Compositions and methods for reducing protein aggregation, neurodegeneration and / or proteinopathies

Abstract

Provided here are compositions and methods for reducing protein aggregation in a neuronal cell and / or reducing or treating a proteinopathy or neurodegeneration in a subject. In some embodiments the protein comprises TDP-43 or a TDP-43 variant.

Description

Attorney Docket: 10504- 109WO1 COMPOSITIONS AND METHODS FOR REDUCING PROTEIN AGGREGATION, NEURODEGENERATION AND / OR PROTEINOPATHIESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U. S. Provisional Application No. 63 / 730,230, filed December 10, 2024, the entirety of which is hereby incorporated by reference herein for all purposes.REFERN CE TO SEQUENCE LISTING

[0002] The sequence listing submitted on December 10, 2025, as an. XML entitled “10504- 109WO1. xml” created on December 10, 2025, and having a file size of 88,020 bytes is hereby incorporated by reference pursuant to 37 C. F. R. § 1.52(e)(5).STATEMENT OF GOVERNMENT INTEREST

[0003] This invention was made with government support under W81 XWH-20- 1 -0242 awarded by the Defense Health Agency, Medical Research and Development Branch (DHA / MRDB) and under NS127187; NS105756; AG064940 and NS129101 awarded by the National Institutes of Health. The government has certain rights in this invention. BACKGROUND OF THE INVENTION

[0004] There are no effective therapeutics for several fatal TDP-43 proteinopathies, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), limbic- predominant age-related TDP-43 encephalopathy (LATE), Alzheimer’s disease (AD), and chronic traumatic encephalopathy. A unifying pathological feature of degenerating neurons in approximately 97% of ALS cases, approximately 45% of FTD cases, ail LATE cases, approximately 57% of AD cases, and approximately 85% of CTE cases is the aberrant cytoplasmic mislocalization and aggregation of TDP-43. TDP-43 is an essential and predominantly nuclear RNA-binding protein with a prion-like domain (PrLD), which plays critical roles in numerous RNA processing modalities, including regulation of splicing, polyadenylation, and transcript stability.

[0005] TDP-43 contains two RNA recognition motifs (RRMs), RRM1 and RRM2, which engage RNA and confer a preference for UG-rich binding motifs (Fig. 1 A). TDP- 43 also contains an intrinsically disordered PrLD, which includes a short, conserved region (CR) with transient a-helical structure (Fig. 1 A). The CR plays a pivotal role in TDP-43 phase separation and aggregation. Typically, wild-type (WT) TDP-43 aggregates in disease, but rare forms of disease are connected with TDP-43 missenseAttorney Docket: 10504- 109WO1 variants. The PrLD harbors the vast majority of disease-linked mutations. Aberrant post- translational modifications (PTMs) of TDP-43 are prevalent in disease, including hyperphosphorylation and lysine acetylation.

[0006] RNA has recently emerged as a potent solubilizing agent for TDP-43 in vitro.Indeed, one short 34-nucleotide (nt) RNA derived from the 3’UTR of the TARDBP mRNA, termed Clip34 (Table 1 and Fig. IB), which TDP-43 binds to regulate its own expression, can prevent and reverse WT TDP-43 phase separation and aggregation at the pure protein level and in engineered human cell lines. There has been great success in utilizing short oligonucleotides (e.g., antisense oligonucleotides [ASOs]) as therapeutics for patients with various diseases, including cases where the oligonucleotide must exert its effect in the brain. Thus, Clip34 and potentially other short RNA chaperones are strong candidates as therapeutic agents to treat TDP-43 proteinopathies.

[0007] Several critical barriers, however, limit our understanding of short RNA chaperones like Clip34, which restricts their development. First, it is not clear how short RNAs must engage TDP-43 to antagonize aberrant assembly. Second, it remains uncertain how short RNAs might alter TDP-43 structure to prevent aberrant TDP-43 assembly. Third, it is unclear whether short RNAs can prevent aggregation of diverse disease-linked TDP-43 variants, including missense mutants and TDP-43 bearing disease-linked PTMs. Fourth, it is not clear whether RNA sequences exist that have enhanced chaperone activity against TDP-43 beyond Clip34. Finally, it is not known whether short RNAs can mitigate aberrant TDP-43 phenotypes in patient-derived neurons or mouse models of disease.SUMMARY OF THE INVENTION

[0008] The present disclosure answers these and other unmet needs. Identified herein is the mechanism by which specific, short RNAs must engage TDP-43 and alter its structure to antagonize aggregation. By exploring sequence space, short RNA chaperones have been uncovered with enhanced chaperone activity against TDP-43 and diverse disease-linked variants. Importantly, enhanced short RNA chaperones correct aberrant TDP-43 phenotypes in optogenetic cellular models, ALS patient-derived and control motor neurons, and mice. The present disclosure reveals mechanistic aspects of short RNA chaperone activity and pave the way for the development of short RNA therapeutics for several fatal TDP-43 proteinopathies.Attorney Docket: 10504- 109WO1

[0009] The present invention provides a composition for reducing a proteinopathy or neurodegeneration in a subject comprising, an oligonucleotide that binds to or reduces aggregation of one or more TDP-43 or one or more TDP-43 variants.

[0010] In some embodiments, the oligonucleotide comprises SEQ ID NO: 10, SEQ ID N():9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, SEQ ID NO: 19, or a modification or fragment thereof. In some embodiments, the oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 10, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO: 19.

[0011] In some embodiments, the oligonucleotide comprises SEQ ID NO:5, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16, or a modification or fragment thereof.

[0012] In some embodiments, the oligonucleotide comprises SEQ ID NO: 10, or a modification or fragment thereof.

[0013] In some embodiments, the modification is a 2’ OMe modification.

[0014] In certain aspects, the proteinopathy or neurodegeneration comprises Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), and Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), Iambic-predominant Age- related TDP-43 Encephalopathy (LATE), Multisystem Proteinopathy, Traumatic Brain Injury, Cortical Basal Degeneration, or Huntington’s Disease.

[0015] In certain aspects, the proteinopathy or neurodegeneration comprises Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), and Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), or Limbic-predominant Age- related TDP-43 Encephalopathy (LATE).

[0016] In some embodiments, the one or more TDP-43 variants are Pl 12H, KI 8 IE, G295T, G298S, A321V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, or S292 / 409 / 410E.

[0017] In some embodiments, the oligonucleotide reduces aggregation of more than one TDP-43 variant. For example, in some embodiments, the oligonucleotide reduces aggregation of two TDP-43 variants. In some embodiments, the oligonucleotide reduces aggregation of three TDP-43 variants, the oligonucleotide reduces aggregation of four TDP-43 variants. In some embodiments, the oligonucleotide reduces aggregation of fiveAttorney Docket: 10504- 109WO1 TDP-43 variants. Also included are embodiments wherein the oligonucleotide reduces aggregation of TDP-43 and one or more TDP-43 variant.

[0018] In some embodiments, the oligonucleotide is selected from a group comprising a short RNA, a small interfering (si) ribonucleic acid (RNA) (siRNA), a microRNA (miRNA), a long noncoding RNA (IncRNA), a short hairpin RNA (shRNA), and an antisense oligonucl eotide.

[0019] Also included herein is a method of treating a proteinopathy or a neurodegeneration in a subject comprising administering to the subject an oligonucleotide that binds to or reduces aggregation of TDP-43 or a variant of TDP-43.

[0020] In some embodiments of the method of treating, the oligonucleotide comprises SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 19, or a modification or fragment thereof. In some embodiments of the method of treating, the oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NOT, SEQ ID NO:8, or SEQ ID NO:19.

[0021] In some embodiments of the method of treating, the oligonucleotide comprises SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NOT3, SEQ ID NO:14, SEQ ID NO: 15, or SEQ ID NO: 16, or a modification or fragment thereof.

[0022] In some embodiments of the method of treating, the oligonucleotide comprises SEQ ID NO:10, or a modification or fragment thereof.

[0023] In some embodiments of the method of treating, the modification is a 2’ OMe modification.

[0024] In some embodiments of the method of treating, the proteinopathy or neurodegeneration comprises Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), and Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), Limbic-predominant Age-related TDP-43 Encephalopathy (LATE), Multisystem Proteinopathy, Traumatic Brain Injury, Cortical Basal Degeneration, and Huntington’s Disease. In other embodiments, the proteinopathy or neurodegeneration comprises Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), and Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), or Limbic-predominant Age- related TDP-43 Encephalopathy (LATE).Attorney Docket: 10504- 109WO1

[0025] In some embodiments of the method of treating, the one or more TDP-43 variants are P112H, K181E, G295T, G298S, A321V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, or S292 / 409 / 410E.

[0026] Further included is a method of reducing protein aggregation in a neuronal cell comprising contacting the neuronal cell with a composition comprising SEQ ID NO: 10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO: 8, SEQ ID NO: 19, or a modification or fragment thereof. In other embodiments of the method of reducing protein aggregation, the oligonucleotide that comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 10, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO: 19.

[0027] In other embodiments, the composition comprises SEQ ID NO:5, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16, or a modification or fragment thereof. In still other embodiments, the composition comprises SEQ ID NO: 10.

[0028] In some embodiments of the method of reducing protein aggregation, the protein is TDP-43. The TDP-43 can comprise SEQ ID NO:1. In other or further embodiments, the protein is a TDP-43 variant. The TDP-43 variant can comprise Pl 12H, K181E, G295T, G298S, A321V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, or S292 / 409 / 410E.

[0029] In some embodiments, the neuronal cell is a sensory neuron, motor neuron, interneuron, or anoxic neuron.BRIEF DESCRIPTION OF FIGURES

[0030] Figure l(A-N) shows Clip34 is an allosteric antagonist of TDP-43 aggregation.(A) Domain map of TDP-43 indicating the locations of five phenylalanine -to-leucine mutations within RRM1 and RRM2, and the A326P mutation in the PrLD. (B) RNA sequence of Clip34 (SEQ ID NO:1). Clip34 is a 34nt RNA derived from the 3’ UTR of TARDBP RNA, to which TDP-43 binds to autoregulate its expression. (C) Area under the curve (AUG) of standardized aggregation turbidity data for each TDP-43 deletion construct, normalized to WT TDP-43. Data are mean + SEM (n=3; one-way ANOVA with Dunnett’s correction comparing to WT; *p < 0.05). (D-I) AUG of turbidity data for each variant normalized to its respective No RNA control. The domain map for the construct used in each assay is shown above the graph. For (D) and (F to I), No RNAAttorney Docket: 10504- 109WO1 conditions are based on the same data as shown in (C). Data are mean ± SEM (n=3; n=13 for (E); one-way ANOVA with Dunnett’s correction comparing to No RNA; **p < 0.01, ****p < 0.0001). (J) Bound 5’ 6-FAM Clip34 signal for EMSAs performed with indicated TDP-43-MBP-His variants or MBP-His. Data are mean ± SEM (n=3 for TDP- 43 valiants; n=2 for MBP-His; shown is the nonlinear regression: [agonist] vs. response with variable slope, of the combined replicates). (K) AUG of TDP-435FLturbidity data normalized to the No RNA control. Data are mean ± SEM (n=3; one-way ANOVA with Dunnett’s correction comparing to No RNA; ****p < 0.0001). (L) Apparent KD values calculated from the bound signal from individual replicates of EMSAs performed with 5’ 6-FAM Clip34 and WT TDP-43-MBP-His or the indicated TDP-43 variant. WT data shown is the same data as in (J). Data are mean ± SEM (n=3; one-way ANOVA with Dunnett’s correction comparing to WT; *p< 0.05; **p< 0.01; ***p < 0.001; ****p < 0.0001). (M) Secondary structure of Clip34 as predicted by RNAstructure. Text color indicates the probability for each nucleotide, as in the legend. (N) ECso values calculated from individual replicates of relative fluorescence intensity for 5’ 6-FAM Clip343’ BHQ1 with indicated TDP-43-MBP-His variants. Data are mean ± SEM (n=3; 100 nM RNA; one-way ANOVA with Dunnett’s correction comparing to WT; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

[0031] Figure 2( A-G) shows hydrogen / deuterium-exchange reveals stabilization of the TDP-43 RRMs and destabilization of the CR within the PrLD upon Clip34 RNA binding. (A) Top: domain map of TDP-43, aligned with data underneath. Botom: For each timepoint, residues are colored corresponding to the consensus percentage difference in exchange between the Clip34-bound (2: 1:: [Clip34]: [TDP-43]) and free states as indicated in the legend, as calculated by manual analysis of percentage exchange differences for all peptides including an amino acid. White spaces represent small coverage gaps. (B) The consensus percentage difference in exchange between Clip34-bound and free states at the 4.5 hour timepoint shown again as in (A). Aligned beneath it are peptides analyzed at the 4.5 hour timepoint, with percentage differences in exchange between Clip34-bound and free states for each peptide colored as shown in the legend for (A). Amino acid number is indicated on the axis below. (C) Image was generated using Pymol. Consensus percentage difference in exchange between Clip34- bound and free states at the 4.5 h timepoint is shown on the structure of the RRMs bound to AUG12 RNA (PDB: 4BS2), colored according to the legend in (A). The RRMs are represented as a cartoon, whereas the RNA is represented as a stick. (D) HX for aAttorney Docket: 10504- 109WO1 representative RRM1 peptide (VQVKKDEKTGHSKGFGFVRF, SEQ ID NO:44). The dashed line represents the fully-deuterated condition. Data are mean ± SD (n=3-7 replicates run on mass spectrometry per timepoint; some error bars are too small to visualize; Welch’s t-test comparing bound and free at each timepoint; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). (E) The consensus percentage difference in exchange between Clip34-bound and free states at the 2 s timepoint shown again as in (A). Aligned beneath it are peptides analyzed at the 2 s timepoint, displayed as in (B). (F) Image was generated using Pymol. Consensus percentage difference in exchange between Clip34-bound and free states at the 2 s timepoint shown on the cartoon representation of the AlphaFold structure of WT TDP-43 (Uniprot: QI 3148), downloaded from the AlphaFold Protein Structure Database, colored according to the legend in (A). (G) Representative raw mass spectra at the 2 s timepoint for a representative peptide located in the CR of the PrLD (AAAQAALQSSWGMMGML, SEQ ID NO:45). Signal corresponding to this peptide as determined by appropriate m / z values is colored red, whereas noise from overlapping peptide(s) is colored black.Dashed lines serve as visual guides; the blue dashed line indicates the monoisotopic peak, whereas the purple dashed line indicates the centroid value of the peptide in the fully deuterated sample.

[0032] Figure 3(A-H) shows Clip34 (SEQ ID NO: 1) and Clip34_UG6 (SEQ ID NO:4) effectively prevent aggregation of diverse disease-linked TDP-43 variants. (A) Domain map of TDP-43 to scale (excluding MBP-His solubility tags). Missense mutants (top) and post-translational modification mimetics (bottom) investigated in this study are indicated. (B, C) TDP-43-MBP-His (5 pM) was incubated with TEV protease in the presence or absence of Clip34 (B) or Clip34_UG6 (C) for 16 hours, measuring turbidity every minute in a plate reader. Standardized turbidity data was normalized to the No RNA condition for that replicate; the AUG of this data was utilized to calculate an ICso value (nonlinear regression: [inhibitor] vs. normalized response with variable slope). Data are mean ± SEM (n=5-8; one-way ANOVA with Dunnett’s correction comparing to WT; *p < 0.05, **p < 0.01, ***p < 0.001, ** * *p < 0.0001). (D) RNA sequences of Clip34 and its variants (SEQ ID NO:1, SEQ ID NO: 4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7). Red text represents nucleotides in Clip34, whereas underline text represents nucleotides in Clip34. UG6. (E, F) ICso values for Clip34 and Clip34 variants with WT TDP-43 (E) or TDP-43K145 / 192Q(F). Data are mean + SEM (n=3-4; n.c. indicates that an ICso value could not be accurately calculated). (G, II) Apparent KDAttorney Docket: 10504- 109WO1 values calculated from the bound signal from individual replicates of EMSAs performed with 5’ 6-FAM Clip34 and the indicated TDP-43 protein (G), or TDP-43K145 / 192Qwith 5’ 6-FAM Clip34 or Clip34_UG6 (H). Data shown for TDP-43Kl45 / 19’QwithClip34 is the same in both figure parts, and WT TDP-43 with Clip34 as in Fig. I, J and L. Data are mean ± SEM (n=3; one-way ANOVA with Dunnett’s correction comparing to WT (G), or unpaired t-test (H); ***p< 0.001, ****p < 0.0001).

[0033] Figure 4(A-F) shows Malat1_start RNA (SEQ ID NO: 10) displays enhanced chaperone activity against diverse disease-linked TDP-43 variants. (A) RNA sequences of tested RNAs (SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO: 9, SEQ ID NO:10, SEQ ID NO:11). (B) Heatmap displaying mean values of the individual ICso data shown in Fig. 3 (C, D, F) and in Fig. 15 (C-E). (C) Apparent KD values calculated from bound 5’ 6-FAM signal of the indicated RNAs, from individual replicates of EMSAs performed with WT TDP-43. Clip34 data is the same as shown in Fig. 3G. Data are mean + SEM (n=3-4; one-way ANOVA with Tukey’s correction; *p < 0.05; **p < 0.01). (D) The KD,appfor WT TDP-43 with each indicated RNA, as shown in (C), is plotted against the IC50 for that RNA with WT TDP-43, as shown in (B) (Pearson correlation; not significant). (E) Overlay of Tl-^N heteronuclear single quantum coherence (IISQC) spectra of TDP-43 RRMs with Clip34 RNA (green, 2:l::[Clip34]:[TDP-43]) and Malatl... start RNA (magenta, 2:l::[Malat1_start]:[TDP-43]). (F)1H and15N chemical shift perturbations (A5’H (top) and A5l5N (middle), respectively), and intensity ratios (bottom) of TDP-43 RRMs upon binding of Clip34 (green) and Malat1_start (magenta) RNA. Domain map of TDP-43 RRMs shown at the bottom, aligned to x-axes of graphs.

[0034] Figure 5(A-D) shows Malat1_start RNA (SEQ ID NO:10) mitigates aberrant TDP-43 phenotypes in optogenetic human cell models and patient-derived neurons. (A) Sequence of the control (CTR) RNA (UGUAUUUUGAGCUAGUUUGCUGAU, SEQ ID NO:46). (B) OptoTDP-43 stable HEK293 cells were treated with the indicated RNA, followed by blue light exposure to induce Cry2olig oligomerization, and imaged after fixation. The average area of cytoplasmic puncta per cell, normalized to the average of the CTR-treated condition. Data are mean + SEM (n=3 biological replicates; one-way ANOVA with Dunnett’s correction comparing to CTR; *p < 0.05; **p< 0.01). (C) Representative images of C9orf72-ALS patient iPSC -derived neurons treated with the indicated RNAs, stained with DAPI and for TDP-43 and MAP2. Scale bar indicates 25 gm. (D) The average ratio of TDP-43 nuclear to cytoplasmic signal, normalized to healthy control iPSC-derived neurons without RNA treatment. Data are mean ± SEMAttorney Docket: 10504- 109WO1 (n=3 biological replicates, represented as the average of n=2 technical replicates each; one-way ANOVA with Dunnett’s correction comparing to CTR; *p < 0.05).

[0035] Figure 6(A-F) shows Malat1_start RNA (SEQ ID NO: 10) mitigates neurodegeneration, TDP-43 aggregation, and TDP-43 dysfunction in a mouse model of TDP-43 proteinopathy. (A) Schematic of experimental paradigm. On Day 0 (DO), animals undergo laminectomy and bilateral AAV9 viral injection across the C4-C6 region, to express TDP-43ΔNLSthroughout the ventral horns of cervical spine. On D7, animals undergo a second surgery to receive RNA or saline. Histology was assessed at days 3 (D10) and 5 (D12) following treatment. (B) Representative immunohistochemistry, images of ventral horns at D12, stained for choline acetyltransferase (ChAT). 20x magnification z-stack confocal images; scale bar indicates 100 pm. (C) ChAT+motor neurons were manually counted within the ventral horn of spinal cord sections. Data are mean + SEM (n=10 animals per condition; shown: oneway ANOVA with Dunnett’s correction comparing to D7 TDP-43; ****p < 0.0001; not shown: two-way ANOVA with Sfdak’s correction: ****p < 0.0001 for Malat1_start versus saline at D10 and D12). (D) Representative 60x magnification immunofluorescent staining images from 5 -day (12-day expressing) saline-treated (left) and RNA-treated (right) animals. Scale bar indicates 20 pm. (E) TDP-43 positive puncta were assessed in ChA motor neurons at 60x magnification in the ventral horn for each animal. The average puncta size per neuron was calculated for each animal. Data shown are mean + SEM (n=10 animals per condition; average of 30 neurons per animal; shown: two-way ANOVA with Sfdak’s correction; ****p < 0.0001; not shown: one-way ANOVA with Dunnett’s correction comparing to D7 TDP-43: *p < 0.05 for Malat1_start at D10). (F) The ratio of relative mRNA levels of Sort1 transcripts containing exon 17b to canonical Sort1 transcripts (WT) per animal. Data shown are mean ± SEM (n=10 animals per condition; shown: two-way ANOVA with Sfdak’s correction; ***p < 0.001; ****p < 0.0001; not shown: one-way ANOVA with Dunnett’s correction comparing to D7 TDP- 43- **«p < 0.0001 for D10 Malat1_start and ***p < 0.001 for D12 Malat1_start).

[0036] Figure 7(A-E) TDP-43 purification, aggregation assay, and inefficacy of Clip34 against FUS phase separation. (A, B) 4-15% Tris-HCl SDS-PAGE gels loaded with 1 pg of each indicated purified TDP-43-MBP-His variant (or MBP-His alone) and subsequently stained with Coomassie Brilliant Blue. (C) Schematic of in vitro TDP-43 aggregation prevention assay. TDP-43-MBP-His (5 pM) was incubated with TEV protease (to cleave off the solubilizing MBP-His tag) in the presence or absence of RNAAttorney Docket: 10504- 109WO1 for 16 h, measuring every minute in a plate reader. The standardized turbidity data is normalized so that the No RNA condition maximum value is set to 100; subsequently, the normalized area under the curve (AUC) of this data is taken, which is then utilized to calculate an IC50 value (nonlinear regression: [inhibitor] vs. normalized response with variable slope). (D) Representative lOOx brightfield microscopy images of FUS condensates in the presence or absence of Clip34 RNA, after -2-2.5 h of measurement in the plate reader. The scale bar represents 10 pm (n=9; 3 biological replicates, each consisting of 3 technical triplicates; [RNA]: [FUS]; 2 pM FUS). (E) AUC of turbidity data for the same FUS samples imaged in (D), normalized to the average No RNA value for the respective technical triplicate. Data are mean + SEM (n=9; 3 biological replicates, each consisting of 3 technical triplicates; [RNA]: [FUS]; 2 pM FUS).

[0037] Figure 8(A-F) shows RNA binding and remodeling activity of TDP-43 variants.(A) Representative image of an EMSA for 100 nM 5’ 6-FAM Clip34 with indicated WT TDP-43-MBP-His concentrations, run on a 6% DNA Retardation gel. The vertical bar indicates the approximate area quantified for the bound fraction. (B, C) Bmax(B) and apparent KD (C) values calculated from the bound signal from individual replicates of EMS As performed with 5’ 6-FAM Clip34 and WT TDP-43-MBP-His or the indicated TDP-43 variant, corresponding to summary data in Fig. 1 J. WT data shown is the same data as in Fig. IL. Data are mean ± SEM (n=3-4; one-way ANOVA with Dunnett’s correction comparing to WT; **p< 0.01; ****p < 0.0001). (D) Bound 5’ 6-FAM Clip34 signal for EMSAs performed with indicated TDP-43-MBP-His variants. WT data shown is the same in Fig. 1J. This is the summary data corresponding to KD values calculated from individual replicates, shown in Fig. 11... Data are mean + SEM (n=3; shown is the nonlinear regression: [agonist] vs. response with variable slope, of the combined replicates). (E) Domain maps of TDP-43 partial PrLD deletion constructs. Amino acids deleted, inclusive, are: ACR, aa316-346; AIDR2(G / S), aa367-414. (F) Relative fluorescence intensity values for 5’ 6-FAM Clip343’ BHQ1 with indicated TDP-43- MBP-IIis variants or MBP-IIis. The red arrow indicates the RNA alone condition, which exhibits low fluorescence and is set at zero for relative fluorescence intensity. Data are mean ± SEM (n=3 for TDP-43 variants; n=2 for MBP-His; 100 nM RNA; shown is the nonlinear regression: [agonist] vs. response with variable slope, of the combined replicates). EC50 values were calculated from individual replicates and are shown in Fig. IN.

[0038] Figure 9(A-I) shows Clip34 exhibits enhanced chaperone activity against partialAttorney Docket: 10504- 109WO1 PrLD-deletion valiants. (A) Domain maps of the TDP-43 partial PrLD deletion constructs. Amino acids deleted, inclusive, are: AIDR1, aa274-320; ACR, aa316-346; ACR / IDR2(Q / N), aa321-366; AIDR2(G / S), aa367-414; and ACR / IDR2, aa321-414. (B) Area under the curve (AUG) of standardized aggregation turbidity data for the No RNA condition for each partial PrLD deletion construct, normalized to WT TDP-43 No RNA, tested by in vitro aggregation prevention assays. Data are mean + SEM (n=3-4; one-way ANOVA with Dunnett’s correction comparing to WT; *p < 0.05, **p < 0.01). (C) Heatmap displaying the mean AUG values from in vitro aggregation prevention assays for each TDP-43 variant at the indicated molar concentration ratios, normalized to the respective variant’s No RNA condition. (D-I) Individual replicates of the summary data shown in (C) for each TDP-43 variant. Data are mean ± SEM (n=3-4; one-way ANOVA with Dunnett’s correction comparing to No RNA; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

[0039] Figure 10(A-C) shows hydrogen / deuterium-exchange for TDP-43 in the absence or presence of Clip34 RNA. (A, B ) Heatmaps displaying hydrogen / deuterium-exchange for each TDP-43 amino acid in the free (A) and bound (B) states at each timepoint, normalized so that 1 represents fully deuterated and 0 represents not deuterated. White spaces represent small gaps in coverage. Sub-localization between peptides to determine the exchange value at each amino acid was performed by HDExaminer. All 1 s, 2 s, 6 s, and 18 s timepoints were collected utilizing pH 6.0 buffer; 20 s, 1 min, and 3 min timepoints were collected with some replicates utilizing pH 6.0 buffer and others utilizing pH 7.0 buffer; 10 min and longer timepoints were collected utilizing pH 7.0 buffer. (C) Bound 5’ 6-FAM Clip34 signal for EMSAs performed with WT TDP-43 in pH 6.0 buffer. Data are mean + SEM (n=3; shown curve is the nonlinear regression: [agonist] vs. response with variable slope, of the combined replicates; apparent KD value was calculated from individual replicates).

[0040] Figure 11 shows Hydrogen / deuterium-exchange reveals stabilization of the TDP- 43 RRMs and destabilization of the a-helical conserved region in the PrLD upon Clip34 RNA binding. Top: domain map of TDP-43, aligned with data underneath. Bottom: The consensus percentage difference in exchange between the Clip34-bound and free states at each indicated timepoint is shown again as in Fig. 2A. Aligned beneath each consensus percentage difference in exchange plot are the peptides analyzed at the respective timepoint, with percentage differences in exchange between the Clip34-bound and free states for each peptide colored as shown in the legend. The amino acid number isAttorney Docket: 10504- 109WO1 indicated on the axis below.

