme Core XIII). In some embodiments of the modified DZyme comprising DZyme Core XIII, the linker 3' of the A nucleotide at position 12 is a msl (DZyme Core XIV). In some embodiments of the modified DZyme comprising DZyme Core XIII or DZyme Core XIV, the linker 3' of the C nucleotide at position 13 is a msl (DZyme Core XV).

[0133] In some embodiments of a modified DZyme comprising any of DZyme Core VII-XV, the nucleotide sequence of the modified core further comprises at least 5, at least 6, or at least 7 linker modifications selected from (a) - (g). In some embodiments, the nucleotide sequence comprises at least 5 linker modifications selected from (a)-(g). In some embodiments, the nucleotide sequence comprises at least 6 linker modifications selected from (a)-(g). In some embodiments, the nucleotide sequence comprises at least 7 linker modifications selected from (a)-(g).

[0134] In some embodiments of a modified DZyme comprising any of the modified cores DZyme CORE VII-XV, the modified core further comprises modified or unmodified sugars and or bases.

[0135] In some embodiments of a modified DZyme disclosed herein comprising a modified catalytic core of DZyme CORE VII, the modified catalytic core comprises nucleotides 9-23 of any of SEQ ID NO: 793 (dz014614), SEQ ID NO: 796 (dz013834), SEQ ID NO: 797 (dz017281), SEQ ID NO: 798 (dz017283), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 801 (dz016261), SEQ ID NO: 802 (dz017288), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 805 (dz016265), SEQ ID NO: 806 (dz016259), and SEQ ID NO: 807 (dz017417); or nucleotides 8-22 of any of SEQ ID NO: 786 (dz013860), SEQ ID NO: 887 (dz013859), SEQ ID NO: 788 (dz013858), SEQ ID NO: 789 (dz013857), SEQ ID NO: 790 (dz013856), SEQ ID NO: 791 (dz013855), and SEQ ID NO: 792 (dz008804).

[0136] In other embodiments of a modified DZyme disclosed herein comprising a modified catalytic core of DZyme CORE VII, the modified catalytic core comprises nucleotides 10-24 of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 600 (dz017215), SEQ ID NO: 605 (dz017220),P-634420-PCSEQ ID NO: 658 (dz017375), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 653 (dz015432), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 650 (dz016388), SEQ ID NO: 495 (dz017256), SEQ ID NO: 674 (dz016365), SEQ ID NO: 627 (dz016331), SEQ ID NO: 675 (dz016362), SEQ ID NO: 676 (dz016364), SEQ ID NO: 677 (dz016498), SEQ ID NO: 468 (dz012831), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 652 (dz015431), SEQ ID NO: 620 (dz014626), SEQ ID NO: 469 (dz012832), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 625 (dz016330), SEQ ID NO: 592 (dz016354), SEQ ID NO: 528 (dz015429), SEQ ID NO:654 (dz016497), SEQ ID NO: 680 (dz016490), SEQ ID NO: 548 (dz015430), SEQ ID NO: 681 (dz016366), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 632 (dz016329), SEQ ID NO: 497 (dz017258), SEQ ID NO: 593 (dz016355), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 498 (dz017259), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 470 (dz012833), SEQ ID NO: 685 (dz015706), SEQ ID NO: 672 (dz016359), SEQ ID NO: 686 (dz017535), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 501 (dz017262), SEQ ID NO: 631 (dz016338), SEQ ID NO: 546 (dz013895), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 638 (dz017519), SEQ ID NO: 690 (dz017539), SEQ ID NO: 648 (dz017525), SEQ ID NO: 499 (dz017260), SEQ ID NO: 500 (dz017261), SEQ ID NO: 471 (dz012834), SEQ ID NO: 691 (dz016393), SEQ ID NO: 692 (dz014981), SEQ ID NO: 579 (dz016356), SEQ ID NO: 693 (dz015925), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 661 (dz014634), SEQ ID NO: 615 (dz014632), SEQ ID NO: 694 (dz016363), SEQ ID NO: 472 (dz012835), SEQ ID NO: 651 (dz017528), SEQ ID NO: 473 (dz012836), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 662 (dz014635), SEQ ID NO: 639 (dz015710), SEQ ID NO:697 (dz014984), SEQ ID NO: 618 (dz014633), SEQ ID NO:698 (dz016489), SEQ ID NO: 699 (dz015714), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 702 (dz015697), SEQ ID NO: 560 (dz013900), SEQ ID NO:703 (dz016333), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 706 (dz014978), SEQ ID NO: 707 (dz015715), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 564 (dz013905), SEQ ID NO: 637P-634420-PC(dz017609), SEQ ID NO: 545 (dz013894), SEQ ID NO: 710 (dz016491), SEQ ID NO: 619 (dz014631), SEQ ID NO: 711 (dz016386), SEQ ID NO: 566 (dz013907), SEQ ID NO: 522 (dz014649), SEQ ID NO: 565 (dz013906), SEQ ID NO: 712 (dz014979), SEQ ID NO: 713 (dz015926), SEQ ID NO: 714 (dz015927), SEQ ID NO: 715 (dz016401), SEQ ID NO: 716 (dz014972), SEQ ID NO: 557 (dz013898), SEQ ID NO: 617 (dz016343), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 563 (dz013903), SEQ ID NO: 663 (dz014636), SEQ ID NO: 720 (dz014982), SEQ ID NO: 621 (dz015705), SEQ ID NO: 721 (dz014974), SEQ ID NO: 722 (dz016342), SEQ ID NO: 558 (dz013904), SEQ ID NO: 523 (dz010725), SEQ ID NO: 723 (dz016391), SEQ ID NO:561 (dz013901), SEQ ID NO: 724 (dz016335), SEQ ID NO: 474 (dz012837), SEQ ID NO: 726 (dz016390), SEQ ID NO: 524 (dz010726), SEQ ID NO: 533 (dz012811), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 530 (dz012808), SEQ ID NO:730 (dz014987), SEQ ID NO: 519 (dz010722), SEQ ID NO: 731 (dz016495), SEQ ID NO: 520 (dz010723), SEQ ID NO: 535 (dz012813), SEQ ID NO: 521 (dz010724), SEQ ID NO: 732 (dz013916), SEQ ID NO: 534 (dz012812), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 531 (dz012809), SEQ ID NO: 734 (dz013913), SEQ ID NO: 735 (dz014989), SEQ ID NO: 736 (dz015700), SEQ ID NO: 737 (dz013915), SEQ ID NO: 738 (dz015730), SEQ ID NO: 739 (dz014655), SEQ ID NO:740 (dz015703), SEQ ID NO: 741 (dz014976), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 543 (dz012795), SEQ ID NO: 743 (dz014975), SEQ ID NO: 537 (dz012815), SEQ ID NO: 744 (dz014971), SEQ ID NO: 532 (dz012810), SEQ ID NO:745 (dz013917), SEQ ID NO: 525 (dz012804), SEQ ID NO: 746 (dz014653), SEQ ID NO: 747 (dz013914), SEQ ID NO: 748 (dz013918), SEQ ID NO:749 (dz013919), SEQ ID NO: 518 (dz010727), SEQ ID NO: 567 (dz013908), SEQ ID NO: 750 (dz014652), SEQ ID NO: 751 (dz015713), SEQ ID NO: 752 (dz014988), SEQ ID NO: 502 (dz015696), SEQ ID NO: 753 (dz014985), SEQ ID NO: 754 (dz014986), SEQ ID NO: 542 (dz012794), SEQ ID NO: 755 (dz014983), SEQ ID NO: 756 (dz015701), SEQ ID NO: 757 (dz013912), SEQ ID NO:541 (dz012793), SEQ ID NO: 759 (dz014654), SEQ ID NO: 760 (dz014980), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 538 (dz012816), SEQ ID NO: 644 (dz015716), SEQ ID NO: 536 (dz012814), SEQ ID NO: 539 (dz012817), SEQ ID NO: 488 (dz012851), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 763 (dz014650), SEQ ID NO: 764 (dz014651), SEQ ID NO: 766 (dz014973), SEQ ID NO: 767 (dz014977), SEQ ID NO: 559 (dz012800), SEQ ID NO: 771P-634420-PC(dz012819), SEQ ID NO: 772 (dz012821), SEQ ID NO: 645 (dz015717), SEQ ID NO: 540 (dz012818), SEQ ID NO: 553 (dz012800), and SEQ ID NO: 775 (dz012863).

[0137] As described herein, a skilled artisan would clearly understand how to design 5' and 3' arms accompanying a modified catalytic core disclosed herein, and comprised in a modified DZyme.

[0138] In certain embodiments, a DZyme comprising a modified catalytic core of DZyme COREVII and targeting the HTT rs362307 mutant allele comprises a modified DZyme as set forth in any of SEQ ID NO: 793 (dz014614), SEQ ID NO: 796 (dz013834), SEQ ID NO: 797 (dz017281), SEQ ID NO: 798 (dz017283), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 801 (dz016261), SEQ ID NO: 802 (dz017288), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 805 (dz016265), SEQ ID NO: 806 (dz016259), SEQ ID NO: 807 (dzO17417), SEQ ID NO: 786 (dz013860), SEQ ID NO: 887 (dz013859), SEQ ID NO: 788 (dz013858), SEQ ID NO: 789 (dz013857), SEQ ID NO: 790 (dz013856), SEQ ID NO: 791 (dz013855), and SEQ ID NO: 792 (dz008804).

[0139] In other embodiments, a DZyme comprising a modified catalytic core of DZyme COREVII and targeting the KRAS G12V mutant allele comprises a modified DZyme as set forth in any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 600 (dz017215), SEQ ID NO: 605 (dz017220), SEQ ID NO: 658 (dz017375), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 653 (dz015432), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 650 (dz016388), SEQ ID NO: 495 (dz017256), SEQ ID NO: 674 (dz016365), SEQ ID NO: 627 (dz016331), SEQ ID NO: 675 (dz016362), SEQ ID NO: 676 (dz016364), SEQ ID NO: 677 (dz016498), SEQ ID NO: 468 (dz012831), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 652 (dz015431), SEQ ID NO: 620 (dz014626), SEQ ID NO: 469 (dz012832), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 625 (dz016330), SEQ ID NO: 592 (dz016354), SEQ ID NO: 528 (dz015429), SEQ ID NO:654 (dz016497), SEQ ID NO: 680 (dz016490), SEQ ID NO: 548 (dz015430), SEQ ID NO: 681 (dz016366), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 632 (dz016329), SEQ ID NO: 497 (dz017258), SEQ ID NO: 593 (dz016355), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 498 (dz017259), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 470 (dz012833), SEQ ID NO: 685 (dz015706), SEQ ID NO: 672 (dz016359), SEQ ID NO: 686 (dz017535), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 501 (dz017262), SEQ ID NO: 631 (dz016338), SEQ ID NO: 546P-634420-PC(dz013895), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 638 (dz017519), SEQ ID NO: 690 (dz017539), SEQ ID NO: 648 (dz017525), SEQ ID NO: 499 (dz017260), SEQ ID NO: 500 (dz017261), SEQ ID NO: 471 (dz012834), SEQ ID NO: 691 (dz016393), SEQ ID NO: 692 (dz014981), SEQ ID NO: 579 (dz016356), SEQ ID NO: 693 (dz015925), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 661 (dz014634), SEQ ID NO: 615 (dz014632), SEQ ID NO: 694 (dz016363), SEQ ID NO: 472 (dz012835), SEQ ID NO: 651 (dz017528), SEQ ID NO: 473 (dz012836), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 662 (dz014635), SEQ ID NO: 639 (dz015710), SEQ ID NO:697 (dz014984), SEQ ID NO: 618 (dz014633), SEQ ID NO:698 (dz016489), SEQ ID NO: 699 (dz015714), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 702 (dz015697), SEQ ID NO: 560 (dz013900), SEQ ID NO:703 (dz016333), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 706 (dz014978), SEQ ID NO: 707 (dz015715), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 564 (dz013905), SEQ ID NO: 637 (dz017609), SEQ ID NO: 545 (dz013894), SEQ ID NO: 710 (dz016491), SEQ ID NO: 619 (dz014631), SEQ ID NO: 711 (dz016386), SEQ ID NO: 566 (dz013907), SEQ ID NO: 522 (dz014649), SEQ ID NO: 565 (dz013906), SEQ ID NO: 712 (dz014979), SEQ ID NO: 713 (dz015926), SEQ ID NO: 714 (dz015927), SEQ ID NO: 715 (dz016401), SEQ ID NO: 716 (dz014972), SEQ ID NO: 557 (dz013898), SEQ ID NO: 617 (dz016343), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 563 (dz013903), SEQ ID NO: 663 (dz014636), SEQ ID NO: 720 (dz014982), SEQ ID NO: 621 (dz015705), SEQ ID NO: 721 (dz014974), SEQ ID NO: 722 (dz016342), SEQ ID NO: 558 (dz013904), SEQ ID NO: 523 (dz010725), SEQ ID NO: 723 (dz016391), SEQ ID NO:561 (dz013901), SEQ ID NO: 724 (dz016335), SEQ ID NO: 474 (dz012837), SEQ ID NO: 726 (dz016390), SEQ ID NO: 524 (dz010726), SEQ ID NO: 533 (dz012811), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 530 (dz012808), SEQ ID NO:730 (dz014987), SEQ ID NO: 519 (dz010722), SEQ ID NO: 731 (dz016495), SEQ ID NO: 520 (dz010723), SEQ ID NO: 535 (dz012813), SEQ ID NO: 521 (dz010724), SEQ ID NO: 732 (dz013916), SEQ ID NO: 534 (dz012812), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 531 (dz012809), SEQ ID NO: 734 (dz013913), SEQ ID NO: 735 (dz014989), SEQ ID NO: 736P-634420-PC(dz015700), SEQ ID NO: 737 (dz013915), SEQ ID NO: 738 (dz015730), SEQ ID NO: 739 (dz014655), SEQ ID NO:740 (dz015703), SEQ ID NO: 741 (dz014976), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 543 (dz012795), SEQ ID NO: 743 (dz014975), SEQ ID NO: 537 (dz012815), SEQ ID NO: 744 (dz014971), SEQ ID NO: 532 (dz012810), SEQ ID NO:745 (dz013917), SEQ ID NO: 525 (dz012804), SEQ ID NO: 746 (dz014653), SEQ ID NO: 747 (dz013914), SEQ ID NO: 748 (dz013918), SEQ ID NO:749 (dz013919), SEQ ID NO: 518 (dz010727), SEQ ID NO: 567 (dz013908), SEQ ID NO: 750 (dz014652), SEQ ID NO: 751 (dz015713), SEQ ID NO: 752 (dz014988), SEQ ID NO: 502 (dz015696), SEQ ID NO: 753 (dz014985), SEQ ID NO: 754 (dz014986), SEQ ID NO: 542 (dz012794), SEQ ID NO: 755 (dz014983), SEQ ID NO: 756 (dz015701), SEQ ID NO: 757 (dz013912), SEQ ID NO:541 (dz012793), SEQ ID NO: 759 (dz014654), SEQ ID NO: 760 (dz014980), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 538 (dz012816), SEQ ID NO: 644 (dz015716), SEQ ID NO: 536 (dz012814), SEQ ID NO: 539 (dz012817), SEQ ID NO: 488 (dz012851), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 763 (dz014650), SEQ ID NO: 764 (dz014651), SEQ ID NO: 766 (dz014973), SEQ ID NO: 767 (dz014977), SEQ ID NO: 559 (dz012800), SEQ ID NO: 771 (dz012819), SEQ ID NO: 772 (dz012821), SEQ ID NO: 645 (dz015717), SEQ ID NO: 540 (dz012818), SEQ ID NO: 553 (dz012800), and SEQ ID NO: 775 (dz012863).

[0140] In some embodiments, there are at least five (5) modified backbone linkers within the catalytic core sequence. In some embodiments, the at least 5 modified linkers comprise a 25, an eop, a msl, a mop, a pg, a bsl, or a ps linkage, or any combination thereof. In some embodiments, the at least 5 modified linkers comprise pg modifications. In some embodiments, the at least 5 modified linkers comprise eop modifications. In some embodiments, the catalytic core further comprises at least 4 nucleoside modifications (base and or sugar modifications). In some embodiments, the catalytic core further comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside modifications.

[0141] In some embodiments, a modified DZyme targeting an RNA transcript comprises in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein said nucleotide sequence comprises at least four (4) linker modifications selected from (a)-(g) (DZyme Core XVI), wherein:P-634420-PC(a) the linker 3' of the guanosine (G) nucleotide at position 2 is a phosphoryl guanidine (pg);(b) the linker 3' of the G nucleotide at position 6 is a pg;(c) the linker 3' of the cytidine (C) nucleotide at position 7 is a pg;(d) the linker 3' of the adenosine (A) nucleotide at position 9 is a pg;(e) the linker 3' of the C nucleotide at position 10 is a pg;(f) the linker 3' of the A nucleotide at position 12 is a pg;(g) the linker 3' of the A nucleotide at position 15 is a pg; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0142] In some embodiments of a modified DZyme comprising a modified catalytic DZyme Core XVI, the linker 3' of the thymidine (T) nucleotide at position 8 is a pg and / or the linker 3' of the A at position 11 is a pg and / or the linker 3' of the G at position 14 is a pg (DZyme Core XVII). In some embodiments of a modified DZyme comprising a modified catalytic DZyme Core XVI or a DZyme Core XVII, the linker 3' of the C nucleotide at position 3 is a pg and / or the linker 3' of the C nucleotide at position 13 is a pg (DZyme Core XVIII). In some embodiments of a modified DZyme comprising a modified catalytic DZyme Core XVI, the linker 3' of the T nucleotide at position 4 comprises a pg or a ps (DZyme Core XIX).

[0143] In some embodiments of a modified DZyme comprising a modified catalytic core selected from any of DZyme Core XVI-XIX, the nucleoside moieties of amino acids 10-24 of SEQ ID NO: 1 comprise any combination of modified or unmodified sugars and or bases.

[0144] In some embodiments of a modified DZyme disclosed herein comprising a modified catalytic core of DZyme CORE XVI, the modified catalytic core comprises nucleotides 10-24 of any of SEQ ID NO: 584 (dz016348), SEQ ID NO: 591 (dz016353), SEQ ID NO: 582 (dz016347), SEQ ID NO: 664 (dz017531), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 580 (dz016346), SEQ ID NO: 605 (dz017220), SEQ ID NO: 599 (dz017214), SEQ ID NO: 604 (dz017219), SEQ ID NO: 597 (dz017212), SEQ ID NO: 587 (dz016351), SEQ ID NO:603 (dz017218), SEQ ID NO: 610 (dz017225), SEQ ID NO: 607 (dz017222), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 585 (dz016349), SEQ ID NO: 581 (dz016344), SEQ ID NO: 586 (dz016350), SEQ ID NO: 608 (dz017223), SEQ ID NO: 577 (dz014643), SEQ ID NO: 590 (dz015727), SEQ ID NO: 589 (dz015724), SEQ ID NO: 641 (dz017517), SEQ ID NO: 583 (dz016496), SEQ ID NO: 578 (dz016345), SEQ ID NO: 592 (dz016354), SEQ ID NO: 573 (dz015726), SEQ ID NO: 593P-634420-PC(dz016355), SEQ ID NO: 609 (dz017224), SEQ ID NO: 602 (dz017217), SEQ ID NO: 574 (dz014640), SEQ ID NO: 579 (dz016356), SEQ ID NO: 640 (dz017607), SEQ ID NO: 572 (dz014638), SEQ ID NO: 575 (dz014641), SEQ ID NO: 649 (dz017526), SEQ ID NO: 576 (dz014642), SEQ ID NO: 70 (dz013911), SEQ ID NO: 571 (dz014639), SEQ ID NO: 569 (dz013910), SEQ ID NO: 709 (dz017536), SEQ ID NO: 588 (dz016352), and SEQ ID NO: 595 (dz014645).

[0145] As described herein, a skilled artisan would clearly understand how to design 5' and 3' arms accompanying a modified catalytic core disclosed herein, and comprised in a modified DZyme. In certain embodiments, a DZyme comprising a modified catalytic core of DZyme COREXVI and targeting the KRAS G12V mutant allele comprises a modified DZyme as set forth in any of SEQ ID NO: 584 (dz016348), SEQ ID NO: 591 (dz016353), SEQ ID NO: 582 (dz016347), SEQ ID NO: 664 (dz017531), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 580 (dz016346), SEQ ID NO: 605 (dz017220), SEQ ID NO: 599 (dz017214), SEQ ID NO: 604 (dz017219), SEQ ID NO: 597 (dz017212), SEQ ID NO: 587 (dz016351), SEQ ID NO:603 (dz017218), SEQ ID NO: 610 (dz017225), SEQ ID NO: 607 (dz017222), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 585 (dz016349), SEQ ID NO: 581 (dz016344), SEQ ID NO: 586 (dz016350), SEQ ID NO: 608 (dz017223), SEQ ID NO: 577 (dz014643), SEQ ID NO: 590 (dz015727), SEQ ID NO: 589 (dz015724), SEQ ID NO: 641 (dz017517), SEQ ID NO: 583 (dz016496), SEQ ID NO: 578 (dz016345), SEQ ID NO: 592 (dz016354), SEQ ID NO: 573 (dz015726), SEQ ID NO: 593 (dz016355), SEQ ID NO: 609 (dz017224), SEQ ID NO: 602 (dz017217), SEQ ID NO: 574 (dz014640), SEQ ID NO: 579 (dz016356), SEQ ID NO: 640 (dz017607), SEQ ID NO: 572 (dz014638), SEQ ID NO: 575 (dz014641), SEQ ID NO: 649 (dz017526), SEQ ID NO: 576 (dz014642), SEQ ID NO: 70 (dz013911), SEQ ID NO: 571 (dz014639), SEQ ID NO: 569 (dz013910), SEQ ID NO: 709 (dz017536), SEQ ID NO: 588 (dz016352), and SEQ ID NO: 595 (dz014645).