[0041] Figure 12(A-N) shows hydrogen / deuterium-exchange deuteration curves illustrate the effects of Clip34 RNA binding on TDP-43 structure. (A-N) HX for representative peptides, with charge state and peptide sequence indicated in the graph titles (SEQ ID NO:47-60). Representative examples are shown of peptides in the NTD (A-C); bridging the NTD and RRM1 (D); in RRM1 (E); bridging RRM1 and the linker between RRMs (F); bridging RRM1, the linker between RRMs, and RRM2 (G); in RRM2 (II, I); in the PrLD primarily outside of the CR (J-L); and primarily within the a- helical conserved region (CR) of the PrLD (M, N). Other regional features of interest include peptides with residues in the nuclear localization sequence (NLS) (C, D) and peptides located in different parts of the PrLD: within IDR1 (J), at the end of the CR and extending into IDR2 (K), and within the glycine- and serine-rich region of IDR2 (L). The dashed line represents the fully-deuterated condition. Data are mean ± SD (n=3-7 replicates run on mass spectrometry per timepoint; error is too small to visualize for a subset of timepoints; Welch’s t-test comparing bound and free at each timepoint; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

[0042] Figure 13(A-C) shows mass spectra illustrate the effects of Clip34 RNA binding on TDP-43 structure. (A-C) Raw mass spectra data, with signal corresponding to the appropriate peptide (SEQ ID NO:59) as determined by appropriate m / z values colored red, and noise from overlapping peptide(s) colored black. The two dashed lines serve as visual guides; the blue dashed line indicates the monoisotopic peak, whereas the purple dashed line indicates the centroid value of the peptide in the fully deuterated sample. Spectra at 1 s, 2 s, and 6 s timepoints for the free and bound states for the indicated peptide in the CR of the PrLD, in addition to the representative spectra shown in Fig. 2G (A). The raw mass spectrum data of a representative non-deuterated sample, and remaining raw mass spectra data for replicates at 1 s, 2 s, and 6 s timepoints for the free and bound states of the indicated peptide, in addition to those shown in Fig. 2G and Fig.13 (B). The raw mass spectrum data of a representative non-deuterated sample, and representative spectra at 1 s and 2 s timepoints for the free and bound states for the indicated peptide (SEQ ID NO:61) in the CR of the PrLD (C).

[0043] Figure 14(A, B) shows hydrogen / deuterium-exchange for TDP-435FLin the absence or presence of Clip34 RNA. (A, B ) Heatmaps displaying hydrogen / deuterium- exchange for each TDP-435FLamino acid in the free (A) and bound (B) states at each timepoint, normalized so that 1 represents fully deuterated and 0 represents notAttorney Docket: 10504- 109WO1 deuterated. White spaces represent small gaps in coverage. Sub-localization between peptides to determine the exchange value at each amino acid was performed by HDExaminer. 2 s limepoints were collected utilizing pH 6.0 buffer, whereas 4.5 h timepoints were collected utilizing pH 7.0 buffer.

[0044] Figure 15(A-E) shows hydrogen / deuterium-exchange reveals that Clip34 induces markedly reduced stabilization of the RRMs of TDP-435FLcompared to WT TDP-43. (A) Top: domain map of TDP-435FL, aligned with data underneath. Bottom: For each timepoint, residues are colored corresponding to the consensus percentage difference in exchange between the Clip34-bound (2:l::[Clip34]:[TDP-435FL]) and free states as indicated in the legend, as calculated by manual analysis of percentage exchange differences for all peptides including an amino acid. White spaces represent small coverage gaps. Aligned beneath each consensus percentage difference map are peptides analyzed at that timepoint, with percentage differences in exchange between Clip34- bound and free states for each peptide colored as indicated in the legend. Amino acid number is indicated on the axis below. (B, C) HX for a representative RRM1 (SEQ ID NO:62) peptide for WT TDP-43 (B) or TDP-435FL(C). The dashed line represents the fully-deuterated condition. Arrows are included in (B) as a visual reference for the timepoints matching timepoints collected for TDP-435FLshown in (C). Data are mean ± SD (n=3-7 replicates run on mass spectrometry per timepoint; some error bars are too small to visualize; Welch’s t-test comparing bound and free at each timepoint; **p < 0.01, ***p < 0.001, ****p < 0.0001). (D, E) HX for a representative RRM2 peptide (SEQ ID NO:63) for WT TDP-43 (D) or TDP-435FL(E). The dashed line represents the fully -deuterated condition. Arrows are included in (D) as a visual reference for the timepoints matching timepoints collected for TDP-435FLshown in (E). Data are mean ± SD (n=3-7 replicates run on mass spectrometry per timepoint; some error bars are too small to visualize; Welch’s t-test comparing bound and free at each timepoint; *p < 0.05, ***p < 0.001, ****p < 0.0001). Small-magnitude stabilizing effects of Clip34 on TDP- 435FL, greatly reduced in magnitude compared to effects seen on WT TDP-43, agree well with the concept of strongly impaired binding affinity of TDP-435FLand consequent weak, transient binding.

[0045] Figure 16(A-D) shows mass spectra for TDP-435FLCR peptides retain bimodality in the presence of Clip34. ( A-D) Raw mass spectra data, with signal corresponding to the appropriate peptide (SEQ ID NO:59 or SEQ ID NO:61) as determined by appropriate m / z values, and noise from overlapping peptide(s). The dashed line serves as a visualAttorney Docket: 10504- 109WO1 guide indicating the monoisotopic peak. Representative spectra at the 2 s timepoint for the free and bound states are displayed for the indicated peptide in the CR of the PrLD for WT TDP-43 (A, C) and TDP-435FL(B, D). Mass spectra for the free state are slightly shifted left for TDP-435FLcompared to WT TDP-43, indicating that F147, F149, F194, F229, and F231 may play a role in priming unfolding of the CR in the apo state of TDP- 43. Mass spectra for samples containing Clip34 display clear bimodality for TDP-435FL, indicating the presence of a stabilized population (corresponding to the a-helical form of the CR) and a destabilized population (corresponding to the unstructured form of the CR), whereas WT TDP-43 spectra only display the destabilized, unstructured form.

[0046] Figure 17(A-G) shows molecular insights from atomistic molecular dynamics simulations (45 ps) into the allosteric coupling between the TDP-43 RRMs, PrLD, and RNA. (A) AUC of standardized turbidity data for aggregation prevention assays with 5 pM WT TDP-43 and AUG12 RNA, normalized to the No RNA condition. Data are mean ± SEM (n=3; one-way ANOVA with Dunnett’s correction comparing to No RNA; **p < 0.01, ****p < 0.0001). (B) CR helix propensity in ANTD constructs without (black) and with RNA (red). Data are mean + SEM. (C) Contacts between protein residues and RNA nucleotides across TDP-43 domains. Data show the mean. The upper panel shows the domain map corresponding to the data in the lower plot. Vertical lines mark the positions of the five Phe residues within RRM1 and RRM2 that are commonly mutated in TDP-435FL. (D) PrLD conformational changes upon RNA binding. Left: Radius of gyration (Rg) distributions. Right: Average intrachain Cαdistances (Rij) as a function of sequence separation (li-jl). Reference scaling laws for ideal chain (magenta, v=1 / 2), self-avoiding random walk (cyan, v=3 / 5), and collapsed globule (yellow, v=1 / 3) are shown, with b=5.5 A. Representative PrLD structures are shown at the bottom. (E) Intramolecular contact maps for the PrLD in the absence (upper diagonal ) and in the presence of RNA (lower diagonal). (F) Distributions of the number of contacts between RRM1-CR, RRM2-CR, RRM1-RRM2, and IDR1-IDR2 domains. Violin plots display the full probability densities with mean shown as a solid black line, highlighting differences between the interaction patterns in the absence and presence of RNA. (G) Model of allosteric crosstalk between the TDP-43 RRMs, PrLD, and RNA. Without RNA, the tandem RRMs show high conformational heterogeneity, whereas the PrLD is compact with a helical CR. RNA binding through conserved Phe residues leads to a more compact tandem RRM ensemble, protecting RRM1 from adopting misfolded states.Attorney Docket: 10504- 109WO1 IDR1-RNA electrostatic interactions remodel the interaction network, disrupting IDR1- IDR2 contacts and CR helicity.

[0047] Figure 18(A-C) shows full-length TDP-43 simulations show that the NTD destabilizes RNA binding. (A) Helix propensity of the conserved region (CR, residues: 319-341) without (black) and with RNA (red). Data are mean ± SEM across three replicates. In the presence of RNA, CR secondary structure is impaired. (B) Radius of gyration (Rg) distributions for backbone atoms of tandem RRMs (left, residues 102-176 and 192-269) and the PrLD (right, residues 270-414). RNA binding leads the tandem RRMs to be more compact while expanding the PrLD. (C) RNA contact profiles over time for full-length (right) and ΔNTD (left) TDP-43. Heat maps show contacts between RNA and each protein residue, with contacts defined as heavy atoms within 4.5 A. The presence of the NTD destabilizes RNA binding, leading to dissociation in FL simulations. Representative structures from the final frame of each trajectory show only tandem RRMs and RNA for clarity.

[0048] Figure 19(A, B) shows TDP-435FLmutations impair RNA binding and restore CR helicity. (A) RNA contact profiles over time for ΔNTD TDP-435FLstarting from the RNA-bound state. Heat maps show contacts between RNA and each protein residue (heavy atoms within 4.5 A). Representative structures show tandem RRMs-RNA relative positioning at the end of each simulation. (B) Secondary structure evolution of PrLD residues 310-350 over time (left) and helix propensity distributions (right). Disrupted Phe-RNA interactions lead to RNA dissociation and CR-helix reformation as evident from Replica 1, supporting that RNA binding is required for allosteric CR destabilization.

[0049] Figure 20( A-C ) shows characterization of the structural changes in the conformational ensemble of the tandem RRMs. (A) Radius of gyration (Rg) distributions for backbone atoms of the tandem RRMs (residues 102-176 and 192-269) without (black) and with RNA (red). (B) Root mean square deviation (RMSD) distribution for RRM1 Cα atoms (residues 102-176). (C) RMSD distribution for RRM2 Cα atoms (residues 192-269).

[0050] Figure 21(A-I) shows Clip34 (SEQ ID NO: 1) and Clip34_. UG6 (SEQ ID NO: 4) effectively prevent aggregation of diverse disease-linked TDP-43 variants. (A, B) 4-20% Tris-HCl SDS-PAGE gels loaded with 1 pg of each indicated purified TDP-43 variant and subsequently stained with Coomassie Brilliant Blue. (C, D) AUG values for No RNA conditions for all examined TDP-43 variants, normalized to WT. For each graph,Attorney Docket: 10504- 109WO1 all data for each replicate was collected within the same experiment. Data are mean ± SEM (n=3; one-way ANOVA with Dunnett’s correction comparing to WT (C) or unpaired t-test (D)). (E, F) Heatmaps displaying the mean normalized AUG value at each tested molar concentration ratio of Clip34 (E) or Clip34_UG6 (F) to TDP-43, across individual replicates of aggregation assays. Data is normalized to the respective variant’s No RNA condition. This data was utilized to calculate the IC50 values depicted in Fig. 3, C and D. (G) Heatmaps displaying the mean normalized AUG value at each tested molar concentration ratio of Clip34 variants to WT TDP-43 or TDP-43Ki45 / 192Q, across individual replicates of aggregation assays. Data is normalized to the respective variant’s No RNA condition. This data was utilized to calculate the IC50 values depicted in Fig. 3, E and F. (II) Bound 5’ 6-FAM Clip34 signal for EMSAs performed with the indicated TDP-43-MBP-His variants. This is the summary data corresponding to KD values calculated from individual replicates, shown in Fig. 3G. WT data is the same as shown in Fig. 1 J and fig. S2D. Data are mean ± SEM (n=3; shown is the nonlinear regression: [agonist] vs. response with variable slope, of the combined replicates). (I) Bound 5’ 6- FAM RNA signal for EMSAs performed with TDP-43K145 / 192Q. This is the summary data corresponding to KD values calculated from individual replicates, shown in Fig. 3H. The Clip34 curve data is the same as shown in (H), included for reference. Data are mean ± SEM (n=3; shown is the nonlinear regression: [agonist] vs. response with variable slope, of the combined replicates).

[0051] Figure 22(A-H) shows Malat1_start (SEQ ID NO: 10), SATIII (SEQ ID NO:9), CLN6. middle (SEQ ID NO: 11), and (UG)17(SEQ ID NO:8) effectively prevent aggregation of diverse disease-linked TDP-43 variants. (A) RNA sequences of tested RNAs. (B ) IC50 values calculated for the indicated TDP-43 variants with (UG)17. Data are mean + SEM (n=7; one-way ANOVA with Dunnett’s correction comparing to WT). (C-E) IC50 values for SATIII (C), Malat1_start (D), or CLN6_middle (E) RNAs with each TDP-43 variant. Data are mean ± SEM (n=5-7; one-way ANOVA with Dunnett’s correction comparing to WT; *p < 0.05). (F-H) Heatmaps displaying the mean normalized AUG value at each tested molar concentration ratio of SATIII (F), Malat1_start (G), or CLN6_middle (H) RNAs to TDP-43, across individual replicates of aggregation assays. Data is normalized to the respective variant’s No RNA condition. This data was utilized to calculate the IC50 values depicted in (C-E).

[0052] Figure 23(A-K) shows several short RNA chaperones effectively prevent aggregation of diverse disease-linked TDP-43 variants. (A) RNA sequences of testedAttorney Docket: 10504- 109WO1 RNAs (SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:11, SEQ ID NO:15, SEQ ID NO:16). (B) Heatmap displaying rankings of the IC50 data shown in Fig. 4B. Rankings of RNA IC50 values are determined for each TDP-43 variant, with a ranking of 1 corresponding to the "‘best” (lowest IC50 value), and a ranking of 5 corresponding to the “worst” (highest IC50 value). (C) The IC50 for each TDP-43 variant: RNA pair is plotted against the hill slope for that same pair, as calculated by nonlinear regression: [inhibitor] vs. normalized response with variable slope, from the combined data of all replicates (Pearson correlation; ****p < 0.0001). (D-G) IC50 values calculated for the indicated TDP-43 variants with Malatl_middle (D), Malatl_end (E), CLN6_start (F), or CLN6_end (G) RNAs. Data are mean ± SEM (n=4-7; one-way ANOVA with Dunnett’s correction comparing to WT; **p < 0.01, ***p < 0.001). (H, I) Quantification of the WT TDP-43 signal in the supernatant after sedimentation was performed at the end timepoint of aggregation assays. 4-20% Tris-HCl SDS-PAGE gels were loaded with equal volumes of supernatant from each sample, and subsequently stained with Coomassie Brilliant Blue. Replicates within each graph were collected within the same experiment. Data are mean ± SEM (n=3-6; one-way ANOVA with Dunnett’s correction comparing to No RNA: **p < 0.01, ***p < 0.001, ****p < 0.0001). (J) AUG of turbidity data for WT TDP-43 with annealed LTR-III RNA, normalized to the No RNA condition. Data are mean + SEM (n=3). (K) Circular dichroism spectrum for 5 pM LTR-III RNA after annealing.

[0053] Figure 24(A-H) shows short RNA chaperone engagement of the TDP-43 RRMs.(A, B) Bound 5’ 6-FAM RNA signal for EMS As performed with WT TDP-43 (A) or TDP-43P112H(B). The Clip34 curve data is the same as shown in Fig. 1 J, fig. S2D, and fig. S15H, included for reference. Data are mean ± SEM (n=3-4; shown is the nonlinear regression: [agonist] vs. response with variable slope, of the combined replicates). (C) Apparent KD values calculated from bound 5’ 6-FAM signal of the indicated RNAs, from indi vidual replicates of EMS As performed with TDP-43P112H, corresponding to summary data shown in (B). Clip34 data is the same as shown in Fig. 3G. Data are mean + SEM (n=3; unpaired t-test; *p < 0.05). (D-G) Overlay of1H-15N heteronuclear single quantum coherence (HSQC) spectra of WT TDP-43 RRMs (D, E) and TDP-435FLRRMs (F, G) with A(GU)6RNA (blue, no RNA; green, 0.5:1:: [RNA]: [TDP-43]; pink, l:l::[RNA]:[TDP-43]). Black arrows indicate direction of chemical shift perturbations for each peak upon RNA binding. Although similar chemical shift perturbations at many known RNA binding sites are seen for WT TDP-43 RRMs and TDP-435FLRRMs in theAttorney Docket: 10504- 109WO1 presence of an equivalent molar amount of RNA (pink), broad resonances are observed for TDP-435FLRRMs: RNA, suggesting chemical exchange rate is enhanced, consistent with weaker binding. No shifts are seen for some resonances of TDP-435FLRRMs that do shift for WT TDP-43 RRMs (e.g. T199, T103), suggesting binding residues are fewer in TDP-435FLRRMs. At 0.5 molar equivalents (green), two peaks are observed for several resonances showing large shifts for the WT TDP-43 RRMs, consistent with slow exchange and tight binding, while peaks are broadened beyond detection (G170) or show approximately half the shift as observed at 1 molar equivalent (G142), consistent with intermediate / fast exchange due to weaker binding than for WT. (H) Overlay of1H-15N heteronuclear single quantum coherence (HSQC) spectra of WT TDP-43 RRMs with Clip34 RNA (green, 2:l::[CIip34]:[TDP-43]) and Clip34_UG6 RNA (blue, 2:l::[Clip34_UG61:[TDP-43]). (I)1H and15N chemical shift perturbations ( A31H (top) and Δδ15N (middle), respectively), and intensity ratios (bottom) of WT TDP-43 RRMs upon binding of Clip34 (green) and Clip34_UG6 (blue) RNA. Domain map of TDP-43 RRMs shown at the bottom, aligned to x-axes of graphs.

[0054] Figure 25(A-C) shows Malat1_start (SEQ ID NO: 10) dissolves preformed TDP- 43 condensates. 4.22 pM TDP-43-MBP-His was incubated with TEV protease in the absence of RNA for 1.5 h, producing preformed TDP-43 condensates for which turbidity measurements had achieved plateau. After 1.5 h, RNA or buffer was added, resulting in final concentrations of 0 or 2 pM RNA, 4 pM TDP-43, 150 mM NaCl, 20 mM HEPES- NaOH pH 7.4, 1 mM DTT, 10 pg / mL TEV protease. Turbidity measurements at 350 nm were collected for 1 h post-addition. (A) Buffer-standardized turbidity measurements at 350 nm were normalized to the respective pre-addition reading for each sample. Data are mean (solid lines) ± SEM (dashed lines) (n=3). (B) Final normalized turbidity measurements after 1 h of incubation post-addition. Data are mean + SEM (n=3; one¬ way ANOVA with Dunnett’s correction comparing to +Buffer; * ***p < 0.0001). (C) Representative lOOx brightfield images of samples after 1.5 h of condensate formation (pre-addition) or after an additional 1 h post-addition. Scale bar indicates 10 pm.

[0055] Figure 26(A-F) shows Malat1_start (SEQ ID NO: 10) solubilizes TDP-43 aggregates. 4 pM TDP-43-MBP-His was incubated with TEV protease in the absence of RNA for 4 h, producing preformed TDP-43 aggregates for which turbidity measurements had achieved plateau. After 4 h, RNA or water was added, resulting in final concentrations of 0 or 40 pM RNA, 3.648 pM TDP-43, 136.8 mM NaCl, 18.24 mM HEPES-NaOH pH 7.0, 0.912 mM DTT. Reactions were then incubated for 16 h beforeAttorney Docket: 10504- 109WO1 assessment at the end timepoint by sedimentation and electron microscopy. (A) Representative 4-20% Tris-HCl SDS-PAGE gel loaded with equal volumes of supernatant (S), pellet (P), or input (I) from each sample, and subsequently stained with Coomassie Brilliant Blue. (B) Quantification of the TDP-43 signal in the supernatant as a percentage of the input of that sample after sedimentation. Data are mean ± SEM (n=3; one-way ANOVA with Tukey’s correction; **p < 0.01, ***p < 0.001). (C) Representative electron micrographs of samples collected at the end timepoint of the disaggregation assay. Scale bar indicates 2 pm. (D-F) Quantification of micrographs performed utilizing Image!, including the average size of aggregates in pm2(D), the percentage of micrograph area occupied by aggregates (E), and the average integrated density of aggregates (F). Data are mean + SEM (n=4-6 micrographs per condition; oneway ANOVA with Dunnett’s correction comparing to No RNA; **p < 0.01, ***p < 0.001).

[0056] Figure 27(A-G) shows Clip34 (SEQ ID NO: 1) and Malat1_start (SEQ ID NO: 10) mitigate aberrant TDP-43 phenotypes in an optogenetic human cell model without interfering with TDP-43 function. (A-C) OptoTDP-43 stable HEK293 cells were treated with the indicated RNA, followed by blue light exposure to induce Cry2olig oligomerization, and imaged after fixation. Representative images corresponding to quantification in Fig. 5B, for optoTDP-43 (A), the binary signal of cytoplasmic optoTDP-43 puncta (B), and the merged image showing optoTDP-43 and Hoechst (C). Images of cells without blue light exposure (Dark) are shown as references for the baseline cellular appearance of optoTDP-43 without induction of oligomerization. Scale bar indicates 10 pm. (D-F) OptoTDP-43 stable HEK293 cells were treated with the indicated RNA, followed by blue light exposure and protein fractionation into RIPA- soluble or RIPA-insoluble (urea-soluble) fractions. A representative blot stained by TDP- 43 antibody with the optoTDP-43 band indicated (D) was quantified as soluble / total optoTDP-43 (soluble + insoluble) (E) and insoluble / total optoTDP-43 (soluble + insoluble) (F). Data are mean ± SEM (n=3; one-way ANOVA with Dunnett’s correction; *p < 0.05). (G) Stable HEK293 cells with inducible CUTS biosensor were transfected with 200 nM of Clip34, Malat1_start, and (UG)r / RNA oligos for 48 hours in doxycycline supplemented media (1000 ng / mL). The cells were also reverse transfected with a low dose (37.5 pM) siRNA of TDP-43 for 72 hours, together with 48 hours of doxycycline as a positive control. Cells experiencing TDP-43 loss of function will have green nuclei due to the expression of GFP-NLS that would ordinarily be repressed by aAttorney Docket: 10504- 109WO1 TDP-43-regulated cryptic exon (94). Live-imaging of CUTS HEK cells transfected with siRNA of TDP-43, Clip34, Malat1_start, and (UG)17. Green = GFP; red = mCherry. Scale bar indicates 100 pm.

[0057] Figure 28(A-C) shows Clip34 (SEQ ID NO: 1) and Malat1_start (SEQ ID NO: 10) restore proper TDP-43 localization in C9ORF72 iPSC-derived motor neurons. (A) The average ratio of TDP-43 nuclear to cytoplasmic signal normalized to healthy control iPSC-derived neurons without RNA treatment. C9 CTR condition data are the same as shown in Fig. 5D. Data are mean ± SEM (n=2-6 technical replicates; one-way ANOVA with Tukey’s correction; ***p < 0.001, ****p < 0.0001). (B) In addition to images in Fig. 5C, lower magnification representative images of C9orf72-ALS patient iPSC- derived motor neurons treated with the indicated RNAs, stained with DAPI and for TDP- 43 and MAP2. Scale bar indicates 50 pm. (C) The average ratio of nuclear to cytoplasmic signal of the indicated Cy5 -labeled RNA in iPSC-derived motor neurons. Data are mean ± SEM (n=4; one-way ANOVA with Tukey’s correction).

[0058] Figure 29(A-E) shows Malat1_start (SEQ ID NO: 10) suppresses cryptic splicing of TDP-43 targets in sodium-arsenite-treated iPSC-derived motor neurons. (A-E) Control iPSC-derived motor neurons were nontreated (NT) or treated with 500 nM CTR RNA or Malat1_start, then were untreated or treated with 250 pM sodium arsenite (NaAsCh) for 2 h, as indicated. (A) Representative images of control iPSC-derived motor neurons stained with Hoechst and for TDP-43, G3BP1, and MAP2. Scale bar indicates 20 pm. (B, C) RT-PCR gel and corresponding quantification assessing aberrant splicing of TDP- 43 target STMN2. TDP-43 knockdown by siRNA was confirmed to induce cryptic splicing. Data was normalized to P-actin as a loading control, and fold change was calculated to the untreated CTR RNA condition. Data are mean ± SEM (n=2; unpaired t- test; *p < 0.05). (D, E) RT-PCR gel and corresponding quantification assessing aberrant splicing of TDP-43 target KCNQ2. TDP-43 knockdown by siRNA was confirmed to induce cryptic splicing. Data was normalized to 18S as a loading control, and fold change was calculated to the untreated CTR RNA condition. Data are mean ± SEM (n=3; two-way ANOVA with Tukey’s correction; *p < 0.05, **p < 0.01).

[0059] Figure 30 shows Malat1_start (SEQ ID NO: 10) treatment does not perturb physiological cytoplasmic RNA granules in iPSC-derived motor neurons. Representative images of soma (left) and corresponding neurites (right) for healthy isogenic control or C9orf72-ALS patient iPSC-derived motor neurons treated with Cy5-labeled CTR or Malat1_start RNA as indicated. Neurons were stained for MAP2 and TDP-43 or STAU1,Attorney Docket: 10504- 109WO1 as indicated. Scale bars indicate 10 uni (separate scale bars are shown for soma and neurites).

[0060] Figure 31(A-D) shows quantification of RNA granules in neurites of iPSC- derived motor neurons. (A-D) Quantification corresponding to representative images shown in fig. S24. Puncta are expressed as the number of puncta per 100 pm, and markers were considered to colocalize if Pearson > 0.5. For each technical replicate, the average value was calculated across 20-25 neurites. Data are mean + SEM (n=4 technical replicates; one-way ANOVA with Sidak’s correction; *p < 0.05, **p < 0.01).

[0061] Figure 32(A-E) shows Malat1_start RNA (SEQ ID NO: 18) mitigates neurodegeneration in a mouse model of TDP-43 proteinopathy. (A) Representative transduction profile showing lOx magnification images following six lx IO11GC injections of AAV9-TDP-43ΔNLS’YFPin pl80 female mice. Shown here is baseline 7 days of expression, 30 pm spinal cord slice. Scale bar indicates 100 pm. (B) Representative image showing TDP-43 puncta (green), as well as Cy5-tagged Malat1_start RNA (magenta) in NeuN positive (red) motor neurons of the ventral horn of the spinal cord. Shown is a 5-day (12-day expressing) treated animal, demonstrating effective penetration of RNA to this region. 60x magnification; scale bar indicates 10 pm. (C) The average percentage of TDP-43-YFP colocalized with Cy5-Malatl... start per cell, based on Mander’s coefficient for colocalization. Data shown are mean ± SEM (n=10). (D) Representative immunohistochemistry images of ventral horns, stained for choline acetyltransferase (ChAT). 20x magnification z-stack confocal images; scale bar indicates 100 pm. (E) Immunostaining quantification for NeuN+neurons manually counted within the ventral horn region of spinal cord sections. Data are mean + SEM (n=10 animals per condition; shown: one-way ANOVA with Dunnett’s correction comparing to D7 TDP- 43: ****p < 0.0001; not shown: two-way ANOVA with Sidak’s correction: ****p < 0.0001 for Malat1_start versus saline at D10 and D12).

[0062] Figure 33(A-C) shows Malat1_start RNA (SEQ ID NO: 18) mitigates TDP-43 aggregation and dysfunction in a mouse model of TDP-43 proteinopathy. (A) Representative 60x magnification immunofluorescent staining images showing single channels corresponding to merged images shown in Fig. 6D; from 5-day (12-day expressing) saline -treated (top) and RNA-treated (bottom) animals. Scale bar indicates 20 pm. (B) TDP-43 positive puncta were assessed in ChAT+motor neurons. Fields at 60x magnification were taken in the ventral horn for each animal (same fields as for Fig.6E). For each animal, the average number of puncta per neuron was standardized to setAttorney Docket: 10504- 109WO1 the average D7 TDP-43 value to 0. Data shown are mean ± SEM (n=9-10 animals per condition; shown: two-way ANOVA with Sfdak’s correction: ****p < 0.0001; not shown: one-way ANOVA with Dunnett’s correction comparing to D7 TDP-43: ****p < 0.0001 for D10 and D12 saline, and D12 Malat1_start). (C) Total levels of Sortl mRNA normalized to GAPDH, with fold change calculated from D7 baseline. Data are mean ± SEM (n=10 animals per condition; one-way ANOVA with Dunnett’s correction comparing to D7 TDP-43).DETAILED DESCRIPTION

[0063] Provided here are compositions and methods for reducing protein aggregation in a neuronal cell and / or reducing or treating a proteinopatliy or neurodegeneration in a subject. It is a surprising finding of the present disclosure that various oligonucleotide sequences and groups of oligonucleotide sequences reduce aggregation of TDP-43 and / or TDP-43 variants.

[0064] Terminology

[0065] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. The following definitions are provided for the full understanding of terms used in this specification.

[0066] Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular polynucleotide is disclosed and discussed and a number of modifications that can be made to the polynucleotide are discussed, specifically contemplated is each and every combination and permutation of the polynucleotide and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of polynucleotides A, B, and C are disclosed as well as a class of polynucleotides D, E, and F and an example of a combination polynucleotide, or, for example, a combination polynucleotide comprising A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is alsoAttorney Docket: 10504- 109WO1 disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.

[0067] It is understood that the compositions disclosed herein have certain functions.Disclosed herein are certain structural requirements for performing the disclosed functions, and it is understood that there are a variety of structures which can perform the same function which are related to the disclosed structures, and that these structures will ultimately achieve the same result.

[0068] Unless otherwise expressly stated, it is in no way intended that any method set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not actually recite an order to be followed by its steps or it is not otherwise specifically stated in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including: matters of logic with respect to arrangement of steps or operational flow; plain meaning derived from grammatical organization or punctuation; and the number or type of embodiments described in the specification.

[0069] As used in the specification and claims, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “an agent” includes a plurality of agents, including mixtures thereof.

[0070] As used herein, the terms “can,” “may,” “optionally,” “can optionally,” and “may optionally” are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation “may include an excipient” is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.

[0071] Use of the phrase “and / or” indicates that any one or any combination of a list of options can be used. For example, “A, B, and / or C” means “A”, or “B”, or “C”, or “A and B”, or “A and C”, or “B and C”, or “A and B and C”.

[0072] Grammatical variations of “administer,” “administration,” and “administering” to a subject include any route of introducing or delivering to a subject an agent.Attorney Docket: 10504- 109WO1 Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. “Concurrent administration”, “administration in combination”, “simultaneous administration” or “administered simultaneously” as used herein, means that the compounds are administered at the same point in time, overlapping in time, or one following the other. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. “Systemic administration” refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject’s body (e.g. greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, “local administration” refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration, but are undetectable or detectable at negligible amounts in distal parts of the subject’s body. Administration includes self-administration and the administration by another.

[0073] A “control” is an alternative subject, sample, or set of values used in an experiment for comparison purposes. A control can be “positive” or “negative.” A control can also be a collection of values used as a standard applied to one or more subjects (e.g., a general number or average that is known and not identified in the method using a sample).

[0074] “Identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% orAttorney Docket: 10504- 109WO1 higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the complement of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10 amino acids or 20 nucleotides in length, or more preferably over a region that is 10-50 amino acids or 20- 50 nucleotides in length. As used herein, percent (%) amino acid sequence identity is defined as the percentage of amino acids in a candidate sequence that are identical to the amino acids in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.

[0075] For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

[0076] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs)Attorney Docket: 10504- 109WO1 by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences ) uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

[0077] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01.

[0078] As used herein, the terms “aggregate” or “aggregation” refer to a biological phenomenon in which a protein molecule attaches to another and accumulates to form a higher order complex such as a proteinaceous clump or fibril. Generally, protein aggregates contain a single type of protein, of which numerous copies attach and clump together. A protein aggregate can, but need not necessarily, deposit (e.g., on or in cells orAttorney Docket: 10504- 109WO1 tissue) as an insoluble complex. The term is intended to exclude small oligomeric clumps (10 copies of a protein molecule or less), as well as native hetero- and homo- polymeric proteins in which the polymeric form of the protein naturally contributes to the function of the protein (e.g., polymeric actin filaments). Incorrect three-dimensional protein folding (“misfolding”) is a known cause of protein aggregation. Numerous diseases, including many neurodegenera live diseases, are associated with protein aggregation. As used herein, the term “aggregate” and grammatical variations thereof, as it relates to proteins, is used interchangeably with the terms “inclusion,” “particle,” and grammatical variations thereof.

[0079] As used herein, the term “disaggregate” refers to the breaking down of one or more protein aggregates. As a protein aggregate contains numerous copies of a protein clumped together, disaggregation refers to a process of removing portions of the aggregated protein clump. 'Thus, as used herein, disaggregation refers to the removal of portions of an existing protein aggregate, such that after disaggregation, the result is a smaller protein aggregate clump or an absence of a protein aggregate clump altogether. Detection of aggregate size and changes thereto depend on the sensitivity of the equipment and techniques used to detect aggregate size. Thus, under one technique, a disaggregated clump may be undetectable, whereas under another technique, the same disaggregated clump may be detected as having a smaller size.

[0080] As used herein, the term “associated with a neurodegen erative disease,” as it relates to a nucleic acid-binding polypeptide, is intended to refer to the existence of a correlation between the nucleic acid-binding polypeptide and occurrence of the neurodegenerative disease which is sufficiently strong and researched, such that one of skill in the ait would conclude that the nucleic acid-binding polypeptide (specifically, in vivo aggregation of the nucleic acid-binding polypeptide) likely plays a role in the risk, onset, progression, and / or exacerbation of the neurodegenerative disease. However, one of skill in the art would neither need to conclude that the nucleic acid-binding polypeptide plays the only role in the risk, onset, progression, and / or exacerbation of the neurodegenerative disease, nor that the particular neurodegenerative disease is always influenced or affected by the nucleic acid-binding protein.

[0081] “Pharmaceutically acceptable carrier” (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms “carrier” orAttorney Docket: 10504- 109WO1 “pharmaceutically acceptable carrier” can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term “carrier” encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.

[0082] “Preventing” a disorder or unwanted physiological event in a subject refers specifically to the prevention of the occurrence of symptoms and / or their underlying cause, wherein the subject may or may not exhibit heightened susceptibility to the disorder or event. As used herein, preventing protein inclusion includes preventing or delaying the initiation of protein inclusion. The term further includes preventing a recurrence of one or more signs or symptoms of protein inclusion.

[0083] “Polynucleotide” refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine (T) when the polynucleotide is RNA. Thus, a “polynucleotide” sequence can be represented by the sequential alphabetical representation of each base in a polynucleotide molecule.

[0084] “Peptide,” “protein,” and “polypeptide” are used interchangeably to refer to a natural or synthetic molecule comprising two or more amino acids linked by the carboxyl group of one amino acid to the alpha amino group of another. The amino acids may be natural or synthetic, and can contain chemical modifications such as disulfide bridges, substitution of radioisotopes, phosphorylation, substrate chelation (e.g., chelation of iron or copper atoms), glycosylation, acetylation, formylation, amidation, biotinylation, and aAttorney Docket: 10504- 109WO1 wide range of other modifications. A polypeptide may be attached to other molecules, for instance molecules required for function. Examples of molecules which may be attached to a polypeptide include, without limitation, cofactors, polynucleotides, lipids, metal ions, phosphate, etc. Non-limiting examples of polypeptides include peptide fragments, denatured / unstructured polypeptides, polypeptides having quaternary or aggregated structures, etc. There is expressly no requirement that a polypeptide must contain an intended function; a polypeptide can be functional, non-functional, function for unexpected / unintended purposes, or have unknown function. A polypeptide is comprised of approximately twenty, standard naturally occurring amino acids, although natural and synthetic amino acids which are not members of the standard twenty amino acids may also be used. The standard twenty amino acids include alanine (Ala, A), arginine (Arg, R), asparagine (Asn, N), aspartic acid (Asp, D), cysteine (Cys, C), glutamine (Gln, Q), glutamic acid (Glu, E), glycine (Gly, G), histidine, (His, H), isoleucine (Ile, I), leucine (Leu, L), lysine (Lys, K), methionine (Met, M), phenylalanine (Phe, F), proline (Pro, P), serine (Ser, S), threonine (Thr, T), tryptophan (Trp, W), tyrosine (Tyr, Y), and valine (Val, V). The terms “polypeptide sequence” or “amino acid sequence” are an alphabetical representation of a polypeptide molecule.

[0085] As used herein, the terms “reduce,” “reduced” and “reducing” mean to decrease by a statistically significant amount. In some embodiments, the reduction is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70, about 80%, about 90%, or about 95%. In some embodiments, the reduction is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70, at least about 80%, at least about 90%, or at least about 95%.

[0086] The term “TDP-43” refers herein to TAR DNA Binding Protein 43 kDa. TDP-43 is also known as TDP43, TARDBP, and ALS10. In some embodiments, the TDP-43 polypeptide or polynucleotide is that identified in one or more publicly available databases as follows: HGNC: 11571 Entrez Gene: 23435 Ensembl: ENSG00000120948 OMIM: 605078 UniProtKB: Q13148. In some embodiments, TDP-43 comprises SEQ ID NO:25.

[0087] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be furtherAttorney Docket: 10504- 109WO1 understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular' value in addition to the value itself. For example, if the value” 10” is disclosed, then “about 10” is also disclosed.

[0088] “Therapeutically effective amount” or “therapeutically effective dose” of a composition (e.g. a composition comprising an agent) refers to an amount that is effective to achieve a desired therapeutic result. In some embodiments, a desired therapeutic result is the control of type I diabetes. In some embodiments, a desired therapeutic result is the control of obesity. Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and / or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.

[0089] The terms “treat,” “treating,” “treatment,” and grammatical variations thereof as used herein, include partially or completely delaying, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing, mitigating, and / or reducing the intensity or frequency of one or more diseases or conditions, symptoms of a disease or condition, or underlying causes of a disease or condition. Treatments according to the invention may be applied prophylactically, pallatively or remedially. Prophylactic treatments are administered to a subject prior to onset (e.g., before obvious signs of cancer), during early onset (e.g., upon initial signs and symptoms of cancer), or after an established development of cancer. Prophylactic administration can occur for several days to year's prior to the manifestation of symptoms.

[0090] Compositions

[0091] Included herein are compositions for reducing protein aggregation in a neuronal cell and / or reducing a proteinopathy or neurodegeneration in a subject. The neuronalAttorney Docket: 10504- 109WO1 cell, or neuron, can be a sensory neuron, motor neuron, interneuron, or anoxic neuron. In some embodiments, the neuron is a sensory neuron. In some embodiments, the neuron is a motor neuron. In some embodiments, the neuron is an interneuron. In some embodiments, the neuron is an anoxic neuron.

[0092] The protein aggregation that is reduced according to present disclosure includes TDP-43 aggregation and TDP-43 variant aggregation. In some embodiments, the TDP- 43 comprises SEQ ID NO:1. Accordingly, included herein are compositions for reducing aggregation of TDP-43 or a TDP-43 variant. Also included herein are compositions for reducing a proteinopathy or neurodegeneration that is TDP-43 aggregation-associated or TDP-43 variant aggregation-associated. The word “proteinopathy” refers to a disease or condition in which one or more proteins become structurally abnormal and such abnormality leads to or causes the disease or condition.

[0093] As used herein, “TDP-43 variant” refers to a TDP-43 mutation. A non-limiting list of TDP-43 variants is: P1I2H, K181E, G295R, G298S, A321 V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, and S292 / 409 / 410E wherein the amino acid numbers in each variant (e.g., 112, 181) correlate with SEQ ID NO:1. In some embodiments, the TDP-43 variant is P1I2H. In some embodiments, the TDP-43 variant is KI 8 IE. In some embodiments, the TDP-43 variant is G295R. In some embodiments, the TDP-43 variant is G298S. In some embodiments, the TDP-43 variant is A321V. In some embodiments, the TDP-43 variant is Q331K. In some embodiments, the TDP-43 variant is M337V. In some embodiments, the TDP-43 variant is A382T. In some embodiments, the TDP-43 variant is K145 / 192Q. In some embodiments, the TDP-43 variant is S292E. In some embodiments, the TDP-43 variant is R293F. In some embodiments, the TDP-43 variant is S409 / 410E. In some embodiments, the TDP-43 variant is S292 / 409 / 410E.

[0094] In some embodiments, the oligonucleotide reduces aggregation of more than one TDP-43 variant. For example, in some embodiments, the oligonucleotide reduces aggregation of two TDP-43 variants. In some embodiments, the oligonucleotide reduces aggregation of three TDP-43 variants, the oligonucleotide reduces aggregation of four TDP-43 variants. In some embodiments, the oligonucleotide reduces aggregation of five TDP-43 variants. Also included are embodiments wherein the oligonucleotide reduces aggregation of TDP-43 and one or more TDP-43 variant.

[0095] The proteinopathy or neurodegeneration can comprise any of Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Alzheimer's Disease (AD), chronicAttorney Docket: 10504- 109WO1 traumatic encephalopathy (CTE), Limbic-predominant Age-related TDP-43 Encephalopathy (LAIE), Multisystem Proteinopathy, Traumatic Brain Injury, Cortical Basal Degeneration, and Huntington’s Disease. In some embodiments, the proteinopathy or neurodegeneration er can comprise any of Amyotrophic Lateral Sclerosis (ALS), Frontotemporal Dementia (FTD), and Alzheimer's Disease (AD), Chronic Traumatic Encephalopathy (CTE), or Limbic-predominant Age-related TDP-43 Encephalopathy (LATE). In some embodiments, the proteinopathy or neurodegeneration comprises Amyotrophic Lateral Sclerosis (ALS). In some embodiments, the proteinopathy or neurodegeneration comprises Frontotemporal Dementia (FTD). In some embodiments, the proteinopathy or neurodegeneration comprises Alzheimer's Disease (AD). In some embodiments, the proteinopathy or neurodegeneration comprises Chronic Traumatic Encephalopathy (CTE). In some embodiments, proteinopathy or neurodegeneration comprises Limbic-predominant Age-related TDP-43 Encephalopathy (LAIE). In some embodiments, the proteinopathy or neurodegeneration comprises Multisystem Proteinopathy. In some embodiments, the proteinopathy or neurodegeneration comprises Traumatic Brain Injury. In some embodiments, the proteinopathy or neurodegeneration comprises Cortical Basal Degeneration. In some embodiments, the proteinopathy or neurodegeneration comprises Huntington’s Disease.

[0096] The composition of the present disclosure comprises an oligonucleotide that binds to or reduces aggregation of one or more TDP-43 or one or more variants of TDP- 43. In some embodiments, the oligonucleotide comprises a short RNA, a small interfering (si) ribonucleic acid (RNA) (siRNA), a microRNA (miRNA), a long noncoding RNA (IncRNA), a short hairpin RNA (shRNA), and an antisense oligonucleotide. The present disclosure includes oligonucleotides that comprise SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 19, or a modification or fragment thereof. In some embodiments, the modification is a 2’ OMe modification. In certain aspects, the oligonucleotide comprises SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO: 15, or SEQ ID NO:16, or a modification or fragment thereof. In some embodiments, the oligonucleotide comprises SEQ ID NO: 10, or a modification or fragment thereof. Also included herein are oligonucleotides that comprise a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ IDAttorney Docket: 10504- 109WO1 NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO: 19.

[0097] The determined rates of aggregation can be compared to a control. In some embodiments, the rate of aggregation in the cell is at least 5% reduced compared to a control. In some embodiments, the rate or amount of aggregation in the cell is reduced by at least at least 10%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% reduced compared to a control.

[0098] The control can comprise a biological sample, or alternatively, a collection of values used as a standard applied to one or more subjects (e.g., a general number or average that is known and not identified in the method using a sample). In some embodiments, the control can comprise an untreated biological sample of a subject having or suspected of having a neurodegenerative disease (e.g., a baseline sample). In some embodiments, the control can comprise untreated neuronal cells (e.g., from a subject having or suspected of having a neurodegenerative disease). In some embodiments, the control can be a treatment comprising a polynucleotide known not to bind to the nucleic acid-binding polypeptide (a non-targeting polynucleotide). In some embodiments, the control can comprise a scrambled polynucleotide sequence.

[0099] Also disclosed herein are pharmaceutical compositions comprising a therapeutically effective amount of a pharmaceutically acceptable excipient and a polynucleotide that binds a nucleic acid-binding polypeptide, wherein the nucleic acidbinding polypeptide can aggregate in cells and is associated with a neurodegenerative disease. In some embodiments, the oligonucleotide is present in a therapeutically effective amount to treat a neurodegenerative disease. Suitable excipients include, but are not limited to, salts, diluents, (e.g., Tris-HCl, acetate, phosphate), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), binders, fillers, solubilizers, disintegrants, sorbents, solvents, pH modifying agents, antioxidants, anti -infective agents, suspending agents, wetting agents, viscosity modifiers, tonicity agents, stabilizing agents, and other components and combinations thereof. Suitable pharmaceutically acceptable excipients are preferably selected from materials which are generally recognized as safe (GRAS) and may be administered to an individual without causing undesirable biological side effects or unwanted interactions. Suitable excipients and their formulations are described in Remington's Pharmaceutical Sciences, 16th ed. 1980, Mack Publishing Co. In addition, such compositions can be complexed with polyethylene glycol (PEG), metalAttorney Docket: 10504- 109WO1 ions, or incorporated into polymeric compounds such as polyacetic acid, polyglycolic acid, hydrogels, etc., or incorporated into liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts or spheroblasts. Suitable dosage forms for administration, e.g., parenteral administration, include solutions, suspensions, and emulsions. Typically, the components of the formulation are dissolved or suspended in a suitable solvent such as, for example, water, Ringer's solution, phosphate buffered saline (PBS), or isotonic sodium chloride. The formulation may also be a sterile solution, suspension, or emulsion in a nontoxic, parenterally acceptable diluent or solvent such as 1,3-butanediol. In some cases, formulations can include one or more tonicity agents to adjust the isotonic range of the formulation. Suitable tonicity agents are well known in the art and include glycerin, mannitol, sorbitol, sodium chloride, and other electrolytes. In some cases, the formulations can be buffered with an effective amount of buffer necessary to maintain a pH suitable for parenteral administration. Suitable buffers are well known by those skilled in the art and some examples of useful buffers are acetate, borate, carbonate, citrate, and phosphate buffers. In some embodiments, the formulation can be distributed or packaged in a liquid form, or alternatively, as a solid, obtained, for example by lyophilization of a suitable liquid formulation, which can be reconstituted with an appropriate carrier or diluent prior to administration. The pharmaceutical compositions comprise a polynucleotide that selectively binds a nucleic acid-binding polypeptide, wherein the nucleic acid-binding polypeptide is capable of intracellular aggregation and is associated with a neurodegenerative disease in a therapeutically effective amount sufficient to treat a neurodegenerative disease. The pharmaceutical compositions can be formulated for medical and / or veterinary use.

[0100] Methods of Treatment

[0101] The present disclosure also includes methods of using the herein described compositions. Included herein is a method of treating a proteinopathy or a neurodegeneration in a subject comprising administering to the subject an oligonucleotide that binds to and / or reduces aggregation of TDP-43 or a TDP-43 variant. The term “subject” is defined herein to include animals such as mammals, including, but not limited to, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice and the like. In some embodiments, the subject is a human.

[0102] In some embodiments of the method of treatment, the TDP-43 variant is Pl 12H, K181E, G295R, G298S, A321V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, or S292 / 409 / 410E wherein the amino acid numbers in each variant (e.g.,Attorney Docket: 10504- 109WO1 112, 181) correlate with SEQ ID NO:1. In some embodiments of the method of treatment, the TDP-43 variant is Pl 12H. In some embodiments of the method of treatment, the TDP-43 variant is K181E, In some embodiments of the method of treatment, the TDP-43 variant is G295R. In some embodiments, the TDP-43 variant is G298S. In some embodiments of the method of treatment, the TDP-43 variant is A321V. In some embodiments of the method of treatment, the TDP-43 variant is Q331K. In some embodiments of the method of treatment, the TDP-43 variant is M337V. In some embodiments of the method of treatment, the TDP-43 variant is A382T. In some embodiments of the method of treatment, the TDP-43 variant is K145 / 192Q. In some embodiments of the method of treatment, the TDP-43 variant is S292E. In some embodiments of the method of treatment, the TDP-43 variant is R293F. In some embodiments, the TDP-43 variant is S409 / 410E. In some embodiments of the method of treatment, the TDP-43 variant is S292 / 409 / 410E.

[0103] In some embodiments of the method of treatment, the oligonucleotide reduces aggregation of more than one TDP-43 variant. For example, in some embodiments, the oligonucleotide reduces aggregation of two TDP-43 variants. In some embodiments, the oligonucleotide reduces aggregation of three TDP-43 variants, the oligonucleotide reduces aggregation of four TDP-43 variants. In some embodiments, the oligonucleotide reduces aggregation of five TDP-43 variants. Also included are method of treatment embodiments wherein the oligonucleotide reduces aggregation of TDP-43 and one or more TDP-43 variant.

[0104] The proteinopathy or neurodegeneration treated using the present methods can comprise any of Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), Limbic- predominant Age-related TDP-43 Encephalopathy (LATE), Multisystem Proteinopathy, Traumatic Brain Injury, Cortical Basal Degeneration, and Huntington’s Disease. In some embodiments of the method of treatment, the proteinopathy or neurodegeneration can comprise any of Amyotrophic Lateral Sclerosis (ALS), Frontotemporal Dementia (FTD), and Alzheimer's Disease (AD), Chronic Traumatic Encephalopathy (CTE), or Limbic- predominant Age-related TDP-43 Encephalopathy (LATE). In some embodiments of the method of treatment, the proteinopathy or neurodegeneration comprises Amyotrophic Lateral Sclerosis (ALS). In some embodiments of the method of treatment, the proteinopathy or neurodegeneration comprises Frontotemporal Dementia (FTD). In some embodiments of the method of treatment, the proteinopathy or neurodegenerationAttorney Docket: 10504- 109WO1 comprises Alzheimer's Disease (AD). In some embodiments of the method of treatment, the proteinopathy or neurodegeneration comprises Chronic Traumatic Encephalopathy (CTE). In some embodiments of the method of treatment, the proteinopathy or neurodegeneration comprises Limbic-predominant Age-related TDP-43 Encephalopathy (LATE). In some embodiments of the method of treatment, the proteinopathy or neurodegeneration comprises Multisystem Proteinopathy. In some embodiments of the method of treatment, the proteinopathy or neurodegeneration comprises Traumatic Brain Injury. In some embodiments of the method of treatment, the proteinopathy or neurodegeneration comprises Cortical Basal Degeneration. In some embodiments of the method of treatment, the proteinopathy or neurodegeneration comprises Huntington ’s Disease.

[0105] The methods of treatment of the present disclosure include methods that comprise administration of an oligonucleotide that binds to or reduces aggregation of one or more TDP-43 or one or more variants of TDP-43. In some embodiments of the method of treatment, the oligonucleotide comprises a short RNA, a small interfering (si) ribonucleic acid (RNA) (siRNA), a microRNA (miRNA), a long noncoding RNA (IncRNA), a short hairpin RNA (shRNA), and an antisense oligonucleotide. The methods of treatment include administration of oligonucleotides that comprise SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:19, or a modification or fragment thereof. In some embodiments, the modification is a 2’ OMe modification. In certain aspects, the oligonucleotide comprises SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO: 16, or a modification or fragment thereof. In some embodiments, the oligonucleotide comprises SEQ ID NO:10, or a modification or fragment thereof. Also included herein are methods of treatment comprising administration of an oligonucleotide having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO: 15, SEQ ID NO:16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO: 19.

[0106] The methods can improve a range of physical, mental, and emotional attributes of the treated subject. The subject can show an improvement in one or more symptoms of a neurodegenerative disease. Such improvements include, but are not limited to, improved physical abilities such as fine motor skills (e.g., writing and typing, graspingAttorney Docket: 10504- 109WO1 small objects, cutting, pointing, etc.), or gross motor skills (e.g., walking, balance, jumping, standing up, throwing); improved sensations such as decreased tingling and / or increased sensitivity in extremities, reduced sensation of muscle weakness or rigidity, and reduced tremors or pain; improved cognitive abilities such as increased alertness, reduced memory loss / improved memory recall, increased cognitive comprehension, improved speech and sleep, improved puzzle-solving abilities, increased focus; and improved behavioral performance such as decreased apathy, depression, agitation, or anxiety, and improved mood and general contentment.

[0107] In some embodiments, the methods treat or prevent a neurodegenerative disease by reducing the rate of protein aggregation in the subject (e.g., reducing the rate of formation of protein inclusions). In some embodiments, the methods treat a neurodegenerative disease by reducing the amount of aggregate of the protein (e.g., reducing the amount of protein inclusions). In some embodiments, the method prevents aggregation of the protein in the subject. Thus, the methods can reduce and / or prevent formation of pathological inclusions in cells of a subject. For instance, the methods can treat and / or prevent pathological phase separation and aggregation of one or more proteins such as TDP-43 or a TDP-43 variant.

[0108] In some or further embodiments, the methods of treatment can disaggregate existing protein aggregates. Thus, the methods can reduce the amount of existing protein aggregates prior to beginning the methods. This can be important for patients experiencing neurodegenerative disease symptoms, as such patients are likely to have existing protein aggregates. Disaggregation of existing aggregates can be, but need not necessarily be, in addition to prevention or reduction of further aggregate formation.

[0109] The methods of treatment can generate neuroprotective results when performed in a subject. As used herein, the term '‘neuroprotective” refers to maintaining or improving existing neurological function in the target neurological organ or tissue (e.g., nerve, spinal cord), or can refer to maintaining or improving the rate or overall amount of neuronal cell death in target neuronal cells. For example, “neuroprotective” can refer to slowing the rate of nerve tissue destruction, deterioration, or malfunction, slowing the rate of neuronal cell death, reducing the rate at which nerve conduction speed slows, etc. In some embodiments, the methods can generate at least 5%, at least 10%, at least 20%, or at least 25% or more neuroprotective improvement, as compared to a control.

[0110] The subject can be any mammalian subject, for example a human, dog, cow, horse, mouse, rabbit, etc. In some embodiments, the subject is a primate, particularly aAttorney Docket: 10504- 109WO1 human. The subject can be a male or female of any age, race, creed, ethnicity, socioeconomic status, or other general classifiers. The subject can be diagnosed as having, or suspected of having, one or more neurodegenerative diseases. In some embodiments, the subject comprises neuronal cells having a reduced concentration of free polynucleotides. Binding of the polynucleotide to the protein (e.g., TDP-43 or TDP-43 variant) can treat and / or prevent neurodegenerative proteinopathies, and can further prevent cell death. [Oi l 1] The administering step can include at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten dosages. The administering step can be performed before the subject exhibits disease symptoms (e.g., prophylactically), or during or after disease symptoms occur. The administering step can be performed prior to, concurrent with, or subsequent to administration of other agents to the subject. In some embodiments, the administering step is performed prior to, concurrent with, or subsequent to the administration of one or more additional diagnostic or therapeutic agents. In some embodiments, the methods comprise administering one or more additional polynucleotides. In some embodiments, at least two, at least three, at least four, or at least five different polynucleotides are administered.

[0112] In some embodiments, a subsequent administration is provided at least one day after a prior administration, or at least two days, at least three days, at least four days, at least five days, or at least six days after a prior administration. In some embodiments, a subsequent administration is provided at least one week after a prior administration, or at least two weeks, at least three weeks, or at least four weeks after a prior administration. In some embodiments, a subsequent administration is provided at least one month, at least two months, at least three months, at least six months, or at least twelve months after a prior administration.