[0146] In some embodiments, a modified DZyme targeting an RNA transcript comprises in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein said nucleotide sequence comprises modified linkers (DZyme Core XX),(a) wherein the linker 3' of the guanosine (G) nucleotide at position 2 is an ethoxy phosphonate (eop);P-634420-PC(b) wherein the linker 3' of the cytidine (C) nucleotide at position 7 is an eop; (c) wherein the linker 3' of the adenosine (A) nucleotide at position 9 is an eop; (d) wherein the linker 3' of the C nucleotide at position 10 is an eop;(e) wherein the linker 3' of the A nucleotide at position 12 is an eop; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0147] In some embodiments of a modified DZyme comprising a modified catalytic core of DZyme Core XX, the nucleoside moieties of amino acids 10-24 of SEQ ID NO: 1 comprise any combination of modified or unmodified sugars and or bases.

[0148] In some embodiments of a modified DZyme, the catalytic core comprises a combination of modifications, wherein for each nucleotide the base, sugar, and or PO linkage may be modified. In certain embodiments of a modified DZyme targeting an RNA transcript, the modified DZyme comprises in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1 (G1-A15) represented as follows G, LI, X2, L2, X3, L3, X4, L4, X5, L5, G, L6, X7, L7, X8, L8, X9, L9, X10, L10, Xll, Lil, A, L12, X13, L13, X14, L14, X15, and L15, wherein X represents a nucleoside with or without a modified sugar moiety or a modified base or both, and L represents a phosphodiester (PO) linkage or modified linkage between nucleosides (DZyme Core XXI); wherein(a) LI comprises a mesyl phosphoramidate (msl), a phosphoryl guanidine (pg), a phosphorothioate (ps), or an ethoxy phosphonate (eop) linkage;(b) X2 comprises a G, a 2'-O-methyl modified G (Gom) or a 8-aza-7- deazaguanosine modified G (Gsg);(c) L2 comprises a PO, a msl, a pg, a ps, or an eop linkage, wherein when X2 is a Gsg then L2 is a msl linkage;(d) X3 comprises a cytosine nucleoside (C) or a threose nucleic acid modified C (Ctna);(e) L3 comprises a PO, a msl, a ps, or a pg linkage, wherein when X3 is a Ctna L3 is a PO, a msl, or a pg linkage;(f) X4 comprises a thymine nucleoside (T), a 5-fluoro-2'-deoxyuridine (U5fu), a deoxyuridine (dU), 2'-fluoro modified U (Uf), or a 2'-NH2 modified U (Uam); (g) L4 comprises a PO, a pg, or a ps linkage;P-634420-PC(h) X5 comprises an adenine nucleoside (A) or 4'-methyl-2'-deoxyribose A (A4me);(i) L5 comprises a PO, a msl, a ps, or a pg linkage, wherein when L5 is a ps linkage X5 is A;(j) L6 comprises a msl, a pg, a ps, or an eop linkage;(k) X7 comprises a C, a 2'-NH2 modified C (Cam), or a 2'-O-methyl (Com); (l) L7 comprises a msl, a pg, an eop, a ps, or a PO linkage, wherein when L7 is an eop or a ps linkage X7 is C;(m)X8 comprises a 2'-O-methyl Uridine (Uom), a 6-aza-2'-deoxyuridine (U6azadu), a 2'-O-methoxyethyl T (Tmo), an unlocked U (Uuna), a 2'-fluoro U (Uf), L-DNA (Tl), a glycol nucleic acid (Tgna), a l',2'-dideoxyribose (T12d) or a T, or is absent;(n) L8 comprises a PO, a msl, a pg, a eop, or a ps linkage;(o) X9 comprises an A or a 2'-Ome-arabinose A (Acar);(p) L9 comprises a msl, a pg, a PO, an eop, or a ps linkage, wherein when X9 is Acar L9 is a msl linkage, and when L9 is an eop linkage X9 is A;(q) X10 comprises a C, a 5 -methylcytosine C (Cmc), a 4'-methyl-2'-deoxyribose C (C4me), or a 5-hydroxymethlcytosine (Che);(r) L10 comprises a pg, a msl, a PO, a ps, or an eop linkage, wherein when X10 is Cmc L10 is a pg linkage, when X10 is C4me L10 is a pg linkage, and when X10 is Chc L10 is a msl linkage, and wherein when L10 is a ps linkage X10 is C and when L10 is an eop linkage X10 is C;(s) X11 comprises an A, a 2'-fluoro A (Af), or a 2'-O-methyl A (Aom);(t) LI 1 comprises a msl, a pg, a PO, a ps, or an eop linkage, wherein when XI 1 is Aom LI 1 is a PO linkage and when LI 1 is an eop linkage XI 1 is A;(u) L12 comprises a msl, a pg, a PO, a ps, or an eop linkage;(v) X13 comprises a C or a Cmc;(w)L13 comprises a msl, a PO, a ps, a pg, or an eop linkage, wherein when X13 is Cmc L13 is a msl linkage;(x) X14 comprises a 2'-methoxy ethyl G (Gmo), a 2’-O-methyl G (Gom), a 2'-NH2 G(Gam), a G, or a 2'-Fluoro G (Gf);(y) L14 comprises a PO, a msl, a pg, a ps, or an eop linkage, wherein when L14 is an eop linkage X14 is G;(z) X15 comprises an A, an Af, a lock nucleic acid A (Aln), a 2'-O-methoxy ethylP-634420-PCA (Amo), an Atna, a RNA (2’ -OH) A (Ar), a or an Aom; and (aa) L15 comprises a pg, a msl, a PO, a ps, or an eop linkage, wherein when X15 is Amo LI 5 is a msl or pg linkage, when X15 is a Atna LI 5 is a PO linkage, when X15 is an Aom L15 is a PO linkage, when X15 is Ar L15 is a PO or an ps linkage, and wherein when L15 is an ps linkage X15 is A, and when L15 is an eop linkage X15 is A; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0149] In some embodiments of a modified DZyme comprising a modified DZyme Core XXI, the modified catalytic core comprises the nucleotide sequence: G, LI, X2, L2, X3, L3, X4, L4, X5, L5, G, L6, X7, L7, X8, L8, X9, L9, X10, LIO, X11, L11, A, L12, X13, L13, X14, L14, X15, and LI 5 (DZyme Core XXII), wherein(a) L1 comprises a msl, pg, or a ps linkage;(b) X2 comprises a G, a Gom or a Gsg;(c) L2 comprises a pg or a msl linkage, wherein when X2 is a Gsg then L2 is a msl linkage;(d) X3 comprises a C or a Ctna;(e) L3 comprises a PO or a msl linkage, wherein when X3 is C L3 is a msl linkage; (f) X4 comprises a T, a U5fu, a dU, or a Uf;(g) L4 comprises a PO, a pg, or a ps linkage, wherein when X4 is dU L4 is a PO or a pg linkage and when X4 is Uf L4 is a PO or a pg linkage;(h) X5 comprises an A or an A4me;(i) L5 comprises a PO, a msl, a ps, or a pg linkage, wherein when L5 is a ps linkage X5 is A;(j) L6 comprises a msl, a pg, or a ps linkage;(k) X7 comprises a C or a Cam;(l) L7 comprises a msl, a pg, or a PO linkage;(m)X8 comprises a Uom, a U6azadu, a Tmo, an Uuna, a Uf, a Tl, a Tgna, a T12d, or is absent;(n) L8 comprises a PO or a msl linkage, wherein when X8 is U6azadu L8 is a msl linkage, when X8 is Tmo L8 is a msl linkage, when X8 is Tgna L8 is a PO linkage and when X8 is T12d L8 is a msl linkage;(o) X9 comprises an A or an Acar;(p) L9 comprises a msl or a pg linkage, wherein when X9 is Acar L9 is a mslP-634420-PClinkage;(q) X10 comprises a C, a Cmc, a C4me, or a Che;(r) L10 comprises a pg or a msl linkage, wherein when X10 is Cmc L10 is a pg linkage, when X10 is C4me L10 is a pg linkage, and when X10 is Chc L10 is a msl linkage;(s) X11 comprises an Af or an A;(t) L11 comprises a msl, a pg, a PO, or a ps linkage, wherein when X11 is A L11 is pg;(u) L12 comprises a msl, a pg, or a ps linkage;(v) X13 comprises a C or a Cmc;(w)L13 comprises a msl, a pg, a PO, or a ps linkage, wherein when X13 is Cmc L13 is a msl linkage;(x) X14 comprises a Gmo, a Gam, a G, or a Gf;(y) L14 comprises a PO, a msl, a pg, or a ps linkage, wherein when X14 is G L14 is a msl linkage and when X14 is Gf L14 is a msl linkage;(z) X15 comprises an A, an Af, an Aln, an Amo, an Atna, or an Ar; and(aa) L15 comprises a pg, a msl, a PO, or a ps linkage, wherein when X15 is a Atna LI 5 is a PO linkage, when X15 is Ar L15 is a PO linkage, and wherein when L15 is a ps linkage X15 is A.

[0150] In some embodiments of a modified DZyme comprising a modified DZyme Core XXI or a modified DZyme Core XXII, the core nucleotide sequence comprises further modifications wherein (DZyme Core XXIII)(a) L5 comprises a msl, a ps, or a pg linkage, wherein when L5 is a ps linkage X5 is A; (b) L13 comprises a msl, a pg, or a ps linkage, wherein when X13 is Cmc L13 is a msl linkage; and(c) L15 comprises a pg, a msl, a PO, or a ps linkage, wherein when X15 is an A L15 comprises a pg, a msl, or a ps linkage, when X15 is a Atna L15 is a PO linkage, when X15 is Ar L15 is a PO linkage, and wherein when L15 is a ps linkage X15 is A.

[0151] In some embodiments of a modified DZyme comprising a modified selected from any of DZyme Core XXI-DZyme Core XXIII, the core nucleotide sequence comprises further modifications wherein (DZyme Core XXIV) L4 comprises a PO, a pg, or a ps linkage, wherein when X4 is dU L4 is a PO or a pg linkage, when X4 is T L4 is a pg or a ps linkage, and when X4 is Uf L4 is a PO or a pg linkage.

[0152] In some embodiments of a modified DZyme comprising a modified selected from any ofP-634420-PCDZyme Core XXI-DZyme Core XXIV, the core nucleotide sequence comprises further modifications wherein the modified catalytic core comprises the nucleotide sequence: G, LI, X2, L2, X3, L3, X4, L4, A, L5, G, L6, X7, Cam, X8, L8, A, L9, X10, LIO, Af, Lil, A, L12, X13, L13, X14, L14, X15, and LI 5 (DZyme Core XXV), and wherein(a) L1 comprises a msl or a ps linkage;(b) X2 comprises a G or a Gom;(c) L2 comprises a pg, a msl, or a ps linkage;(d) X3 comprises a Ctna or a C;(e) L3 comprises a PO or a msl linkage, wherein when X3 is C L3 is a msl linkage; (f) X4 comprises a U5fu, a dU, or a Uf;(g) L4 comprises a PO, a pg, or a ps linkage, wherein when X4 is dU L4 is a PO or a pg linkage, and when X4 is Uf L4 is a PO or a pg linkage;(h) L5 comprises a msl or a ps linkage;(i) L6 comprises a msl, a pg, or a ps linkage;(j) L7 comprises a msl or a pg linkage;(k) X8 comprises a Uom, a U6azadu, an Uuna, a Uf, a Tl, or is absent;(l) L8 comprises a PO or a msl linkage, wherein when X8 is U6azadu L8 is a msl linkage, when X8 is Uuna L8 is a msl linkage, when X8 is a Tl L8 is a msl linkage, and when X8 is a Uf L8 is a msl linkage;(m)L9 comprises a msl or a pg linkage;(n) X10 comprises a C, a Cmc, a C4me;(o) L10 comprises a pg or a msl linkage, wherein when X10 is Cmc L10 is a pg linkage and when X10 is C4me L10 is a pg linkage;(p) L11 comprises a msl, a pg, a PO, or a ps linkage;(q) L12 comprises a msl, a pg, or a ps linkage;(r) X13 comprises a C or a Cmc;(s) L13 comprises a msl or a ps linkage, wherein when X13 is Cmc L13 is a msl linkage;(t) X14 comprises a Gmo or a Gam;(u) L14 comprises a PO, a msl, a pg, or a ps linkage;(v) X15 comprises an A, an Af, an Aln, an Amo, an Atna, or an Ar; and(w) L15 comprises a pg, a msl, a PO, or a ps linkage, wherein when X15 is a Atna LI 5 is a PO linkage, wherein when X15 is a Ain LI 5 is a PO linkage, when X15 is Ar L15 is a PO linkage, and wherein when L15 is a ps linkage X15 is A.P-634420-PC

[0153] In some embodiments, a modified DZyme comprising a modified catalytic core sequence of DZyme Core XXI comprises nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 658 (dz017375), SEQ ID NO: 657 (dz017374), SEQ ID NO: 666 (dz016336), SEQ ID NO: 650 (dz016388), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 641 (dz017517), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 592 (dz016354), SEQ ID NO: 680 (dz016490), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 691 (dz016393), SEQ ID NO: 640 (dz017607), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 707 (dz015715), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 723 (dz016391), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 731 (dz016495), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 811 (dz017145), and SEQ ID NO: 810 (dz016774), or nucleotides 13-27 of SEQ ID NO: 812 (dz015779) (selected from the DZymes of Figure 10 and Figure 16B). In some embodiments, the modified core sequences set forth in any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 658 (dz017375), SEQ ID NO: 657 (dz017374), SEQ ID NO: 666 (dz016336), SEQ ID NO: 650 (dz016388), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 641 (dz017517), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 592 (dz016354), SEQ ID NO: 680 (dz016490), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671P-634420-PC(dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 691 (dz016393), SEQ ID NO: 640 (dz017607), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 707 (dz015715), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 723 (dz016391), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 731 (dz016495), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 811 (dz017145), SEQ ID NO: 810 (dz016774), and SEQ ID NO: 812 (dz015779) may be flanked by modified or unmodified 5’ and 3’ arms. In some embodiments, a modified DZyme capable of cleaving a UGt / U target site comprises a modified catalytic core set forth in nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 658 (dz017375), SEQ ID NO: 657 (dz017374), SEQ ID NO: 666 (dz016336), SEQ ID NO: 650 (dz016388), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 641 (dz017517), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 592 (dz016354), SEQ ID NO: 680 (dz016490), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 691 (dz016393), SEQ ID NO: 640 (dz017607), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 707P-634420-PC(dz015715), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 723 (dz016391), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 731 (dz016495), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 811 (dz017145), and SEQ ID NO: 810 (dz016774), or nucleotides 13-27 of SEQ ID NO: 812 (dz015779).

[0154] In some embodiments, a modified DZyme comprises SEQ ID NO: 664 (dz017531), SEQ ID NO: 658 (dz017375), SEQ ID NO: 657 (dz017374), SEQ ID NO: 666 (dz016336), SEQ ID NO: 650 (dz016388), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 641 (dz017517), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 592 (dz016354), SEQ ID NO: 680 (dz016490), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 691 (dz016393), SEQ ID NO: 640 (dz017607), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 707 (dz015715), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 723 (dz016391), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 731 (dz016495), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646P-634420-PC(dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), and SEQ ID NO: 645 (dz015717).

[0155] In certain embodiments, methods of targeting the KRAS G12V mutant allele comprises administering a modified DZyme set forth in any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 658 (dz017375), SEQ ID NO: 657 (dz017374), SEQ ID NO: 666 (dz016336), SEQ ID NO: 650 (dz016388), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 641 (dz017517), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 679 (dz016334), SEQ ID NO: 592 (dz016354), SEQ ID NO: 680 (dz016490), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 691 (dz016393), SEQ ID NO: 640 (dz017607), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 707 (dz015715), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 718 (dz016400), SEQ ID NO: 719 (dz015729), SEQ ID NO: 723 (dz016391), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 731 (dz016495), SEQ ID NO: 733 (dz016996), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), and SEQ ID NO: 645 (dz015717).

[0156] SEQ ID NO: 856 (dzO17532)SEQ ID NO: 850 (dzO17971)SEQ ID NO: 880 (dzO16922)SEQ ID NO: 883 (dzO16925)SEQ ID NO: 884 (dzO16924)SEQ ID NO: 886 (dzO16911)SEQ ID NO: 887 (dzO16428)SEQ ID NO: 889 (dzO17527)SEQ ID NO: 894 (dzO16921)SEQ ID NO: 901 (dzO16452)SEQ ID NO: 903 (dzO16918)SEQ ID NO: 905 (dzO16451)SEQ ID NO: 906 (dzO17537)SEQ ID NO: 908 (dzO16429)SEQ ID NO: 910 (dzO16917)SEQ ID NO: 912 (dzO17529)InP-634420-PCsome embodiments, a DZyme comprises the catalytic core present in the DZymes set forth in Figure 15I, for example but not limited to the modified catalytic cores comprising nucleotides 9-23 of the SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), or SEQ ID NO: 926 (dz017973). (Figure 15I positions G1-A15). In certain embodiments, methods of allele specific targeting of HTT rs362307 comprises administering a modified DZyme comprising nucleotides 9-23 of any of SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), and SEQ ID NO: 926 (dz017973),, flanked 5’ and 3’ by modified or unmodified arms. In certain embodiments, methods of allele specific targeting of HTT rs362307 comprises administering a modified DZyme comprising nucleotides 9-23 of SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), or SEQ ID NO: 926 (dz017973), flanked 5’ and 3’ by modified arms, wherein the nucleotide sequence of the modified arms is based on the sequences at positions C-8 to A-l and A+l to C+8 of SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), or SEQ ID NO: 926 (dz017973). In certain embodiments, methods of allele specific targeting of HTT rs362307 comprises administering the modified DZyme set forth in any of SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), SEQ ID NO: 926 (dz017973).

[0157] In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: SEQ ID NO: 807 (dz017417). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 923 (dz016893). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-P-634420-PC23 of SEQ ID NO: 920 (dz017415). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 921 (dz017414). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 806 (dz016259). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 922 (dz016891). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 803 (dz017416). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 804 (dz016266). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 801 (dz016261). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 924 (dz016892). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 925 (dz017974). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises a modified catalytic core comprising nucleotides 9-23 of SEQ ID NO: 926 (dz017973).

[0158] In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 807 (dz017417). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 923 (dz016893). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 920 (dz017415). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 921 (dz017414). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 806 (dz016259). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 922 (dz016891). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 803 (dz017416). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 804 (dz016266). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 801 (dz016261). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 924 (dz016892). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 925 (dz017974). In some embodiments, a modified DZyme targeting the HTT rs362307 comprises SEQ ID NO: 926 (dz017973).

[0159] In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 664 (dz017531SEQ ID NO: 664 (dz017531SEQ IDP-634420-PCNO: 664 (dz017531). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 658 (dz017375). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 657 (dz017374). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 666 (dz016336). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 650 (dz016388). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 668 (dz016361). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 669 (dz016340). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 641 (dz017517). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 630 (dz017518). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 656 (dz016499). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 679 (dz016334). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 592 (dz016354). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 680 (dz016490). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 670 (dz016387). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 682 (dz016360). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 593 (dz016355). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 659 (dz017376). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 684 (dz016389). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 671 (dz016357). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 672 (dz016359). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 655 (dz015702). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 687 (dz016358). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 688 (dz016385). In certain embodiments, a modified DZyme targeting the KRAS G12V mutantP-634420-PCallele comprises nucleotides 10-24 of SEQ ID NO: 689 (dz016399). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 631 (dz016338). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 638 (dz017519). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 691 (dz016393). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 640 (dz017607). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 651 (dz017528). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 695 (dz016492). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 696 (dz016392). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 649 (dz017526). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 639 (dz015710). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO:698 (dz016489). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 700 (dz016493). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 701 (dz016494). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 704 (dz016394). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 705 (dz016398). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 629 (dz017608). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 707 (dz015715). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 709 (dz017536). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 637 (dz017609). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 710 (dz016491). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 711 (dz016386). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 588 (dz016352). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 715 (dz016401). In certain embodiments, aP-634420-PCmodified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 718 (dz016400). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 719 (dz015729). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 723 (dz016391). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 724 (dz016335). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 726 (dz016390). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO:727 (dz016488). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 728 (dz016395). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 729 (dz016341). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 660 (dz017280). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 731 (dz016495). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 733 (dz016996). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 635 (dz016337). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 736 (dz015700). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 738 (dz015730). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO:740 (dz015703). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 634 (dz017520). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 742 (dz016339). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 756 (dz015701). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 646 (dz015731). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 633 (dz017610). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 644 (dz015716). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 642 (dz015711). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ IDP-634420-PCNO: 647 (dz015732). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 643 (dz015712). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 645 (dz015717). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 845 (dz017970). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 850 (dz017971). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 851 (dz016910). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 852 (dz016906). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 853 (dz016907). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 854 (dz016426). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 855 (dz016415). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 856 (dz017532). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 857 (dz016913). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 858 (dz016417). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 859 (dz016425). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 860 (dz016427). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 861 (dz016909). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 862 (dz016915). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 863 (dz016914). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 864 (dz016908). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 865 (dz016416). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 866 (dz016413). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 867 (dz016412). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 868 (dz016912). In certain embodiments, a modified DZyme targeting the KRAS G12V mutantP-634420-PCallele comprises nucleotides 10-24 of SEQ ID NO: 869 (dz016919). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 870 (dz016411). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 871 (dz016920). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 872 (dz016418). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 873 (dz016446). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 874 (dz016916). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 875 (dz016414). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 876 (dz016444). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 877 (dz016419). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 878 (dz016432). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 879 (dz016430). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 880 (dz016922). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 881 (dz016926). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 882 (dz016410). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 883 (dz016925). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 884 (dz016924). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 885 (dz016442). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 886 (dz016911). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 887 (dz016428). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 888 (dz016445). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 889 (dz017527). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 890 (dz016447). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 891 (dz016436). In certain embodiments, aP-634420-PCmodified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 892 (dz016434). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 893 (dz016450). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 894 (dz016921). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 895 (dz016923). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 896 (dz016443). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 897 (dz016409). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 898 (dz016440). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 899 (dz016441). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 900 (dz016431). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 901 (dz016452). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 902 (dz016448). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 903 (dz016918). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 904 (dz016420). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 905 (dz016451). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 906 (dz017537). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 907 (dz016449). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 908 (dz016429). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 909 (dz016439). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 910 (dz016917). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 911 (dz016433). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 912 (dz017529). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 913 (dz016437). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ IDP-634420-PCNO: 914 (dz016421). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 915 (dz016422). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 916 (dz001619). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 917 (dz016423). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 918 (dz016453). In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises nucleotides 10-24 of SEQ ID NO: 919 (dz016424).

[0160] In certain embodiments, a modified DZyme targeting the KRAS G12V mutant allele comprises any of the DZymes set forth in the table of Figure 10.

[0161] In some embodiments of a modified DZyme comprising a modified DZyme Core XXI, the modified catalytic core comprises the nucleotide sequence: G, LI, X2, L2, X3, L3, X4, L4, A, L5, G, L6, X7, L7, X8, L8, A, L9, X10, L10, Af, LI 1, A, L12, X13, L13, X14, L14, X15, and L15 (DZyme Core XXVI), wherein(a) L1 comprises a msl or a ps linkage;(b) X2 comprises a G or a Gom;(c) L2 comprises a msl, a pg, or a ps linkage;(d) X3 comprises a Ctna or a C;(e) L3 comprises a PO or a msl linkage, wherein when X3 is C L3 is a msl linkage; (f) X4 comprises a U5fu, a dU, a Uf, or an Uam;(g) L4 comprises a PO, a pg, or a ps linkage, wherein when X4 is Uam L4 is a msl linkage;(h) L5 comprises a msl or a ps linkage;(i) L6 comprises a msl, a pg, a ps linkage;(j) X7 comprises a Cam or a C;(k) L7 comprises a msl or a pg linkage, wherein when X7 is C L7 is a msl linkage; (l) X8 comprises a Uom, a U6azadu, an Uuna, an Uf, a Tl, or is absent;(m) L8 comprises a msl or a PO linkage, wherein when X8 is an Uuna L8 is a msl linkage, when X8 is an Uf L8 is a msl linkage, when X8 is Tl L8 is a msl linkage, and when X8 is a U6azadu L8 is a msl linkage;(n) L9 comprises a msl or a pg linkage;(o) X10 comprises a C, a Cmc, or a C4me;(p) L10 comprises a pg or a msl linkage, wherein when X10 is Cmc L10 is a pg linkage and when X10 is C4me L10 is a pg linkage;P-634420-PC(q) L11 comprises a msl, a pg, a PO, or a ps linkage;(r) L12 comprises a msl, a pg, or a ps linkage;(s) X13 comprises a C or a Cmc;(t) LI 3 comprises a msl or a ps linkage, wherein when X13 is Cmc LI 3 is a msl linkage;(u) X14 comprises a Gam, a Gmo, or a G;(v) L14 comprises a msl, a pg, a PO, or a ps linkage, wherein when X14 is G L14 is a msl linkage;(w)X15 comprises an Af, an A, an Atna, an Amo, an Ain, or an Ar; and(x) L15 comprises a pg, a msl, a PO, or a ps linkage, wherein when X15 is Amo LI 5 is a msl or pg linkage, when X15 is a Atna LI 5 is a PO linkage, when X15 is Ar LI 5 is a PO linkage, and when X15 is Al L15 is a PO linkage.

[0162] In certain embodiments, a modified DZyme comprises in 5’ to 3’ order: (i) a first substratebinding arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a catalytic core comprising the nucleotide sequence of DZyme Core XXVI; and (iii) a second substrate-binding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5' to the first region of the RNA transcript.

[0163] In some embodiments, a modified DZyme comprising a modified catalytic core of DZyme Core XXVI comprises nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 691 (dz016393), SEQ ID NO: 670 (dz016387), SEQ ID NO: 723 (dz016391), SEQ ID NO: 704 (dz016394), SEQ ID NO: 657 (dz017374), SEQ ID NO: 696 (dz016392), SEQ ID NO: 658 (dz017375), SEQ ID NO: 688 (dz016385), SEQ ID NO: 726 (dz016390), SEQ ID NO: 650 (dz016388), SEQ ID NO: 689 (dz016399), SEQ ID NO: 684 (dz016389), SEQ ID NO: 733 (dz016996), SEQ ID NO: 672 (dz016359), SEQ ID NO: 659 (dz017376), SEQ ID NO: 638 (dz017519), SEQ ID NO: 705 (dz016398), SEQ ID NO: 711 (dz016386), SEQ ID NO: 666 (dz016336), SEQ ID NO: 671 (dz016357), SEQ ID NO: 679 (dz016334), SEQ ID NO: 669 (dz016340), SEQ ID NO: 630 (dz017518), SEQ ID NO: 728 (dz016395), SEQ ID NO: 718 (dz016400), SEQ ID NO: 687 (dz016358), SEQ ID NO: 655 (dz015702), SEQ ID NO: 701 (dz016494), SEQ ID NO: 715 (dz016401), SEQ ID NO: 680 (dz016490), SEQ ID NO:698 (dz016489), SEQ ID NO: 656 (dz016499), SEQ ID NO: 639 (dz015710), SEQ ID NO: 700 (dz016493), SEQ ID NO: 631 (dz016338), SEQ ID NO: 682 (dz016360), SEQ ID NO: 668 (dz016361), SEQ ID NO: 710 (dz016491), SEQ ID NO: 695 (dz016492), SEQ ID NO: 664 (dz017531), SEQ ID NO: 637 (dz017609), SEQ ID NO: 731 (dz016495), SEQ ID NO: 629 (dz017608), SEQ ID NO: 651 (dz017528), SEQ ID NO:740 (dz015703), SEQ ID NO: 641 (dz017517), SEQ ID NO: 707P-634420-PC(dz015715), SEQ ID NO: 719 (dz015729), SEQ ID NO:727 (dz016488), SEQ ID NO: 592 (dz016354), SEQ ID NO: 640 (dz017607), SEQ ID NO: 738 (dz015730), SEQ ID NO: 593 (dz016355), SEQ ID NO: 729 (dz016341), SEQ ID NO: 643 (dz015712), SEQ ID NO: 724 (dz016335), SEQ ID NO: 588 (dz016352), SEQ ID NO: 660 (dz017280), SEQ ID NO: 742 (dz016339), SEQ ID NO: 634 (dz017520), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 633 (dz017610), SEQ ID NO: 702 (dz015697), SEQ ID NO: 550 (dz012797), SEQ ID NO: 647 (dz015732), SEQ ID NO: 756 (dz015701), SEQ ID NO: 645 (dz015717), SEQ ID NO: 642 (dz015711), SEQ ID NO: 644 (dz015716), SEQ ID NO: 646 (dz015731), SEQ ID NO: 649 (dz017526), and SEQ ID NO: 709 (dz017536). (derived from Figure 11). In some embodiments the modified core sequences set forth in any of SEQ ID NO: 691 (dz016393), SEQ ID NO: 670 (dz016387), SEQ ID NO: 723 (dz016391), SEQ ID NO: 704 (dz016394), SEQ ID NO: 657 (dz017374), SEQ ID NO: 696 (dz016392), SEQ ID NO: 658 (dz017375), SEQ ID NO: 688 (dz016385), SEQ ID NO: 726 (dz016390), SEQ ID NO: 650 (dz016388), SEQ ID NO: 689 (dz016399), SEQ ID NO: 684 (dz016389), SEQ ID NO: 733 (dz016996), SEQ ID NO: 672 (dz016359), SEQ ID NO: 659 (dz017376), SEQ ID NO: 638 (dz017519), SEQ ID NO: 705 (dz016398), SEQ ID NO: 711 (dz016386), SEQ ID NO: 666 (dz016336), SEQ ID NO: 671 (dz016357), SEQ ID NO: 679 (dz016334), SEQ ID NO: 669 (dz016340), SEQ ID NO: 630 (dz017518), SEQ ID NO: 728 (dz016395), SEQ ID NO: 718 (dz016400), SEQ ID NO: 687 (dz016358), SEQ ID NO: 655 (dz015702), SEQ ID NO: 701 (dz016494), SEQ ID NO: 715 (dz016401), SEQ ID NO: 680 (dz016490), SEQ ID NO:698 (dz016489), SEQ ID NO: 656 (dz016499), SEQ ID NO: 639 (dz015710), SEQ ID NO: 700 (dz016493), SEQ ID NO: 631 (dz016338), SEQ ID NO: 682 (dz016360), SEQ ID NO: 668 (dz016361), SEQ ID NO: 710 (dz016491), SEQ ID NO: 695 (dz016492), SEQ ID NO: 664 (dz017531), SEQ ID NO: 637 (dz017609), SEQ ID NO: 731 (dz016495), SEQ ID NO: 629 (dz017608), SEQ ID NO: 651 (dz017528), SEQ ID NO:740 (dz015703), SEQ ID NO: 641 (dz017517), SEQ ID NO: 707 (dz015715), SEQ ID NO: 719 (dz015729), SEQ ID NO:727 (dz016488), SEQ ID NO: 592 (dz016354), SEQ ID NO: 640 (dz017607), SEQ ID NO: 738 (dz015730), SEQ ID NO: 593 (dz016355), SEQ ID NO: 729 (dz016341), SEQ ID NO: 643 (dz015712), SEQ ID NO: 724 (dz016335), SEQ ID NO: 588 (dz016352), SEQ ID NO: 660 (dz017280), SEQ ID NO: 742 (dz016339), SEQ ID NO: 634 (dz017520), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 633 (dz017610), SEQ ID NO: 702 (dz015697), SEQ ID NO: 550 (dz012797), SEQ ID NO: 647 (dz015732), SEQ ID NO: 756 (dz015701), SEQ ID NO: 645 (dz015717), SEQ ID NO: 642 (dz015711), SEQ ID NO: 644 (dz015716), SEQ ID NO: 646 (dz015731), SEQ ID NO: 649 (dz017526), and SEQ ID NO: 709P-634420-PC(dz017536) may be flanked by modified or unmodified 5’ and 3’ substrate-binding arms. In some embodiments, a modified DZyme capable of cleaving a UAU target site comprises any of the modified catalytic cores set forth in nucleotides 10-24 (positions G1-A15) of SEQ ID NO: 691 (dz016393), SEQ ID NO: 670 (dz016387), SEQ ID NO: 723 (dz016391), SEQ ID NO: 704 (dz016394), SEQ ID NO: 657 (dz017374), SEQ ID NO: 696 (dz016392), SEQ ID NO: 658 (dz017375), SEQ ID NO: 688 (dz016385), SEQ ID NO: 726 (dz016390), SEQ ID NO: 650 (dz016388), SEQ ID NO: 689 (dz016399), SEQ ID NO: 684 (dz016389), SEQ ID NO: 733 (dz016996), SEQ ID NO: 672 (dz016359), SEQ ID NO: 659 (dz017376), SEQ ID NO: 638 (dz017519), SEQ ID NO: 705 (dz016398), SEQ ID NO: 711 (dz016386), SEQ ID NO: 666 (dz016336), SEQ ID NO: 671 (dz016357), SEQ ID NO: 679 (dz016334), SEQ ID NO: 669 (dz016340), SEQ ID NO: 630 (dz017518), SEQ ID NO: 728 (dz016395), SEQ ID NO: 718 (dz016400), SEQ ID NO: 687 (dz016358), SEQ ID NO: 655 (dz015702), SEQ ID NO: 701 (dz016494), SEQ ID NO: 715 (dz016401), SEQ ID NO: 680 (dz016490), SEQ ID NO:698 (dz016489), SEQ ID NO: 656 (dz016499), SEQ ID NO: 639 (dz015710), SEQ ID NO: 700 (dz016493), SEQ ID NO: 631 (dz016338), SEQ ID NO: 682 (dz016360), SEQ ID NO: 668 (dz016361), SEQ ID NO: 710 (dz016491), SEQ ID NO: 695 (dz016492), SEQ ID NO: 664 (dz017531), SEQ ID NO: 637 (dz017609), SEQ ID NO: 731 (dz016495), SEQ ID NO: 629 (dz017608), SEQ ID NO: 651 (dz017528), SEQ ID NO:740 (dz015703), SEQ ID NO: 641 (dz017517), SEQ ID NO: 707 (dz015715), SEQ ID NO: 719 (dz015729), SEQ ID NO:727 (dz016488), SEQ ID NO: 592 (dz016354), SEQ ID NO: 640 (dz017607), SEQ ID NO: 738 (dz015730), SEQ ID NO: 593 (dz016355), SEQ ID NO: 729 (dz016341), SEQ ID NO: 643 (dz015712), SEQ ID NO: 724 (dz016335), SEQ ID NO: 588 (dz016352), SEQ ID NO: 660 (dz017280), SEQ ID NO: 742 (dz016339), SEQ ID NO: 634 (dz017520), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 633 (dz017610), SEQ ID NO: 702 (dz015697), SEQ ID NO: 550 (dz012797), SEQ ID NO: 647 (dz015732), SEQ ID NO: 756 (dz015701), SEQ ID NO: 645 (dz015717), SEQ ID NO: 642 (dz015711), SEQ ID NO: 644 (dz015716), SEQ ID NO: 646 (dz015731), SEQ ID NO: 649 (dz017526), and SEQ ID NO: 709 (dz017536).

[0164] In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of dz014654 - SEQ ID NO: 759. In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 691 (dz016393).. In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 670 (dz016387). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 723 (dz016391).P-634420-PCIn some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 704 (dz016394). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 657 (dz017374). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 696 (dz016392). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 658 (dz017375). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 688 (dz016385). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 726 (dz016390). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 650 (dz016388). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 689 (dz016399). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 684 (dz016389). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 733 (dz016996). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 672 (dz016359). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 659 (dz017376). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 638 (dz017519). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 705 (dz016398). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 711 (dz016386). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 666 (dz016336). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 671 (dz016357). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 679 (dz016334). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 669 (dz016340). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 630 (dz017518). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 728 (dz016395). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 718 (dz016400). In some embodiments, a modified DZyme comprises a modified catalytic core comprisingP-634420-PCnucleotides 10-24 of SEQ ID NO: 687 (dz016358). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 655 (dz015702). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 701 (dz016494). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 715 (dz016401). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 680 (dz016490). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO:698 (dz016489). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 656 (dz016499). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 639 (dz015710). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 700 (dz016493). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 631 (dz016338). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 682 (dz016360). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 668 (dz016361). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 710 (dz016491). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 695 (dz016492). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 664 (dz017531SEQ ID NO: 664 (dz017531SEQ ID NO: 664 (dz017531). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 637 (dz017609). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 731 (dz016495). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 629 (dz017608). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 651 (dz017528). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO:740 (dz015703). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 641 (dz017517). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 707 (dz015715). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 719P-634420-PC(dz015729). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO:727 (dz016488). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 592 (dz016354). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 640 (dz017607). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 738 (dz015730). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 593 (dz016355). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 729 (dz016341). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 643 (dz015712). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 724 (dz016335). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 588 (dz016352). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 660 (dz017280). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 742 (dz016339). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 634 (dz017520). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 635 (dz016337). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 736 (dz015700). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 633 (dz017610). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 702 (dz015697). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 550 (dz012797). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 647 (dz015732). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 756 (dz015701). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 645 (dz015717). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 642 (dz015711). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 644 (dz015716). In some embodiments, a modified DZyme comprises a modified catalytic coreP-634420-PCcomprising nucleotides 10-24 of SEQ ID NO: 646 (dz015731). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 649 (dz017526). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 709 (dz017536). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 811 (dz017145). In some embodiments, a modified DZyme comprises a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 810 (dz016774). In some embodiments, a modified DZyme comprises a modified catalytic core comprising or nucleotides 13-27 of SEQ ID NO: 812 (dz015779).