[0113] The amount of the disclosed compositions administered to a subject will vary from subject to subject, depending on the nature of the disclosed compositions and / or formulations, the species, gender, age, weight and general condition of the subject, the mode of administration, and the like. Effective dosages and schedules for administering the compositions may be determined empirically, and making such determinations is within the skill in the art. The dosage ranges for the administration of the disclosed compositions are those large enough to produce the desired effect (e.g., to reduce protein inclusions or to improve a symptom of a neurodegenerative disease). The dosage should not be so large as to outweigh benefits by causing extensive or severe adverse sideAttorney Docket: 10504- 109WO1 effects, such as unwanted cross-reactions, anaphylactic reactions, and the like, although some adverse side effects may be expected. The dosage can be adjusted by the individual clinician in the event of any counterindications. Generally, the disclosed compositions and / or formulations are administered to the subject at a dosage of active component(s) ranging from 0.1 pg / kg body weight to 100 g / kg body weight. In some embodiments, the disclosed compositions and / or formulations are administered to the subject at a dosage of active component(s) ranging from 1 pg / kg to 10 g / kg, from 10 pg / kg to 1 g / kg, from 10 pg / kg to 500 mg / kg, from 10 pg / kg to 100 mg / kg, from 10 pg / kg to 10 mg / kg, from 10 pg / kg to 1 mg / kg, from 10 pg / kg to 500 pg / kg, or from 10 pg / kg to 100 pg / kg body weight. Dosages above or below the range cited above may be administered to the individual subject if desired. The compositions can be administered in any herein disclosed pharmaceutical composition comprising a pharmaceutically acceptable excipient.

[0114] Methods of Reducing Aggregation

[0115] Further included herein is a method of reducing protein aggregation in a neuronal cell comprising contacting the neuronal cell with a composition comprising SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 19, or a modification or fragment thereof. In some embodiments of the method of reducing protein aggregation, the oligonucleotide comprises SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO: 16, or a modification or fragment thereof. In some embodiments of the method of reducing protein aggregation, the oligonucleotide comprises SEQ ID NO:10, or a modification or fragment thereof. In certain aspects, the modification is a 2’ OMe modification. Also included herein are methods of reducing protein aggregation in a neuronal cell comprising contacting the neuronal cell with an oligonucleotide having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO: 8, or SEQ ID NO: 19.

[0116] The neuronal cell, or neuron, of the method of reducing protein aggregation can be a sensory neuron, motor neuron, interneuron, or anoxic neuron. In some embodiments, the neuron is a sensory neuron. In some embodiments, the neuron is aAttorney Docket: 10504- 109WO1 motor neuron. In some embodiments, the neuron is an interneuron. In some embodiments, the neuron is an anoxic neuron.

[0117] In some embodiments of the method of reducing protein aggregation, the protein comprises TDP-43 or a TDP-43 variant. In certain aspects of this method, the TDP-43 comprises SEQ ID NO:1. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is P112H, K181E, G295R, G298S, A321V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, or S292 / 409 / 410E wherein the amino acid numbers in each variant (e.g., 112, 181) correlate with SEQ ID NO:1. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is P112H. In some embodiments of the method of reducing protein aggregation, the TDP- 43 variant is KI 8 IE. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is G295R. In some embodiments, the TDP-43 variant is G298S. In some embodiments of the method of reducing protein aggregation, the TDP- 43 variant is A321 V. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is Q331K. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is M337V. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is A382T. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is K145 / 192Q. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is S292E. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is R293F. In some embodiments of the method of reducing protein aggregation, the TDP-43 variant is S409 / 410E. In some embodiments of the method of reducing protein aggrega tion, the TDP-43 varian t is S292 / 409 / 410E.

[0118] In some embodiments, the method reduces the rate of protein aggregation in the neuronal cell compared to an untreated control. In some embodiments, the method prevents aggregation of the protein in the neuronal cell compared to an untreated control.

[0119] The determined rates of aggregation can be compared to a control. In some embodiments, the rate of aggregation in the cell is at least 5% reduced compared to a control. In some embodiments, the rate or amount of aggregation in the cell is reduced by at least at least 10%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% reduced compared to a control.

[0120] 'The control can comprise a biological sample, or alternatively, a collection of values used as a standard applied to one or more subjects (e.g., a general number orAttorney Docket: 10504- 109WO1 average that is known and not identified in the method using a sample). In some embodiments, the control can comprise an untreated biological sample of a subject having or suspected of having a neurodegenerative disease (e.g., a baseline sample). In some embodiments, the control can comprise untreated neuronal cells (e.g., from a subject having or suspected of having a neurodegenerative disease). In some embodiments, the control can be a treatment comprising a polynucleotide known not to bind to the nucleic acid-binding polypeptide (a non-targeting polynucleotide). In some embodiments, the control can comprise a scrambled polynucleotide sequence.

[0121] It should be understood that the foregoing relates to preferred embodiments of the present invention and that numerous changes may be made therein without departing from the scope of the invention. The invention is further illustrated by the following examples, which are not to be construed in any way as imposing limitations upon the scope thereof. On the contrary, it is to be clearly understood that resort may be had to various other embodiments, modifications, and equivalents thereof, which, after reading the description herein, may suggest themselves to those skilled in the art without departing from the spirit of the present invention and / or the scope of the appended claims. All patents, patent applications, and publications referenced herein are incorporated by reference in their entirety for all purposes.

[0122] EXAMPLES

[0123] Example 1. Clip34 is an allosteric antagonist of TDP-43 aggregation

[0124] First, the domains of TDP-43 that enable the chaperone activity of Clip34 were mapped. Thus, the full-length TDP-43 and TDP-43 constructs lacking the N-terminal domain (TDP-43ANTD), RRM1 (TDP-43ARRM1), RRM2 (TDP-43ARRM2), RRM1 and RRM2 (TDP-43 ARRM 1 / 2), the PrLD (TDP-43 APrLD), or the NTD and PrLD (TDP- 43ANTD / PrLD) with a C -terminal MBP tag were purified (Fig. 1A and Fig. 7, A and B). Specific removal of the MBP tag with TEV protease elicits rapid TDP-43 aggregation, whereas TDP-43 remains soluble when the tag was not removed (Fig. 7C and Fig. 1, C to I). Under our assembly conditions, upon removal of the MBP tag, TDP-43 aggregated robustly, as did TDP-43 ANTD, TDP-43 ARRM1, and TDP-43 ARRM2 (Fig. 1C). As expected, TDP-43 proteins lacking the PrLD did not aggregate (Fig. 1C) (41). Unexpectedly, TDP-43ΔRRM1 / 2 exhibited reduced aggregation (Fig. 1C). This finding indicates that the RRMs contribute to the aggregation propensity of full-length TDP-43.

[0125] The ability of Clip34 to antagonize the aggregation of these TDP-43 deletion constructs was next assessed. At a 1:4 ratio of RNA to TDP-43, Clip34 abolished TDP-43Attorney Docket: 10504- 109WO1 aggregation (Fig. ID), indicating that substoichiometric levels of Clip34 suffice to potently inhibit TDP-43 aggregation (28). This effect was specific, as Clip34 was unable to reduce phase separation of FUS (Fig. 7, D and E), another RNA-binding protein with a PrLD connected to ALS / FTD. Moreover, the UG-deficient RNA (AC)17, which does not bind TDP-43, was unable to inhibit TDP-43 aggregation (Fig. IE). Thus, not any short RNA can antagonize TDP-43 aggregation, indicating that specific sequence features are required for chaperone activity.

[0126] Clip34 potently inhibited the aggregation of TDP-43 ANTD (Fig. IF), indicating that Clip34 binding to the NTD is not required for inhibition. Clip34 also effectively inhibited TDP-43ARRM1 aggregation (Fig. 1G). By contrast, Clip34 exhibited reduced ability to antagonize aggregation of TDP-43ARRM2 (Fig. 1H). Thus, RRM2 plays an important role in enabling Clip34 to antagonize TDP-43 aggregation. Clip34 was unable to antagonize aggregation of TDP-43ΔRRM1 / 2 (Fig. II). Furthermore, Clip34 was unable to antagonize the aberrant assembly of a construct containing only the TDP-43 PrLD (data not shown). Thus, Clip34 does not inhibit TDP-43 aggregation via direct interactions with the PrLD. which drives TDP-43 aggregation. Rather, Clip34 must engage the RRMs to antagonize TDP-43 aggregation. These results suggest that Clip34 binding to the TDP-43 RRMs elicits an allosteric effect on other domains of TDP-43, which precludes TDP-43 aggregation.

[0127] Example 2. Revealing a dynamic allosteric network between the TDP-43 RRMs, PrLD, and RNA

[0128] To explore how Clip34 promotes aggregation-resistant TDP-43 conformers, TDP- 43 binding to Clip34 was explored. TDP-43 binds Clip34 cooperatively, with a hill slope (h) -2.4 and a KD of -0.49 yM (Fig. 1J and Fig. 8, A to C). By contrast, Clip34 does not bind strongly to TDP-435FL, which bears F147L, F149L, F194L, F229L, and F231L mutations in the RRMs that impair RNA binding (Fig. 1 J and Fig. 8B) (35, 59, 60). Indeed, Clip34 is unable to inhibit TDP-435FLaggregation (Fig. IK) (28). Thus, Clip34 does not engage the NTD or PrLD to exert chaperone activity. Rather, Clip34 engages the RRMs to abrogate TDP-43 aggregation and must exert allosteric effects to inhibit aggregation mediated by intermolecular contacts between PrLDs.

[0129] The contribution of RRM1 and RRM2 was next assessed. TDP-43ARRM1binding to Clip34 was reduced by -1.6-fold in terms of Bmax (the maximum specific binding) compared to full-length TDP-43, whereas TDP-43ARRM2binding was only reduced by -1.1 -fold (Fig. 1.1 and fig. S2B). TDP-43ARRM1binds Clip34 with reduced cooperativityAttorney Docket: 10504- 109WO1 (h~l.2) and a KD of -6.4 pM, whereas TDP-43ARRM2binds Clip34 cooperatively (h~2.5) with a KD of -0.9 pM (Fig. 1J and Fig. 8C). Thus, RRM1 makes a larger contribution to tight, cooperative binding of Clip34 than RRM2. Despite weaker binding, Clip34 effectively inhibited aggregation of TDP-43ARRM1, but was less effective against TDP- 43ARRM2Q and ji) Thus, binding affinity does not necessarily predict chaperone activity. Indeed, these findings suggest that Clip34 must engage TDP-43 in a specific manner to effectively prevent aggregation, consistent with an allosteric mode of action.

[0130] The role of the NTD in binding to Clip34 was next explored. It was determined that the NTD negatively regulates Clip34 binding, as TDP-43ΔNTDbinds Clip34 with a KD of -0.37 pM, indicating an -1.3-fold increase in affinity compared to full-length TDP-43 (Fig. IL and Fig. 8D). This finding is consistent with previous work identifying an allosteric connection between the NTD and RRMs (61). However, while the NTD negatively regulates binding to Clip34 (Fig. IL and Fig. 8D), Clip34 effectively inhibited TDP-43ANTD aggregation (Fig. IF). Thus, the NTD is not required for Clip34 chaperone activity.

[0131] How does the interaction between Clip34 and the RRMs prevent intermol ecular contacts between PrLDs that drive aggregation? It was considered whether Clip34 binding to the RRMs might allosterically affect the PrLD. The PrLD drives TDP-43 aggregation, but in cells the PrLD promotes binding and regulation of a subset of RNA targets, which contain over lOOnt-long binding regions composed of dispersed binding sequences, including the 3’UTR of the TARDBP mRNA. Most studies of TDP-43 binding to RNA have employed the isolated RRMs and not the full-length protein, hence the mechanism whereby the PrLD may impact RNA binding remains unclear. Thus, it was assessed how the PrLD affects Clip34 binding by soluble TDP-43. Unexpectedly, it was found that the PrLD negatively regulates Clip34 binding to the RRMs. Deletion of the PrLD enhanced binding to Clip34 (Fig. IL and Fig. 8D). TDP-43APrLDbinds Clip34 more cooperatively (h~2.7) with a KD of -0.32 pM, indicating an ~1.5-fold increase in affinity compared to full-length TDP-43 (Fig. IL and Fig. 8D). Hence, in addition to directly establishing intermolecular contacts that drive TDP-43 aggregation, the PrLD also indirectly promotes TDP-43 insolubility by reducing the apparent affinity of the RRMs for RNA. Indeed, RNA-binding deficient TDP-43 is highly aggregation -prone in cells.

[0132] To determine whether this inhibitory effect stems from a specific portion of the PrLD, TDP-43 variants with specific deletions within the PrLD were tested. Deletion of the extreme C -terminal portion of the PrLD (TDP43vs) sjjghtly enhanced binding toAttorney Docket: 10504- 109WO1 Clip34, with an ~ 1.2-fold increase in affinity compared to full-length TDP-43 (Fig. IL and Fig. 8, D and E). Strikingly, deletion of the a-helical conserved region (CR) of the PrLD strongly enhanced binding to Clip34, indicated by an ~2.1-fold increase in affinity for TDP-43ACRcompared to full-length TDP-43 (Fig. IL and Fig. 8, D and E). A helixbreaking mutation within the CR, TDP-43A326P, also enhanced binding to Clip34 (Fig. IL and Fig. 8D). Thus, negative regulation of RNA binding by the PrLD appears to be mediated, at least in part, by the a-helicity of the CR, a region that is critical for TDP-43 phase separation via helix-helix interactions, and aggregation via intermolecular β-sheet interactions.

[0133] To explore whether the inhibitory effect of the PrLD on RNA binding impacts the ability of Clip34 to prevent TDP-43 aggregation, the ability of Clip34 to antagonize aggregation of TDP-43 variants with specific deletions within the PrLD: TDP-43A1DR1, TDP-43ACR, 'rDP-43ACR / lDR2(Q / N);TDP-43AmR2< G / S),andTDP-43ACR'iDR2(Fjg 9A) wagassessed. As anticipated, TDP-43ACRand TDP-43ACR / IDR2exhibited reduced aggregation, whereas TDP-43A1DRi, TDP-43ACR / JDR2(Q / N), TDP-43AIDR2(& / S)aggregate<j to a similar extent as full-length TDP-43 (Fig. 9B). Notably, Clip34 exhibited an enhanced ability to antagonize aggregation of these partial PrLD deletion variants (Fig. 9B, C to I). Thus, the entire PrLD antagonizes the ability of Clip34 to reduce TDP-43 aggregation. Collectively, these findings reveal allosteric crosstalk between the TDP-43 RRMs, PrLD, and RNA, which regulates the balance of soluble and aggregation-prone forms of TDP-43.

[0134] Example 3. TDP-43 binding remodels Clip34 by unfolding stem-loop structure

[0135] The TDP-43 RRMs engage single-stranded RNA often found in introns. However, Clip34 is predicted to form a stem-loop structure (Fig. IM). To assess this prediction, we utilized Clip34 RNA with a 5’ fluorophore and a 3’ quencher, based on the structural prediction that the ends of Clip34 are likely to be in close proximity (Fig. IM). Very low fluorescent signal was measured for the Clip34 fluorophore-quencher RNA on its own, indicating that the 5’ and 3’ ends are in close proximity, consistent with a stem-loop structure (Fig. IN and Fig. 8F, red arrow). However, WT TDP-43 cooperatively binds to Clip34 (Fig. 1 J ), which may enable unfolding of the stem-loop structure. Indeed, upon addition of WT TDP-43, fluorescence increased strongly (Fig. IN and Fig. 8F), indicating that TDP-43 remodels Clip34 in a manner that increases the distance between the 5’ and 3’ ends. Deletion of RRM1 slightly impaired remodeling, w'hereas deletion of both RRMs strongly impaired remodeling (Fig. IN and Fig. 8F). Conversely, deletion of the PrLD or the CR helix-breaking TDP-43A326Pmutation enhanced remodeling (Fig. IN and Fig. 8F).Attorney Docket: 10504- 109WO1 Thus, TDP-43 remodels the stem-loop structure of Clip34 in a manner that depends on the RRMs and is negatively regulated by the PrLD. These findings made us wonder whether the energetics of the TDP-43: Clip34 interaction might alter the structural dynamics of TDP-43.

[0136] Example 4. Clip34 binding remodels TDP-43 by stabilizing the RRMs and destabilizing the PrLD CR

[0137] Next examined was how Clip34 affected TDP-43 native structure via hydrogen / deuterium-exchange mass spectrometry (HXMS). HXMS measures the exchange of backbone amide hydrogen atoms over time after dilution in D2O-based buffer. When backbone hydrogens make hydrogen bonds, they exchange more slowly with deuterium. As backbone hydrogens make hydrogen bonds involved in protein secondary and tertiary structure, the kinetics by which the hydrogens exchange reports on the stability of structure in that region of the protein. In this way, we can establish how Clip34 might alter TDP-43 structural dynamics to preclude aggregation.

[0138] HXMS was performed across a wide timescale (1 s-14.5 h) with TDP-43 (with a C -terminal MBP tag to ensure solubility) in the presence or absence of excess Clip34 to saturate binding (Table S2 and Fig. 10, A to C). A 87.9% or greater coverage of the TDP- 43 sequence was achieved for all conditions (Table 2 and Fig. 10, A and B). The percentage difference in exchange between Clip34-bound and free states was calculated for each peptide at each timepoint, based on which consensus values for the percentage difference in exchange were calculated for each TDP-43 amino acid (Fig. 2, A and B, and Fig. 11).

[0139] It was determined that exchange is similar in the NTD in the Clip34-bound and free states, indicating that binding to Clip34 does not strongly impact NTD structure (Fig.2A and Fig. 12, A to C), which is consistent with our finding that the NTD is dispensable for Clip34 chaperone activity (Fig. IF). By contrast, extensive decreases in exchange in the RRMs occurred in the presence of Clip34, particularly at later timepoints (Fig. 2, A to D, and Fig. 12, D to I). This decreased exchange indicates that binding to Clip34 stabilizes the structure of the RRMs of TDP-43. Previous NMR studies have revealed the structure of the RRMs of TDP-43 in complex with a 12nt RNA, AUG12 (Table 1). In the HXMS data described herein, extensive stabilization was observed in both RRMs, including throughout the -sheet binding surface determined in the NMR structure (Fig. 2C). In particular, sub-localizing exchange differences by comparing overlapping peptides reveals that Clip34 binding strongly stabilizes residues established to play key roles in binding, including F149 in RRM1, and 1-229 and F231 in RRM2 (Fig. 2B and Fig. 11).Attorney Docket: 10504- 109WO1 Additionally, at late timepoints Clip34 binding exerted one of its strongest stabilizing effects on the extreme C-terminal portion of RRM1 (Y155-D174) (Fig. 2A). Clip34- mediated stabilization of this C-terminal portion of RRM1 likely prevents any localized unfolding that is proposed to contribute to TDP-43 aggregation.

[0140] Exchange was rapid and unaffected by Clip34 for the majority of the PrLD, including both IDR1 and IDR2, as expected for an intrinsically disordered domain (Fig.2A and Fig. 12, J to L). There was, however, one important exception. Exchange in the CR in the PrLD increased in the presence of Clip34, particularly at the early timepoints (1-18 s) (Fig. 2A and E to G, and Fig. 12, M and N, and Fig. 13, A to C). This increased exchange indicates that Ciip34 binding to TDP-43 destabilizes the CR in the PrLD. As displayed on the AlphaFold structure of TDP-43, the destabilization occurs from residue M323 within the predicted a-helix, to L340, at the end of the region predicted to have transient helical structure (Fig. 2F). Sub-localizing exchange differences reveals that Clip34 binding strongly destabilizes Q331 and S332 in the minor helical region (Fig. 2E and Fig. 11). Thus, the destabilization of the PrLD upon Clip34 binding is specific to the CR and occurs throughout both the major and minor helical regions. These findings confirm the allosteric effect of Clip34 on the PrLD, which is expected to antagonize aggregation.

[0141] Delving deeper into this destabilization, it was determined that mass spectra for CR peptides exhibited bimodality at early timepoints (Fig. 2G and Fig. 13, A to C). This bimodality suggests that there are two populations of TDP-43, with two different structures for the CR. Strikingly, the slow-exchanging, more stabilized, population is strongly represented in spectra at early timepoints in the free state, but poorly represented in the Clip34-bound state (Fig. 2G and Fig. 13, A to C). This finding indicates that Clip34 binding decreases the probability of a more stabilized CR structure. The CR is established to form a transient a-helical structure. Hence, we suggest that in the absence of RNA, the TDP-43 CR forms a transient a-helix, whereas upon Clip34 binding, the TDP-43 CR is destabilized to disfavor a-helical structure. Given the important role of the a-helical structure of the CR in phase separation and aggregation (Fig. 9B), this observation helps explain how Clip34 prevents TDP-43 aggregation. Specifically, Clip34 binding induces an aggregation-resistant form of TDP-43 with stabilized RRMs and a destabilized CR in the PrLD.

[0142] To further evaluate this model, HXMS analyses of TDP-435FL was performed in the absence or presence of Clip34. Clip34 binds weakly to TDP-435FL (Fig. 1J and Fig.Attorney Docket: 10504- 109WO1 8B) and fails to inhibit TDP-435FL aggregation (Fig. IK), indicating a reduced capacity to induce an aggregation-resistant conformation. Consistent with this observation, HXMS revealed markedly diminished or absent stabilization of the TDP-435FL RRMs in the presence of Clip34 (Table 3 and Fig. 14, A and B, and Fig. 15, A to E). Moreover, the CR of TDP-435FLretained bimodal exchange spectra, including a prominent slow-exchanging population, in the presence of Clip34 (Fig. 15A and Fig. 16, A to D). These findings demonstrate that Clip34 exhibits reduced ability to stabilize the RRMs and disrupt the bimodal behavior of the CR in TDP-435FL, thereby limiting chaperone activity. Therefore, stabilization of the RRMs and destabilization of the CR within the PrLD are both induced by Clip34 binding to the RRMs.

[0143] Mechanistically explaining how a short RNA chaperone binding to folded domains, such as the tandem RRMs, favors a distinct ensemble of conformations of a distant disordered region like the Prl.1 ) presents a significant experimental challenge. Such effects may arise from a combination of forces that are propagated through the protein upon RNA engagement. These processes are often described as allosteric, although this term has been applied broadly and does not always capture the full range of mechanisms involved, even within well-structured proteins and especially within intrinsically disordered proteins (IDPs). Previous studies have proposed that IDPs can undergo allosteric regulation through enthalpic mechanisms such as binding-site competition or entropic mechanisms such as entropic redistribution. These mechanisms range from direct local contacts to global conformational rewiring, both of which are particularly relevant for TDP-43. It was therefore asked whether a short RNA chaperone binding to the RRMs influences the distant PrLD through direct RNA-PrLD contacts that immediately alter PrLD conformation, or through indirect mechanisms in which RNA engagement remodels the TDP-43 interaction landscape and thereby shifts the PrLD conformational ensemble.

[0144] To evaluate these mechanisms and complement experimental findings, we performed multi-microsecond all-atom molecular dynamics simulations of both TDP- 43ANTDanj fun-length TDP-43 in the absence and presence of the AUG12 short RNA chaperone (Table 1 and Table 4 and Fig. 17). The AUG12 RNA (GUGUGAAUGAAU) is a synthetic GU-rich 12-mer originally used to solve the NMR structure of the TDP-43 RRMs bound to RNA, and serves here as a defined model ligand. AUG 12 inhibits TDP- 43 aggregation in a concentration-dependent manner (Fig. 17A). Consistent with experimental observations (Fig. 2F), the a-helical CR was disrupted in the presence of RNA in both TDP-43ANTOand full-length TDP-43 (Fig. 17B and Fig. 18A). TheAttorney Docket: 10504- 109WO1 simulations further revealed that the NTD destabilizes RNA binding (Fig. 18C), consistent with experimental findings showing that Clip34 binds to full-length TDP-43 with reduced affinity compared to TDP-43ANTD (Fig. IL). Given that RNA chaperone activity is independent of the NTD (Fig. IF), we focused subsequent analyses on TDP-43ΔNTD.

[0145] The molecular determinants of RNA binding in the presence of the PrLD (Fig.17C) was next examined. Both RRMs display UG-rich sequence specificity through hydrophobic interactions between conserved Phe residues (F147, F149, F194, F229, and F231) and U / G bases. In addition, positively charged Arg residues within IDR1 form electrostatic interactions with the negatively charged RNA backbone, which may compete with RRM-RNA contacts and contribute to the negative regulatory influence of the PrLD (Fig. 1, L and N). Notably, neither the CR nor IDR2 exhibited substantial interactions with RNA, indicating that changes in CR helicity upon RNA binding likely arise from indirect, allosteric effects rather than direct RNA engagement (Fig. 17C). Consistent with this interpretation, the TDP-435FLconstruct, which disrupts conserved Phe-RNA interactions and promotes RNA dissociation, displayed no alteration in CR helicity (Fig. 19, A and B).

[0146] Having ruled out direct RNA CR contacts, it was next examined how short RNA chaperone binding indirectly remodels the PrLD by altering its conformational ensemble and underlying interaction network. To quantify these effects, the radius of gyration (Rg) and intrachain distance (Rij) was calculated to assess global compaction and long-range contacts, respectively. Short RNA chaperone binding shifted the PrLD toward a more expanded and flexible state, disrupting long-range interactions and producing behavior characteristic of an ideal chain (Fig. 17D and Fig. 18B). Simultaneously, RNA binding restricted the tandem RRMs to a compact conformation that prevents RRM1 unfolding (Fig. 18B and Fig. 20, A to C). Analysis of intramolecular contacts showed that RNA engagement disrupts IDR1-IDR2 interactions as IDR1 engages the RNA backbone (Fig.17, E and F). At the same time, RRM1-RRM2 contacts remain intact, a defining feature of the RNA-bound state (Fig. 17, E and F). Notably, neither RRM directly interacts with the CR under either condition (Fig. 17F).

[0147] Collectively, these computational results reinforce the experimental observations and support an indirect mechanism in which short RNA chaperone binding to the tandem RRMs remodels the PrLD conformational ensemble and interaction network without requiring direct contact with the CR. The data demonstrate that the short RNA exerts chaperone activity specifically when the tandem RRMs engage UG-rich sequences through conserved Phe residues. RNA binding reorganizes intramolecular interactions,Attorney Docket: 10504- 109WO1 shifting the PrLD toward a more disordered ensemble associated with loss of CR helicity, while constraining RRM conformational heterogeneity to suppress aggregation-prone states (Fig. 17G).

[0148] Example 5. Enhancing Clip34 activity against diverse disease-linked TDP-43 variants

[0149] Ideally, for maximal deployability, short RNA chaperones would mitigate aggregation of diverse disease-linked TDP-43 variants, including missense variants that cause disease, as well as forms of TDP-43 bearing pathological PTMs. Thus, the following was assessed: the chaperone capability of Clip34 against a suite of ALS / FTD-linked missense variants in RRM1 (P112H), the linker between RRM1 and RRM2 (K181E), or the PrLD (G295R, G298S, A321 V, Q33 IK, M337V, and A382T), as well as PTM mimetic variants, including the pathological phosphorylation mimetics (S292E, S409 / 410E, and S292 / 409 / 410E), the pathological lysine acetylation mimetic (K145 / 192Q), and a physiological arginine methylation mimetic (R293F) (Fig. 3A and Fig. 21, A and B ). These TDP-43 variants all aggregated to a similar extent over the time period studied (Fig. 21, C and D). Strikingly, Clip34 prevented aggregation of all disease-linked TDP-43 variants, with half-maximal inhibitor concentration (IC50) values ranging from -0.12 pM-0.69 pM (Fig. 3, B and F, and Fig. 21E). Notably, for a subset of TDP-43 variants Clip34 prevented aggregation more effectively than for WT TDP-43 (ICso-OA pM), including TDP-43P!12H(IC50-0.28 pM) located in RRM1 and TDP-43K181E(ICso~O.12 pM) located in the linker between RRMs (Fig. 3B). This result is intriguing as it has been suggested that these mutations may reduce RNA binding, indicating that Clip34 can overcome this deficit and still engage and chaperone effectively. Clip34 also exhibited a significantly lower IC50 against the phosphomimetic variants TDP-43S409 / 4i0E(IC50~0.29 pM) and TDP-43S292 / 409 / 410E Q 19 Fig. 3B). Aberrant phosphoforms of TDP-43 accumulate in pathological inclusions, but our findings indicate that Clip34 can antagonize aggregation of these species. Collectively our findings suggest that Clip34 has broad chaperone activity against different forms of TDP-43 connected to disease.

[0150] By contrast, Clip34 was less effective at antagonizing aggregation of the lysine acetylation mimetic TDP-43K,45 / l92Q(ICSO~O.69 pM) compared to WT TDP-43 (Fig. 3F and Fig. 21, E to G). The K145Q: K192Q mutations reduce RNA binding, which likely reduces Clip34 efficacy. This issue of reduced efficacy is problematic for Clip34, as TDP- 43 acetylated at KI 45 accumulates in pathological inclusions in ALS.Attorney Docket: 10504- 109WO1

[0151] To overcome this deficit of Clip34, we next defined an enhanced CIip34 variant with increased activity against TDP-43K145 / 192Q. This Clip34 variant, Clip34_UG6, harbors (UG)4 in place of CAGAGACU in the middle of the sequence (Fig. 3, C and D). Clip34_UG6 binds to the isolated TDP-43 RRMs with higher affinity than Clip34. Remarkably, Clip34_UG6 prevented aggregation of diverse disease-linked TDP-43 variants with IC50 values ranging from -0.16 pM-0.45 1.1 M (Fig. 3C). Like Clip34, Clip34_UG6 was significantly more effective at inhibiting aggregation of the RRM1 variant, TDP-43P112H(IC50~0.23 uM), RRM1-RRM2 linker variant TDP-43Ki81E(IC'5o~O.16 pM), and the phosphomimetic variants TDP-43S409 / 410E(IC50~0.28 uM) and TDP-43S292 / 409 / 410E(IC 50-0.21 pM) than WT TDP-43 (IC5o~O.45 pM; Fig. 3C and Fig.2 IF). Unlike Clip34, Clip34_UG6 was significantly more effective at inhibiting aggregation of the PrLD variant TDP-43A321V(IC50~0.25 pM) and the arginine methylation mimetic TDP-43R293F(IC50~0.26 pM) than WT TDP-43 (ICso-0.45 pM; Fig.3C). Importantly, Clip34_UG6 prevented aggregation of the double acetylation mimetic TDP-43K145 / 192Qwith a similar efficacy (ICso-0.35 pM) as for WT TDP-43 (ICso-0.45 pM; Fig. 3C). The enhanced activity of Clip34_UG6 against TDP-43K145 / 192Qcould not be recapitulated by introducing (UGh at different positions in the central portion of Clip34 (Fig. 3D). Although Clip34_UG2_start, Clip34_UG2_middle, and Clip34_UG2_end all displayed robust chaperone activity against WT TDP-43 (Fig. 3E), they were not as effective as Clip34_UG6 against TDP-43K145 / 192Q(Fig. 3F and Fig. 21G). Indeed, Clip34_UG2_middle was ineffective against TDP-43K145 / 192Q(Fig. 3F and Fig. 21G). Overall, these data suggest that Clip34_UG6 chaperone activity has broader applicability than Clip34 and is likely less affected by pathological K145 / K192 acetylation.

[0152] To gain mechanistic insight into the differences in short RNA chaperone activity, it was assessed whether differing IC50 values could be due to alterations in binding affinity. Thus, we determined the KD of select TDP-43 variants for Clip34. In some cases, KD tracked closely with IC50 (Fig. 3, G and H, and Fig. 21, H and I). For example, TDP- 43G295Rbound to Clip34 with a similar affinity as WT TDP-43, in accordance with the similar IC50 values of TDP-43G295Rand WT TDP-43 with Clip34 (Fig. 3, C and G, and Fig. 21H). Moreover, TDP-43K145 / 192Qexhibited impaired binding to Clip34 compared to Clip34_UG6, with binding affinity to Clip34 reduced by -2.9-fold compared to WT TDP- 43 (Fig. 3, G and H, and Fig. 21, H and I). This finding helps explain why Clip34 is less effective against TDP-43K145 / 192Q. In other cases, the KD does not precisely track with IC50. For example, despite exhibiting lower IC50 values with CIip34 than WT TDP-43, TDP-Attorney Docket: 10504- 109WO1 43P112Hand TDP-43K181Edid not show increased binding affinity to Clip34 (Fig. 3, C and G, and Fig. 21H). In fact, TDP-43P112Hdisplayed impaired binding to Clip34 compared to WT TDP-43 (Fig. 3G and Fig. 21H). We suggest that while a certain threshold of binding affinity (KD < 1.4 pM) is critical for a short RNA to effectively chaperone TDP-43, other components of the interaction beyond simple binding affinity must contribute to chaperone activity.

[0153] Example 6. Defining additional potent short RNA chaperones against diverse disease-linked TDP-43 variants

[0154] To expand the arsenal of short RNA chaperones, additional RNAs that prevent aggregation of the broad spectrum of TDP-43 disease-relevant variants (Fig. 4A and Fig.22A) were defined. First, the synthetic RNA, (UG)17, was assessed, which is an extremely potent RNA chaperone (IC50~0.2 μM) for WT TDP-43 (Fig. 22B). (UG)17also potently chaperoned all tested disease-relevant TDP-43 variants, including missense mutants in both the RRMs (TDP-43P112Hand TDP-43K181E) and the PrLD (TDP-43G295Rand TDP-43Q331K) (Fig. 22B). Thus, simple repetitive UG sequences can effectively chaperone TDP- 43.

[0155] Next identified were potent short RNA chaperones based on natural RNA sequences known to interact with TDP-43 (Fig. 4A). These include SATIII, derived from the pericentromeric satellite 111 repeat RNA; Malat1_start, from the MALAT1 long non-coding RNA; and CLN6_middle, from the CLN6 protein-coding transcript. It was determined that each of these short RNAs effectively chaperoned TDP-43 and disease- linked variants, including TDP-43K145 / 192Q(Fig. 4B and Fig. 22, C to H). The response of TDP-43 variants to these short RNAs closely resembled the pattern observed for Clip34 and Clip34_UG6 (Fig. 4B). However, compared to Clip34 and Clip34_UG6, there were fewer significant differences in the SATIII, Malat1_start, and CLN6..middle IC50 values for WT TDP-43 and the disease-associated TDP-43 variants (Fig. 3, C and D, and Fig. 22, C to E). This finding suggests that the nature of how SATIII, Malat1_start, and CLN6_middle engage TDP-43 is more similar across TDP-43 variants than it is for Clip34 and Clip34_UG6. Overall, Malat1_start emerged as the most potent chaperone based on natural RNA sequences. Malat1_start had the lowest IC50 values against WT TDP-43 (IC50~0.36 pM) and disease-relevant variants (IC50 ranges from -0.17 pM-0.44 pM) (Fig.4B and Fig. 23, A and B). These findings support the development of Malat1_start as a short therapeutic RNA.Attorney Docket: 10504- 109WO1

[0156] A feature that emerged across the tested short RNA chaperones and TDP-43 variants was a positive correlation between the IC50 value and the steepness of the hill slope for inhibition (Fig. 23C). In general, RNAs inhibited TDP-43 aggregation in a cooperative manner with h ranging from -1.2 to -20 (Fig. 23C). However, increased cooperativity correlated with decreased efficacy of the RNA at preventing TDP-43 aggregation.

[0157] In addition to Malat1_start and CLN6_middle, we tested two additional RNAs derived from both the MALAT1 and CLN6 RNAs: Malat1_middle, Malat1_end, CLN6_start, and CLN6_end (Fig. 23A). These RNAs were effective at preventing WT TDP-43 aggregation, although less potently than Malat1_start or CLN6_middle, respectively, based on IC50 values (Fig. 23, D to G). Each of these four RNAs also prevented aggregation of the TDP-43 RRM1 missense variant TDP-43P112Hand the RRM1-RRM2 linker variant TDP-43K181E(Fig. 23, D to G). Out of all tested natural RNAs, CLN6_end had the lowest potency against WT TDP-43 (IC50~0.67 pM; Fig. 3B and Fig.22, C to E, and fig. 23, D to G). This trend was also captured by sedimentation analysis of the end timepoint of aggregation assays, where CLN6_end was less effective at maintaining WT TDP-43 in the soluble fraction (Fig. 23, H and I).

[0158] To identify additional natural RNAs that effectively chaperone TDP-43, findings were also considered that G-quadruplex DNAs and RNAs can serve as protein chaperones. Indeed, a 28nt G-quadruplex-forming DNA sequence, LTR-III, can effectively chaperone denatured TagRFP675 protein. As TDP-43 binds to HIV-1 LTR DNA, and the LTR-III RNA derived from this HIV-1 LTR sequence contains UG dinucleotides, we tested the ability of this RNA to prevent TDP-43 aggregation (Fig. 23, A and J). We found that this short G-quadruplex-forming RNA effectively prevents aggregation of WT TDP-43 (Fig.23, J and K). Thus, short G-quadruplex RNAs emerge as potent chaperones for TDP-43.

[0159] Example 7. Effective RNA chaperones can engage the TDP-43 RRMs differently

[0160] Having assembled an arsenal of effective short RNA chaperones for TDP-43, we next set out to understand the basis of the differences in chaperone efficacy between RNAs. The binding affinity for WT TDP-43 or TDP-43P112Hfor each RNA did not correlate with the IC50 values of these RNAs with the respective TDP-43 variant (Fig. 4, C and D, and Fig. 24, A to C). This observation confirms that binding affinity is not the sole determinant of the ability of a short RNA to prevent TDP-43 aggregation. Another factor that may influence chaperone activity is exactly how each RNA engages the TDP-43 RRMs. ToAttorney Docket: 10504- 109WO1 understand whether different short RNAs engage the TDP-43 RRMs in the same way, we conducted NMR experiments on the isolated RRMs of TDP-43 in solution.

[0161] NMR experiments were performed with WT TDP-43 RRMs and TDP-435FLRRMs in the presence of increasing concentrations of the short A(GU)6RNA. Compared with WT, TDP-435FLRRMs displayed several broadened resonances and lacked chemical-shift perturbations for a subset of residues, indicating weaker binding and involvement of fewer residues in binding RNA (Fig. 24, D to G). These results are consistent with the established characterization of TDP-435FLas RNA-binding deficient (Fig. 1 J).

[0162] NMR experiments were then performed with WT TDP-43 RRMs with two-fold excess Clip34, Clip34_UG6, and Malat1_start to saturate binding. Overall similarities in resonance shifts and broadening were observed, which report on molecular structure and conformational exchange as these three RNAs engage the RRMs, particularly in RRM1 (residues 138-142 and 160-172), indicating that these regions are important for binding independent of the details of the RNA sequence (Fig. 4, E and F, and Fig. 24, H and I). However, there were focused regions of discernable differences between the three different RNAs, indicative of changes in interaction and conformational exchange and motions dependent upon the RNA sequence (Fig. 4, E and F, and Fig. 24, H and I). When in complex with Clip34 compared to with Malat1_start, the TDP-43 RRMs showed more broadening and unique shifts in the region of residues 145-151 in the third p-strand of RRM1 (Fig. 4, E and F). This region harbors K145 that can be acetylated to disrupt RNA binding, and F147 and Fl 49 that stack to interact with a U or G base, respectively, and are essential for RNA binding in RRM1. Additionally, broadening and unique shifts were also observed in the region of residues 104-106 on the adjacent first P-strand of RRM1 (Fig. 4, E and F). Therefore, unique interactions or motions in these regions are present for Clip34 compared to Malatl... start. Additionally, Clip34_UG6 also showed distinct perturbations compared to Clip34 in the vicinity of K145, as well as large chemical shift perturbations at three positions between 130 and 140, distinguishing these two similar sequences (Fig.24, H and I). These differences may help explain why Clip34 is less effective in chaperoning the pathological acetylation mimic, TDP-43K145 / 192Q, in comparison to Clip34_UG6 and Malat1_start, which are more effective (Fig. 4B). It was concluded that while RNAs exhibit partial similarity in their interactions with TDP-43, there are also noticeable differences in specific regions, which likely translate into differences in chaperone activity.

[0163] Example 8. Malat1_start reverses TDP-43 condensation and aberrant aggregationAttorney Docket: 10504- 109WO1

[0164] Having identified Malat1_start as the most potent naturally derived inhibitor of TDP-43 aggregation, it was next asked whether this RNA could also reverse TDP-43 condensation and aggregation. TDP-43 aggregates are already present in neurons of patients with ALS / FTD, so the ability to dissolve existing cytoplasmic condensates and aggregates would substantially enhance the therapeutic potential of this RNA chaperone. Under physiological concentrations and buffer conditions, purified TDP-43 spontaneously phase separates into condensates. Preformed TDP-43 condensates remained intact after addition of buffer or the negative control RNA (AC)17(Fig. 25, A to C). However, brightfield microscopy revealed that TDP-43 condensates were initially spherical, but over time morphed into more irregular structures in the presence of buffer or (AC)17, indicating an aberrant phase transition (Fig. 25C). In striking contrast, TDP-43 condensates were rapidly solubilized by Malat1_start (Fig. 25, A to C). Thus, like Clip34, Malat1_start potently reverses TDP-43 condensation.

[0165] Purified TDP-43 can also rapidly aggregate into tangled fibrillar aggregates. These preformed TDP-43 aggregates were stable and unaffected by addition of water or the negative control RNA (AC)17(Fig. 26, A and B). In striking contrast, Malat1_start partially restored TDP-43 to the soluble fraction (Fig. 26, A and B). Electron microscopy revealed that large TDP-43 aggregates persisted in the presence of water or the negative control RNA (AC)17(Fig. 26, C to F). Strikingly, Malat1_start remodeled large aggregates into smaller structures (Fig. 26, C to F). Indeed, TDP-43 aggregate size was reduced -100-fold by Malat1_start compared to the no RNA control (Fig. 26D). Likewise, Malat1_start greatly reduced TDP-43 aggregate area and density (Fig. 26, E and F). Thus, Malat1_start directly solubilizes TDP-43 aggregates.

[0166] Example 9. Short RNAs reduce cytoplasmic TDP-43 aggregation in an optogenetic cellular model

[0167] It was next assessed whether short RNAs combat TDP-43 aggregation in human cells. An optogenetic model of TDP-43 proteinopathy was utilized in which TDP-43 is fused to Cry2olig, a domain derived from the cryptochrome 2 protein that undergoes homo-oligomerization upon exposure to blue light. This homo-oligomerization results in the formation of cytoplasmic TDP-43 puncta that display typical hallmarks of disease, including colocalization with p62 and pTDP-43(pS409 / 410) signal. Using this optogenetic model in human (HEK293) cells, the effect of a subset of short RNAs with a range of activities in vitro was tested: Malat1_start (IC50~0.36 pM), (UG)17(IC50~0.2 pM), and CLN6_middle (IC50~0.42 pM). Compared to cells treated with a control (CTR) RNA notAttorney Docket: 10504- 109WO1 expected to bind TDP-43, Malat1_start and (UG)17significantly reduced the average area of cytoplasmic TDP-43 inclusions per cell, whereas CLN6_middle did not (Fig. 5, A and B, and Fig. 27, A to C). Instead, cells treated with Malat1_start and (UG)17exhibited nuclear foci, resembling cells expressing optoTDP-43 but not exposed to blue light (dark) where optoTDP-43 forms nuclear condensates (Fig. 27, A to C). It was confirmed that Malat1_start solubilizes optoTDP-43 in cells via biochemical fractionation. Treatment with Malat1_start, but not the CTR RNA, increased optoTDP-43 levels in the soluble fraction and decreased optoTDP-43 levels in the insoluble fraction compared to nontreated (NT) cells that did not receive RNA (Fig. 27, D to F). These findings indicate that Malat1_start enhances TDP-43 solubility in a cellular model of TDP-43 proteinopathy. Malat1_start and (UG)17were the two most effective RNAs at reducing cytoplasmic TDP- 43 puncta area in human cells and preventing TDP-43 aggregation in vitro. Thus, our in vitro aggregation assays provide a powerful platform for identifying RNAs with chaperone activity against TDP-43 in human cells.

[0168] Example 10. Clip34 and Malat1_start RNAs do not cause TDP-43 loss of function

[0169] A possible concern with employing short RNAs in this way is that they might remain too stably bound to TDP-43 and interfere with essential RNA-processing reactions. However, when RNA-binding proteins are engaged by nuclear-import receptors in the cytoplasm for transport to the nucleus, bound RNA is ejected, such that the short RNA would be recycled for further rounds of chaperone activity. Clip34 is not toxic to human cells and does not affect nuclear localization of endogenous TDP-43. Moreover, Clip34 does not inhibit TDP-43 function in pre-mRNA splicing reactions.

[0170] To assess whether Malat1_start, Clip34, and (UG)17might interfere with TDP-43 function, we employed the CUTS (CFTR UNC13A TDP-43 Loss-of-Function) biosensor, a cryptic exon RNA biosensor enabling real-time detection of TDP-43 loss of splicing function. CUTS can detect even an -10% decrease in TDP-43 functionality. Clip34 and Malat1_start did not interfere with TDP-43 function (Fig. 27G). By contrast, (UG)17interfered with TDP-43 function, and this effect was larger than a siRNA positive control that reduces TDP-43 expression by -2% (Fig. 27D). Thus, (UG)17displays undesirable properties and hence did not advance to studies with human induced pluripotent stem cell (iPSC)-derived motor neurons or mice.

[0171] Example 11. Short RNA chaperones restore physiological TDP-43 localization in ALS patient-derived motor neuronsAttorney Docket: 10504- 109WO1

[0172] To further evaluate the translational potential of short RNAs, iPSC-derived motor neurons from a healthy control or individuals with ALS caused by a hexanucleotide repeat expansion in the C9orf72 gene (C9-ALS) were utilized. C9-ALS iPSC-derived motor neurons exhibit TDP-43 pathology in the form of a decreased TDP-43 nuclear / cytoplasmic ratio. Indeed, compared to healthy control iPSC-derived motor neurons without RNA treatment (mock) or treated with the CTR RNA, C9-ALS iPSC-derived motor neurons exhibited a decreased TDP-43 nuclear / cytoplasmic ratio (Fig. 28, A and B). By contrast, treatment of C9-ALS iPSC-derived motor neurons with Clip34 or Malat1_start, but not the CTR RNA, increased the TDP-43 nuclear / cytoplasmic ratio to the level of healthy control iPSC-derived motor neurons with mock treatment (Fig. 5, C and D, and Fig. 28B). This rescue was not attributable to altered subcellular distribution of the therapeutic RNA, as the CTR RNA and Malat1_start RNA exhibited similar localization patterns in motor neurons (Fig. 28C). These results indicate that Clip34 and Malat1_start counteract cytoplasmic mislocalization of TDP-43 and promote nuclear localization of TDP-43 in C9-ALS patient-derived motor neurons experiencing nuclear-pore injury.

[0173] Example 12. Malat1_start restores TDP-43 functionality in stressed iPSC-derived motor neurons

[0174] It was next examined how short RNA chaperones affect the functional activity of TDP-43 as a splicing regulator. Oxidative stress can induce TDP-43 mislocalization, dysfunction, and cryptic exon retention. Control iPSC-derived motor neurons were treated with sodium arsenite, which induces TDP-43 nuclear depletion, TDP-43 loss of function, and G3BP1-positive stress granules (Fig. 29 A). Loss of TDP-43 function induces cryptic splicing of numerous genes. In particular, TDP-43 dysfunction promotes inclusion of a cryptic exon in STMN2, leading to premature polyadenylation and loss of STMN2 protein, which is essential for axonal regeneration. TDP-43 loss-of-function also causes exon skipping in KCNQ2, which encodes a voltage-gated potassium channel critical for neuronal excitability. Sodium arsenite treatment of iPSC-derived motor neurons induced cryptic splicing of both STMN2 and KCNQ2 (Fig. 29, B to E). Compared with the control RNA, Malat1_start markedly reduced the levels of both cryptic products in sodium arsenite-treated motor neurons (Fig. 29, B to E). These findings demonstrate that Malat1_start restores TDP-43 splicing function in iPSC-derived motor neurons undergoing stress-induced TDP-43 loss of function.

[0175] Example 13. Malat1_start restores TDP-43 function without disrupting physiological RNA granulesAttorney Docket: 10504- 109WO1

[0176] Although TDP-43 is predominantly nuclear, it also serves as a key component of axonal RNA granules. To confirm that short RNA chaperones do not perturb these physiological granules, TDP-43-containing RNA granules in neurites of healthy isogenic and C9-ALS iPSC -derived motor neurons were analyzed (Fig. 30 and Fig. 31). The abundance of TDP-43 puncta in neurites was similar following treatment with Malat1_start or the C'TR RNA (Fig. 30 and Fig. 31A). Furthermore, the abundances of neuritic TDP-43 puncta in the CTR and Malat1_start conditions for the isogenic line were no different from healthy control iPSC-derived motor neurons without RNA treatment (data not shown). To further assess effects on physiological RNA granules, Staufen-1 (STAU1), another RNA-binding protein with established roles in neuritic RNA transport and localization was examined. Both Malat1_start and the CTR RNA showed minimal colocalization with STAU1 in neurites (Fig. 30 and Fig. 31, B and C). Moreover, the abundance of STAU1-containing puncta remained comparable across treatments with Malat1_start and the CTR RNA (Fig. 30 and Fig. 31D). Together, these findings indicate that Malat1_start mitigates aberrant TDP-43 phenotypes without disturbing the physiological localization of TDP-43 or STAU1 to neuritic RNA granules.

[0177] Example 14. Malat1_start mitigates neurodegeneration and TDP-43 aggregation in mice

[0178] After establishing the ability of Malat1_start to mitigate aberrant TDP-43 phenotypes in optogenetic models and in ALS patient-derived and control motor neurons, this short RNA was tested in vivo. An acute spinal expression paradigm in mice was utilized that was employed to explore astrocytic mutant FUS expression in vivo (Fig. 6A). Adeno-associated virus (AAV) 9 containing the CMV-promoter driven TDP-43 NLS1 YFP plasmid was generated, which results in cytoplasmic YFP-tagged TDP-43 due to a mutated nuclear localization signal (TDP-43ΔNLS). This virus was bilaterally injected across six sites in the cervical spinal cord of p180 mice (Fig. 6A). At day 7 (D7), highly efficient viral delivery to the ventral horn was observed along with robust expression of TDP-43ΔNLS(Fig. 32A), which formed cytoplasmic puncta (Fig. 32B). At D7, animals were treated with either saline or Malat1_start.

[0179] The effect of RNA treatment on motor neuron loss and TDP-43 aggregation was then determined. RNA penetration to the spinal cord ventral horn and found partial colocalization of TDP-43 puncta with Malat1_start was verified, indicating successful target engagement (Fig. 32, B and C). Motor neurons from these mice with two neuronal markers were counted: choline acetyltransferase (ChAT), which denotes cholinergic motorAttorney Docket: 10504- 109WO1 neurons, and NeuN, which stains neuronal nuclei. Saline-treated TDP-43ΔNLSanimals displayed a progressive temporal loss of ChAT+motor neurons, with the average percent of remaining motor neurons, compared to sham surgery controls, of 68.8% at D7 falling to 41.2% at DIO and 30.1% at D12 (Fig. 6, B and C, and Fig. 32D). By contrast, Malat1_start-treated TDP-43ΔNLSanimals maintained their ChAT+motor neurons over this time course, with averages of 63.1% at DIO and 63.2% at D12 (Fig. 6, B and C, and Fig.32D). Similarly, assessment of ventral horn NeuN+neurons revealed that in saline-treated TDP-43ΔNLSanimals, the average of 76.5% of neurons at D7, compared to sham surgery controls, progressively decreased to 50.5% at DIO and 38.4% at D12 (Fig. 32E). NeuN⁺ neurons were also maintained in the Malat1_start-treated TDP-43ΔNLSanimals, with average neuronal values comparable to the D7 baseline across the weeklong time course (70.2% at DIO and 70.2% at D12) (Fig. 32E). Thus, Malat1_start mitigates TDP-43-driven neurodegeneration in vivo.

[0180] Three-dimensional image analysis was then used to determine the average TDP- 43 puncta size per motor neuron. The average TDP-43 puncta size was reduced in animals treated with Malat1_start compared to saline-treated animals at both D10 and D12 timepoints (Fig. 6, D and E, and Fig. 33A). Furthermore, the average puncta size was reduced at D10 in Malat1_start treated animals compared to the D7 baseline (Fig. 6E). Thus, Malat1_start partially reversed TDP-43 aggregation, indicating that it acts on existing aggregates in vivo. We also determined the change in the average number of TDP- 43 puncta per motor neuron in each animal. The average total TDP-43 puncta per neuron increased progressively in saline-treated animals, starting at 25.5 at D7 and increasing to 35.7 at D10 and 52.7 at D12 (Fig. 6D and Fig. 33, A and B). Compared to saline-treated animals, the average number of puncta per neuron was reduced in Malat1_start-treated animals (29.7 at D10 and 39.8 at D12) (Fig. 6D and Fig. 33, A and B). Thus, Malat1_start treatment reduces both the size and number of TDP-43 aggregates in mouse motor neurons.

[0181] Finally, TDP-43 functionality in vivo was evaluated by quantifying the aberrant inclusion of exon 17b in the Sort1 transcript, a known TDP-43 splicing target in both mice and humans. Total Sort1 mRNA levels were similar across all treatment groups (Fig. 33C). However, Malat1_start treatment reduced the ratio of the exon 17b-containing Sort1 isoform to the canonical transcript by approximately 50% relative to saline-treated animals at both D10 and D12 (Fig. 6F). These results demonstrate that Malat1_start corrects TDP- 43-dependent splicing defects in vivo. Together, the data show that a single dose ofAttorney Docket: 10504- 109WO1 Malat1_start RNA mitigates TDP-43 aggregation, restores TDP-43 function, and reduces motor neuron degeneration in a mouse model of TDP-43 proteinopathy.

[0182] Example 15. Interpretation of HXMS Data for Bimodal Peptides Reveals Reduced Allosteric Coupling in TDP-435FL

[0183] For HXMS experiments, interpretation of stabilization changes based on differences in exchange percentage is complicated when peptides exhibit bimodal behavior. This complexity arises because differences in exchange percentage are derived from peptide deuteration levels calculated using envelope centroid values. The centroid values reported by HDExaminer are less informative for bimodal peptides, since a single centroid does not readily capture the relative populations of peptides in stabilized versus destabilized states. Mass spectra therefore provide a more reliable measure for these bimodal peptides, as they reveal clear shifts in the proportion of stabilized and destabilized populations.

[0184] For example, although Clip34 appears to destabilize the CR of TDP-435FLwhen visualized by exchange percentage (Fig. 15A), inspection of the mass spectra shows that the effect is minimal and of greatly reduced magnitude compared with the impact of Clip34 on the CR of wild-type TDP-43 (Fig. 16, A to D). Thus, Clip34 strongly destabilizes the CR only in the wild-type protein, whereas spectra for TDP-435FLretain pronounced bimodality similar to the free state (Fig. 16, A to D). The modest destabilizing effect of Clip34 on the CR of TDP-435FLparallels the correspondingly weak stabilizing effect on the RRMs, reflecting the reduced affinity of Clip34 for the RRMs in this variant (Fig. 1 J and Fig. 15, A to E). In addition, exchange percentage data for CR peptides indicate that the CR in TDP-435FLis slightly more stable in the free state than in wild-type TDP-43 (Fig. 10A and Fig. 14A). This mildly increased intrinsic stability further limits the capacity of Clip34 to destabilize the CR upon binding to the RRMs. Together, these findings indicate that mutation of the five conserved Phe residues in TDP-435FLincreases the intrinsic stability of the CR while weakening short RNA binding to the RRMs. These effects combine to attenuate the chaperone activity of Clip34 against TDP-435FL. Furthermore, these data suggest that the five Phe residues mutated in TDP-435FLlikely contribute to priming CR unfolding in the free state, and disruption of these residues weakens the allosteric coupling between the RRMs and CR.