[0165] In some embodiments of a modified DZyme, the catalytic core comprises a combination of modifications, wherein for each nucleotide the base, sugar, and or PO linkage may be modified. In certain embodiments of a modified DZyme targeting an RNA transcript, said modified DZyme comprises in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1 represented as follows XI, LI, X2, L2, X3, L3, X4, L4, X5, L5, G, L6, X7, L7, X8, L8, X9, L9, X10, L10, Xll, Lil, A, L12, X13, L13, X14, L14, X15, and L15, wherein X represents a nucleoside with or without a modified sugar moiety or a modified base or both, and L represents a phosphodiester (PO) linkage or modified linkage between nucleosides (DZyme Core XXVII);(a) X1 comprises a G or a threose nucleic acid modified G (Gtna);(b) L1 comprises a busyl phosphoramidate (bsl), a PO, a mesyl phosphoramidate (msl), a phosphoryl guanidine (pg), a phosphorothioate (ps), or an ethoxy phosphonate (eop) linkage, wherein when X1 is Gtna L1 is PO;(c) X2 comprises a G, a 2'-O-methyl modified G (Gom) or a 8-aza-7- deazaguanosine modified G (Gsg);(d) L2 comprises a pg, a bsl, a PO, a msl, a ps, or an eop linkage, wherein when X2 is a Gsg then L2 is a msl linkage;(e) X3 comprises a cytosine nucleoside (C) or a threose nucleic acid modified C (Ctna);(f) L3 comprises a PO, a pg, a bsl, a msl, or a ps linkage, wherein when X3 is a Ctna L3 is a PO, a msl, or a pg linkage;(g) X4 comprises a 5-fluoro-2'-deoxyuridine (U5fd), a thymine nucleoside (T), aP-634420-PCdeoxyuridine (Ud), 2'-fluoro modified U (Uf), or a 2'-NH2 modified U (Uam); (h) L4 comprises a PO, a pg, a msl or a ps linkage;(i) X5 comprises an adenine nucleoside (A) or a 4'-methyl-2'-deoxyribose A (A4me);(j) L5 comprises a PO, a msl, a bsl, a ps, or a pg linkage, wherein when X5 is A4me L5 is a PO, a msl, or a pg linkage;(k) L6 comprises a pg, a PO, a msl, a ps, or an eop linkage;(l) X7 comprises a C, a 2'-NH2 modified C (Cam), or a 2'-O-methyl (Com); (m)L7 comprises a pg, a bsl, a msl, an eop, a ps, or a PO linkage, wherein when L7 is an eop or a ps linkage X7 is C and wherein X7 is Com L7 is a PO linkage; (n) X8 comprises a 2'-O-methyl Uridine (Uom), a 6-aza-2'-deoxyuridine (U6azad, a 2'-O-methoxyethyl T (Tmo), an unlocked U (Uuna), a 2'-fluoro U (Uf), L- DNA (Tl), a glycol nucleic acid (Tgna), a l',2'-dideoxyribose (T12d) or a T, or is absent;(o) L8 comprises a PO, a bsl, a msl, a pg, a eop, or a ps linkage;(p) X9 comprises an A, a 7-deaza-8-aza-2’-deoxyadenosine (A78), a threose nucleic acid modified A (Atna) or a 2'-Ome-arabinose A (Acar);(q) L9 comprises a pg, a PO, a msl, a bsl, or an eop linkage, wherein when X9 is Acar L9 is a msl linkage, when X9 is A78 L9 is a pg linkage, and when X9 is Atna L9 is a PO linkage;(r) X10 comprises a C, a 5 -methylcytosine C (Cmc), a 4'-methyl-2'-deoxyribose C (C4me), or a 5-hydroxymethlcytosine (Che);(s) L10 comprises a pg, a msl, a PO, a ps, an eop, or a bsl linkage, wherein when X10 is Cmc L10 is a pg linkage, when X10 is C4me L10 is a pg linkage, and when X10 is Che L10 is a msl linkage;(t) X11 comprises a 2'-fluoro A (Af), an A, or a 2'-O-methyl A (Aom);(u) L11 comprises a msl, a pg, a PO, a ps, an eop, or a bsl linkage, wherein when X11 is an Aom L11 is a PO linkage;(v) L12 comprises a pg, a PO, a msl, a bsl, a ps, or an eop linkage;(w)X13 comprises a C or a Cmc;(x) L13 comprises a bsl, a PO, a msl, a ps, a pg, or an eop linkage, wherein when X13 is Cmc L13 is a msl linkage;(y) X14 comprises a 2'-methoxyethyl G (Gmo), a 6-Thio-deoxyguanosine (G6td), a 2’-O-methyl G (Gom), a 2'-NH2 G(Gam), a G, or a 2'-Fluoro G (Gf);P-634420-PC(z) L14 comprises a PO, a msl, a pg, a ps, or an eop linkage, wherein when L14 is an eop linkage X14 is G;(aa) X15 comprises an A, an Af, a lock nucleic acid A (Aln), a 2'-O- methoxyethyl A (Amo), an Atna, a RNA (2’ -OH) A (Ar), or an Aom; and (bb) L15 comprises a pg, a bsl, a msl, a PO, a ps, or an eop linkage, wherein when X15 is Amo LI 5 is a msl or pg linkage, when X15 is a Atna LI 5 is a PO linkage, when X15 is an Aom LI 5 is a PO linkage, when X15 is Ar L15 is a PO linkage, when L15 is an ps linkage X15 is A, and when L15 is an eop linkage X15 is A; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0166] In some embodiments, a modified DZyme comprising a modified catalytic core sequence (DZyme Core XXVII) comprises core sequences selected from Tables 10 and 11. In some embodiments, a modified DZyme comprising a modified catalytic core (DZyme Core XXVII) comprises nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 851 (dz016910), SEQ ID NO: 852 (dz016906), SEQ ID NO: 584 (dz016348), SEQ ID NO: 853 (dz016907), SEQ ID NO: 591 (dz016353), SEQ ID NO: 582 (dz016347), SEQ ID NO: 854 (dz016426), SEQ ID NO: 664 (dz017531), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 920 (dz017415), SEQ ID NO: 856 (dz017532), SEQ ID NO: 580 (dz016346), SEQ ID NO: 845 (dz017970), SEQ ID NO: 605 (dz017220), SEQ ID NO: 857 (dz016913), SEQ ID NO: 858 (dz016417), SEQ ID NO: 599 (dz017214), SEQ ID NO: 658 (dz017375), SEQ ID NO: 604 (dz017219), SEQ ID NO: 859 (dz016425), SEQ ID NO: 860 (dz016427), SEQ ID NO: 861 (dz016909), SEQ ID NO: 587 (dz016351), SEQ ID NO: 597 (dz017212), SEQ ID NO:603 (dz017218), SEQ ID NO: 862 (dz016915), SEQ ID NO: 610 (dz017225), SEQ ID NO: 747 (dz013914), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 607 (dz017222), SEQ ID NO: 864 (dz016908), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 865 (dz016416), SEQ ID NO: 866 (dz016413), SEQ ID NO: 653 (dz015432), SEQ ID NO: 585 (dz016349), SEQ ID NO: 867 (dz016412), SEQ ID NO: 581 (dz016344), SEQ ID NO: 868 (dz016912), SEQ ID NO: 586 (dz016350), SEQ ID NO: 494 (dz017255), SEQ ID NO: 869 (dz016919), SEQ ID NO: 870 (dz016411), SEQ ID NO: 871 (dz016920), SEQ ID NO: 872 (dz016418), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 873 (dz016446), SEQ ID NO: 874 (dz016916), SEQ ID NO: 875 (dz016414), SEQ ID NO: 673 (dz017181), SEQ ID NO: 850 (dz017971), SEQ ID NO: 650 (dz016388), SEQ ID NO: 495 (dz017256), SEQ ID NO: 674P-634420-PC(dzO16365), SEQ ID NO: 627 (dz016331), SEQ ID NO: 608 (dz017223), SEQ ID NO 675 (dz016362), SEQ ID NO: 876 (dzO 16444), SEQ ID NO: 676 (dz016364), SEQ ID NO 677 (dz016498), SEQ ID NO: 677 (dz016498), SEQ ID NO: 877 (dz016419), SEQ ID NO 878 (dz016432), SEQ ID NO: 468 (dz012831), SEQ ID NO: 879 (dzO 16430), SEQ ID NO 880 (dz016922), SEQ ID NO: 667 (dz017533), SEQ ID NO: 590 (dz015727), SEQ ID NO 491 (dz017252), SEQ ID NO: 881 (dzO 16926), SEQ ID NO: 589 (dzO 15724), SEQ ID NO 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 883 (dz016925), SEQ ID NO 882 (dz016410), SEQ ID NO: 467 (dz012830), SEQ ID NO: 884 (dz016924), SEQ ID NO 652 (dz015431), SEQ ID NO: 620 (dz014626), SEQ ID NO: 641 (dz017517), SEQ ID NO 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 469 (dz012832), SEQ ID NO 583 (dzO16496), SEQ ID NO: 656 (dz016499), SEQ ID NO: 496 (dz017257), SEQ ID NO 625 (dz016330), SEQ ID NO: 578 (dz016345), SEQ ID NO: 492 (dz017253), SEQ ID NO 490 (dz017251), SEQ ID NO: 885 (dz016442), SEQ ID NO: 573 (dz015726), SEQ ID NO 886 (dz016911), SEQ ID NO: 528 (dz015429), SEQ ID NO:654 (dz016497), SEQ ID NO 548 (dz015430), SEQ ID NO 887 (dz016428), SEQ ID NO 681 (dz016366), SEQ ID NO 888 (dz016445), SEQ ID NO 889 (dz017527), SEQ ID NO 632 (dz016329), SEQ ID NO 497 (dz017258), SEQ ID NO 683 (dz017538), SEQ ID NO 890 (dzO 16447), SEQ ID NO 891 (dz016436), SEQ ID NO 892 (dz016434), SEQ ID NO 628 (dz016332), SEQ ID NO 609 (dz017224), SEQ ID NO 893 (dzO 16450), SEQ ID NO 894 (dzO 16921), SEQ ID NO 498 (dz017259), SEQ ID NO 470 (dz012833), SEQ ID NO 505 (dz017265), SEQ ID NO 685 (dz015706), SEQ ID NO 895 (dz016923), SEQ ID NO 896 (dz016443), SEQ ID NO 686 (dz017535), SEQ ID NO 462 (dz012825), SEQ ID NO 897 (dzO 16409), SEQ ID NO 501 (dz017262), SEQ ID NO 507 (dz017267), SEQ ID NO 602 (dz017217), SEQ ID NO 508 (dz017268), SEQ ID NO 898 (dzO 16440), SEQ ID NO 899 (dzO 16441), SEQ ID NO 900 (dz016431), SEQ ID NO 465 (dz012828), SEQ ID NO 546 (dz013895), SEQ ID NO 901 (dz016452), SEQ ID NO 623 (dz014627), SEQ ID NO 616 (dz014625), SEQ ID NO 902 (dz016448), SEQ ID NO 690 (dz017539), SEQ ID NO 679 (dz016334), SEQ ID NO 592 (dz016354), SEQ ID NO 680 (dzO 16490), SEQ ID NO 670 (dz016387), SEQ ID NO 682 (dz016360), SEQ ID NO 593 (dz016355), SEQ ID NO 659 (dz017376), SEQ ID NO 684 (dz016389), SEQ ID NO 671 (dz016357), SEQ ID NO 672 (dz016359), SEQ ID NO 655 (dz015702), SEQ ID NO 687 (dz016358), SEQ ID NO 688 (dz016385), SEQ ID NO 689 (dz016399), SEQ ID NO 631 (dz016338), SEQ ID NO 638 (dz017519), SEQ ID NO 648 (dz017525), SEQ ID NO 499 (dz017260), SEQ ID NO 804 (dzO 16266), SEQ ID NO 574 (dz014640), SEQ ID NO 903 (dz016918), SEQ ID NO 801 (dzO 16261), SEQ ID NO 464P-634420-PC(dz012827), SEQ ID NO: 904 (dz016420), SEQ ID NO: 796 (dz013834), SEQ ID NO: 691 (dz016393), SEQ ID NO: 466 (dz012829), SEQ ID NO: 694 (dz016363), SEQ ID NO: 905 (dz016451), SEQ ID NO: 692 (dz014981), SEQ ID NO: 579 (dz016356), SEQ ID NO: 459 (dz016408), SEQ ID NO: 906 (dz017537), SEQ ID NO: 693 (dz015925), SEQ ID NO: 493 (dz017254), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 572 (dz014638), SEQ ID NO: 661 (dz014634), SEQ ID NO: 615 (dz014632), SEQ ID NO: 472 (dz012835), SEQ ID NO: 651 (dz017528), SEQ ID NO: 575 (dz014641), SEQ ID NO: 473 (dz012836), SEQ ID NO: 695 (dz016492), SEQ ID NO: 478 (dz012841), SEQ ID NO: 461 (dz012824), SEQ ID NO: 696 (dz016392), SEQ ID NO: 907 (dz016449), SEQ ID NO: 649 (dz017526), SEQ ID NO: 480 (dz012843), SEQ ID NO: 908 (dz016429), SEQ ID NO: 547 (dz013896), SEQ ID NO: 576 (dz014642), SEQ ID NO: 559 (dz013899), SEQ ID NO: 463 (dz012826), SEQ ID NO: 460 (dz012823), SEQ ID NO: 70 (dz013911), SEQ ID NO: 909 (dz016439), SEQ ID NO: 477 (dz012840), SEQ ID NO: 910 (dz016917), SEQ ID NO: 662 (dz014635), SEQ ID NO:697 (dz014984), SEQ ID NO: 618 (dz014633), SEQ ID NO: 571 (dz014639), SEQ ID NO: 911 (dz016433), SEQ ID NO: 699 (dz015714), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 569 (dz013910), SEQ ID NO: 476 (dz012839), SEQ ID NO: 701 (dz016494), SEQ ID NO: 526 (dz012805), SEQ ID NO: 912 (dz017529), SEQ ID NO: 509 (dz017269), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO:703 (dz016333), SEQ ID NO: 479 (dz012842), SEQ ID NO: 913 (dz016437), SEQ ID NO: 482 (dz012845), SEQ ID NO: 629 (dz017608), SEQ ID NO: 504 (dz017264), SEQ ID NO: 706 (dz014978), SEQ ID NO: 707 (dz015715), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 564 (dz013905), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 619 (dz014631), SEQ ID NO: 914 (dz016421), SEQ ID NO: 566 (dz013907), SEQ ID NO: 545 (dz013894), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 522 (dz014649), SEQ ID NO: 565 (dz013906), SEQ ID NO: 481 (dz012844), SEQ ID NO: 712 (dz014979), SEQ ID NO: 511 (dz017271), SEQ ID NO: 713 (dz015926), SEQ ID NO: 475 (dz012838), SEQ ID NO: 714 (dz015927), SEQ ID NO: 614 (dz012867) SEQ ID NO: 718 (dz016400), SEQ ID NO: 716 (dz014972), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 483 (dz012846), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 719 (dz015729), SEQ ID NO: 663 (dz014636), SEQ ID NO: 563 (dz013903), SEQ ID NO: 720 (dz014982), SEQ ID NO: 621 (dz015705), SEQ ID NO: 721P-634420-PC(dz014974), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 510 (dz017270), SEQ ID NO: 558 (dz013904), SEQ ID NO: 523 (dz010725), SEQ ID NO: 723 (dz016391), SEQ ID NO:561 (dz013901), SEQ ID NO: 724 (dz016335), SEQ ID NO: 474 (dz012837), SEQ ID NO:453 (dz000182), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 524 (dz010726), SEQ ID NO: 533 (dz012811), SEQ ID NO: 915 (dz016422), SEQ ID NO: 728 (dz016395), SEQ ID NO: 595 (dz014645), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 530 (dz012808), SEQ ID NO:730 (dz014987), SEQ ID NO: 519 (dz010722), SEQ ID NO: 731 (dz016495), SEQ ID NO: 520 (dz010723), SEQ ID NO: 534 (dz012813), SEQ ID NO: 521 (dz010724), SEQ ID NO: 732 (dz013916), SEQ ID NO: 534 (dz012812), SEQ ID NO: 484 (dz012847), SEQ ID NO: 613 (dz012866), SEQ ID NO: 733 (dz016996), SEQ ID NO: 916 (dz001619), SEQ ID NO: 531 (dz012809), SEQ ID NO: 734 (dz013913), SEQ ID NO: 702 (dz015697), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 735 (dz014989), SEQ ID NO: 512 (dz017272), SEQ ID NO: 737 (dz013915), SEQ ID NO: 739 (dz014655), SEQ ID NO: 741 (dz014976), SEQ ID NO: 543 (dz012795), SEQ ID NO: 743 (dz014975), SEQ ID NO: 537 (dz012815), SEQ ID NO: 485 (dz012848), SEQ ID NO: 744 (dz014971), SEQ ID NO: 532 (dz012810), SEQ ID NO: 745 (dz013917), SEQ ID NO: 525 (dz012804), SEQ ID NO: 746 (dz014653), SEQ ID NO: 747 (dz013914), SEQ ID NO: 486 (dz012849), SEQ ID NO: 748 (dz013918), SEQ ID NO:749 (dz013919), SEQ ID NO: 518 (dz010727), SEQ ID NO: 567 (dz013908), SEQ ID NO: 750 (dz014652), SEQ ID NO: 751 (dz015713), SEQ ID NO: 752 (dz014988), SEQ ID NO: 502 (dz015696), SEQ ID NO: 917 (dz016423), SEQ ID NO: 753 (dz014985), SEQ ID NO: 918 (dz016453), SEQ ID NO: 754 (dz014986), SEQ ID NO: 542 (dz012794), SEQ ID NO: 755 (dz014983), SEQ ID NO: 757 (dz013912), SEQ ID NO:541 (dz012793), SEQ ID NO: 758 (dz012853), SEQ ID NO: 759 (dz014654), SEQ ID NO: 513 (dz017273), SEQ ID NO: 491 (dz017252), SEQ ID NO: 760 (dz014980), SEQ ID NO: 487 (dz012850), SEQ ID NO: 761 (dz000327), SEQ ID NO: 762 (dz016438), SEQ ID NO: 538 (dz012816), SEQ ID NO: 539 (dz012817), SEQ ID NO: 536 (dz012814), SEQ ID NO: 488 (dz012851), SEQ ID NO: 763 (dz014650), SEQ ID NO: 764 (dz014651), SEQ ID NO: 765 (dz012862), SEQ ID NO: 766 (dz014973), SEQ ID NO: 767 (dz014977), SEQ ID NO: 919 (dz016424), SEQ ID NO: 768 (dz012860), SEQ ID NO: 769 (dz012856), SEQ ID NO: 770 (dz012861), SEQ ID NO: 514 (dz017274), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643P-634420-PC(dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 556 (dz013897), SEQ ID NO: 771 (dz012819), SEQ ID NO: 772 (dz012821), SEQ ID NO: 773 (dz017183), SEQ ID NO: 774 (dz012864), SEQ ID NO: 540 (dz012818), SEQ ID NO: 553 (dz012800), SEQ ID NO: 775 (dz012863), SEQ ID NO: 776 (dz012865), SEQ ID NO: 550 (dz012797), SEQ ID NO: 777 (dz010718).

[0167] In some embodiments, the modified core sequences set forth in any of DZyme Core XXVII sequences comprising nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 851 (dz016910), SEQ ID NO: 852 (dz016906), SEQ ID NO: 584 (dz016348), SEQ ID NO: 853 (dz016907), SEQ ID NO: 591 (dz016353), SEQ ID NO: 582 (dz016347), SEQ ID NO: 854 (dz016426), SEQ ID NO: 664 (dz017531), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 920 (dz017415), SEQ ID NO: 856 (dz017532), SEQ ID NO: 580 (dz016346), SEQ ID NO: 845 (dz017970), SEQ ID NO: 605 (dz017220), SEQ ID NO: 857 (dz016913), SEQ ID NO: 858 (dz016417), SEQ ID NO: 599 (dz017214), SEQ ID NO: 658 (dz017375), SEQ ID NO: 604 (dz017219), SEQ ID NO: 859 (dz016425), SEQ ID NO: 860 (dz016427), SEQ ID NO: 861 (dz016909), SEQ ID NO: 587 (dz016351), SEQ ID NO: 597 (dz017212), SEQ ID NO:603 (dz017218), SEQ ID NO: 862 (dz016915), SEQ ID NO: 610 (dz017225), SEQ ID NO: 747 (dz013914), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 607 (dz017222), SEQ ID NO: 864 (dz016908), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 865 (dz016416), SEQ ID NO: 866 (dz016413), SEQ ID NO: 653 (dz015432), SEQ ID NO: 585 (dz016349), SEQ ID NO: 867 (dz016412), SEQ ID NO: 581 (dz016344), SEQ ID NO: 868 (dz016912), SEQ ID NO: 586 (dz016350), SEQ ID NO: 494 (dz017255), SEQ ID NO: 869 (dz016919), SEQ ID NO: 870 (dz016411), SEQ ID NO: 871 (dz016920), SEQ ID NO: 872 (dz016418), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 873 (dz016446), SEQ ID NO: 874 (dz016916), SEQ ID NO: 875 (dz016414), SEQ ID NO: 673 (dz017181), SEQ ID NO: 850 (dz017971), SEQ ID NO: 650 (dz016388), SEQ ID NO: 495 (dz017256), SEQ ID NO: 674 (dz016365), SEQ ID NO: 627 (dz016331), SEQ ID NO: 608 (dz017223), SEQ ID NO: 675 (dz016362), SEQ ID NO: 876 (dz016444), SEQ ID NO: 676 (dz016364), SEQ ID NO: 677 (dz016498), SEQ ID NO: 677 (dz016498), SEQ ID NO: 877 (dz016419), SEQ ID NO: 878 (dz016432), SEQ ID NO: 468 (dz012831), SEQ ID NO: 879 (dz016430), SEQ ID NO: 880 (dz016922), SEQ ID NO: 667 (dz017533), SEQ ID NO: 590 (dz015727), SEQ ID NO: 491 (dz017252), SEQ ID NO: 881 (dz016926), SEQ ID NO: 589 (dz015724), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 883 (dz016925), SEQ ID NO: 882 (dz016410), SEQ ID NO: 467 (dz012830), SEQ ID NO: 884P-634420-PC(dz016924), SEQ ID NO: 652 (dz015431), SEQ ID NO: 620 (dz014626), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 469 (dz012832), SEQ ID NO: 583 (dzO16496), SEQ ID NO: 656 (dz016499), SEQ ID NO: 496 (dz017257), SEQ ID NO: 625 (dz016330), SEQ ID NO: 578 (dz016345), SEQ ID NO: 492 (dz017253), SEQ ID NO: 490 (dz017251), SEQ ID NO: 885 (dz016442), SEQ ID NO: 573 (dz015726), SEQ ID NO: 886 (dz016911), SEQ ID NO: 528 (dz015429), SEQ ID NO:654 (dz016497), SEQ ID NO: 548 (dz015430), SEQ ID NO: 887 (dz016428), SEQ ID NO: 681 (dz016366), SEQ ID NO: 888 (dz016445), SEQ ID NO: 889 (dz017527), SEQ ID NO: 632 (dz016329), SEQ ID NO: 497 (dz017258), SEQ ID NO: 683 (dz017538), SEQ ID NO: 890 (dz016447), SEQ ID NO: 891 (dz016436), SEQ ID NO: 892 (dz016434), SEQ ID NO: 628 (dz016332), SEQ ID NO: 609 (dz017224), SEQ ID NO: 893 (dz016450), SEQ ID NO: 894 (dz016921), SEQ ID NO: 498 (dz017259), SEQ ID NO: 470 (dz012833), SEQ ID NO: 505 (dz017265), SEQ ID NO: 685 (dz015706), SEQ ID NO: 895 (dz016923), SEQ ID NO: 896 (dz016443), SEQ ID NO: 686 (dz017535), SEQ ID NO: 462 (dz012825), SEQ ID NO: 897 (dz016409), SEQ ID NO: 501 (dz017262), SEQ ID NO: 507 (dz017267), SEQ ID NO: 602 (dz017217), SEQ ID NO: 508 (dz017268), SEQ ID NO: 898 (dz016440), SEQ ID NO: 899 (dz016441), SEQ ID NO: 900 (dz016431), SEQ ID NO: 465 (dz012828), SEQ ID NO: 546 (dz013895), SEQ ID NO: 901 (dz016452), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 902 (dz016448), SEQ ID NO: 690 (dz017539), SEQ ID NO: 679 (dz016334), SEQ ID NO: 592 (dz016354), SEQ ID NO: 680 (dz016490), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 648 (dz017525), SEQ ID NO: 499 (dz017260), SEQ ID NO: 804 (dz016266), SEQ ID NO: 574 (dz014640), SEQ ID NO: 903 (dz016918), SEQ ID NO: 801 (dz016261), SEQ ID NO: 464 (dz012827), SEQ ID NO: 904 (dz016420), SEQ ID NO: 796 (dz013834), SEQ ID NO: 691 (dz016393), SEQ ID NO: 466 (dz012829), SEQ ID NO: 694 (dz016363), SEQ ID NO: 905 (dz016451), SEQ ID NO: 692 (dz014981), SEQ ID NO: 579 (dz016356), SEQ ID NO: 459 (dz016408), SEQ ID NO: 906 (dz017537), SEQ ID NO: 693 (dz015925), SEQ ID NO: 493 (dz017254), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 572 (dz014638), SEQ ID NO: 661 (dz014634), SEQ ID NO: 615 (dz014632), SEQ ID NO: 472 (dz012835), SEQ ID NO: 651 (dz017528), SEQ ID NO: 575 (dz014641), SEQ ID NO: 473 (dz012836), SEQ ID NO: 695 (dz016492), SEQ ID NO: 478P-634420-PC(dz012841), SEQ ID NO: 461 (dz012824), SEQ ID NO: 696 (dz016392), SEQ ID NO: 907 (dz016449), SEQ ID NO: 649 (dz017526), SEQ ID NO: 480 (dz012843), SEQ ID NO: 908 (dz016429), SEQ ID NO: 547 (dz013896), SEQ ID NO: 576 (dz014642), SEQ ID NO: 559 (dz013899), SEQ ID NO: 463 (dz012826), SEQ ID NO: 460 (dz012823), SEQ ID NO: 70 (dz013911), SEQ ID NO: 909 (dz016439), SEQ ID NO: 477 (dz012840), SEQ ID NO: 910 (dz016917), SEQ ID NO: 662 (dz014635), SEQ ID NO:697 (dz014984), SEQ ID NO: 618 (dz014633), SEQ ID NO: 571 (dz014639), SEQ ID NO: 911 (dz016433), SEQ ID NO: 699 (dz015714), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 569 (dz013910), SEQ ID NO: 476 (dz012839), SEQ ID NO: 701 (dz016494), SEQ ID NO: 526 (dz012805), SEQ ID NO: 912 (dz017529), SEQ ID NO: 509 (dz017269), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO:703 (dz016333), SEQ ID NO: 479 (dz012842), SEQ ID NO: 913 (dz016437), SEQ ID NO: 482 (dz012845), SEQ ID NO: 629 (dz017608), SEQ ID NO: 504 (dz017264), SEQ ID NO: 706 (dz014978), SEQ ID NO: 707 (dz015715), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 564 (dz013905), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 619 (dz014631), SEQ ID NO: 914 (dz016421), SEQ ID NO: 566 (dz013907), SEQ ID NO: 545 (dz013894), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 522 (dz014649), SEQ ID NO: 565 (dz013906), SEQ ID NO: 481 (dz012844), SEQ ID NO: 712 (dz014979), SEQ ID NO: 511 (dz017271), SEQ ID NO: 713 (dz015926), SEQ ID NO: 475 (dz012838), SEQ ID NO: 714 (dz015927), SEQ ID NO: 614 (dz012867) SEQ ID NO: 718 (dz016400), SEQ ID NO: 716 (dz014972), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 483 (dz012846), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 719 (dz015729), SEQ ID NO: 663 (dz014636), SEQ ID NO: 563 (dz013903), SEQ ID NO: 720 (dz014982), SEQ ID NO: 621 (dz015705), SEQ ID NO: 721 (dz014974), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 510 (dz017270), SEQ ID NO: 558 (dz013904), SEQ ID NO: 523 (dz010725), SEQ ID NO: 723 (dz016391), SEQ ID NO:561 (dz013901), SEQ ID NO: 724 (dz016335), SEQ ID NO: 474 (dz012837), SEQ ID NO:453 (dz000182), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 524 (dz010726), SEQ ID NO: 533 (dz012811), SEQ ID NO: 915 (dz016422), SEQ ID NO: 728 (dz016395), SEQ ID NO: 595 (dz014645), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 530 (dz012808), SEQ ID NO:730 (dz014987), SEQ ID NO: 519 (dz010722), SEQ ID NO: 731P-634420-PC(dz016495), SEQ ID NO: 520 (dz010723), SEQ ID NO: 534 (dz012813), SEQ ID NO: 521 (dz010724), SEQ ID NO: 732 (dz013916), SEQ ID NO: 534 (dz012812), SEQ ID NO: 484 (dz012847), SEQ ID NO: 613 (dz012866), SEQ ID NO: 733 (dz016996), SEQ ID NO: 916 (dz001619), SEQ ID NO: 531 (dz012809), SEQ ID NO: 734 (dz013913), SEQ ID NO: 702 (dz015697), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO:740 (dz015703), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 735 (dz014989), SEQ ID NO: 512 (dz017272), SEQ ID NO: 737 (dz013915), SEQ ID NO: 739 (dz014655), SEQ ID NO: 741 (dz014976), SEQ ID NO: 543 (dz012795), SEQ ID NO: 743 (dz014975), SEQ ID NO: 537 (dz012815), SEQ ID NO: 485 (dz012848), SEQ ID NO: 744 (dz014971), SEQ ID NO: 532 (dz012810), SEQ ID NO: 745 (dz013917), SEQ ID NO: 525 (dz012804), SEQ ID NO: 746 (dz014653), SEQ ID NO: 747 (dz013914), SEQ ID NO: 486 (dz012849), SEQ ID NO: 748 (dz013918), SEQ ID NO:749 (dz013919), SEQ ID NO: 518 (dz010727), SEQ ID NO: 567 (dz013908), SEQ ID NO: 750 (dz014652), SEQ ID NO: 751 (dz015713), SEQ ID NO: 752 (dz014988), SEQ ID NO: 502 (dz015696), SEQ ID NO: 917 (dz016423), SEQ ID NO: 753 (dz014985), SEQ ID NO: 918 (dz016453), SEQ ID NO: 754 (dz014986), SEQ ID NO: 542 (dz012794), SEQ ID NO: 755 (dz014983), SEQ ID NO: 757 (dz013912), SEQ ID NO:541 (dz012793), SEQ ID NO: 758 (dz012853), SEQ ID NO: 759 (dz014654), SEQ ID NO: 513 (dz017273), SEQ ID NO: 491 (dz017252), SEQ ID NO: 760 (dz014980), SEQ ID NO: 487 (dz012850), SEQ ID NO: 761 (dz000327), SEQ ID NO: 762 (dz016438), SEQ ID NO: 538 (dz012816), SEQ ID NO: 539 (dz012817), SEQ ID NO: 536 (dz012814), SEQ ID NO: 488 (dz012851), SEQ ID NO: 763 (dz014650), SEQ ID NO: 764 (dz014651), SEQ ID NO: 765 (dz012862), SEQ ID NO: 766 (dz014973), SEQ ID NO: 767 (dz014977), SEQ ID NO: 919 (dz016424), SEQ ID NO: 768 (dz012860), SEQ ID NO: 769 (dz012856), SEQ ID NO: 770 (dz012861), SEQ ID NO: 514 (dz017274), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 556 (dz013897), SEQ ID NO: 771 (dz012819), SEQ ID NO: 772 (dz012821), SEQ ID NO: 773 (dz017183), SEQ ID NO: 774 (dz012864), SEQ ID NO: 540 (dz012818), SEQ ID NO: 553 (dz012800), SEQ ID NO: 775 (dz012863), SEQ ID NO: 776 (dz012865), SEQ ID NO: 550 (dz012797), SEQ ID NO: 777 (dz010718), may be flanked by modified or unmodified 5’ and 3’ arms. In some embodiments, a modified DZyme capable of cleaving a UGt / U target site comprises a modified catalytic core set forth in nucleotides 10-24 (positions G1-A15) of any of the catalytic cores disclosed in Table 10 (Figure 10). In some embodiments, a modified DZyme capable ofP-634420-PCcleaving a UAl / U target site comprises a modified catalytic core set forth in nucleotides 10-24 (positions G1-A15) of any of the catalytic cores disclosed in Figure 11.