[0185] Example 16. Discussion

[0186] In this study, allosteric crosstalk between the TDP-43 RRMs, PrLD, and RNA has been defined, which dictates the propensity of TDP-43 to access soluble or aggregation-Attorney Docket: 10504- 109WO1 prone states. Specifically, the RRMs and PrLD form a sensitive interdependent module within TDP-43. When a short 34nt RNA binds to the TDP-43 RRMs, it acts as a molecular stabilizer, allosterically inducing the PrLD to populate disordered states with reduced propensity to self-assemble. For example, Clip34 engages and stabilizes the RRMs, and destabilizes a transient a-helix in the CR of the PrLD. This destabilization promotes solubility and disfavors self-assembly. Indeed, Clip34 binding elicits strong local destabilization of structure at residues Q331 and S332 in the CR. This allosteric effect suggests that short RNA binding does more than simply anchor TDP-43 to the nucleic acid. Rather, the short RNA alters TDP-43 conformation such that aggregation-prone states are depopulated.

[0187] Deletion of RRM2 more drastically impaired the ability of Clip34 to chaperone TDP-43 than deletion of RRM1. As RRM2 is proximal to the PrLD, it is suggested that RRM2 transmits the effect of RNA binding to the PrLD. In the apo state, the CR region of the PrLD morphs from a disordered state to an a-helical form, which promotes intermolecular contacts between PrLDs that drive phase separation. Ultimately, an aberrant phase transition occurs when the a-helical CR transitions to the intermolecular p- sheet structure of TDP-43 fibrils. By allosterically promoting disorder in this region, RNA effectively chaperones TDP-43 and prevents pathological aggregation. Intriguingly, although the destabilizing effect of Clip34 is specific to the CR when measured for soluble full-length TDP-43, Clip34 can also prevent aggregation of TDP-43 deletion constructs lacking the CR. Thus, Clip34 binding to the RRMs likely imposes additional allosteric effects on the PrLD beyond the CR that maintain intrinsic disorder, and thereby prevent formation of intermolecular contacts and structures that drive aggregation.

[0188] Conversely, the PrLD negatively regulates the affinity of the RRMs for RNA. The increase in RNA binding when the PrLD is deleted suggests that the PrLD likely moderates RNA- binding capacity of TDP-43, thereby maintaining a balanced engagement with RNA under physiological conditions. Within the PrLD, the CR plays an important role in this negative regulation, as deletion of the CR increases the affinity of TDP-43 for Clip34 RNA by -2.1-fold. Intriguingly, we found that TDP-43 remodels Clip34 by separating its 5’ and 3' ends, an activity that was also negatively regulated by the CR and PrLD. It will be important to determine whether this RNA-remodeling activity is important for TDP-43 function. Consistent with previous findings that the PrLD modulates TDP-43 binding and function at a subset of endogenous RNA regions, the findings herein suggest that the PrLD acts as a regulatory hub for tuning RNA interactions. Importantly, deletion of the CRAttorney Docket: 10504- 109WO1 confers impaired neuronal function and behavioral abnormalities in mice, reinforcing the critical role of the CR in regulating TDP-43 function. Overall, these findings suggest that interplay between the RRMs, PrLD, and RNA maintains a precise balance between TDP- 43 solubility and self-assembly propensity. TDP-43 likely responds dynamically to environmental cues, such as RNA availability, to maintain solubility and avoid aggregation. It is suggested herein that RNA-depleted environments, such as the cytoplasm of aging neurons or the interior of aging stress granules or other aberrant assemblies, place TDP-43 at risk for pathological aggregation. Indeed, pathological TDP-43 inclusions are typically depleted of RNA.

[0189] Importantly, the initial lead RNA, Clip34, is effective at preventing the pathological aggregation of diverse ALS / FTD-linked forms of TDP-43, including the WT protein, and several missense variants in RRM1 (P112H), the linker between RRM1 and RRM2 (K181E), and in the PrLD (G295R, G298S, A321V, Q331K, M337V, and A382T). Thus, this approach is likely to be broadly applicable to the majority of sporadic ALS cases in addition to rare familial forms caused by TDP-43 mutations. The ability to counter aggregation of TDP-43P112H and TDP-43K181E was surprising, as these TDP-43 variants have been reported to have reduced RNA binding (78-80), indicating that Clip34 can overcome this deficit and still chaperone effectively. Clip34 could also effectively chaperone pathological phosphomimetic variants of TDP-43 (S409 / 410E and S292 / S409 / 410E) and the physiological PrLD arginine methylation mimetic (R293F). However, Clip34 was less effective against pathological RRM lysine acetylation mimetic (K145 / 192Q). This reduction in activity is problematic, as TDP-43 acetylated at K145 accumulates in pathological inclusions in ALS. Hence, enhanced, short RNA chaperones were sought that were also effective against TDP-43K145 / K192Q.

[0190] By mining the sequence space of natural and synthetic short RNAs that engage TDP-43, many short RNAs have been uncovered that can effectively chaperone TDP-43. Of these, the two most potent were an engineered variant of Clip34 (SEQ ID NO:1), Clip34_UG6 (SEQ ID NO:4), and Malat1_start derived from the MALAT1 long non-coding RNA (SEQ ID NO: 10). Clip34_UG6 and Malat1_start effectively chaperoned diverse disease-linked TDP-43 variants, including TDP-43K145 / K192Q. A short synthetic RNA, (UG)17 (SEQ ID NO:8), was also effective. Importantly, Malat1_start and (UG)17 could also mitigate TDP-43 aggregation in an optogenetic model of TDP-43 proteinopathy in human cells. Thus, their activity extends beyond the pure protein level. However, a concern with using short RNAs in this way is that the RNA may remain too stably boundAttorney Docket: 10504- 109WO1 to TDP-43 and interfere with TDP-43 function. Indeed, using a sensitive CUTS reporter of TDP-43 functionality, it was determined that that (UG)17 interfered with TDP-43 function in human cells. Thus, this synthetic RNA is unsuitable for further development. Importantly, neither Malat1_start nor Clip34 interfered with TDP-43 function at the same concentration. Furthermore, Malat1_start enhanced TDP-43 solubility in the optogenetic model of TDP-43 proteinopathy.

[0191] Remarkably, treatment of C9-ALS iPSC-derived motor neurons with Clip34 (SEQ ID NO:1) or Malat1_start (SEQ ID NO:10) short RNAs restored nuclear TDP-43 localization to levels seen in control motor neurons. Thus, Clip34 and Malat1_start short RNAs can correct TDP-43 localization in patient-derived motor neurons. These findings suggest that short RNA chaperones have applications in C9-ALS / FTD cases, which also present with TDP-43 proteinopathy. Malat1_start also corrected multiple cryptic splicing events regulated by TDP-43 in sodium-arsenite-treated iPSC-derived motor neurons.

[0192] Finally, the ability of Malat1_start to mitigate aberrant TDP-43 phenotypes was assessed in an acute spinal expression paradigm in mice in which AAV9 delivers TDP- 43ANLS. TDP-43ΔNLSaggregates in the cytoplasm and elicits motor neuron degeneration within 2 weeks. A challenge facing short RNA therapeutics is drug delivery, but we show here that 2’OMe-modified Malat1_start (SEQ ID NO:18) bearing five phosphorothioate linkages at each end can be readily delivered by direct spinal cord application, which penetrates into the cytoplasm of neurons effectively. Thus, Malat1_start was delivered after 7 days of TDP-43ΔNLSexpression, at which time TDP-43 aggregates had already accumulated in the cytoplasm of motor neurons, and motor neuron degeneration is underway. Remarkably, Malat1_start reduced TDP-43 aggregation, mitigated misregulation of a TDP-43 target transcript, and prevented motor neuron degeneration in this model. Thus, a single dose of Malat1_start RNA reduces TDP-43 aggregation, TDP- 43 dysfunction, and motor neuron degeneration in vivo.

[0193] These studies reveal mechanisms of short RNA chaperones and pave the way for their development as therapeutics for fatal TDP-43 proteinopathies. These findings present a highly actionable therapeutic opportunity for diverse TDP-43 proteinopathies, including ALS / FTD, AD, LATE, and CTE. By transiently engaging TDP-43 with a short RNA therapeutic, one can shift the equilibrium back to soluble forms of TDP-43, which can be transported to the nucleus to mitigate TDP-43 loss of function. Short RNAs would preferentially engage TDP-43 in the cytoplasm where there is less competition from endogenous RNA, which is more concentrated in the nucleus. Moreover, as nuclear-importAttorney Docket: 10504- 109WO1 receptors bind solubilized TDP-43 in the cytoplasm, they will eject the bound RNA, such that the short RNA can be recycled for further rounds of TDP-43 solubilization in the cytoplasm. In this way, an apo form of TDP-43 is chaperoned back into the nucleus safely by nuclear-import receptors, where it can functionally engage RNA targets. Importantly, our short RNAs are similar in size and chemistry to FDA-approved ASOs, which can be readily delivered to the spinal cord and brain parenchyma of patients to exert therapeutic effects in ALS caused by SOD1 mutations and spinal muscular atrophy. Thus, defined herein is a mechanistic and therapeutic framework for RNA-based strategies to counter TDP-43 proteinopathies.

[0194] Example 17. Materials and Methods

[0195] Animals

[0196] Experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at Thomas Jefferson University and were conducted in compliance with the Guide for the Care and Use of Laboratory Animals from the National Institutes of Health. Female non-transgenic C57BL / 6J mice aged 180 days were acquired from Jackson Laboratories (https: / / www.jax.org / strain / 000664) and housed in an animal facility with controlled humidity, temperature and light cycles, with access to ad libitum water and standard chow. As analgesics are delivered on the basis of animal weight, and to better control variance in animal starting weight, female mice were exclusively chosen for this present study.

[0197] This study represents a total of 64 animals having undergone the spinal surgeries described below. Initial characterization of viral expression used n=3 animals in sham surgery, and TDP-43ΔNLSgroups expressing virus for 7 days. In the main cohort of animals, there were n=8 sham non-injected animals and 50 animals which received injections to express TDP-43ΔNLS. After one week, all 58 animals underwent a second surgery. Sham animals again received no treatment, whereas TDP-43ΔNLSanimals were subdivided into saline and RNA treatment groups (n=20 for each). Of these two groups, n=10 were used for each of the 3-day and 5-day endpoints for immunostaining analysis. The n=8 sham animals were also collected at the 5-day endpoint.

[0198] Cell lines

[0199] Induced pluripotent stem cell (iPSC) lines CS151CTR-5, CS29iALS-nl, and CS52iALS-n6A were obtained from the Cedars-Sinai RMI iPSC Core, and are male. Line JH034 was obtained from Johns Hopkins Hospital, and is female. The estimated G4C2Attorney Docket: 10504- 109WO1 repeat expansion sizes are >2.5 kb for line JH034, and 6-8 kb for lines CS29iALS-n1 and CS52iALS-n6A.

[0200] iPSCs were differentiated into motor neurons following previously described protocols. iPSCs were cultured in Matrigel (Corning) and mTeSR+ (StemCell Technologies) and kept in a humidified chamber with regulated levels of CO2 (5%) and temperature (37°C). For differentiation, 1x106iPSCs were plated in 6-well plates. Once cells reached -90% confluency, media was changed from mTeSR+ to N2B27 media (50% DMEM: F12, 50% Neurobasal, plus NEAA, Glutamax, N2 and B27; all from Gibco) plus 10 pM SB431542 (StemCell Technologies), 100 nM LDN-193189 (Sigma- Aldrich), 1 pM RA (Sigma-Aldrich) and 1 pM Smoothened-Agonist (SAG, Cayman Chemical). Media was changed daily for a total of 6 days. Cells were then switched to N2B27 including 1 pM RA, 1 pM SAG, 4 pM SU5402 (Cayman Chemical) and 5 pM DAPT (Cayman Chemical), and media was changed daily until day 13. Neurons were dissociated on day 14 using TrypLE and DNAse I, and plated in Matrigel-coated 24-well plates with glass coverslips for confocal imaging studies. Cells were fed every other day and maintained for 13 days after plating in Neurobasal media + NEAA, Glutamax, N2, B27, plus 10 ng / mL BDNF, GDNF, CNTF (all from PeproTech) and 0.2 pg / mL Ascorbic acid (Sigma- Aldrich).

[0201] Microbe strains

[0202] Escherichia coli BL.21 (DE3)-RIL cells (Agilent 230245) and BL21 Star (DE3) Chemically competent cells (Thermo Fisher C601003) were utilized for protein purification, with growth conditions as described in the purification sections. Escherichia coli XL10-Gold Ultracompetent cells (Agilent 200314) were utilized for cloning and plasmid propagation, and were grown at 37°C with the appropriate antibiotic.

[0203] Cloning

[0204] pJ4M was from Addgene (plasmid #104480; http: / / n2t.net / addgene: 104480;RRID:Addgene_104480). All other TDP-43 constructs purified were generated using the pJ4M plasmid. Partial PrLD deletion plasmids were generated previously. TDP-435FLwas generated previously. TDP-43S292E, TDP-43R293F, TDP-43S409 / 4l0E, and TDP-43S292 / 409 / 4l0Eplasmids were generated previously. All other TDP-43 disease-relevant variants and domain deletion plasmids, as well as the MBP-His plasmid, were generated via QuikChange Site-Directed Mutagenesis (Agilent 210518). MBP-FUS was generated previously.

[0205] Purification of TEV proteaseAttorney Docket: 10504- 109WO1

[0206] TEV protease was purified as previously described. His-TEV plasmid was transformed into BL21 (DE3)-RIL E. coli and grown on an LB-ampicillin plate at 37°C for 16 h. The cells were then transferred to a starter culture of LB containing 100 pg / mL ampicillin and 34 pg / mL chloramphenicol, and incubated at 37°C for 2 h while shaking at 250 rpm. After 2 h, the starter culture was diluted 1:100 into the main culture of LB containing 100 pg / mL ampicillin and 34 pg / mL chloramphenicol. The main culture was shaken at 37°C and 250 rpm until the OD600reached -0.7, then stored at 4°C for ~30 min while the incubator cooled to 15 °C. The culture was then induced with 1 mM IPTG (MilliporeSigma 420322), and grown shaking at 250 rpm for 16 h at 15°C. After 16 h, the culture was harvested by centrifugation at 4658 rcf at 4°C for 25 min. The pelleted cells were resuspended in 30 mL Lysis Buffer (500 mM NaCl, 25 mM Tris-HCl pH 8.0, supplemented with 10 mM P-mercaptoethanol and complete, EDTA-free Protease Inhibitor Cocktail (MilliporeSigma (Roche) 5056489001) at 1 tablet / 50 mL buffer). The resuspended cells were lysed on ice with 1 mg / mL lysozyme (MilliporeSigma L6876) for 30 min, then sonication. The lysate was then centrifuged at 30,597 rcf at 4°C for 20 min.

[0207] A CV of 2.67 mL of Ni-NTA resin (QIAGEN 30250) was utilized per 1 L prep, and the Ni-NTA resin was equilibrated with 10 CV of MilliQ and 6 CV of Lysis Buffer. The clarified supernatant was rotated with Ni-NTA resin for 1.5 h at 4°C, then centrifuged at 179 rcf at 4°C for 5 min. The Ni-NTA resin was then washed with 25 CV of Wash Buffer (500 mM NaCl, 25 mM Tris-HCl pH 8.0, 25 mM imidazole, supplemented with 10 mM P-mercaptoethanol), with centrifugations performed at 179 rcf at 4°C for 2 min. The Ni-NTA resin was then resuspended in 2 CV of Wash Buffer and applied to a chromatography column. Protein was eluted with 5 CV of Elution Buffer (500 mM NaCl, 25 mM Tris-HCl pH 8.0, 300 mM imidazole, supplemented with 10 mM P- mercaptoethanol). Eluted protein was pooled and concentrated to —10 mL utilizing an Amicon Ultra- 15 Centrifugal Filter Unit, MWCO 30 kDa (Millipore UFC9030), by centrifugation at 716 rcf at 4°C. Concentrated protein was centrifuged at 716 rcf at 4°C for 3 min. Dialysis tubing was equilibrated in Dialysis Buffer (25 mM HEPES-NaOH pH 7.0, 5% glycerol, supplemented with 5 mM P-mercaptoethanol) for ~10 min. The protein was dialyzed in 5 L of Dialysis Buffer overnight, stirring at 4°C.

[0208] Dialyzed protein was centrifuged at 716 rcf at 4°C for 10 min. Filtered supernatant was purified using an FPLC with a HiTrap SP XL column, equilibrated in Low-Salt ion exchange (IEX) Buffer (25 mM HEPES-NaOH pH 7.0, 5% glycerol, supplemented with 5 mM DTT). The column was washed with 2 CV of Low-Salt IEX Buffer, then proteinAttorney Docket: 10504- 109WO1 was eluted utilizing a 0-80% gradient with Low-Salt IEX Buffer as the base buffer, and High-Salt IEX Buffer (750 mM NaCl, 25 mM HEPES-NaOH pH 7.0, 5% glycerol, supplemented with 5 mM DTT) as the elution buffer. Based on the chromatogram, elution fractions were pooled and concentrated to -40 mg / mL utilizing an Amicon Ultra- 15 Centrifugal Filter Unit, MWCO 30 kDa (Millipore), by centrifugation at 716 rcf at 4°C. The concentrated protein was supplemented to 50% glycerol with 100% glycerol, then aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C until use.

[0209] Purification of TDP-43-MBP-His

[0210] TDP-43-MBP-His, or MBP-His alone, plasmids were transformed into BL21 (DE3)-R1L E. coli and grown on LB-Kanamycin plates at 37°C for 16 h. The cells were then transferred to a starter culture of LB containing 50 pg / mL kanamycin and 34 pg / mL chloramphenicol, and incubated at 37°C for 4 h while shaking at 250 rpm. After 4 h, the starter culture was diluted 1:100 into the main culture of 1 L LB containing 50 pg / mL kanamycin, 34 pg / mL chloramphenicol, and 0.2% glucose. The main culture was shaken at 37°C and 250 rpm until the OD600reached -0.25, then continued to grow while cooling to 16°C, and induced with 1 mM IPTG after reaching 16°C and an OD600of -0.5-0.6. The induced culture was grown shaking at 250 rpm for 16 h at 16°C. After 16 h, the culture was harvested by centrifugation at 4658 rcf at 4°C for 20 min. The pelleted cells were resuspended in 20 mL of Resuspension / Wash Buffer (1 M NaCl, 20 mM Tris-HCl pH 8.0, 10% glycerol, 10 mM imidazole pH 8.0, supplemented with 1 mM DTT, 5 pM Pepstatin A, 100 pM PMSF, and complete, EDTA-free Protease Inhibitor Cocktail at 1 tablet / 50 mL buffer). The resuspended cells were lysed on ice with 1 mg / mL lysozyme for 30 min, then sonication. The lysate was then centrifuged at 30,966 rcf at 4°C for 20 min.

[0211] A CV of 5 mL of Ni-NTA resin (QIAGEN) was utilized per 1 L prep, and the Ni- NTA resin was equilibrated with 18 CV of MilliQ and 3 C V of Resuspension / W ash Buffer. The clarified supernatant was rotated with Ni-NTA resin for 1 h at 4°C, then centrifuged at 179 rcf (2000 rpm; 50 mL tubes) at 4°C for 4 min. The Ni-NTA slurry was then applied to a chromatography column, with the flow-through re-applied once. At 4°C, the column was washed with 10 CV of Resuspension / Wash buffer, then eluted in 3 CV of Nickel Elution Buffer (1 M NaCl, 20 mM Tris-HCl pH 8.0, 10% glycerol, 300 mM imidazole pH 8.0, supplemented with 1 mM DTT, 5 μM Pepstatin A, 100 μM PMSF, and complete, EDTA-free Protease Inhibitor Cocktail at 1 tablet / 50 mL buffer). Eluted fractions were stored overnight at 4°C.Attorney Docket: 10504- 109WO1

[0212] Eluted fractions were pooled based on purity determined by SDS-PAGE.Approximate protein concentration was determined by Bradford, and 1 mL amylose resin (New England Biolabs E8021L) per 6 mg protein was utilized as the amylose resin CV. Amylose resin was equilibrated in -10 CV MilliQ and 3 CV Resuspension / Wash Buffer. The protein was rotated with amylose resin at 4°C for 30 min, then centrifuged at 179 rcf at 4°C for 4 min. The amylose slurry was then applied to a chromatography column, with the flow-through re-applied once. At 4°C, the column was washed with 5 CV of Resuspension / Wash buffer, then eluted in 3 CV of Amylose Elution Buffer (1 M NaCl, 20 mM Tris-HCl pH 8.0, 10% glycerol, 10 mM imidazole pH 8.0, supplemented with 1 mM DTT, 5 pM Pepstatin A, 100 pM PMSF, 10 mM maltose). Eluted fractions were pooled based on purity determined by SDS-PAGE, then concentrated utilizing an Amicon Ultra- 15 Centrifugal Filter Unit, MWCO 50 kDa (Millipore UFC9050), by centrifugation at 716 rcf at 4°C, until a concentration of -150-200 pM was achieved. The protein was aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C until use.

[0213] Purification of TDP-43-MBP-His utilized for condensation assays

[0214] Purification was performed based on a previously described protocol. TDP-43- MBP-His plasmid was transformed into One Shot BL21 Star (DE3) E. Coll (Thermo Fisher Scientific) and grown on LB-Kanamycin plates at 37°C for 16 h. The cells were then transferred to a starter culture of LB containing 50 pg / mL kanamycin, and grown at 37°C and 250 rpm. The starter culture was diluted into a main culture of 1 L LB containing 50 pg / mL kanamycin and 0.2% glucose, which was grown at 37°C and 250 rpm until reaching an OD600of -0.5 -0.6. The culture was then incubated at 4°C for 30-45 min, then induced with 1 mM IPTG and grown at 16°C and 250 rpm for 16 h. After 16 h, the culture was harvested by centrifugation at 4658 rcf at 4°C for 20 min. The pelleted cells were resuspended in 30 mL of Lysis Buffer (1 M NaCl, 20 mM Tris-HCl pH 8.0, 10 mM imidazole pH 8.0, 10% glycerol, and supplemented with 2.5 mM P-mercaptoethanol and complete, EDTA-free Protease Inhibitor Cocktail at 1 tablet / 50 mL buffer). The resuspended cells were lysed by sonication, then centrifuged at 48,384 ref at 4°C for 1 h, then filtered.

[0215] The filtered lysate was purified using an FPLC with a XK 50 / 20 column (Cytiva) packed with Ni-NTA agarose beads (Qiagen), equilibrated in Lysis Buffer. The column was washed with 3 CV of Buffer A (Lysis Buffer without Protease Inhibitor Cocktail), then protein was eluted utilizing a 0-80% gradient with Buffer A as the base buffer, and Buffer B (1 M NaCl, 20 mM Tris-HCl pH 8.0, 500 mM imidazole pH 8.0, 10% glycerol,Attorney Docket: 10504- 109WO1 and supplemented with 2.5 mM P-mercaptoethanol) as the elution buffer. Desired elution fractions were pooled, concentrated with an Amicon Ultra- 15 Centrifugal Filter Unit, MWCO 50 kDa (Millipore), and filtered. The filtered protein was then further purified using an FPLC with a 26 / 600 Superdex 200 pg column (Cytiva), equilibrated in SEC Buffer (300 mM NaCl, 20 mM Tris-HCl pH 8.0, and supplemented with 1 mM DTT). The fractions from the second out of three peaks, as determined by absorbance at 280 nm, were pooled and concentrated with an Amicon Ultra-15 Centrifugal Filter Unit, MWCO 50 kDa (Millipore) until a concentration of at least 250 pM. The protein was aliquoted, flash- frozen in liquid nitrogen, and stored at -80°C until use.

[0216] Purification of MBP-FUS

[0217] MBP-FUS was purified based on previous protocols. In brief, MBP-FUS plasmid DNA was transformed into One Shot BL21 Star (DE3) E. coli (Thermo Fisher Scientific) cells via heat shock, plated on LB agar plates containing 100 pg / ml ampicillin and incubated overnight at 37°C. The next day, bacterial cultures were scaled-up in LB media supplied with 100 pg / mL ampicillin and 0.2 % glucose and grown to an OD600of 0.6 at 37°C. Expression was induced by adding 1 mM IPTG followed by incubation for 16 h at 16°C and 250 rpm. Cells were har vested by centrifugation for 20 min at 4658 rcf and 4°C. Cells were resuspended in lysis buffer (20 mM HEPES, pH 7.4, 50 mM NaCl, 2 mM EDTA, 10% glucose, 2 mM DTT), supplied with 20 mg / mL lysozyme and incubated on ice for 30 min. After sonication, the lysate was centrifuged for 20 min at 30,966 rcf and 4°C.

[0218] The supernatant was pooled and added to 5 mL amylose beads (New England Biolabs) equilibrated with resuspension buffer and nutated for 2 h at 4°C. Subsequently, the beads were washed with resuspension buffer and eluted using the same buffer supplied with 10 mM maltose. For further purification and RNA removal, the eluted sample was loaded onto a Heparin column (HiTrap Heparin HP, Cytiva) equilibrated with resuspension buffer using an FPLC. The sample was eluted with a linear gradient ranging from 0-80% high-salt buffer (20 mM HEPES, pH 7.4, 1 M NaCl, 2 mM EDTA, 10% glucose, 2 mM DTT) over 90 mL. Protein-containing fractions were pooled, concentrated using an Amicon spin concentrator (Merck Millipore, MWCO 50 kDa) and flash-frozen in liquid nitrogen.

[0219] Purification of TDP-43 RRMs utilized for NMR experiments

[0220] The TDP-435FLRRMs plasmid was synthesized in the pJ411 vector by GenScript.WT TDP-43 RRMs (102-269) was expressed via a codon-optimized sequence in the pJ411Attorney Docket: 10504- 109WO1 vector. Protein growth and purification protocols were adapted from the literature. The protein was grown in BL21 Star (DE3) E. coli cells in M9 minimal media supplemented with15NH4C1 for isotopic labeling. Bacterial cultures were grown at 37°C with agitation at 200 rpm to an optical density of 0.8. The cultures were induced with 1 mM IPTG and grown for 4 additional hours before harvesting by centrifugation at 6000 rpm and 4°C for 15 min. and resuspended in lysis buffer (20 mM HEPES pH 7.5, 1 M NaCl, 30 mM imidazole, 1 mM DTT) supplemented with an EDTA-free protease inhibitor cocktail (Roche). The cells were lysed using an EmulsiFlex C3 homogenizer (Avestin), and the lysate was cleared by centrifugation at 20,000 rpm and 4°C for 1 h. The protein was eluted via a nickel HisTrap HP column (GE Healthcare) by affinity chromatography with a linear gradient of elution buffer (20 mM HEPES pH 7.5, 1 M NaCl, 300 mM imidazole, 1 mM DTT). The hexahistidine tag was cleaved by overnight dialysis with 0.03 mg / mL TEV protease at room temperature (20 mM HEPES pH 7.5, 500 mM NaCl, 1 mM DTT). The tag and TEV protease were removed with an additional elution over the HisTrap HP column. The purified protein was buffer exchanged into NMR buffer (20 mM KPi pH 6.8, 1 mM DTT), concentrated to ~1 mM, flash frozen, and stored at -80°C.

[0221] RNA oligon ucleotides

[0222] All RNA oligonucleotides utilized were purchased from Integrated DNA Technologies (IDT) or Horizon Discovery. All RNAs utilized for in vitro assays were unmodified and purified with standard desalting (except for RNAs utilized for NMR, which were HPLC purified), and were resuspended in RNase-free water, with nanodrop measurement performed to calculate the RNA concentration. RNAs utilized for cellular experiments were HPLC purified and were fully 2’0Me modified; the Clip34 RNA also had five phosphorothioate backbone modifications on each end of the RNA. RNAs utilized for mouse experiments were purified with in vivo HPLC, were fully 2’0Me modified, and had five phosphorothioate backbone modifications on each end of the RNA (e.g., SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21). A subset of RNA utilized for mouse experiments contained a 5’ Cy5 fluorophore.

[0223] In vitro TDP-43 aggregation prevention assay

[0224] RNA was thawed on ice, then serially diluted in water to achieve the desired working concentrations. Protein was thawed on ice, then centrifuged at 21,300 rcf for 10 min. at 4°C. Protein was then buffer exchanged into aggregation assay buffer (166.66 mM NaCl, 22.22 mM HEPES-NaOH pH 7.0, 1.11 mM DTT) using Micro Bio-Spin Chromatography Columns (BIO-RAD 7326200), following manufacturer’s instructions.Attorney Docket: 10504- 109WO1 After buffer exchange, nanodrop measurements were performed to calculate protein concentration. Aggregation assay buffer, and subsequently protein, were added to the tubes containing water / RNA, in order to achieve sample reactions with final concentrations of 5 pM TDP-43, 150 mM NaCl, 20 mM HEPES-NaOH pH 7.0, 1 mM DTT, with varying concentrations of RNA. The reactions were incubated for 15 min at RT after the addition of protein. To a 96-well nonbinding plate (Greiner Bio-One 655906), 0.25 pg TEV protease was added for a final concentration of 2.5 pg / mL, or TEV protease elution buffer for the No TEV control. The reactions were then added to the 96-well plate. The 96-well plate was sealed using parafilm. Turbidity was measured at absorbance 395 nm in a Tecan plate reader (Infinite M1000 or Safire2) for 16 h, measuring every 1 min. Plate reader measurements were conducted at ambient temperature, typically ~25-30°C.

[0225] For quantification, turbidity data was first standardized by setting the initial value for each well to 0. For the standardized data, any negative values were also set to 0. For normalization, the maximum value of the standardized No RNA condition data for a replicate was set to 100, with all other conditions for that protein in the replicate normalized based on this. Area under the curve (AUC) was calculated for the normalized data. To then normalize the AUC data, the AUC for the No RNA condition was set to 100. This analysis was performed separately for each replicate. The normalized AUC was then used to calculate an IC50 value for each replicate, utilizing nonlinear regression: [inhibitor] vs. normalized response with variable slope. The IC50 value for each replicate was then combined to generate summary data.

[0226] In vitro FUS phase separation prevention assay

[0227] RNA was thawed on ice and diluted in water and 2x LLPS buffer to achieve the desired RNA concentration in lx FUS Li PS buffer (20 mM HEPES-NaOH pH 7.4, 1 mM DTT). Protein was thawed on ice, then centrifuged at 21,300 rcf for 5 min at 4°C. Protein was diluted to 6 pM in FUS elution buffer (570 mM NaCl, 20 mM HEPES-NaOH pH 7.4, 2 mM EDTA, 10% glycerol, 0.5 mM DTT). TEV protease was diluted to 0.12 mg / mL in lx FUS LLPS buffer. Equal volumes of protein and RNA were mixed, then transferred to a 384-well glass bottom plate (Azenta MGB101-1-2-LG-L). Diluted TEV protease was then added directly to the samples in the 384-well plate, to achieve final concentrations of 2 pM FUS protein, varying concentrations of RNA, 0.04 mg / mL TEV protease, 190 mM NaCl, 20 mM HEPES-NaOH pH 7.4, 0.83 mM DTT, 0.67 mM EDTA, and 3.33% glycerol. Turbidity was measured at absorbance 395 nm in a BMG Labtech plate reader (CLARIOstar Plus) for -2-2.5 h at 26°C, measuring every 1 min. At the endpoint ofAttorney Docket: 10504- 109WO1 turbidity measurements, samples were imaged within the plate by brightfield microscopy with a 100x objective (EVOS M5000).

[0228] Electrophoretic mobility shift assay

[0229] Protein was thawed on ice, then centrifuged at 21,300 rcf for 10 min at 4 °C. Protein was then buffer exchanged into 150 mM NaCl, 20 mM HEPES-NaOH pH 7.0 (or pH 6.0 where indicated), 10% glycerol, 1 mM DTT using BIO-RAD Micro Bio-Spin Chromatography Columns, following manufacturer’s instructions. After buffer exchange, nanodrop measurements were performed to calculate protein concentration. Protein was diluted in buffer to achieve a working concentration of 50 pM, in EMSA assay buffer (150 mM NaCl, 20 mM HEPES-NaOH pH 7.0 (or pH 6.0 where indicated), 10% glycerol, 1 mM DTT, 20 ng / µL bovine serum albumin (BSA; Thermo Fisher 23209), 2.5 ng / pL yeast tRNA (Thermo Fisher AM7119), 0.4 U / pL RNasin (Promega N2511)). Protein was then serially diluted in EMSA assay buffer to achieve a range of protein concentrations. 20 pM 5’ 6-FAM RNA resuspended in RNase-free water was diluted to 1 pM in EMSA assay buffer (10x working concentration). 10x RNA was then added to protein samples to achieve 100 nM (lx) RNA and a range of protein concentrations in EMSA assay buffer. Samples were incubated at RT for 30 min. During this incubation, 6% DNA Retardation gels (Thermo Fisher EC63655BOX) were pre-run in 0.5x TBE buffer at 150 V for ~20 min. lx dye was prepared by dilution of 5x dye (20 mM EDI’A, 50% sucrose, 0.25% bromophenol blue) in EMSA assay buffer. After incubation, heparin (MilliporeSigma H3393) was added to each sample to achieve a final concentration of 0.5 mg / mL heparin.15 pL of lx dye was loaded in the first lane to monitor sample progression, while 15 pL of undyed sample was loaded in remaining lanes. Gels were run at 150 V for 40 min. Gels were then imaged on a Typhoon Scanner using FAM fluorescence measurement. The signal of bound TDP-43 in each lane was quantified utilizing Image Studio Lite.

[0230] SDS-PAGE

[0231] Samples were diluted in 3x sample buffer (187.5 mM Tris-HCl, 6% SDS, 30% glycerol, 0.05% bromophenol blue, pH 6.8, 1.42 M P-mercaptoethanol) and boiled at 95°C for 5 min. Precision Plus Protein Dual Color Standard (BIO-RAD 1610374) and samples were loaded on Tris-HCl gels (4-15% or 4-20% as indicated) (BIO-RAD 3450027, 3450033), and run at 175 V for 1 h 15 min. Gels were stained with Coomassie Brilliant Blue, followed by incubation with Destain I (40% methanol, 7% acetic acid), then Destain II (5% methanol, 7% acetic acid) overnight before imaging.

[0232] Fluorescence 5’ 6-FAM Clip343’ BHQ1 assayAttorney Docket: 10504- 109WO1

[0233] Protein was thawed on ice, then centrifuged at 21,300 rcf for 10 min at 4°C. Protein was then buffer exchanged into fluorescence assay buffer (150 mM NaCl, 20 mM HEPES- NaOH pH 7.0, 1 mM DTT) using BIO-RAD Micro Bio-Spin Chromatography Columns, following manufacturer’s instructions. After buffer exchange, nanodrop measurements were performed to calculate protein concentration. Protein was diluted in fluorescence assay buffer to achieve a working concentration of 50 pM. Protein was then serially diluted in fluorescence assay buffer to achieve a range of protein concentrations. 20 pM 5 ’ 6-FAM 3’ BHQ1 RNA resuspended in RNase-free water was diluted to 1 pM in fluorescence assay buffer (lOx working concentration). lOx RNA was then added to a 96-well nonbinding plate (Greiner). Protein samples were then also added to the 96-well plate, to achieve final concentrations of 100 nM 5’ 6-FAM Clip34 3’ BHQ1, and a range of protein concentrations, in 150 mM NaCl, 2.0 mM HEPES-NaOH pH 7.0, 1 mM DTT. Samples were incubated at RT for 30 min.

[0234] Fluorescence was measured in a Tecan plate reader (Spark) at 25 °C. Excitation:475 nm; bandwidth: 15 nm. Emission: 520 nm; bandwidth: 20 nm. A gain value of 80 was used for all trials. The turbidity value at 30 min was utilized. For each protein variant, it was validated that the signal was stable at the 30 min timepoint by measuring after sample addition to the plate, for 1 h every 1 min, for at least one replicate. For quantification, (F- Fo) / Fo values were calculated for each condition: the average signal for the RNA alone (no TDP-43) condition was subtracted from the signal for a condition, which was then divided by the average signal for the RNA alone (no TDP-43) condition. ECso values were determined from this data, by performing nonlinear regression: [agonist] vs. response with variable slope for each replicate.

[0235] Hydrogen / deuteri um-exchange mass spectrometry (HXMS)

[0236] RNA was thawed on ice where needed. Protein was thawed on ice, then centrifuged at 21,300 rcf for 10 min at 4°C. For “free” conditions, protein was buffer exchanged into Non-Deuterated Buffer (150 mM NaCl, 20 mM HEPES-NaOH pH 7.0, 1 mM DTT) using BIO-RAD Micro Bio-Spin Chromatography Columns, following manufacturer’s instructions. After buffer exchange, nanodrop measurements were performed to calculate protein concentration. Protein was then diluted in Non-Deuterated Buffer to make a protein sample consisting of 20 µM TDP-43-MBP-His in 150 mM NaCl, 20 mM HEPES-NaOH pH 7.0, 1 mM DTT. Deuterium on-exchange was performed at 25°C by mixing 10 uL of sample with 40 uL of deuterium on-exchange buffer (D₂O-based; 150 mM NaCl, 20 mM HEPES-NaOD pH 7.0, 1 mM DTT), resulting in a D2O concentration of 80%. At theAttorney Docket: 10504- 109WO1 indicated timepoint, the exchange reaction was quenched by addition of 10 pL of ice-cold 250 mM phosphoric acid, to achieve a final pH of pH 2.5. For non-deuterated samples, 10 pL of sample was mixed with 40 pL of Non-Deuterated Buffer, then quenched by addition of 10 pL of ice-cold 250 mM phosphoric acid. For the fully deuterated sample, 10 pL of sample was mixed with 40 pL of on-exchange buffer, incubated at 30°C for ~18 h, then quenched by addition of 10 pL of ice-cold 250 mM phosphoric acid. For “Clip34-bound” conditions, all procedures were the same, except that the protein was buffer exchanged into 166.67 mM NaCl, 22.22 mM HEPES-NaOH pH 7.0, 1.11 mM DTT, then diluted into the same buffer along with RNA and water, to achieve final sample concentrations of 20 pM TDP-43-MBP-His and 40 pM Clip34 in 150 mM NaCl, 20 mM HEPES-NaOH pH 7.0, 1 mM DTT.

[0237] HX measurements from 20 s to 14.5 h were performed at pH 7.0. In order to measure less protected, faster exchanging parts of the protein, another set of measurements was performed at pH 6.0. Due to the direct dependence of the intrinsic exchange rate on OH⁻ concentration, these measurements can be put on the same time axis as the pH 7.0 measurements by dividing the actual exchange time by 10. For the subset of timepoints done with pH 6-based buffer, all procedures were the same, except that the HEPES-NaOH component of both the Non-Deuterated Buffer and on-exchange buffer was at pH 6.0, and the quench reagent utilized was ice-cold 145 mM phosphoric acid (to achieve a final pH of pH 2.5). All 1 s, 2 s, 6 s, and 18 s timepoints were collected utilizing pH 6.0 buffer; 1 min and 3 min timepoints were collected with some replicates utilizing pH 6.0 buffer and others utilizing pH 7.0 buffer; 20 s, and 10 min and longer timepoints were collected utilizing pH 7.0 buffer. For example, the “1 min” timepoints were measured by 1 min of on-exchange at pH 7.0, or 10 min of on-exchange at pH 6.0. The agreement between these duplicated replicates indicates that the protein structural stability measured by HX is not affected by the pH change. In addition, WT TDP-43 and Clip34 were confirmed to maintain binding at pH 6.0.

[0238] For MS analysis, the sample was digested by loading 50 pL onto a homemade pepsin column maintained at 0°C, where pepsin was immobilized by coupling to POROS 20 AL support (Applied Biosystems) and packed into a column housing of 2 mm x 2 cm (64 pL) (Upchurch). The protease-generated fragments were then collected onto a TARGA C85 pM Piccolo HPLC column (1.0 x 5.0 mm, Higgins Analytical) and separated on a C8 analytical column utilizing a shaped 10-45% Buffer B gradient at 8 pL / min (Buffer A: 0.1% formic acid; Buffer B: 0.1% formic acid, 99.9% acetonitrile). The effluent wasAttorney Docket: 10504- 109WO1 electrosprayed into the mass spectrometer. Peptides were identified from non -deuterated samples by MS / MS (Thermo Q Exactive), by analyzing MS / MS data using SEQUEST Proteome Discoverer (ThermoFisher). Peptide identification was performed separately for WT TDP-43 and TDP-435FL. Deuterated samples, and additional non -deuterated reference samples, were analyzed by MS (Thermo Q Exactive or Thermo Exactive Plus EMR).

[0239] HDExaminer software was utilized to process and analyze the HXMS data. The timepoints for samples performed at pH 6.0 were input as one-tenth of the actual on- exchange time. ExMS2, a MATLAB-based program, was used to prepare the peptide pool used by HDExaminer, from the SEQUEST output files for MS / MS data analysis. HDExaminer uses a non -deuterated sample as the reference for identifying deuterated peptides. Manual adjustment of retention times and m / z windows was performed as needed to correct any initial errors. Each deuterated peptide is corrected for back exchange after quenching, by normalizing to the maximal deuteration level of that peptide as detected in the fully deuterated sample. For calculating the peptide deuteration level at each timepoint, HDExaminer identifies the peptide envelope centroid values for both the non-deuterated and deuterated peptides.

[0240] HXMS data visualization

[0241] For visualizing the difference in peptide deuteration levels for each peptide, the HDExaminer data was visualized using MATLAB. At each timepoint, the average deuteration percent for a peptide in either the free or bound condition was calculated by taking the average deuteration percent of all replicates for the peptide at that timepoint that were identified with medium or high confidence. These values were then analyzed in MATLAB by subtracting the average deuteration percent of the peptide in the Clip34- bound state from the average deuteration percent of the peptide in the free state. This data is plotted in MATLAB according to the colors shown in the color legends in the figures (e.g. Fig. 2). Peptides of the same sequence but different charge states are plotted to allow visualization of the agreement across separate charge states for a unique peptide sequence.

[0242] To generate plots of consensus exchange difference for each timepoint, the exchange differences of the peptides at that timepoint were manually analyzed, with the consensus exchange difference determined based on the average classification of all peptides including a specific residue. This was done via a scoring system, where a peptide with a difference of less than 10% receives a score of 0, a peptide with a difference of > 10% (light blue according to legend) receives a score of -1, a peptide with a difference of > 20% (medium blue) receives a score of -2, a peptide with a difference of > 30% (darkAttorney Docket: 10504- 109WO1 blue) receives a score of -3, a peptide with a difference of < -10% (light red) receives a score of +1, a peptide with a difference of < -20% (medium red) receives a score of +2, and a peptide with a difference of < -30% (dark red) receives a score of +3. As peptides were binned according to this scoring system, the displayed consensus percentage differences in exchange do not report the exact value of the percentage difference for each peptide, and do not report the proximity of each peptide’s behavior to the cutoff value for each score. The average score for each residue was rounded to the nearest whole number, and this data was plotted in GraphPad Prism, with the rounded score value for each residue colored according to the same scoring system as described for the manual analysis above.

[0243] To generate plots of HX data for representative peptides displaying exchange as the number of deuterons, the HDExaminer output of this data was visualized using GraphPad Prism. For a peptide, the values for the number of deuterons from HDExaminer was taken for each replicate with high or medium confidence at each timepoint, for both free and bound states. This was then plotted in GraphPad Prism.

[0244] To generate plots of mass spectra, HDExaminer output was visualized in GraphPad Prism. The raw mass spectrum data for a particular replicate of a specific timepoint in either the free or bound state was copied into GraphPad Prism. This data was manually- analyzed to determine the signal that corresponded to the desired peptide, based on the signal corresponding to the appropriate m / z values. All signal is displayed in the mass spectra plots, but the signal determined to correspond to the correct peptide is colored red, for ease of visualization. Dashed guidelines for visualization are also displayed, with the blue line corresponding to the value of the monoisotopic peak for that peptide, and the purple line corresponding to the centroid value of the peptide in the fully deuterated condition. Representative spectra for each state at each timepoint were chosen by determining the average value of the centroid for all replicates with peptides of high or medium confidence, for that state and timepoint. The spectrum displayed as the representative spectrum corresponds to the replicate with the centroid value closest to the average of these centroid values.

[0245] Simulation system preparation

[0246] The all-atom model of full-length and ANT’D TDP-43 in complex with RNA was constructed using MODELLER, based on multiple experimentally resolved structures (for NTD PDB: 5MDI, for RRM1 / 2 PDB:4BS2, for CTD PDB:2N3X) and a well-tempered ensemble for the PrLD generated in our previous work as templates. To create the TDP- 435FLconstruct, five Phe residues (positions 147, 149, 194, 229, and 231) were mutated toAttorney Docket: 10504- 109WO1 leucine using the “swapaa” module in ChimeraX. The resulting structures were solvated using GROMACS v2022.5. Specifically, the initial model was placed in an octahedral simulation box (l = 15.0 nm for FL TDP-43 and l = 14 nm for TDP-43ΔNTD) and solvated with explicit water molecules. Na+and Cl⁻ ions were added to achieve a salt concentration of 100 mM, along with additional counterions to ensure overall charge neutrality.

[0247] MD simulations used AUG12 RNA, a 12-nucleotide sequence derived from TDP- 43 CLIP data and designed by Lukavsky et al., rather than Clip34. Since experimental data show that neither the NTD nor PrLD directly involve RNA binding, the 12-nt sequence captures the essential RRM-RNA interactions, and we determined that AUG12 inhibits TDP-43 aggregation, this sequence is sufficient to investigate allosteric regulation upon RRM binding.

[0248] Selection of Protein and RNA Force Fields

[0249] Proteins were modeled using the Amber03ws force field with TIP4P / 2005 water and improved ion parameters from Luo and Roux. This force field was chosen for its optimized protein-water interactions that prevent artifactual compaction in intrinsically disordered regions. RNA was modeled using the χOL3 force field with refined glycosidic torsions, adjusted phosphate oxygen radii, and scaled RNA-water interactions to address known RNA simulation artifacts including unrealistic ladder-like structures and overestimated electrostatic interactions. Force field compatibility was validated in our prior work.

[0250] Simulation Protocol

[0251] The solvated protein systems were first subjected to energy minimization using the steepest descent algorithm in GROMACS. This was followed by an initial configuration relaxation, consisting of a 100ps NVT equilibration using the V-rescale thermostat at a 2 fs time step, and an additional 100ps NPT equilibration using the Parrinello-Rahman barostat with isotropic coupling and a pressure relaxation time of 5 ps. Following equilibration, the topology(.top) and coordinate(.gro) files generated by GROMACS were converted into AMBER-compatible input formats (,parm7 and,rst7) using the ParmEd module in AmberTools22. To enable a 4 fs time step during production runs, hydrogen atom masses were increased to 1.5 amu.

[0252] Production simulations were performed in AMBER22 under constant pressure (1 bar) and temperature (300 K) conditions. Temperature was maintained using Langevin dynamics with a friction coefficient of 1 ps-1, while pressure was controlled using a Monte Carlo barostat with isotropic coupling (relaxation time of 1.0 ps). Short-range nonbondedAttorney Docket: 10504- 109WO1 interactions were calculated with a cutoff of 0.9 nm, and long-range electrostatic interactions were treated using the particle mesh Ewald (PME) method. All bonds involving hydrogen atoms were constrained using the SHAKE algorithm.

[0253] Sedimentation analysis

[0254] At the end timepoint of aggregation prevention assays (t = 16 h), a portion of select conditions was transferred to a tube. 'lubes were spun at 21,300 rcf for 10 min at RT to sediment the pellet. The supernatant was transferred to a fresh tube. The pellet was resuspended in assay buffer of equal volume. Equal volumes of supernatant from multiple conditions were then run on SDS-PAGE gels. To determine the relative amounts of protein in the supernatant. Image Studio Lite was utilized to quantify the TDP-43 band signal for supernatant samples for each condition.

[0255] In vitro TDP-43 disaggregation assay

[0256] TDP-43 was thawed on ice and centrifuged for 10 min at 21,300 rcf at 4°C. TDP- 43 was buffer exchanged into 166.66 mM NaCl, 22.22 mM HEPES-NaOH pH 7.0, 1.11 mM DTT (BIO-RAD Micro Bio-Spin Chromatography Columns, following manufacturer’s instructions) and concentration was determined via NanoDrop, ezso = 114250 cm^M’1. TDP-43 was diluted into buffer and RNase-free water to achieve a final concentration of 4 pM TDP-43, 150 mM NaCl, 20 mM HEPES-NaOH pH 7.0, ImM DTT. TEV protease was added at a final concentration of 7.5 pg / mL. A Safire2 Tecan plate reader was used to assess turbidity once per minute at 395 nm in a nonbinding 96 well plate (Greiner) over 4 h at approximately 25-30°C. After 4 h, turbidity readings were paused. RNA (or water for controls without RNA) was added to samples, resulting in final concentrations of 40 pM RNA (for samples with RNA), 3.648 pM TDP-43, 136.8 mM NaCl, 18.24 mM HEPES-NaOH pH 7.0, 0.912 mM DTT. Turbidity readings in the Tecan plate reader were resumed for an additional 16 h after addition of RNA or water. Sedimentation was performed at the end timepoint of the assay, as described above. At the end timepoint of the assay, samples were also prepared for electron microscopy.

[0257] Transmission electron microscopy

[0258] 300-mesh carbon-coated copper grids (Electron Microscopy Sciences) were glow- discharged. 5 pL of sample from the end timepoint of disaggregation assays was added to the grid and incubated for 40 s. Grids were blotted dry with filter paper. 5 pL of 1 % uranyl acetate was added to the grid, then immediately blotted dry with filter paper. Grids were then stored at room temperature until imaging. Samples were viewed and imaged using a JEOL JEM- 1011 electron microscope. Quantification of electron micrographs wasAttorney Docket: 10504- 109WO1 performed with Image!. The image scale in pixels per pm was set based on the scale bar. Images were inverted to have dark backgrounds, then thresholded to determine regions of interest (ROIs) corresponding to aggregates. Particle analysis was constrained to particles > 2 pixels. ROIs definitively corresponding to the scale bar and any broken remnants of grid were manually excluded from the quantification calculations. Quantification was reported as the values determined for each micrograph, with 4-6 micrographs of the same magnification quantified per condition. Parameters measured per micrograph were the average size of aggregates in pm2, the percentage of micrograph area occupied by aggregates, and the average integrated density of aggregates.[0259 j In vitro TDP-43 condensate reversal assay

[0260] TDP-43 was thawed on ice and centrifuged for 10 min at 16,000 ref at 4°C. TDP- 43 and TEV protease were diluted into PS buffer (150 mM NaCl, 20 mM HEPES-NaOH pH 7.4, 1 mM DIT), then mixed and incubated at room temperature for 75 min (reaction concentrations: 4.22 pM TDP-43, 150 mM NaCl, 20 mM HEPES-NaOH pH 7.4, 1 mM DTT, 10.56 pg / mL TEV protease). Portions of solution were then transferred to wells of a UV-transparent half-area 96-well plate (Greiner) or a glass slide, and allowed to settle. After 15 additional minutes (90 min total incubation), the pre-addition sample on the slide was imaged by brightfield microscopy with 100x objective (EVOS M5000). The solution in the 96-well plate was scanned once at 350 nm in a BMG Labtech plate reader (CLARIOstar Plus), then RN A or buffer was added to the solution in the wells or tubes for final concentrations of 0 or 2 µM RNA, 4 pM TDP-43, 150 mM NaCl, 20 mM HEPES- NaOH pH 7.4, 1 mM DTT, 10 pg / mL TEV protease. Turbidity was then measured at 350 nm once per minute for 60 min at 25 °C. After 1 h of incubation, samples in tubes were imaged by brightfield microscopy with 100x objective (EVOS M5000). For quantification of the turbidity data, pre-addition readings at t=0 were standardized by subtracting the turbidity value of a sample of PS buffer alone. For each condition, values were then normalized to set the value at t=0 to 100 for each condition.

[0261] NMR data collection and processing

[0262] All NMR experiments were heteronuclear single quantum coherence (HSQC) spectra conducted on Bruker Avance 600 MHz ¹H Larmor frequency spectrometers with HCN TCI z-gradient cryoprobe at 298K. TDP-43 RRMs NMR samples contained 50 pM protein in 20 mM KPi pH 6.8, 1 mM DTT, 5% D2O (v / v). NMR samples of RRMs with RNA included 100 pM (2x molar equivalent) RNA. Backbone chemical shift assignments were transferred from BMRB deposited data (BMRB ID 27613). NMR data wereAttorney Docket: 10504- 109WO1 processed and analyzed with Bruker TopSpin, NMRPipe, and CCPNMR. Chemical shift perturbations were quantified by comparison of the ’ H-15N cross-peak measurements in the RNA-containing and RNA-free HSQCs. Intensity ratios were calculated from the intensity of the ¹H-¹⁵N cross-peaks with the formula I / Iowhere I is the RNA-containing sample and Iois the RNA-free control sample.

[0263] G-quadruplex RNA annealing

[0264] RNA was thawed on ice. RNA was diluted to achieve working concentrations of 20 pM RNA, 150 mM NaCl, 20 mM HEPES-NaOH pH 7.0, 1 mM DTT. RNA was then annealed in a PCR machine by heating at 95°C for 2 min, followed by decreasing temperature at a rate of 1°C per minute, until reaching RT. RNA was added to the desired assay within a maximum of 30 min after the end of the annealing process.

[0265] Circular Dichroism

[0266] RN A was first prepared as described in the above “G-quadruplex RN A annealing” methods section. RNA was then diluted to achieve a final concentration of 5 pM RNA, 150 mM NaCl, 20 mM HEPES-NaOH pH 7.0, 1 mM DTT. The absorbance spectra were recorded in a 1 mm pathlength cuvette at 25 °C with an Aviv Circular Dichroism Spectrometer, Model 202. Parameters for measuring the spectra were a measurement range of 220-320 nm, a bandwidth of 2 nm, a wavelength step of 2 nm, and an averaging time of 60 s. Data was standardized by subtracting the absorbance spectrum of the blank. The standardized data was then normalized utilizing the equation: Δε(M⁻¹cm⁻¹) = θ / (32980*c*l), where 0 is the reported CD signal in millidegrees, c is the RNA molar concentration, and 1 is the pathlength in cm.

[0267] HEK293 cell oligonucleotide treatment

[0268] Glass bottom 24-well plates were coated with 50 pg / mL collagen overnight.OptoTDP-43 stable HEK293 cells were plated at either 150,000 cells / well for imaging, or 1,000,000 cells / well in 6-well plates for western blot analysis, in DMEM (Fisher Scientific) with 10% BGS (Hyclone; Fisher Scientific) and 1 % Glutamax (Thermo Fisher).16 hours after plating, optoTDP-43 expression was induced by media change to phenol- free DMEM / 10%BGS / l%Glutamax with 750 ng / mL (for imaging) or 1000 ng / mL (for western blot) doxycycline-hyclate. Immediately after the media change, oligo treatments were started. 2’OMeJRNA oligos were transfected using lipofectamine RNAiMAX according to manufacturer’s instructions (Invitrogen). Briefly, 500 nM of each oligo was diluted in OptiMEM (Thermo Fisher) and mixed with 1 pL lipofectamine per well, incubated at room temperature for 10 minutes, and added dropwise to the cells. Plates wereAttorney Docket: 10504- 109WO1 loosely wrapped in aluminum foil to prevent light exposure and subsequent light-induced TDP-43 oligomerization. 43 hours after doxy cycline-hy elate induction, plates were removed from the foil and placed on an LED array (Amuza) for blue light stimulation (465 nm) for 5 hours at 37°C. After blue light stimulation, cells were pelleted for downstream protein analysis, or for imaging cells were washed once with PBS and fixed with 4% PFA (in PBS) for 20 minutes at room temperature. Cells were permeabilized in 0.3% Triton X- 100 in PBS and stained with Hoechst (1:1000; Thermo Fisher) overnight.