[0168] In certain embodiments, methods of targeting the HTT_SNP1 mutant allele comprises administering a modified DZyme comprising a modified catalytic core (DZyme CORE XXVII) located at nucleotides 9-23 in each of SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), SEQ ID NO: 926 (dz017973), SEQ ID NO: 793 (dz014614), SEQ ID NO: 796 (dz013834), SEQ ID NO: 797 (dz017281), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 802 (dz017288), and SEQ ID NO: 805 (dz016265), and at nucleotides 8-22 of the DZyme sequences set forth in SEQ ID NO: 786 (dz013860), SEQ ID NO: 887 (dz013859), SEQ ID NO: 788 (dz013858), SEQ ID NO: 789 (dz013857), SEQ ID NO: 790 (dz013856), SEQ ID NO: 791 (dz013855), and SEQ ID NO: 792 (dz008804), or at nucleotides 9-23 of SEQ ID NO: 798 (dz017283), SEQ ID NO: 927 (dz017561), SEQ ID NO: 877 (dz016419), SEQ ID NO: 872 (dz016418), SEQ ID NO: 930 (dz016896), SEQ ID NO: 931 (dz016895), SEQ ID NO: 932 (dz016894), and SEQ ID NO: 794 (dz015644; negative control switch), (modified catalytic cores from Figures 15B, 15E, 15G, and 151.) In some embodiments, a modified DZyme comprising a modified catalytic core of DZyme CORE XXVII may be flanked by modified or unmodified 5’ and 3’ arms in order that the DZyme targets the HTT_SNP1 mutant allele.

[0169] In certain embodiments, methods of targeting the HTT_SNP1 mutant allele comprises administering a modified DZyme comprising any of SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), SEQ ID NO: 926 (dz017973), SEQ ID NO: 793 (dz014614), SEQ ID NO: 796 (dz013834), SEQ ID NO: 797 (dz017281), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 802 (dz017288), and SEQ ID NO: 805 (dz016265); or nucleotides 8-22 of any of SEQ ID NO: 887 (dz013859), SEQ ID NO: 788 (dz013858), SEQ ID NO: 789 (dz013857), SEQ ID NO: 790 (dz013856), SEQ ID NO: 791 (dz013855), and SEQ ID NO: 792 (dz008804).

[0170] In certain embodiments, methods of targeting the KRAS G12V mutant allele comprises administering a modified DZyme comprising a modified core as set forth in any of the DZymes disclosed in Figure 10. In some embodiments, a modified DZyme comprising a modified catalyticP-634420-PCcore of DZyme CORE XXVII may be flanked by modified or unmodified 5’ and 3’ arms targeting the KRAS G12V mutant allele. In certain embodiments, methods of targeting the KRAS G12V mutant allele comprises administering a modified DZyme comprising any of the DZymes disclosed in Figure 10.

[0171] In some embodiments of a modified DZyme comprising a modified DZyme Core XXVII, the modified catalytic core comprises nucleotides 10-24 of SEQ ID NO: 1 represented as follows G, LI, X2, L2, X3, L3, X4, L4, X5, L5, G, L6, X7, L7, X8, L8, X9, L9, X10, L10, X11, L11, A, L12, X13, L13, X14, L14, X15, and L15 (DZyme Core XXVIII); wherein(a) LI comprises a bsl, a msl, or a ps linkage;(b) X2 comprises a G, a Gom or a Gsg;(c) L2 comprises a pg, a bsl, or a msl linkage, wherein when X2 is a Gsg then L2 is a msl linkage;(d) X3 comprises a C or a Ctna;(e) L3 comprises a PO, a msl, or a bsl linkage, wherein when X3 is a Ctna L3 is a PO or a msl linkage;(f) X4 comprises a U5fu, a T, a dU, or a Uf;(g) L4 comprises a PO, a pg, or a ps linkage;(h) X5 comprises an A or an A4me;(i) L5 comprises a PO, a msl, a bsl, a ps, or a pg linkage, wherein when L5 is a ps linkage X5 is A;(j) L6 comprises a pg, a msl, or a ps linkage;(k) X7 comprises a C or a Cam;(l) L7 comprises a pg, a bsl, a msl, or a PO linkage;(m)X8 comprises a Uom, a U6azadu, a Tmo, a Uuna, a Uf, Tl, a Tgna, or a T12d, or is absent;(n) L8 comprises a PO, a bsl, or a msl linkage;(o) X9 comprises an A, an A78, or an Acar;(p) L9 comprises a pg or a msl linkage, wherein when X9 is Acar L9 is a msl linkage;(q) X10 comprises a C, a Cmc, a C4me, or a Che;(r) L10 comprises a pg or a msl linkage, wherein when X10 is Cmc L10 is a pg linkage, when X10 is C4me L10 is a pg linkage, and when X10 is Che L10 is a msl linkage;(s) X11 comprises an Af or an A;P-634420-PC(t) LI 1 comprises a msl, a pg, a PO, or a ps linkage;(u) L12 comprises a pg, a msl, a bsl, or a ps linkage;(v) X13 comprises a C or a Cmc;(w)L13 comprises a bsl, a msl, a ps, or a pg linkage, wherein when X13 is Cmc L13 is a msl linkage;(x) X14 comprises a Gmo, a GTd, a Gam, a G, or a Gf;(y) L14 comprises a PO, a msl, a pg, or a ps linkage;(z) X15 comprises an A, an Af, an Aln, an Amo, or an Atna; and(aa) L15 comprises a pg, a bsl, a msl, a PO, or a ps linkage, wherein when X15 is Amo LI 5 is a msl or pg linkage, when X15 is a Atna LI 5 is a PO linkage, and wherein when L15 is a ps linkage X15 is A.

[0172] In some embodiments of a modified DZyme comprising a modified DZyme Core XXVIII, the modified catalytic core comprises nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 856 (dz017532), SEQ ID NO: 845 (dz017970), SEQ ID NO: 658 (dz017375), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 653 (dz015432), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 850 (dz017971), SEQ ID NO: 650 (dz016388), SEQ ID NO: 627 (dz016331), SEQ ID NO: 880 (dz016922), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 883 (dz016925), SEQ ID NO: 884 (dz016924), SEQ ID NO: 652 (dz015431), SEQ ID NO: 620 (dz014626), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 625 (dz016330), SEQ ID NO: 886 (dz016911), SEQ ID NO: 528 (dz015429), SEQ ID NO:654 (dz016497), SEQ ID NO: 548 (dz015430), SEQ ID NO: 887 (dz016428), SEQ ID NO: 889 (dz017527), SEQ ID NO: 632 (dz016329), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 894 (dz016921), SEQ ID NO: 895 (dz016923), SEQ ID NO: 686 (dz017535), SEQ ID NO: 546 (dz013895), SEQ ID NO: 901 (dz016452), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 690 (dz017539), SEQ ID NO: 679 (dz016334), SEQ ID NO: 592 (dz016354), SEQ ID NO: 680 (dz016490), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 648 (dz017525), SEQ ID NO: 903 (dz016918), SEQ ID NO: 691 (dz016393), SEQ ID NO: 905 (dz016451), SEQ ID NO: 692 (dz014981), SEQ ID NO: 579P-634420-PC(dz016356), SEQ ID NO: 906 (dz017537), SEQ ID NO: 693 (dz015925), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 615 (dz014632), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 908 (dz016429), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 910 (dz016917), SEQ ID NO:697 (dz014984), SEQ ID NO: 618 (dz014633), SEQ ID NO: 699 (dz015714), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 526 (dz012805), SEQ ID NO: 912 (dz017529), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO:703 (dz016333), SEQ ID NO: 629 (dz017608), SEQ ID NO: 706 (dz014978), SEQ ID NO: 707 (dz015715), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 545 (dz013894), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 522 (dz014649), SEQ ID NO: 712 (dz014979), SEQ ID NO: 713 (dz015926), SEQ ID NO: 714 (dz015927), SEQ ID NO: 718 (dz016400), SEQ ID NO: 716 (dz014972), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 719 (dz015729), SEQ ID NO: 563 (dz013903), SEQ ID NO: 720 (dz014982), SEQ ID NO: 621 (dz015705), SEQ ID NO: 721 (dz014974), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 558 (dz013904), SEQ ID NO: 523 (dz010725), SEQ ID NO: 723 (dz016391), SEQ ID NO:561 (dz013901), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 524 (dz010726), SEQ ID NO: 533 (dz012811), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 530 (dz012808), SEQ ID NO:730 (dz014987), SEQ ID NO: 731 (dz016495), SEQ ID NO: 535 (dz012813), SEQ ID NO: 732 (dz013916), SEQ ID NO: 534 (dz012812), SEQ ID NO: 733 (dz016996), SEQ ID NO: 531 (dz012809), SEQ ID NO: 734 (dz013913), SEQ ID NO: 635 (dz016337), SEQ ID NO: 735 (dz014989), SEQ ID NO: 736 (dz015700), SEQ ID NO: 737 (dz013915), SEQ ID NO: 738 (dz015730), SEQ ID NO: 739 (dz014655), SEQ ID NO:740 (dz015703), SEQ ID NO: 741 (dz014976), SEQ ID NO: 634 (dz017520), SEQ ID NO: 743 (dz014975), SEQ ID NO: 537 (dz012815), SEQ ID NO: 742 (dz016339), SEQ ID NO: 744 (dz014971), SEQ ID NO: 532 (dz012810), SEQ ID NO:745 (dz013917), SEQ ID NO: 525 (dz012804), SEQ ID NO: 746 (dz014653), SEQ ID NO: 747 (dz013914), SEQ ID NO: 748 (dz013918), SEQ ID NO:749 (dz013919), SEQ ID NO: 567 (dz013908), SEQ ID NO: 750 (dz014652), SEQ ID NO: 751P-634420-PC(dz015713), SEQ ID NO: 752 (dz014988), SEQ ID NO: 502 (dz015696), SEQ ID NO: 753 (dz014985), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 918 (dz016453), SEQ ID NO: 754 (dz014986), SEQ ID NO: 755 (dz014983), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 757 (dz013912), SEQ ID NO: 759 (dz014654), SEQ ID NO: 760 (dz014980), SEQ ID NO: 538 (dz012816), SEQ ID NO: 536 (dz012814), SEQ ID NO: 539 (dz012817), SEQ ID NO: 763 (dz014650), SEQ ID NO: 764 (dz014651), SEQ ID NO: 766 (dz014973), SEQ ID NO: 767 (dz014977), SEQ ID NO: 556 (dz013897), SEQ ID NO: 771 (dz012819), SEQ ID NO: 540 (dz012818), SEQ ID NO: 553 (dz012800), and SEQ ID NO: 679 (dz016334),

[0173] In some embodiments, the modified core sequences set forth in any of DZyme Core XXVIII sequences comprising nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 856 (dz017532), SEQ ID NO: 845 (dz017970), SEQ ID NO: 658 (dz017375), SEQ ID NO: 665 (dz017530), SEQ ID NO: 657 (dz017374), SEQ ID NO: 653 (dz015432), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 850 (dz017971), SEQ ID NO: 650 (dz016388), SEQ ID NO: 627 (dz016331), SEQ ID NO: 880 (dz016922), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 883 (dz016925), SEQ ID NO: 884 (dz016924), SEQ ID NO: 652 (dz015431), SEQ ID NO: 620 (dz014626), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 656 (dz016499), SEQ ID NO: 625 (dz016330), SEQ ID NO: 886 (dz016911), SEQ ID NO: 528 (dz015429), SEQ ID NO:654 (dz016497), SEQ ID NO: 548 (dz015430), SEQ ID NO: 887 (dz016428), SEQ ID NO: 889 (dz017527), SEQ ID NO: 632 (dz016329), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 894 (dz016921), SEQ ID NO: 895 (dz016923), SEQ ID NO: 686 (dz017535), SEQ ID NO: 546 (dz013895), SEQ ID NO: 901 (dz016452), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 690 (dz017539), SEQ ID NO: 679 (dz016334), SEQ ID NO: 592 (dz016354), SEQ ID NO: 680 (dz016490), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 659 (dz017376), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 689 (dz016399), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 648 (dz017525), SEQ ID NO: 903 (dz016918), SEQ ID NO: 691 (dz016393), SEQ ID NO: 905 (dz016451), SEQ ID NO: 692 (dz014981), SEQ ID NO: 579 (dz016356), SEQ ID NO: 906 (dz017537), SEQ ID NO: 693 (dz015925), SEQ ID NO: 640P-634420-PC(dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 615 (dz014632), SEQ ID NO: 651 (dz017528), SEQ ID NO: 695 (dz016492), SEQ ID NO: 696 (dz016392), SEQ ID NO: 649 (dz017526), SEQ ID NO: 908 (dz016429), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 910 (dz016917), SEQ ID NO:697 (dz014984), SEQ ID NO: 618 (dz014633), SEQ ID NO: 699 (dz015714), SEQ ID NO: 639 (dz015710), SEQ ID NO:698 (dz016489), SEQ ID NO: 700 (dz016493), SEQ ID NO: 701 (dz016494), SEQ ID NO: 526 (dz012805), SEQ ID NO: 912 (dz017529), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO: 704 (dz016394), SEQ ID NO: 705 (dz016398), SEQ ID NO:703 (dz016333), SEQ ID NO: 629 (dz017608), SEQ ID NO: 706 (dz014978), SEQ ID NO: 707 (dz015715), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 710 (dz016491), SEQ ID NO: 711 (dz016386), SEQ ID NO: 545 (dz013894), SEQ ID NO: 588 (dz016352), SEQ ID NO: 715 (dz016401), SEQ ID NO: 522 (dz014649), SEQ ID NO: 712 (dz014979), SEQ ID NO: 713 (dz015926), SEQ ID NO: 714 (dz015927), SEQ ID NO: 718 (dz016400), SEQ ID NO: 716 (dz014972), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 719 (dz015729), SEQ ID NO: 563 (dz013903), SEQ ID NO: 720 (dz014982), SEQ ID NO: 621 (dz015705), SEQ ID NO: 721 (dz014974), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 558 (dz013904), SEQ ID NO: 523 (dz010725), SEQ ID NO: 723 (dz016391), SEQ ID NO:561 (dz013901), SEQ ID NO: 724 (dz016335), SEQ ID NO: 726 (dz016390), SEQ ID NO:727 (dz016488), SEQ ID NO: 524 (dz010726), SEQ ID NO: 533 (dz012811), SEQ ID NO: 728 (dz016395), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 530 (dz012808), SEQ ID NO:730 (dz014987), SEQ ID NO: 731 (dz016495), SEQ ID NO: 535 (dz012813), SEQ ID NO: 732 (dz013916), SEQ ID NO: 534 (dz012812), SEQ ID NO: 733 (dz016996), SEQ ID NO: 531 (dz012809), SEQ ID NO: 734 (dz013913), SEQ ID NO: 635 (dz016337), SEQ ID NO: 735 (dz014989), SEQ ID NO: 736 (dz015700), SEQ ID NO: 737 (dz013915), SEQ ID NO: 738 (dz015730), SEQ ID NO: 739 (dz014655), SEQ ID NO:740 (dz015703), SEQ ID NO: 741 (dz014976), SEQ ID NO: 634 (dz017520), SEQ ID NO: 743 (dz014975), SEQ ID NO: 537 (dz012815), SEQ ID NO: 742 (dz016339), SEQ ID NO: 744 (dz014971), SEQ ID NO: 532 (dz012810), SEQ ID NO:745 (dz013917), SEQ ID NO: 525 (dz012804), SEQ ID NO: 746 (dz014653), SEQ ID NO: 747 (dz013914), SEQ ID NO: 748 (dz013918), SEQ ID NO:749 (dz013919), SEQ ID NO: 567 (dz013908), SEQ ID NO: 750 (dz014652), SEQ ID NO: 751 (dz015713), SEQ ID NO: 752 (dz014988), SEQ ID NO: 502 (dz015696), SEQ ID NO: 753P-634420-PC(dz014985), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 918 (dz016453), SEQ ID NO: 754 (dz014986), SEQ ID NO: 755 (dz014983), SEQ ID NO: 644 (dz015716), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 757 (dz013912), SEQ ID NO: 759 (dz014654), SEQ ID NO: 760 (dz014980), SEQ ID NO: 538 (dz012816), SEQ ID NO: 536 (dz012814), SEQ ID NO: 539 (dz012817), SEQ ID NO: 763 (dz014650), SEQ ID NO: 764 (dz014651), SEQ ID NO: 766 (dz014973), SEQ ID NO: 767 (dz014977), SEQ ID NO: 556 (dz013897), SEQ ID NO: 771 (dz012819), SEQ ID NO: 540 (dz012818), SEQ ID NO: 553 (dz012800), and SEQ ID NO: 679 (dz016334), may be flanked by modified or unmodified 5’ and 3’ arms.

[0174] In some embodiments of a modified DZyme comprising a modified DZyme Core XXVIII, the modified catalytic core comprises nucleotides 10-24 of SEQ ID NO: 1 represented as follows G, LI, X2, L2, X3, L3, X4, L4, A, L5, G, L6, X7, L7, X8, L8, X9, L9, C, LIO, X11, L11, A, L12, C, L13, X14, L14, A, and L15 (DZyme Core XXVIV); wherein(a) LI comprises a bsl or a msl linkage;(b) X2 comprises a G or a Gom;(c) L2 comprises a pg, a bsl, or a msl linkage;(d) X3 comprises a C or a Ctna;(e) L3 comprises a PO, a msl, or a bsl linkage, wherein when X3 is a Ctna L3 is a PO or a msl linkage;(f) X4 comprises a U5fu, a T, a dU, or a Uf;(g) L4 comprises a PO, a pg, or a ps linkage;(h) L5 comprises a msl, a bsl, or a pg linkage;(i) L6 comprises a pg or a msl linkage;(j) X7 comprises a C or a Cam;(k) L7 comprises a pg, a bsl, or a msl linkage;(l) X8 comprises a Uom, a U6azadu, or a Uuna;(m)L8 comprises a PO, a bsl, or a msl linkage;(n) X9 comprises an A or an A78;(o) L9 comprises a pg or a msl linkage;(p) LIO comprises a pg or a msl linkage;(q) XI 1 comprises an Af or an A;(r) LI 1 comprises a msl, a pg, or a PO linkage;(s) L12 comprises a pg or a msl linkage;P-634420-PC(t) L13 comprises a bsl, a msl, or a pg linkage;(u) X14 comprises a Gmo, a GTd, or a Gam;(v) L14 comprises a PO, a msl, or a pg linkage; and(w)L15 comprises a pg or a msl linkage.

[0175] In some embodiments of a modified DZyme comprising a modified DZyme Core XXVIV, the modified catalytic core comprises nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 856 (dz017532), SEQ ID NO: 845 (dz017970), SEQ ID NO: 665 (dz017530), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 850 (dz017971), SEQ ID NO: 650 (dz016388), SEQ ID NO: 627 (dz016331), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 883 (dz016925), SEQ ID NO: 620 (dz014626), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 625 (dz016330), SEQ ID NO: 886 (dz016911), SEQ ID NO: 887 (dz016428), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 632 (dz016329), SEQ ID NO: 683 (dz017538), SEQ ID NO: 593 (dz016355), SEQ ID NO: 628 (dz016332), SEQ ID NO: 894 (dz016921), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 679 (dz016334), SEQ ID NO: 895 (dz016923), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 579 (dz016356), SEQ ID NO: 906 (dz017537), SEQ ID NO: 693 (dz015925), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 615 (dz014632), SEQ ID NO: 695 (dz016492), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 910 (dz016917), SEQ ID NO: 618 (dz014633), SEQ ID NO: 639 (dz015710), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 705 (dz016398), SEQ ID NO: 592 (dz016354), SEQ ID NO: 686 (dz017535), SEQ ID NO: 546 (dz013895), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 690 (dz017539), SEQ ID NO:703 (dz016333), SEQ ID NO: 629 (dz017608), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dzO15924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 711 (dz016386), SEQ ID NO: 715 (dz016401), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO: 702 (dz015697), SEQ ID NO: 522 (dz014649), SEQ ID NO: 714 (dz015927), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 719 (dz015729), SEQ ID NO: 563 (dz013903), SEQ ID NO: 637 (dz017609), SEQ ID NO: 545 (dz013894), SEQ ID NO: 619 (dz014631), SEQ ID NO: 621 (dz015705), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 558 (dz013904), SEQ ID NO: 523P-634420-PC(dz010725), SEQ ID NO:561 (dz013901), SEQ ID NO: 724 (dz016335), SEQ ID NO: 524 (dz010726), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 535 (dz012813), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 525 (dz012804), SEQ ID NO: 567 (dz013908), SEQ ID NO: 502 (dz015696), SEQ ID NO: 756 (dz015701), SEQ ID NO: 663 (dz014636), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 556 (dz013897), and SEQ ID NO: 553 (dz012800).

[0176] In some embodiments, the modified core sequences set forth in any of DZyme Core XXVIV sequences comprising nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 856 (dz017532), SEQ ID NO: 845 (dz017970), SEQ ID NO: 665 (dz017530), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 850 (dz017971), SEQ ID NO: 650 (dz016388), SEQ ID NO: 627 (dz016331), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 883 (dz016925), SEQ ID NO: 620 (dz014626), SEQ ID NO: 641 (dz017517), SEQ ID NO: 678 (dz017534), SEQ ID NO: 630 (dz017518), SEQ ID NO: 625 (dz016330), SEQ ID NO: 886 (dz016911), SEQ ID NO: 887 (dz016428), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 632 (dz016329), SEQ ID NO: 683 (dz017538), SEQ ID NO: 593 (dz016355), SEQ ID NO: 628 (dz016332), SEQ ID NO: 894 (dz016921), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 679 (dz016334), SEQ ID NO: 895 (dz016923), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 579 (dz016356), SEQ ID NO: 906 (dz017537), SEQ ID NO: 693 (dz015925), SEQ ID NO: 640 (dz017607), SEQ ID NO: 544 (dz013893), SEQ ID NO: 615 (dz014632), SEQ ID NO: 695 (dz016492), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 910 (dz016917), SEQ ID NO: 618 (dz014633), SEQ ID NO: 639 (dz015710), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 705 (dz016398), SEQ ID NO: 592 (dz016354), SEQ ID NO: 686 (dz017535), SEQ ID NO: 546 (dz013895), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 690 (dz017539), SEQ ID NO:703 (dz016333), SEQ ID NO: 629 (dz017608), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dzO15924), SEQ ID NO: 709 (dz017536), SEQ ID NO: 711 (dz016386), SEQ ID NO: 715 (dz016401), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO: 702 (dz015697), SEQ ID NO: 522 (dz014649), SEQ ID NO: 714P-634420-PC(dz015927), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 719 (dz015729), SEQ ID NO: 563 (dz013903), SEQ ID NO: 637 (dz017609), SEQ ID NO: 545 (dz013894), SEQ ID NO: 619 (dz014631), SEQ ID NO: 621 (dz015705), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 558 (dz013904), SEQ ID NO: 523 (dz010725), SEQ ID NO:561 (dz013901), SEQ ID NO: 724 (dz016335), SEQ ID NO: 524 (dz010726), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 535 (dz012813), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 525 (dz012804), SEQ ID NO: 567 (dz013908), SEQ ID NO: 502 (dz015696), SEQ ID NO: 756 (dz015701), SEQ ID NO: 663 (dz014636), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), SEQ ID NO: 643 (dz015712), SEQ ID NO: 645 (dz015717), SEQ ID NO: 556 (dz013897), and SEQ ID NO: 553 (dz012800), may be flanked by modified or unmodified 5’ and 3’ arms.

[0177] In some embodiments of a modified DZyme comprising a modified DZyme Core XXIX, the modified catalytic core comprises nucleotides 10-24 of SEQ ID NO: 1 represented as follows Gmsl, X2, L2, X3, L3, X4, L4, A, L5, G, L6, X7, L7, X8, msl, X9, L9, C, L10, Af, LI 1, A, L12, C, L13, X14, L14, A, and L15 (DZyme CORE XXX); wherein(a) X2 comprises a G or a Gom;(b) L2 comprises a pg or a msl linkage;(c) X3 comprises a C or a Ctna;(d) L3 comprises a PO or a msl linkage;(e) X4 comprises a U5fu, a T, a dU, or a Uf;(f) L4 comprises a PO, a pg, or a ps linkage;(g) L5 comprises a msl or a pg linkage;(h) L6 comprises a pg or a msl linkage;(i) X7 comprises a C or a Cam;(j) L7 comprises a pg or a msl linkage;(k) X8 comprises a Uom, a U6azadu, or a Uuna;(l) X9 comprises an A or an A78;(m)L9 comprises a pg or a msl linkage;(n) L10 comprises a pg or a msl linkage;(o) LI 1 comprises a msl or a pg linkage;(p) L12 comprises a pg or a msl linkage;P-634420-PC(q) L13 comprises a msl or a pg linkage;(r) X14 comprises a Gmo, a GTd, or a Gam;(s) L14 comprises a msl or a pg linkage; and(t) LI 5 comprises a pg or a msl linkage.

[0178] In some embodiments of a modified DZyme comprising a modified DZyme Core XXX, the modified catalytic core comprises nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 845 (dz017970), SEQ ID NO: 665 (dz017530), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 850 (dz017971), SEQ ID NO: 627 (dz016331), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 620 (dz014626), SEQ ID NO: 678 (dz017534), SEQ ID NO: 625 (dz016330), SEQ ID NO: 632 (dz016329), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 686 (dz017535), SEQ ID NO: 546 (dz013895), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 690 (dz017539), SEQ ID NO: 693 (dz015925), SEQ ID NO: 544 (dz013893), SEQ ID NO: 615 (dz014632), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 618 (dz014633), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO:703 (dz016333), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 545 (dz013894), SEQ ID NO: 619 (dz014631), SEQ ID NO: 714 (dz015927), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 563 (dz013903), SEQ ID NO: 663 (dz014636), SEQ ID NO: 621 (dz015705), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 558 (dz013904), SEQ ID NO:561 (dz013901), SEQ ID NO: 524 (dz010726), SEQ ID NO: 535 (dz012813), SEQ ID NO: 525 (dz012804), SEQ ID NO: 556 (dz013897), SEQ ID NO: 553 (dz012800), SEQ ID NO: 650 (dz016388), SEQ ID NO: 641 (dz017517), SEQ ID NO: 630 (dz017518), SEQ ID NO: 679 (dz016334), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 640 (dz017607), SEQ ID NO: 639 (dz015710), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 711 (dz016386), SEQ ID NO: 715 (dz016401), SEQ ID NO: 719 (dz015729), SEQ ID NO: 724 (dz016335), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO: 634P-634420-PC(dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), and SEQ ID NO: 643 (dz015712).

[0179] In some embodiments, the modified core sequences set forth in any of DZyme Core XXX sequences comprising nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 845 (dz017970), SEQ ID NO: 665 (dz017530), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 850 (dz017971), SEQ ID NO: 627 (dz016331), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 620 (dz014626), SEQ ID NO: 678 (dz017534), SEQ ID NO: 625 (dz016330), SEQ ID NO: 632 (dz016329), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 686 (dz017535), SEQ ID NO: 546 (dz013895), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 690 (dz017539), SEQ ID NO: 693 (dz015925), SEQ ID NO: 544 (dz013893), SEQ ID NO: 615 (dz014632), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 618 (dz014633), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO:703 (dz016333), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 545 (dz013894), SEQ ID NO: 619 (dz014631), SEQ ID NO: 714 (dz015927), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 563 (dz013903), SEQ ID NO: 663 (dz014636), SEQ ID NO: 621 (dz015705), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 558 (dz013904), SEQ ID NO:561 (dz013901), SEQ ID NO: 524 (dz010726), SEQ ID NO: 535 (dz012813), SEQ ID NO: 525 (dz012804), SEQ ID NO: 556 (dz013897), SEQ ID NO: 553 (dz012800), SEQ ID NO: 650 (dz016388), SEQ ID NO: 641 (dz017517), SEQ ID NO: 630 (dz017518), SEQ ID NO: 679 (dz016334), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 640 (dz017607), SEQ ID NO: 639 (dz015710), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 711 (dz016386), SEQ ID NO: 715 (dz016401), SEQ ID NO: 719 (dz015729), SEQ ID NO: 724 (dz016335), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701), SEQ ID NO: 646 (dz015731), SEQ ID NO: 633P-634420-PC(dz017610), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), and SEQ ID NO: 643 (dz015712), may be flanked by modified or unmodified 5’ and 3’ arms.

[0180] In certain embodiments, a modified DZyme comprises in 5’ to 3’ order: (i) a first substratebinding arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a catalytic core comprising the nucleotide sequence of DZyme Core XXVII; and (iii) a second substrate-binding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5' to the first region of the RNA transcript. In certain embodiments, a modified DZyme comprises in 5’ to 3’ order: (i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a catalytic core comprising the nucleotide sequence of DZyme Core XXVIII; and (iii) a second substrate-binding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5' to the first region of the RNA transcript. In certain embodiments, a modified DZyme comprises in 5’ to 3’ order: (i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a catalytic core comprising the nucleotide sequence of DZyme Core XXIX; and (iii) a second substrate-binding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5' to the first region of the RNA transcript. In certain embodiments, a modified DZyme comprises in 5’ to 3’ order: (i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a catalytic core comprising the nucleotide sequence of DZyme Core XXX; and (iii) a second substratebinding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5' to the first region of the RNA transcript.

[0181] In certain embodiments of a modified DZyme targeting an RNA transcript, the modified DZyme comprises in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core comprising nucleotides 10-24 of SEQ ID NO: 1, wherein nucleotides are represented as X1-X15 and backbone linkages between the nucleotides are represented as L1-L15 beginning with the linkage between X1 and X2 (DZyme Core XXXI), and wherein at least X2 is G or Gom, L2 is pg, X3 is C or Ctna, L6 is pg, X7 is C or Cam, L7 is pg, L9 is pg, L10 is pg, X11 is A or Af, L12 is pg, X14 is Gmo or Gf, and L15 is pg; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

[0182] In some embodiments of a modified DZyme comprising a modified DZyme Core XXXI,P-634420-PCthe modified catalytic core comprises nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 851 (dz016910), SEQ ID NO: 852 (dz016906), SEQ ID NO: 584 (dz016348), SEQ ID NO: 853 (dz016907), SEQ ID NO: 584 (dz016348), SEQ ID NO: 582 (dz016347), SEQ ID NO: 854 (dz016426), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 580 (dz016346), SEQ ID NO: 605 (dz017220), SEQ ID NO: 599 (dz017214), SEQ ID NO: 604 (dz017219), SEQ ID NO: 859 (dz016425), SEQ ID NO: 860 (dz016427), SEQ ID NO: 861 (dz016909), SEQ ID NO: 587 (dz016351), SEQ ID NO: 597 (dz017212), SEQ ID NO:603 (dz017218), SEQ ID NO: 610 (dz017225), SEQ ID NO: 607 (dz017222), SEQ ID NO: 567 (dz013908), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 585 (dz016349), SEQ ID NO: 581 (dz016344), SEQ ID NO: 586 (dz016350), SEQ ID NO: 608 (dz017223), SEQ ID NO: 577 (dz014643), SEQ ID NO: 590 (dz015727), SEQ ID NO: 583 (dz016496), SEQ ID NO: 578 (dz016345), SEQ ID NO: 886 (dz016911), SEQ ID NO: 573 (dz015726), SEQ ID NO: 887 (dz016428), SEQ ID NO: 609 (dz017224), SEQ ID NO: 602 (dz017217), SEQ ID NO: 574 (dz014640), SEQ ID NO: 574 (dz014640), SEQ ID NO: 572 (dz014638), SEQ ID NO: 575 (dz014641), SEQ ID NO: 649 (dz017526), SEQ ID NO: 576 (dz014642), SEQ ID NO: 70 (dz013911), SEQ ID NO: 571 (dz014639), SEQ ID NO: 569 (dz013910), SEQ ID NO: 912 (dz017529), SEQ ID NO: 588 (dz016352), SEQ ID NO: 595 (dz014645), SEQ ID NO: 664 (dz017531), SEQ ID NO: 641 (dz017517), SEQ ID NO: 592 (dz016354), SEQ ID NO: 640 (dz017607), SEQ ID NO: 593 (dz016355), SEQ ID NO: 724 (dz016335), SEQ ID NO: 709 (dz017536), SEQ ID NO: 829 (dz017148), and SEQ ID NO: 826 (dz017146).

[0183] In some embodiments, the modified core sequences set forth in any of DZyme Core XXXI sequences comprising nucleotides 10-24 (positions G1-A15) of any of SEQ ID NO: 851 (dz016910), SEQ ID NO: 852 (dz016906), SEQ ID NO: 584 (dz016348), SEQ ID NO: 853 (dz016907), SEQ ID NO: 584 (dz016348), SEQ ID NO: 582 (dz016347), SEQ ID NO: 854 (dz016426), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 580 (dz016346), SEQ ID NO: 605 (dz017220), SEQ ID NO: 599 (dz017214), SEQ ID NO: 604 (dz017219), SEQ ID NO: 859 (dz016425), SEQ ID NO: 860 (dz016427), SEQ ID NO: 861 (dz016909), SEQ ID NO: 587 (dz016351), SEQ ID NO: 597 (dz017212), SEQ ID NO:603 (dz017218), SEQ ID NO: 610 (dz017225), SEQ ID NO: 607 (dz017222), SEQ ID NO: 567 (dz013908), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 585 (dz016349), SEQ ID NO: 581 (dz016344), SEQ ID NO: 586 (dz016350), SEQ ID NO: 608 (dz017223), SEQ ID NO: 577 (dz014643), SEQ ID NO: 590 (dz015727), SEQ ID NO: 583 (dz016496), SEQ ID NO: 578 (dz016345), SEQ ID NO: 886P-634420-PC(dz016911), SEQ ID NO: 573 (dz015726), SEQ ID NO: 887 (dz016428), SEQ ID NO: 609 (dz017224), SEQ ID NO: 602 (dz017217), SEQ ID NO: 574 (dz014640), SEQ ID NO: 574 (dz014640), SEQ ID NO: 572 (dz014638), SEQ ID NO: 575 (dz014641), SEQ ID NO: 649 (dz017526), SEQ ID NO: 576 (dz014642), SEQ ID NO: 70 (dz013911), SEQ ID NO: 571 (dz014639), SEQ ID NO: 569 (dz013910), SEQ ID NO: 912 (dz017529), SEQ ID NO: 588 (dz016352), SEQ ID NO: 595 (dz014645), SEQ ID NO: 664 (dz017531), SEQ ID NO: 641 (dz017517), SEQ ID NO: 592 (dz016354), SEQ ID NO: 640 (dz017607), SEQ ID NO: 593 (dz016355), SEQ ID NO: 724 (dz016335), SEQ ID NO: 709 (dz017536), SEQ ID NO: 829 (dz017148), and SEQ ID NO: 826 (dz017146), may be flanked by modified or unmodified 5’ and 3’ arms.

[0184] In some embodiments, the nucleotide sequence of a modified DZyme disclosed herein comprises SEQ ID NO: 829 (dz017148), or SEQ ID NO: 826 (dz017146) (Figure 16B).

[0185] In certain embodiments, a modified DZyme comprises in 5’ to 3’ order: (i) a first substratebinding arm comprising a nucleotide sequence that base pairs with a first region of an RNA transcript; (ii) a catalytic core comprising the nucleotide sequence of DZyme Core XXXI; and (iii) a second substrate-binding arm comprising a nucleotide sequence that base pairs with a second region of the RNA transcript positioned 5' to the first region of the RNA transcript.

[0186] In certain embodiments, a modified DZyme disclosed herein has enhanced catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 (10-23 core sequence, positions G1-A15). In certain embodiments, a modified DZyme disclosed herein has enhanced metabolic stability, reduced RNase H activity, and / or maintained or enhanced catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 (10-23 core sequence, positions G1-A15) and unmodified arms. In certain embodiments, a modified DZyme disclosed herein has enhanced metabolic stability compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15] and unmodified arms. In certain embodiments, a modified DZyme disclosed herein has reduced RNase H activity, compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15] and unmodified arms. In certain embodiments, a modified DZyme disclosed herein enhanced catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15]. In certain embodiments, a modified DZyme disclosed herein maintains catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15]. In certain embodiments, a modified DZyme disclosed herein has enhanced metabolic stability and enhancedP-634420-PCcatalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15] and unmodified arms. In certain embodiments, a modified DZyme disclosed herein has enhanced metabolic stability while maintaining catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15] and unmodified arms.

[0187] Nucleotide and backbone linkage modifications present in the first substrate-binding arm, in the second substrate-binding arm, or in both arms may influence the catalytic activity, stability, and / or RNAse H activity of a DZyme disclosed herein.

[0188] In certain embodiments, a DZyme comprising a modified catalytic core comprising any of DZyme Cores I- XXXI has enhanced metabolic stability, reduced RNase H activity, and / or maintained or enhanced catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 (10-23 core sequence, positions G1-A15) and unmodified arms. In certain embodiments, a DZyme comprising a modified catalytic core comprising any of DZyme Cores I- XXXI has enhanced metabolic stability compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15] and unmodified arms. In certain embodiments, a DZyme comprising a modified catalytic core comprising any of DZyme Cores I- XXXI has reduced RNase H activity, compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15] and unmodified arms. In certain embodiments, a DZyme comprising a modified catalytic core comprising any of DZyme Cores I- XXXI enhanced catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15]. In certain embodiments, a DZyme comprising a modified catalytic core comprising any of DZyme Cores I-XXXI maintains catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15]. In certain embodiments, a DZyme comprising a modified catalytic core comprising any of DZyme Cores I-XXXI has enhanced metabolic stability and enhanced catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15] and unmodified arms. In certain embodiments, a DZyme comprising a modified catalytic core comprising any of DZyme Cores I-XXXI has enhanced metabolic stability while maintaining catalytic activity compared to a control DZyme comprising an unmodified catalytic core comprising SEQ ID NO: 1 [10-23 core sequence, positions G1-A15] and unmodified arms.

[0189] A skilled artisan would appreciate that the terms “core sequence”, catalytic core sequence”, or “10-23 core sequence” and the like refer to positions G1-A15 of a 10-23 DZyme or a modified 10-23 DZyme.P-634420-PC

[0190] In some embodiments, a modified DZyme comprises enhanced metabolic stability compared to a control DZyme comprising an unmodified catalytic core and unmodified arms. In some embodiments, enhanced stability of a modified DZyme results in a longer half-life of the DZyme in a subject.

[0191] In some embodiments, a first substrate-binding arm and a second substrate binding arm each comprise 4-18 nucleotides. The lengths of a first substrate-binding arm and a second substrate binding arm do not need to be identical. In some embodiments, a first substrate-binding arm comprises 4-18 nucleotides. In some embodiments, a second substrate-binding arm comprises 4-18 nucleotides.

[0192] In some embodiments, a first substrate-binding arm and a second substrate-binding arm each comprise 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides, wherein the first substratebinding arm and the second substrate-bind arm are independently 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides long. In some embodiments, the 5’ arm and the 3’ arms are different lengths, i.e., each arm comprises a different number of nucleotides.

[0193] In some embodiments, a first substrate-binding arm and or a second substrate binding arm comprise 4-12 nucleotides. In some embodiments, a first substrate-binding arm and or a second substrate binding arm comprise 6-14 nucleotides. In some embodiments, a first substrate-binding arm and or a second substrate binding arm comprise 8-16 nucleotides. In some embodiments, a first substrate-binding arm and or a second substrate binding arm comprise 8-18 nucleotides. In some embodiments, a first substrate-binding arm and or a second substrate binding arm comprises 6-12 nucleotides. In some embodiments, a first substrate-binding arm and or a second substrate binding arm comprise 8-10 nucleotides.

[0194] Throughout this application, various embodiments may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the DZymes and uses thereof, disclosed herein. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1-3, from 1-4, from 1-5, from 2-4, from 2-6, from 3-6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0195] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging / ranges between” a first indicate number and a second indicate number and “ranging / ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first andP-634420-PCsecond indicated numbers and all the fractional and integral numerals there between.

[0196] As used herein, the terms “5' arm” and “first substrate-binding arm” may be used interchangeably having all the same meanings and qualities. Similarly, the terms “3' arm” and “second substrate-binding arm” may be used interchangeably having all the same meanings and qualities.

[0197] A skilled artisan would appreciate that the 5' and 3' arms of a modified DZyme, as disclosed herein comprising a modified catalytic core, specifically recognize an RNA target through Watson-Crick base pairing. In some embodiments, target specificity is based on complementary Watson-Crick base pairing between an RNA target and the first and second substrate-binding arms of the modified DZyme. In some embodiments, the DZyme cleaves a G-U dinucleotide junction; therefore, the binding arms may be designed to be complementary to the RNA regions flanking the G-U cut site (Figure 1A). In other embodiments, the DZyme cleaves an A-U dinucleotide junction; therefore, the binding arms may be designed to be complementary to the RNA regions flanking the A-U cut site. A skilled artisan with knowledge of the nucleoside sequences 5' and 3' of a cleavage site within a target RNA transcript, for example a GU or AU cleavage site, would then be able to design 5' and 3' DZyme substrate arms complementary to the respective nucleoside sequences of the RNA transcript flanking the cleavage site (Figure 1A).

[0198] In some embodiments of a modified DZyme, the first substrate-binding arm or the second substrate-binding arm or both the first and the second substrate-binding arms comprise a chemical modification selected from a base modification, a sugar modification, and an inter-nucleotide linkage modification.

[0199] In some embodiments, the substrate binding arms can comprise RNA bases, DNA bases or combinations of RNA and DNA bases. In some embodiments, the substrate-binding arms comprise modified nucleotides, for example comprising the sugar and or base modifications provided in Table 1 or modifications otherwise known in the art. In some embodiments, either or both of the substratebinding arms comprise modified linkages between the nucleotides. In some embodiments, either or both of the substrate-binding arms comprise a combination of sugar and / or base modifications and linkage modifications.

[0200] In certain embodiments, modified bases preserve the base pair specificity of the parent DNA or RNA base and are considered equivalent to the DNA or RNA parent bases, e.g., a sequence mentioned herein as containing “guanine” contain instead modified forms of guanine preserving the base pair specificity of guanine. In some embodiments, alignment of a modified DZyme with a specific site on a target RNA substrate is maintained, independent of a modified first or second substrate-bind arm or modified first and second substrate binding arms.

[0201] In certain embodiments, modifications of substate arms that provided beneficial properties forP-634420-PCthe DZymes may comprise modifications at a limited number of nucleotide and or backbone linkage positions. In some embodiments, at least 2 backbone linkage positions of a first substrate-binding arm comprise modifications. In some embodiments, at least 2 backbone linkage positions are modified in the first substrate binding arm and at least 1 backbone linkage position is modified in the second substrate-binding arm. In some embodiments, at least 3, at least 4, at least 5 backbone linkage positions are modified in the first substrate binding arm. In some embodiments, at least 2, at least 3 backbone linkage positions are modified in the second substrate-binding arm. (See for example the DZymes and associated data presented in at least in Figures 12A-12C, 13A-13C, and 14A-14C).

[0202] Modifications for arm nucleotides and backbone linkages may comprise those present in Table 1 or any modification(s) known in the art. In some embodiments, backbone linkage modifications in a first substrate-binding arm, a second substrate-binding arm, or both comprise msl, pg, or bsl linkage modifications. In some embodiments, arm linkage modifications affect DZyme properties. In some embodiments, backbone linkages in the first substrate-binding arm and the second substrate-binding arm do not comprise consecutive deoxynucleotides (2 or more) with ps or PO linkages (2 or more). One skilled in the art would appreciate that deoxynucleotides are nucleotides with a DNA type ribose; any modification to the ribose will make the moiety “not a deoxyribose”.

[0203] In some embodiments of a modified DZyme disclosed herein,(a) the first substrate-binding arm and the second substrate-binding arm each independently comprise 4-18 nucleotides;(b) the backbone linkages 3' of X-2 (L-2), 3' of X-l (L-l) in the first substrate-binding arm are modified, wherein the modifications each independently comprises a msl, a pg, or a bsl linkage; and(c) the backbone linkages in the first substrate-binding arm and the second substrate binding arm do not comprise consecutive deoxynucleotides with either ps or PO linkages.

[0204] In some embodiments of a modified DZyme disclosed herein,(a) the first substrate-binding arm and the second substrate-binding arm each independently comprise 4-18 nucleotides;(b) the backbone linkages 3' of X-2 (L-2), 3' of X-l (L-l), and 3' of X+l (L+l) in the first substrate-binding arm and the second substrate binding arm, respectively, are modified, wherein the modifications each independently comprises a msl, a pg, or a bsl linkage; andP-634420-PC(c) the backbone linkages in the first substrate-binding arm and the second substrate binding arm do not comprise consecutive deoxynucleotides with either ps or PO linkages.

[0205] In some embodiments, a first substrate-binding arm comprises at least 1 linker modification substituting for the at least one terminal phosphodiester bond (PO) of the 5' binding arm. In some embodiments, a second substrate-binding arm comprises at least 1 linker modification substituting for the at least one terminal PO of the 3' binding arm. In some embodiments, a first substrate-binding arm and a second substrate binding arm each comprise at least llinker modifications substituting for at least one terminal PO bonds at the 5' and 3' arms, respectively.

[0206] In some embodiments, a first substrate-binding arm comprises at least 2 linker modifications substituting for the at least two terminal phosphodiester bonds (PO) of the 5' binding arm. In some embodiments, a second substrate-binding arm comprises at least 2 linker modifications substituting for the at least two terminal PO of the 3' binding arm. In some embodiments, a first substrate-binding arm and a second substrate binding arm each comprise at least 2 linker modifications substituting for the at least two terminal PO bonds at the 5' and 3' arms, respectively.

[0207] In some embodiments, a first substrate-binding arm comprises between at least 1 linker modification substituting for the at least one terminal phosphodiester bond (PO) of the 5' binding arm and all linkers modified so that all PO linkers of the 5’ binding arm are modified. In some embodiments, the range of nucleotides in a 5 ’arm, a 3’ arm, or both 5’ and 3’ arms comprise 4-18 nucleotides, and the first substrate binding arm comprises between 1-18 linker modifications. In other embodiments, the first substrate binding arm comprises between 1 - 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, and 18 linker modifications.

[0208] In some embodiments, a second substrate-binding arm comprises between at least 1 linker modification substituting for the at least one terminal phosphodiester bond (PO) of the 5' binding arm and all linkers modified so that all PO linkers of the 3’ binding arm are modified. In some embodiments, the range of nucleotides in a 5 ’arm, a 3’ arm, or both 5’ and 3’ arms comprise 4-18 nucleotides for each arm, and the second substrate binding arm comprises between 1-18 linker modifications. In other embodiments, the second substrate binding arm comprises between 1 - 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and 18 linker modifications. In other embodiments, the first substrate binding arm comprises between 1 - 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and 18 linker modifications and the second substrate binding arm comprises between 1 - 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, and 18 linker modifications.

[0209] In some embodiments, a first substrate-binding arm comprises 1 linker modifications substituting for the one terminal phosphodiester bond (PO) of the 5' binding arm. In someP-634420-PCembodiments, a second substrate-binding arm comprises 1 linker modifications substituting for the one terminal PO of the 3' binding arm. In some embodiments, a first substrate-binding arm and a second substrate binding arm each comprise 1 linker modification substituting for the one terminal PO bonds at the 5' and 3' arms, respectively.

[0210] In some embodiments, a first substrate-binding arm comprises 2 linker modifications substituting for the two terminal phosphodiester bonds (PO) of the 5' binding arm. In some embodiments, a second substrate-binding arm comprises 2 linker modifications substituting for the two terminal PO of the 3' binding arm. In some embodiments, a first substrate-binding arm and a second substrate binding arm each comprise 2 linker modifications substituting for the two terminal PO bonds at the 5' and 3' arms, respectively.

[0211] In some embodiments, a first substrate-binding arm comprises 1-18 linker modifications substituting for the 1-18 terminal phosphodiester bond (PO) of the 5' binding arm. In some embodiments, a second substrate-binding arm comprises 1-18 linker modifications substituting for the 1-18 terminal PO of the 3' binding arm. In some embodiments, a first substrate-binding arm and a second substrate binding arm each comprise 1-18 linker modifications substituting for the 1-18 terminal PO bonds at the 5' and 3' arms, respectively.

[0212] In some embodiments, linkage modifications in the terminal PO linkages of the 5' arm comprise a phosphorothioate linkage (PS; *, ps) or a mesyl phosphoramidate (MsPA;A, msl) linkage or a phosphoryl guanidine (PG; +, pg) linkage, or any combination thereof. In some embodiments, linkage modifications in the terminal PO linkages of the 3' arm comprise a phosphorothioate linkage (PS; *, ps) or a mesyl phosphoramidate (MsPA;A, msl) linkage or a phosphoryl guanidine (PG; +, pg) linkage, or any combination thereof. In some embodiments, linkage modifications in the terminal PO linkages of both the 5' and 3' arms, comprise a phosphorothioate linkage (PS; *, ps) or a mesyl phosphoramidate (MsPA;A, msl) linkage or a phosphoryl guanidine (PG; +, pg) linkage., or any combination thereof In some embodiments, linkage modifications in the terminal PO linkages of the 5' arm or the 3' arm or both the 5' and 3' arms, comprise a phosphorothioate linkage (PS; *, ps) or a mesyl phosphoramidate (MsPA;A, msl) linkage or a phosphoryl guanidine (PG; +, pg) linkage, or any combination thereof.

[0213] In some embodiments, linkage modifications in the terminal PO linkages of the 5' arm or the 3' arm or both the 5' and 3' arms, comprise phosphorothioate linkages (PS; *, ps). In some embodiments, linkage modifications in the terminal PO linkages of the 5' arm or the 3' arm or both the 5' and 3' arms, comprise mesyl phosphoramidate (MsPA;A, msl) linkages. In some embodiments, linkage modifications in the terminal PO linkages of the 5' arm or the 3' arm or both the 5' and 3' arms, comprise phosphoryl guanidine (PG; +, pg) linkages.P-634420-PC

[0214] In certain embodiments, a modified linkage 3' of X-2 (L-2) and 3' of X-l (L-l) in the 5' arm each individually comprises a msl, a pg, or a bsl. In certain embodiments, a linkage 3' of X-2 (L-2), and 3' of X-l (L-l), and 3' of X+l (L+l) each individually comprises a msl, a pg, or a bsl.

[0215] Using Figure 1A for exemplary purposes only, a skill artisan would recognize that the complementary regions of the 5' (first substrate-binding arm) and 3' (second substrate-binding arm) arms align on either side of the RNA transcript cleavage site, in this case a GU cleavage site, so that the first substrate-binding arm base pairs with a first region of the RNA transcript and the second substrate-binding arm base pairs with a second region of the RNA transcript, and the cleavage site is between the first and second regions of the RNA transcript. In some embodiments, a first substratebinding arm is 100% complementary to a first region of the RNA transcript or is partially complementary to the first regions of the RNA transcript with no more than two mismatches. In some embodiments, a second substrate-binding arm is 100% complementary to a second region of the RNA transcript or is partially complementary to the second regions of the RNA transcript with no more than two mismatches. In some embodiments, a first and a second substrat...

Claims

P-634420-PCCLAIMSWhat is claimed is:

1. A modified DZyme targeting an RNA transcript, said modified DZyme comprising in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core, DZyme Core XXVII, comprising nucleotides 10-24 of SEQ ID NO: 1 represented as follows XI, LI, X2, L2, X3, L3, X4, L4, X5, L5, G, L6, X7, L7, X8, L8, X9, L9, X10, LIO, X11, L11, A, L12, X13, L13, X14, L14, X15, and L15, wherein X represents a nucleoside with or without a modified sugar moiety or a modified base or both, and L represents a phosphodiester (PO) linkage or modified linkage between nucleosides;(a) X1 comprises a G or a threose nucleic acid modified G (Gtna);(b) L1 comprises a busyl phosphoramidate (bsl), a PO, a mesyl phosphoramidate (msl), a phosphoryl guanidine (pg), a phosphorothioate (ps), or an ethoxy phosphonate (eop) linkage, wherein when X1 is Gtna L1 is PO;(c) X2 comprises a G, a 2'-O-methyl modified G (Gom) or a 8-aza-7- deazaguanosine modified G (Gsg);(d) L2 comprises a pg, a bsl, a PO, a msl, a ps, or an eop linkage, wherein when X2 is a Gsg then L2 is a msl linkage;(e) X3 comprises a cytosine nucleoside (C) or a threose nucleic acid modified C (Ctna);(f) L3 comprises a PO, a pg, a bsl, a msl, or a ps linkage, wherein when X3 is a Ctna L3 is a PO, a msl, or a pg linkage;(g) X4 comprises a 5-fluoro-2'-deoxyuridine (U5fd), a thymine nucleoside (T), a deoxyuridine (Ud), 2'-fluoro modified U (Uf), or a 2'-NH2 modified U (Uam); (h) L4 comprises a PO, a pg, a msl or a ps linkage;(i) X5 comprises an adenine nucleoside (A) or a 4'-methyl-2'-deoxyribose A (A4me);(j) L5 comprises a PO, a msl, a bsl, a ps, or a pg linkage, wherein when X5 is A4me L5 is a PO, a msl, or a pg linkage;(k) L6 comprises a pg, a PO, a msl, a ps, or an eop linkage;(l) X7 comprises a C, a 2'-NH2 modified C (Cam), or a 2'-O-methyl (Com);P-634420-PC(m)L7 comprises a pg, a bsl, a msl, an eop, a ps, or a PO linkage, wherein when L7 is an eop or a ps linkage X7 is C and wherein X7 is Com L7 is a PO linkage; (n) X8 comprises a 2'-O-methyl Uridine (Uom), a 6-aza-2'-deoxyuridine (U6azad, a 2'-O-methoxyethyl T (Tmo), an unlocked U (Uuna), a 2'-fluoro U (Uf), L- DNA (Tl), a glycol nucleic acid (Tgna), a l',2'-dideoxyribose (T12d) or a T, or is absent;(o) L8 comprises a PO, a bsl, a msl, a pg, a eop, or a ps linkage;(p) X9 comprises an A, a 7-deaza-8-aza-2’-deoxyadenosine (A78), a threose nucleic acid modified A (Atna) or a 2'-Ome-arabinose A (Acar);(q) L9 comprises a pg, a PO, a msl, a bsl, or an eop linkage, wherein when X9 is Acar L9 is a msl linkage, when X9 is A78 L9 is a pg linkage, and when X9 is Atna L9 is a PO linkage;(r) X10 comprises a C, a 5 -methylcytosine C (Cmc), a 4'-methyl-2'-deoxyribose C (C4me), or a 5-hydroxymethlcytosine (Che);(s) L10 comprises a pg, a msl, a PO, a ps, an eop, or a bsl linkage, wherein when X10 is Cmc L10 is a pg linkage, when X10 is C4me L10 is a pg linkage, and when X10 is Che L10 is a msl linkage;(t) X11 comprises a 2'-fluoro A (Af), an A, or a 2'-O-methyl A (Aom);(u) L11 comprises a msl, a pg, a PO, a ps, an eop, or a bsl linkage, wherein when X11 is an Aom L11 is a PO linkage;(v) L12 comprises a pg, a PO, a msl, a bsl, a ps, or an eop linkage;(w)X13 comprises a C or a Cmc;(x) L13 comprises a bsl, a PO, a msl, a ps, a pg, or an eop linkage, wherein when X13 is Cmc L13 is a msl linkage;(y) X14 comprises a 2'-methoxyethyl G (Gmo), a 6-Thio-deoxyguanosine (G6td), a 2’-O-methyl G (Gom), a 2'-NH2 G(Gam), a G, or a 2'-Fluoro G (Gf);(z) L14 comprises a PO, a msl, a pg, a ps, or an eop linkage, wherein when L14 is an eop linkage X14 is G;(aa) X15 comprises an A, an Af, a lock nucleic acid A (Aln), a 2'-O- methoxyethyl A (Amo), an Atna, a RNA (2’ -OH) A (Ar), or an Aom; and (bb) L15 comprises a pg, a bsl, a msl, a PO, a ps, or an eop linkage, wherein when X15 is Amo LI 5 is a msl or pg linkage, when X15 is a Atna LI 5 is a PO linkage, when X15 is an Aom LI 5 is a PO linkage, when X15 is Ar L15 is a PO linkage, when L15 is an ps linkage X15 is A, and when L15 is an eop linkageP-634420-PCX15 is A; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

2. The modified DZyme according claim 1, wherein(a) the first substrate-binding arm and the second substrate-binding arm each independently comprise 4-18 nucleotides;(b) the backbone linkages 3' of X-2 (L-2) and 3' of X-l (L-l) in the first substrate-binding arm are modified, wherein the modifications each independently comprise a msl, a pg, or a b si linkage; and(c) the backbone linkages in the first substrate-binding arm and the second substrate binding arm do not comprise consecutive deoxynucleotides with either ps or PO linkages.

3. The modified DZyme according to claim 1 or claim 2, wherein the modified catalytic core comprises nucleotides 9-23 in each of SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925 (dz017974), SEQ ID NO: 926 (dz017973), SEQ ID NO: 793 (dz014614), SEQ ID NO: 796 (dz013834), SEQ ID NO: 797 (dz017281), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 802 (dz017288), and SEQ ID NO: 805 (dz016265), and at nucleotides 8-22 of the DZyme sequences set forth in SEQ ID NO: 786 (dz013860), SEQ ID NO: 887 (dz013859), SEQ ID NO: 788 (dz013858), SEQ ID NO: 789 (dz013857), SEQ ID NO: 790 (dz013856), SEQ ID NO: 791 (dz013855), and SEQ ID NO: 792 (dz008804), or at nucleotides 9-23 of SEQ ID NO: 798 (dz017283), SEQ ID NO: 927 (dz017561), SEQ ID NO: 877 (dz016419), SEQ ID NO: 872 (dz016418), SEQ ID NO: 930 (dz016896), SEQ ID NO: 931 (dz016895), and SEQ ID NO: 932 (dz016894).

4. The modified DZyme according to any one of claims 1-3, wherein the nucleotide sequence of the modified DZyme comprises SEQ ID NO: 807 (dz017417), SEQ ID NO: 923 (dz016893), SEQ ID NO: 920 (dz017415), SEQ ID NO: 921 (dz017414), SEQ ID NO: 806 (dz016259), SEQ ID NO: 922 (dz016891), SEQ ID NO: 803 (dz017416), SEQ ID NO: 804 (dz016266), SEQ ID NO: 801 (dz016261), SEQ ID NO: 924 (dz016892), SEQ ID NO: 925P-634420-PC(dz017974), SEQ ID NO: 926 (dz017973), SEQ ID NO: 793 (dz014614), SEQ ID NO: 796 (dz013834), SEQ ID NO: 797 (dz017281), SEQ ID NO: 799 (dz014605), SEQ ID NO: 800 (dz014608), SEQ ID NO: 802 (dz017288), SEQ ID NO: 805 (dz016265), SEQ ID NO: 887 (dz013859), SEQ ID NO: 788 (dz013858), SEQ ID NO: 789 (dz013857), SEQ ID NO: 790 (dz013856), SEQ ID NO: 791 (dz013855), SEQ ID NO: 792 (dz008804), SEQ ID NO: 927 (dz017561), SEQ ID NO: 877 (dz016419), SEQ ID NO: 872 (dz016418), SEQ ID NO: 930 (dz016896), SEQ ID NO: 931 (dz016895), SEQ ID NO: 932 (dz016894), SEQ ID NO: 786 (dz013860), or SEQ ID NO: 798 (dz017283).

5. The modified DZyme according to claim 1 or claim 2, wherein the modified catalytic core, DZyme Core XXVIII, comprises nucleotides 10-24 of SEQ ID NO: 1 represented as follows G, LI, X2, L2, X3, L3, X4, L4, X5, L5, G, L6, X7, L7, X8, L8, X9, L9, X10, L10, Xll, Lil, A, L12, X13, L13, X14, L14, X15, andL15; and(a) LI comprises a bsl, a msl, or a ps linkage;(b) X2 comprises a G, a Gom or a Gsg;(c) L2 comprises a pg, a bsl, or a msl linkage, wherein when X2 is a Gsg then L2 is a msl linkage;(d) X3 comprises a C or a Ctna;(e) L3 comprises a PO, a msl, or a bsl linkage, wherein when X3 is a Ctna L3 is a PO or a msl linkage;(f) X4 comprises a U5fd a T, a Ud, or a Uf;(g) L4 comprises a PO, a pg, or a ps linkage;(h) X5 comprises an A or an A4me;(i) L5 comprises a PO, a msl, a bsl, a ps, or a pg linkage, wherein when L5 is a ps linkage X5 is A;(j) L6 comprises a pg, a msl, or a ps linkage;(k) X7 comprises a C or a Cam;(l) L7 comprises a pg, a bsl, a msl, or a PO linkage;(m)X8 comprises a Uom, a U6azadu, a Tmo, a Uuna, a Uf, Tl, a TSgna, or a T12d, or is absent;(n) L8 comprises a PO, a bsl, or a msl linkage;(o) X9 comprises an A, an A78, or an Acar;(p) L9 comprises a pg or a msl linkage, wherein when X9 is Acar L9 is a msl linkage;P-634420-PC(q) X10 comprises a C, a Cmc, a C4me, or a Che;(r) L10 comprises a pg or a msl linkage, wherein when X10 is Cmc L10 is a pg linkage, when X10 is C4me L10 is a pg linkage, and when X10 is Chc L10 is a msl linkage;(s) X11 comprises an Af or an A;(t) LI 1 comprises a msl, a pg, a PO, or a ps linkage;(u) L12 comprises a pg, a msl, a bsl, or a ps linkage;(v) X13 comprises a C or a Cmc;(w)L13 comprises a bsl, a msl, a ps, or a pg linkage, wherein when X13 is Cmc L13 is a msl linkage;(x) X14 comprises a Gmo, a G6td, a Gam, a G, or a Gf;(y) L14 comprises a PO, a msl, a pg, or a ps linkage;(z) X15 comprises an A, an Af, an Aln, an Amo, or an Atna; and(aa) L15 comprises a pg, a bsl, a msl, a PO, or a ps linkage, wherein when X15 is Amo LI 5 is a msl or pg linkage, when X15 is a Atna LI 5 is a PO linkage, and wherein when L15 is a ps linkage X15 is A.

6. The modified DZyme according any one of claims 1-2 and 5, wherein the modified catalytic core, DZyme Core XXIX, comprises nucleotides 10-24 of SEQ ID NO: 1 represented as follows G, LI, X2, L2, X3, L3, X4, L4, A, L5, G, L6, X7, L7, X8, L8, X9, L9, C, LIO, X11, L11, A, L12, C, L13, X14, L14, A, and L15; and(a) LI comprises a bsl or a msl linkage;(b) X2 comprises a G or a Gom;(c) L2 comprises a pg, a bsl, or a msl linkage;(d) X3 comprises a C or a Ctna;(e) L3 comprises a PO, a msl, or a bsl linkage, wherein when X3 is a Ctna L3 is a PO or a msl linkage;(f) X4 comprises a U5fd a T, a Ud, or a Uf;(g) L4 comprises a PO, a pg, or a ps linkage;(h) L5 comprises a msl, a bsl, or a pg linkage;(i) L6 comprises a pg or a msl linkage;(j) X7 comprises a C or a Cam;(k) L7 comprises a pg, a bsl, or a msl linkage;(l) X8 comprises a Uom, a U6azadu, or a Uuna;P-634420-PC(m)L8 comprises a PO, a bsl, or a msl linkage;(n) X9 comprises an A or an A78;(o) L9 comprises a pg or a msl linkage;(p) LIO comprises a pg or a msl linkage;(q) XI 1 comprises an Af or an A;(r) LI 1 comprises a msl, a pg, or a PO linkage;(s) L12 comprises a pg or a msl linkage;(t) L13 comprises a bsl, a msl, or a pg linkage;(u) X14 comprises a Gmo, a G6td, or a Gam;(v) L14 comprises a PO, a msl, or a pg linkage; and(w)L15 comprises a pg or a msl linkage.

7. The modified DZyme according any one of claims 1-2 and 5-6, wherein the modified catalytic core, DZyme Core XXX, comprises nucleotides 10-24 of SEQ ID NO: 1 represented as follows Gmsl, X2, L2, X3, L3, X4, L4, A, L5, G, L6, X7, L7, X8, msl, X9, L9, C, LIO, Af, Lil, A, L12, C, L13, X14, L14, A, and L15; and(a) X2 comprises a G or a Gom;(b) L2 comprises a pg or a msl linkage;(c) X3 comprises a C or a Ctna;(d) L3 comprises a PO or a msl linkage;(e) X4 comprises a U5fd a T, a Ud, or a Uf;(f) L4 comprises a PO, a pg, or a ps linkage;(g) L5 comprises a msl or a pg linkage;(h) L6 comprises a pg or a msl linkage;(i) X7 comprises a C or a Cam;(j) L7 comprises a pg or a msl linkage;(k) X8 comprises a Uom, a U6azadu, or a Uuna;(l) X9 comprises an A or an A78;(m)L9 comprises a pg or a msl linkage;(n) LIO comprises a pg or a msl linkage;(o) LI 1 comprises a msl or a pg linkage;(p) L12 comprises a pg or a msl linkage;(q) L13 comprises a msl or a pg linkage;(r) X14 comprises a Gmo, a G6td, or a Gam;P-634420-PC(s) L14 comprises a msl or a pg linkage; and(t) LI 5 comprises a pg or a msl linkage.

8. The modified DZymes according to any one of claims 1-2 and 5-7 wherein the modified catalytic core, DZyme Core XXX, comprises nucleotides 10-24 of any of SEQ ID NO: 664 (dz017531), SEQ ID NO: 845 (dz017970), SEQ ID NO: 665 (dz017530), SEQ ID NO: 666 (dz016336), SEQ ID NO: 626 (dz014629), SEQ ID NO: 850 (dz017971), SEQ ID NO: 627 (dz016331), SEQ ID NO: 667 (dz017533), SEQ ID NO: 668 (dz016361), SEQ ID NO: 669 (dz016340), SEQ ID NO: 620 (dz014626), SEQ ID NO: 678 (dz017534), SEQ ID NO: 625 (dz016330), SEQ ID NO: 632 (dz016329), SEQ ID NO: 683 (dz017538), SEQ ID NO: 628 (dz016332), SEQ ID NO: 686 (dz017535), SEQ ID NO: 546 (dz013895), SEQ ID NO: 623 (dz014627), SEQ ID NO: 616 (dz014625), SEQ ID NO: 690 (dz017539), SEQ ID NO: 693 (dz015925), SEQ ID NO: 544 (dz013893), SEQ ID NO: 615 (dz014632), SEQ ID NO: 547 (dz013896), SEQ ID NO: 559 (dz013899), SEQ ID NO: 618 (dz014633), SEQ ID NO: 526 (dz012805), SEQ ID NO: 622 (dz015707), SEQ ID NO: 624 (dz015704), SEQ ID NO: 560 (dz013900), SEQ ID NO:703 (dz016333), SEQ ID NO: 562 (dz013902), SEQ ID NO: 708 (dz015924), SEQ ID NO: 545 (dz013894), SEQ ID NO: 619 (dz014631), SEQ ID NO: 714 (dz015927), SEQ ID NO: 557 (dz013898), SEQ ID NO: 529 (dz012807), SEQ ID NO: 527 (dz012806), SEQ ID NO: 717 (dz015708), SEQ ID NO: 636 (dz015709), SEQ ID NO: 563 (dz013903), SEQ ID NO: 663 (dz014636), SEQ ID NO: 621 (dz015705), SEQ ID NO: 722 (dz016342), SEQ ID NO: 617 (dz016343), SEQ ID NO: 558 (dz013904), SEQ ID NO:561 (dz013901), SEQ ID NO: 524 (dz010726), SEQ ID NO: 535 (dz012813), SEQ ID NO: 525 (dz012804), SEQ ID NO: 556 (dz013897), SEQ ID NO: 553 (dz012800), SEQ ID NO: 650 (dz016388), SEQ ID NO: 641 (dz017517), SEQ ID NO: 630 (dz017518), SEQ ID NO: 679 (dz016334), SEQ ID NO: 670 (dz016387), SEQ ID NO: 682 (dz016360), SEQ ID NO: 593 (dz016355), SEQ ID NO: 684 (dz016389), SEQ ID NO: 671 (dz016357), SEQ ID NO: 672 (dz016359), SEQ ID NO: 655 (dz015702), SEQ ID NO: 687 (dz016358), SEQ ID NO: 688 (dz016385), SEQ ID NO: 631 (dz016338), SEQ ID NO: 638 (dz017519), SEQ ID NO: 640 (dz017607), SEQ ID NO: 639 (dz015710), SEQ ID NO: 705 (dz016398), SEQ ID NO: 629 (dz017608), SEQ ID NO: 709 (dz017536), SEQ ID NO: 637 (dz017609), SEQ ID NO: 711 (dz016386), SEQ ID NO: 715 (dz016401), SEQ ID NO: 719 (dz015729), SEQ ID NO: 724 (dz016335), SEQ ID NO: 729 (dz016341), SEQ ID NO: 660 (dz017280), SEQ ID NO: 635 (dz016337), SEQ ID NO: 736 (dz015700), SEQ ID NO: 738 (dz015730), SEQ ID NO: 634 (dz017520), SEQ ID NO: 742 (dz016339), SEQ ID NO: 756 (dz015701),P-634420-PCSEQ ID NO: 646 (dz015731), SEQ ID NO: 633 (dz017610), SEQ ID NO: 642 (dz015711), SEQ ID NO: 647 (dz015732), and SEQ ID NO: 643 (dz015712).

9. A modified DZyme targeting an RNA transcript, said modified DZyme comprising in 5’ to 3’ order:(i) a first substrate-binding arm comprising a nucleotide sequence that base pairs with a first region of the RNA transcript;(ii) a modified catalytic core, DZyme Core XXXI, comprising nucleotides 10-24 of SEQ ID NO: 1, wherein nucleotides are represented as X1-X15 and backbone linkages between the nucleotides are represented as L1-L15 beginning with the linkage between XI and X2, and wherein at least X2 is G or Gom, L2 is pg, X3 is C or Ctna, L6 is pg, X7 is C or Cam, L7 is pg, L9 is pg, L10 is pg, X11 is A or Af, L12 is pg, X14 is Gmo or Gf, and L15 is pg; and(iii) a second substrate-binding arm comprising a sequence that base pairs with a second region of the RNA transcript positioned 5’ to the first region of the RNA transcript.

10. The modified DZyme according claim 9, wherein(a) the first substrate-binding arm and the second substrate binding arm each independently comprise 4-18 nucleotides;(b) the backbone linkages 3' of X-2 (L-2) and 3' of X-l (L-l) in the first substrate-binding arm are modified, wherein the modifications each independently comprise a msl, a pg, or a b si linkage; and(c) the backbone linkages in the first substrate-binding arm and the second substrate binding arm do not comprise consecutive deoxynucleotides with either ps or PO linkages.

11. The modified DZymes according to claim 9 or claim 10, wherein the modified catalytic core, DZyme Core XXXI, comprises nucleotides 10-24 of any of SEQ ID NO: 851 (dz016910), SEQ ID NO: 852 (dz016906), SEQ ID NO: 584 (dz016348), SEQ ID NO: 853 (dz016907), SEQ ID NO: 584 (dz016348), SEQ ID NO: 582 (dz016347), SEQ ID NO: 854 (dz016426), SEQ ID NO: 598 (dz017213), SEQ ID NO: 600 (dz017215), SEQ ID NO: 601 (dz017216), SEQ ID NO: 580 (dz016346), SEQ ID NO: 605 (dz017220), SEQ ID NO: 599 (dz017214), SEQ ID NO: 604 (dz017219), SEQ ID NO: 859 (dz016425), SEQ ID NO: 860 (dz016427), SEQ ID NO: 861 (dz016909), SEQ ID NO: 587 (dz016351), SEQ ID NO: 597 (dz017212), SEQ ID NO:603 (dz017218), SEQ ID NO: 610 (dz017225), SEQ ID NO:P-634420-PC607 (dz017222), SEQ ID NO: 567 (dz013908), SEQ ID NO: 594 (dz016500), SEQ ID NO: 606 (dz017221), SEQ ID NO: 585 (dz016349), SEQ ID NO: 581 (dz016344), SEQ ID NO: 586 (dz016350), SEQ ID NO: 608 (dz017223), SEQ ID NO: 577 (dz014643), SEQ ID NO: 590 (dz015727), SEQ ID NO: 583 (dz016496), SEQ ID NO: 578 (dz016345), SEQ ID NO: 886 (dz016911), SEQ ID NO: 573 (dz015726), SEQ ID NO: 887 (dz016428), SEQ ID NO: 609 (dz017224), SEQ ID NO: 602 (dz017217), SEQ ID NO: 574 (dz014640), SEQ ID NO: 574 (dz014640), SEQ ID NO: 572 (dz014638), SEQ ID NO: 575 (dz014641), SEQ ID NO: 649 (dz017526), SEQ ID NO: 576 (dz014642), SEQ ID NO: 70 (dz013911), SEQ ID NO: 571 (dz014639), SEQ ID NO: 569 (dz013910), SEQ ID NO: 912 (dz017529), SEQ ID NO: 588 (dz016352), SEQ ID NO: 595 (dz014645), SEQ ID NO: 664 (dz017531), SEQ ID NO: 641 (dz017517), SEQ ID NO: 592 (dz016354), SEQ ID NO: 640 (dz017607), SEQ ID NO: 593 (dz016355), SEQ ID NO: 724 (dz016335), SEQ ID NO: 709 (dz017536), SEQ ID NO: 829 (dz017148), and SEQ ID NO: 826 (dz017146).

12. The modified DZymes according to any one of claims 9-11, wherein the nucleotide sequence of the modified DZyme comprises SEQ ID NO: 829 (dz017148), or SEQ ID NO: 826 (dz017146).

13. The DZyme according to any one of claims 1-12, wherein the first substrate-binding arm is 100% complementary to the first region of the RNA transcript or partially complementary to the first region of the RNA transcript with no more than four mismatches; and the second substrate -binding arm is 100% complementary to the second region of the RNA transcript or partially complementary to the second region of the RNA transcript with no more than four mismatches.

14. The modified DZyme according to any one of claims 1-13, wherein said first substratebinding arm comprises at least 1 modified nucleosides, said at least 1 modified nucleosides substituting for the at least one terminal nucleosides of said binding arm and said second substrate-binding arm comprises at least 1 modified nucleosides, said at least 1 modified nucleosides substituting for the at least one terminal nucleotides of said binding arm.

15. The modified DZyme according to claim 14, wherein said modified nucleosides comprise an om, a tna, a mo, a In, a cET, 2’-F, or 2’-NH2 or any combination thereof.

16. The modified DZyme according to any one of claims 1-15, wherein said first substrate-P-634420-PCbinding arm further comprises at least 1 linker modification substituting for the at least one terminal POs of said binding arm and said second substrate-binding arm further comprises at least 1 linker modification substituting for the at least one terminal POs of said binding arm.

17. The modified DZyme according to claim 16, wherein said modifications comprise a ps, a msl, or a pg linkage.

18. A nucleic acid comprising a modified DZymes according to any one of claims 1-17.

19. The DZyme according to any one of claims 1-17 or the nucleic acid according to claim 18, wherein the DZyme or the nucleic acid is conjugated to a carrier moiety.

20. A lipid nanoparticle (LNP) encapsulating a modified DZyme according to any one of claims 1-17 and 19, or encapsulating the nucleic acid according to claim 18.

21. A pharmaceutical composition comprising a modified DZyme according to any one of claims 1-17 and 19, or a nucleic acid according to claim 18, or an LNP according to claim 20, and a pharmaceutically acceptable carrier.

22. An effective amount of a modified DZyme according to any one of claims 1-17 and 19, a nucleic acid according to claim 18, a LNP according to claim 20, or a pharmaceutical composition according to claim 21, for use in the treatment of a disease or condition.

23. The effective amount of the modified DZyme, the nucleic acid, the LNP, or the pharmaceutical composition for use according to claim 22, wherein said disease or condition is caused by a gene comprising at least one heterozygous single-nucleotide polymorphism (SNP), wherein said at least one heterologous SNP comprises a purinepyrimidine cleavage site (RY) sequence in the disease-causing allele and said RNA transcript encodes the disease-causing allele.

24. The effective amount of the modified DZyme, the nucleic acid, the LNP, or the pharmaceutical composition for use according to claim 23, wherein said RY comprises a GU or AU sequence.P-634420-PC25. The effective amount of the modified DZyme, the nucleic acid, the LNP, or the pharmaceutical composition for use according to any one of claims 22-24, wherein said disease or condition is Huntington’s disease, said heterozygous SNP is SNP rs362307, and said DZyme cleaves an RNA transcript encoding a rs362307-U allele (SEQ ID NO: 934) and does not cleave an RNA transcript encoding the rs362307-C allele (SEQ ID NO: 933).

26. The effective amount of the modified DZyme, the nucleic acid, the LNP, or the pharmaceutical composition for use according to any one of claims 22-24 wherein said disease or condition comprises a cancer expressing a G12V mutation in the KRAS oncoprotein, and said DZyme cleaves an RNA transcript encoding the G12V KRAS mutation and does not cleave an RNA transcript encoding G12 KRAS.

27. The effective amount of the modified DZyme, the nucleic acid, the LNP, or the pharmaceutical composition for use according to any one of claims 22-26 wherein said treating reduces or inhibits expression of a gene associated with the disease or condition.

28. The effective amount of the modified DZyme, the nucleic acid, the LNP, or the pharmaceutical composition for use according to any one of claims 22-27, wherein said RNA transcript is associated with the disease or condition, and said administration leads to cleavage of the RNA transcript.

29. An effective amount of a modified DZyme according to any one of claims 1-17 and 19, a nucleic acid according to claim 20, a LNP according to claim 20, or a pharmaceutical composition according to claim 21, for use in the treatment of a disease or condition, wherein said disease or condition is caused by a gene comprising at least one heterozygous single-nucleotide polymorphism (SNP), wherein said at least one heterologous SNP comprises(a) a pyrimidine to purine mutation 5’ to a pyrimidine in the disease-causing allele and said RNA transcript encodes the disease causing allele; or(b) a purine to pyrimidine mutation 3’ to a purine in the disease-causing allele and said RNA transcript encodes the disease causing allele.

30. The effective amount of a modified DZyme, the nucleic acid, the LNP, or theP-634420-PCpharmaceutical composition, for use according to claim 29, for use wherein said purine present in said at least one heterologous SNP is selected from a guanine or adenine, and said pyrimidine present in said at least one heterologous SNP is selected from a thymine or a cytosine.

Images