[0269] HEK293 cell imaging and analysis

[0270] Image acquisition was performed using a Nikon Eclipse Ti2 Inverted Microscope with a 40X air objective. 20 fields of view (FOVs) were randomly selected by the NIS- Elements software per well. All image visualization and quantification were performed using NIS-Elements AR Analysis 4.1. The microscopy images were collected across three independent experiments and maximum intensity projection images were used for analysis. Binary thresholds (594 nm and 405 nm channel) and spot detection were used to capture and separate nuclei and puncta objects. Puncta overlapping with the nuclear signal were removed from the analysis, leaving only cytoplasmic puncta for quantification. Puncta area (pm2) was divided by nuclei count and expressed as puncta area per cell. Puncta area / cell was normalized against the average value for the control (CTR) oligo. Out-of-focus images were removed, and FOVs with mean puncta area >100 µm² / cell were excluded and considered outliers. Twenty FOVs were analyzed per well, and at least two to three wells were imaged per experiment. Mean values per experiment were normalized to control oligonucleotide treatment and considered a biological replicate, and the mean values of three biological replicates (n=3 experiments) were used to analyze the effect of the oligonucleotide.

[0271] Stable HEK293 CUTS cell line

[0272] Stable HEK293 cells expressing CUTS were generated as previously described (94). Briefly, HEK293 cells were seeded in 6-well plates and transfected at roughly 70% confluency with 2.5 pg of PiggyBac plasmids encoding CUTS along with 0.5 ug of a Super PiggyBac Transposase Expressing plasmid (PB200PA-1), using Lipofectamine 3000 (Invitrogen) as per the manufacturer’s instructions. A control group lacking the transposase plasmid was included. After 48 hours, cells were subjected to selection with 5 pg / mL puromycin (Sigma, P8833), with media being refreshed every two days. Non-transfected control cells typically died within five days under selection. Surviving cells were expanded and cultured in media containing a reduced puromycin concentration (2.5 pg / mL) toAttorney Docket: 10504- 109WO1 establish stable cell lines. Successful transgene expression was validated through live imaging.

[0273] Live Confocal Microscopy of HEK CUTS cell line

[0274] Live-cell imaging was carried out using a Nikon Al laser-scanning confocal microscope equipped with a 10X objective lens. Environmental conditions during imaging were maintained using a Tokai HIT stage-top incubator. Images were acquired and analyzed using Nikon Elements software. Representative images were selected from a minimum of three independent experiments to ensure reproducibility.

[0275] siRNA Reverse Transfection and RNA oligonucleotide transfection of HEK CUTS cell line

[0276] siRNA-mediated gene knockdown was performed via reverse transfection using Lipofectamine RNAiMAX reagent (Invitrogen, 13778150), following the manufacturer's instructions. To reduce TDP-43 expression, ON-TARGETplus SMARTpool siRNA targeting TARDBP (Dharmacon, L-012394-00-0005) was employed. Non-targeting siRNA (Dharmacon, D-001206-13-05) served as a control in these experiments. RNA oligonucleotide transfections were performed using Lipofectamine RNAiMAX reagent (Invitrogen) in accordance with the manufacturer's protocol.

[0277] Detergent Solubility Assay

[0278] The detergent solubility assay was performed as previously described. In brief, cells were collected in RIPA buffer, incubated on ice for 10 minutes, and sonicated. Samples were centrifuged at 100,000 rcf for 1 hour at 4°C. The supernatant was collected and labeled as the detergent-soluble fraction. Protein concentrations were determined using Pierce BCA protein assay (Thermo Fisher). The remaining pellet was resuspended in RIPA buffer, briefly sonicated, and centrifuged at 100,000g for 30 minutes at 4°C. Supernatant was removed, and the remaining cell pellet was resuspended in urea buffer, sonicated, and centrifuged at 100,000 rcf for 1 hour at room temperature. The final supernatant was collected as the detergent-insoluble, urea-soluble fraction. Protein from each fraction was separated using SDS-PAGE and analyzed by western blot analysis.

[0279] SDS-PAGE / Western Blotting

[0280] Protein samples were prepared in 4x Laemmli buffer (BIO-RAD) with P- mercaptoethanol and boiled at 95°C for 10 minutes. Precision Plus Protein Western C ladder (BIO-RAD) and samples were separated via SDS-page (4-20% Mini-PROTEAN TGX precast gels, BIO-RAD) and transferred to nitrocellulose membranes (BIO-RAD) at 10 V for 90 minutes in mini-gel tanks (Invitrogen). Membranes were then incubated inAttorney Docket: 10504- 109WO1 Ponceau for 10 minutes and imaged. Membranes were washed and blocked for 1 hour at room temperature in 5% milk in TBST, then incubated with primary antibody overnight at 4°C. Following TBST washes, membranes were incubated at room temperature for 1 hour with secondary antibody and streptactin HRP-conjugate (BIO-RAD 1:10000). All western blot images were taken on the GE Amersham ImageQuant 800. Membranes were stripped for 10 minutes (Restore PLUS western blot stripping buffer; Thermo Fisher) and reblotted as needed.

[0281] Primary antibodies included: mCherry 1C51 (mouse; Novus Biologicals, Cat:NBP1-96752; 1:1000); TDP-43 (rabbit; Proteintech, Cat: 10782-2-AP; 1:2500); GAPDH (mouse; Proteintech, Cat: 60004-1-IG; 1:10000). Secondary antibodies included: Donkey Anti-Mouse IgG (H+L)-HRP Conjugate (Invitrogen, Cat: SA1100; 1:10000); Goat Anti-Rabbit IgG (H+L)-HRP Conjugate (Jackson ImmunoResearch, Cat: 111035046; 1:10000).

[0282] iPSC-derived neuron treatment and immunostaining

[0283] RNA treatments started on day 13 after plating (DIV27) and lasted 24 h. RNAs were transfected using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. Briefly, each RNA was diluted in OptiMEM (Gibco) and combined with 1 pL Lipofectamine per well, also diluted in OptiMEM. The mixture was incubated at RT for 10 min, and then added dropwise to the cells with each RNA at a final concentration of 500 nM. Neurons were fixed 24 h after RNA treatment on day 14 after plating (DIV28).

[0284] On DIV28, cells were washed once in PBS (Gibco) and fixed in 4% paraformaldehyde (PFA) (Electron Microscopy Sciences) immediately after treatments ended. Cells were kept in PFA for 20 min, then washed three times in PBS and blocked with 5% Donkey Serum ( Jackson ImmunoResearch) + 0.3% TX-100 (Sigma- Aldrich) in PBS for 30 min at RT. Primary antibodies (goat MAP2 1:1000, Phosphosolutions; rabbit TDP-43 1:300, Proteintech) were diluted in blocking solution and incubated overnight at 4°C. Secondary antibodies (donkey Alexa Fluor, Jackson ImmunoResearch) were used at 1:1000 dilution in blocking solution and incubated for 60 min at RT. All treatments and cell lines were treated and probed simultaneously to decrease variability. Coverslips were mounted on slides using Prolong Glass mounting media (Invitrogen).

[0285] Images were acquired (20 per group) using an AIR Nikon Confocal Microscope and fields of view (FOV) were processed for analyses using Nikon NIS Elements Software. Settings were kept consistent across treatments. Within each FOV, neurons thatAttorney Docket: 10504- 109WO1 were isolated (not over glial cells or other neurons) were selected and nuclear TDP-43 signal was measured by overlaying an ROI using DAPI as a guide. Cytosolic area was hand-drawn using MAP2 signal as a guide. Raw intensity values for nuclear signal in the 488 channel (TDP-43) were normalized against cytosolic intensity values and the output was referred to as "nuclear / cytosolic ratio."

[0286] For analysis of neuritic puncta, a Cy5-labeled Malat1_start and CTR oligo were used at the same concentration and timing as described above. We used Staufen-1, another RNA-binding protein, as a control to assess possible interactions between TDP-43 and Malat1_start. Staufen-1 antibody was from Proteintech (14225-1-AP) and was used at a 1:300 dilution. After imaging, Malat1_start and CTR oligo puncta were detected using ROI autodetection on NIS-Elements. Pearson coefficient between Malat1_start / CTR oligo and either TDP-43 or Staufen-1 was calculated for each ROI, and we considered Pearson > 0.5 as colocalizing. The number of total Malat1_start, CTR oligo, TDP-43, and Staufen- 1 puncta were expressed as puncta / 100 pm, same as the number of puncta within each group with Pearson > 0.5. Values were graphed as the average of 20-25 neurites in 4 technical replicates of the same lines.

[0287] Sodium arsenite treatment and immunofluorescence

[0288] Control iPSC-derived MNs were plated on coverslips at a density of 150,000 cells / well. On DIV27 cells received either no treatment (NT), CTR RNA, or Malat1_start RNA. RNAs were delivered at a concentration of 500 nM with RNAiMAX Lipofectamine. On DIV28, 22 h after the RNA treatments, neurons were exposed to 250 pM sodium arsenite for 2 h. Cells were then fixed in 4% PFA, washed 3 times in PBS, blocked in 0.3% TX-100 + 5% Normal Donkey Serum in PBS, and incubated overnight at 4°C in primary antibodies diluted in blocking solution at the following concentrations: TDP-43 (Proteintech 10782-2-AP) at 1:300; G3BP1 (Santa Cruz sc-365338) at 1:100; MAP2 (PhosphoSolutions 1099-MAP2) at 1:1000. Coverslips were then washed in PBS and incubated in secondary antibodies (Jackson ImmunoResearch) at a concentration of 1: 1000 in blocking solution for 90 min at RT, then washed in PBS 3 times and mounted on glass slides with Prolong Glass with NucBiue mounting media (Invitrogen P36983). Images were acquired on a confocal Nikon AIR confocal microscope.

[0289] RT-PCR

[0290] Total RNA from differentiated iPSC-derived motor neurons was extracted using the RNeasy Mini Kit (Qiagen, 74106) according to the manufacturer’s instructions. RNA concentration and purity were assessed with a NanoDrop ND- 1000 spectrophotometerAttorney Docket: 10504- 109WO1 (Thermo Fisher). Complementary DNA (cDNA) was synthesized from total RNA using the iScript Reverse Transcription Supermix (BIO-RAD, 1708841). RT-PCR was conducted on 5 ng of RNA per reaction. Primers utilized to detect KCNQ2 cryptic splicing: KCNQ2-CE-F, 5'-TATGCCCACAGCAAGATCAC-3' (SEQ ID NO:26); KCNQ2-CE-R, 5'-AGACACCGATGAGGGTGAAG-3' (SEQ ID NO:27). As a loading control, 18S was amplified using the following primers: 18S-FWD 5’ GCAGAATCCACGCCAGTACA (SEQ ID NO:28) and 18S-REV 5’ TTCACGGAGCTTGTTGTCCA (SEQ ID NO:29). For STMN2 we ran the full length transcript using the following primers: STMN2-F,5' - AGCTGTCCATGCTGTCACTG-3' (SEQ ID NO:30); STMN2-R, 5'- GGTGGCTTCAAGATCAGCTC -3' (SEQ ID NO:31) and its truncated version: STMN2a-F, 5'- GGACTCGGCAGAAGACCTTC -3' (SEQ ID NO:32); STMN2a-R, 5'- GCAGGCTGTCTGTCTCTCTC-3' (SEQ ID NO:33), and values were normalized against -actin ACTB-F, 5’-TTGTTACAGGAAGTCCCTTGCC-3’ (SEQ ID NO:34); ACTB-R, 5’-ATGCTATCACCTCCCCTGTGTG-3’ (SEQ ID NO:35). For RT-PCR, PCR products were amplified by Quick-Load Taq 2X Master Mix (NEB, M0271L) using the following PCR program in S1000 Thermal Cycler (BIO -RAD): 95 °C for 30 s, followed by 40 cycles of 95 °C for 15 s, 55°C for 30 s, 68 °C for 30 s and extension time of 68 °C for 5 min. PCR products were separated by agarose gel electrophoresis, and the bands were visualized with Amersham ImageQuant 800 GxP biomolecular imager system. Band intensity was quantified utilizing ImageLab from BIORAD.

[0291] Virus Production

[0292] AA V9 virus was generated by Vector Biolabs using a plasmid designed as follows.The CMV-promoter driven pcDNA3.2 TDP-43 NLS1 YEP plasmid, a gift from Aaron Gitler (Addgene plasmid #84912; RRID:Addgene_84912), was packaged into AAV9 viral particles.

[0293] Intraspinal delivery of AAV9 Virus

[0294] Intraspinal delivery of AAV9 in p 180 mice was carried out as previously described.Mice deeply under anesthesia underwent an incision of their dorsal skin and underlying muscle with retraction, revealing the spinous processes between vertebrae C2 and Tl. Following laminectomy at spinal levels C4, C5, and C6, six total bilateral injections were given across this area. Each injection contained IxlO11GC of the AAV9-TDP-43 NLS1 virus (TDP-43ΔNLS) in a 1 pL total volume. A gas-tight Hamilton syringe mounted on a UMP3 electronic micropump (World Precision International) was used for theseAttorney Docket: 10504- 109WO1 injections, with a 33-gauge 45° beveled needle. Targeting of injections was guided on the lateral axis by the midpoint of each spinal segment, and on the rostral-caudal axis by the location of dorsal root entry for C4, C5, and C6. The needle was lowered to a depth 0.8 mm below the dorsal surface for ventral horn targeting, with injections then delivered over a 5 -minute interval at a constant rate. Sham surgery control animals underwent identical procedures and laminectomies, as well as needle placement and insertion. In sham animals, the Hamilton syringe was filled with sterile PBS and the micropump was not initiated. Following the final injection, the dura was removed from the dorsal spinal cord of the injection region, and a non-adhering dressing (Adaptic non-adhering dressing by Systagenix) was applied. Overlying muscles were then closed in layers, using sterile silk sutures. The skin incision was also closed using both sutures and sterile wound clips. Animals recovered on a heating pad until awake, and were then returned to their home cage. To minimize pain and distress, at the time of surgery and at 12-hour intervals for the first 24 hours following surgery, animals were given subcutaneous sterile saline for fluid balance, buprenorphine analgesic (0.05 mg / kg), and cefazolin antibiotic (10 mg / kg). Animals were monitored daily and were checked for signs of pain and / or distress, as well as ambulatory potential and ability to obtain food / water.

[0295] Spinal delivery of RNA

[0296] After one week of viral expression, animals were again deeply anesthetized. The original surgical incision was reopened and skin and muscle retracted to expose the spinal cord. The non-adhering dressing was removed from the spinal cord surface, and was replaced with a pre-saturated gelfoam sponge (sterile gelfoam Dental sponge, Pharmacia & Upjohn). TDP-43ΔNLS-expressing animals were randomized into saline control, or RNA treatment groups, with the sponge being pre-soaked either in sterile saline solution, or sterile saline reconstituted RNA at a 100 gg / mouse dosing. This dosing penetrates to the ventral spinal cord by 3-days post-application in a robust and reproducible manner, and causes no detrimental side-effects when evaluated out to two-weeks post-administration. Sham surgery control animals underwent identical procedures, and received a saline- saturated gelfoam sponge. Following this application, overlying muscles and skin were again closed with sterile silk sutures, with the skin also being bound with sterile wound clips. Animals again recovered on a heating pad until awake, prior to return to home cages. Animals received the same set of compounds to minimize pain and distress, at the time of surgery and at 12-hour intervals for the first 24 hours following surgery: subcutaneous sterile saline for fluid balance, buprenorphine analgesic (0.05 mg / kg), and cefazolinAttorney Docket: 10504- 109WO1 antibiotic (10 mg / kg). Animals were again monitored daily for signs of pain and / or distress, as well as ambulatory potential and ability to obtain food / water. Assessment of motor neuron numbers was carried out at 3 and 5 days following RNA application, to determine potential beneficial therapeutic effects and longevity.

[0297] Animal Harvesting for Spinal Cord Immunofluorescence

[0298] Mice were euthanized using carbon dioxide asphyxiation, and perfused and fixed following standard laboratory procedures. A perfusion needle connected to a peristaltic pump was inserted into the left ventricle of the heart, and animals were then perfused with approximately 20 mL of PBS followed by 25 mL 4% paraformaldehyde. The animal was dissected to obtain the cervical spinal cord, which was then placed in 4% paraformaldehyde overnight. Paraformaldehyde was briefly rinsed off the tissue with PBS, with spinal cords then placed in 30% sucrose until tissue sinking (24-48 hours). Spinal cords were frozen into Tissue-Tek OCT solution and were subsequently sectioned using a Cryostar NX50 cryostat (Epredia) at a section depth of 30 pm. Sections were placed onto charged glass slides. Tissue blocking, permeabilization, and staining were performed according to laboratory standard protocols and according to antibody manufacturer recommendations. 30 m spinal cord sections on slides were heated overnight at 55°C and were then rinsed with PBS. Sections were next blocked in 5% BSA for 1 hour at room temperature, and then incubated in primary antibodies at 4°C overnight (NeuN) or for 48 hours (ChAT). Primary antibodies included: anti-ChAT (Millipore RRID:AB_2079751, 1:1,000) and anti-NeuN (Cell Signaling Cat# 24307, RRID:AB_2651140, 1:400). Following this incubation and PBS washing, secondary labeling for visualization was attained with AlexaFluor594 (Life Technologies). To label cell nuclei, Hoechst stain (ThermoFisher) was used. Slides were mounted with coverslips using Citifluor AF3 (Electron Microscopy Sciences). Microscopy imaging was accomplished using a Nikon A1+ confocal microscope and NIS-Elements software. ChAT+and NeuN+cells were assessed using bilateral ventral horn images with manual counting by a blinded assessor. TDP-43 puncta, visualized using the YEP tag of the virally expressed protein, and colocalization of these puncta with Cy5-tagged Malat1_start molecules were assessed using NIS-Elements software.

[0299] RT-qPCR analysis of Sort1 transcripts

[0300] RNA was extracted from fixed mouse spinal cords using the Thermofisher PureLink RNA Mini Kit. Reverse transcription was accomplished using the Qiagen QuantiTech Reverse Transcription Kit. cDNA samples were then prepared for qPCRAttorney Docket: 10504- 109WO1 assessment using SYBR Green qPCR master mix from Thermofisher, and were evaluated using the QuantStudio 5 Real-Time PCR System. Samples were measured in triplicate for each transcript of interest, with data normalized to GAPDH transcript levels. The ratio of the misspliced variant (Sortl-exl7b) to Sortl -WT transcripts is graphically represented, as has been reported in previous studies. Fold change between groups for total Sortl is also represented.

[0301] The previously described and validated primer pairs for total, WT, and TDP-43 misspliced (Sortl -ex!7b) mouse Sort! transcripts were obtained from Integrated DNA Technologies (IDT). Primer pairs are as follows:Sort1_Total fwd: CGTGTTCCCTGGAGGACTTCCT (SEQ ID NO:36);Sort1_Total rev: TTCAGGCTGCTCCACGCACT (SEQ ID NO:37);Sort1_WT fwd: CCCCACAAAGCAGAATTCCAAGTC (SEQ ID NO:38);Sort1_WT rev: TGACAAGCATCAGTCCCACGAT (SEQ ID NO:39);Sort1_ex17b fwd: AAATCCCAGGAGACAAATGC (SEQ ID NO:40);Sort1_ex17b rev: GAGCTGGATTCTGGGACAAG (SEQ ID NO:41);GAPDH fwd: AACAGCAACTCCCACTCTTC (SEQ ID NO:42);GAPDH rev: CCTGTTGCTGTAGCCGTATT (SEQ ID NO:43).Attorney Docket: 10504- 109WO1 Table 1. RNA oligonucleotides utilized in this study. The sequences of all RNA oligonucleotides used in this study are provided, ‘m’ indicates the nucleotide has a 2’-O-Methyl modification. indicates a phosphorothioate bond modification. RNA secondary structure predictions were performed utilizing the RNAstructure web server, and reported AG values (in kcal / niol) are listed. Nucleotide color corresponds to the confidence in prediction probability; red > 99%; orange > 95%; yellow > 90%; dark green > 80%; light green > 70%; light blue > 60%; dark blue > 50%; pink < 50%. ‘n.p.’ indicates RNAstructure did not generate a predicted secondary structure. Structures were not repeated for the modified versions of unmodified RNAs. The length of each sequence is indicated, as well as two measures of the UG-richness of the sequence. UG (%) was calculated as the percentage of nucleotides in the sequence that are either U or G. UG (#) was calculated as the number of ‘UG’ dinucleotide repeats within the sequence. The rounded IC50 and Ko.app values for each RNA with WT TDP-43 are listed, referring to data shown in Fig. 3, B and C and E, Fig. 4C, Fig. 17, Fig. 22B-E, and Fig. 23D-G, J; RNAs for which these values were not determined are indicated as ‘n.d.’ *Both IC50 and Ko.app values are displayed for reference for both the unmodified and fluorophore-labeled versions of the same RNA sequence, although IC50 values were only calculated with the unmodified RNA and Ko.app values only with the fluorophore-labeled RNA.Attorney Docket: 10504-109W01 Table 1. RNA oligonucleotides utilized in this study.Name RNA sequence and predicted secondary Length UG (U ICso (jiM)* K]),app structure (AG, kcal / mol) (# nt) (%) G) (gM) nt(#)Clip34 GAGAGAGCGCGUGCAGAGACUUGGUGG 34 58.82 4 0.50 0.49UGCAUAA (SEQ ID NO:1)A-.20.J* -x'-'-So& / •fe. / J®(-6.6)(AC)17 ACACACACACACACACACACACACACAC 34 0 0 n.d. n.d.ACACAC (SEQ ID NO:2)n.p.AUG 12 GUGUGAAUGAAU (SEQ ID NO:3) 12 66.67 3 1.79 n.d. Clip34„ GAGAGAGCGCGUGUGUGUGUGUGGUGG 34 73.53 8 0.45 0.27UGCAUAA (SEQ ID NO:4)UG6™ ® " \ Tt \Q. - p rr '30(- 5.6)Attorney Docket: 10504-109W01 Clip34_ GAGAGAGCGCGUGUGUGGACUUGGUGG 34 67.65 6 0.38 n.d.UGCAUAA (SEQ ID NO:5)UG2.start10A A Aac; -< S>A'& / i<> / ■■:■ & J- (- 5.8)Clip34_ G AG AGAGCGCGUGC AU GU GCU UGG UGG 34 64.71 6 0.33 n.d.UGCAUAA (SEQ ID NO:6)UG2...middle AZ*W’u:&;& v.;:(-7.2)Clip34_ GAGAGAGCGCGUGCAGAUGUGUGGUGG 34 64.71 6 0.48 n.d.UGCAUAA (SEQ ID NO:7)UG2 end-2<iA\ ©io-..,-A. / xX. --3Giu1: x;yA- (-6.8)(UG)17 UGUGUGUGUGUGUGUGUGUGUGUGUGU 34 100 17 0.20 n.d.GUGUGUG (SEQ ID NO:8)Attorney Docket: 10504-109W01XA:■£< / X'fev " Xc® (3.1)SATIII UGAAUGGAAUGGAAAGAAUGGAAUCAA 34 47.06 4 0.49 0.53CACGAGU (SEQ ID NO:9)20v X;A;z:x \ZXA,(fv '50w®-"" (2.9)Malatl_ UAUUAGAAUGCAUUGUGAAACGACUGG 34 55.88 5 0.36 0.56AGUAUGA (SEQ ID NO: 10)startsof(-1.4)Attorney Docket: 10504-109W01 CLN6_ UGUGUGUGUCUUGUAUAUGUGUGCGCA 34 73.53 9 0.42 n.d.GAGUGCA (SEQ ID NO: 11)middlesb(-4.9)Malatl.. UGUGAAACGACUGGAGUAUGAUUAAAA 34 61.76 6 0.47 n.d.GUUGUGU (SEQ ID NO:12)middle / (Q<0i 0..(-4.4)Malatl_ GAGUAUGAUUAAAAGUUGUGUCCCCA 34 58.82 5 0.57 n.d.AUGCUUG (SEQ ID NO: 13)end,: S'Ac%~i' _.3C® (.-2A)CLN6_ UCGUGUGUGUGUGUGUGUCUUG 34 88.24 12 0.50 n.d.AUAUGUG (SEQ ID NO: 14)Attorney Docket: 10504-109W01 startV fe&tox. - 3C® (0.2)CLN6_ UAUAUGUGUGCGCAGAGUGCAUCAUUU 34 58.82 4 0.67 n.d.UCAGACU (SEQ ID NO: 15)end.!20V:X _ 30£■:-W(-63)LTR-III GGGAGGCGUGGCCUGGGCGGGACUGGG 28 75.00 3 0.55 n.d.G (SEQ ID NO: 16)10 / I / \ / / " A?.(-5.7)A(GU)6AGUGUGUGUGUGU (SEQ ID NO: 17) 13 92.31 5 n.d. n.d.n.p.Attorney Docket: 10504-109W01 5' 6-FAM 6-FAM - 34 58.82 4 0.50 0.49 Clip34 GAGAGAG CGCGU GC AG AG ACUU GGUGGUGCAUAA (SEQ ID NO:1)5’ 6-FAM 6-FAM - 34 58.82 4 n.d. n.d. Clip34 GAGAGAGCGCGUGCAGAGACUUGGUGG3’ BHQ1 UGCAUAA (SEQ ID NO:24)5’ 6-FAM 6-FAM - 34 73.53 8 0.45 0.27 Clip34_ GAGAGAGCGCGUGUGUGUGUGUGGUGGUGCAUAA (SEQ ID NO:1)UG65’ 6-FAM 6-FAM - 34 47.06 4 0.49 0.53 SATIII UGAAUGGAAUGGAAAGAAUGGAAUCAA CACGAGU (SEQ ID NO:9)5’ 6-FAM 6-FAM - 34 55.88 5 0.36 0.56 Malatl_ UAUUAGAAUGCAUUGUGAAACGACUGGAGUAUGA (SEQ ID NO:10)startCTR mUmGmUmAmUmUmUmUmGmAniGmCniU 24 75.00 4 n.d. n.d.2’OMe HiAmGmUmUmUmGmCmUmGmAmU (SEQID NO: 18)ioJ' ~X -I50\ y&>® (-2.9)Malatl_ mUmAmUmUmAmGniAmAmUmGmCinAmU 34 55.88 5 n.d. n.d.niU mGmUmG m Am Am AmCmGm AmCmU mGstart mGmAmGmUmAmUmGmA (SEQ ID NO: 19)2’OMeCLN6_ mUmGmUmGmUmGmUmGmUmCmUmUniG 34 73.53 9 n.d. n.d.mUmAmUmAmUmGmUmGmUmGmCmGmCmiddle inAmGmAmGmUmGmCmA (SEQ ID NO:20)2’OMe(UG)17mUtnGmUmGmUro GmUmGmUmGmUmGm U 34 100 17 n.d. n.d.2’OMe mGmU mGmU mGmU niGmU mGmU mGmU mGmUmGmUmGmUmGmUmG (SEQ ID NO:21)CliP34 mG*mA*mG*mA*mGmAmGmCmGmCmGm 34 58.82 4 n.d. n.d.2’OMe U mG mCmAmGm AmGmAmCmUmU mGmG mUmGmGmUmG*mC*mA*mU *mA*mA (SEQID NO:22)Malatl_mU!i!mA*mU’|!mU*rnA’,!inGmAmAmUmGniC 34 55.88 5 n.d. n.d.mAmUmUmGmUmGmAmAmAmCmGmAmCAttorney Docket: 10504- 109WO1 start PS mUmGmGniAmG*mU*mA*mU*mG*mA(SEQ ID NO:23)5’ Cy5 Cy5 - 34 55.88 5 n.d. n.d. Malatl_ *mU *mA*mGm AmAmUmGmCtn AtnU mU mGmU ro Gm A tn Atn AmC tnGm AmCstart PS mUmGmGmAmG*mU*mA*mU*mG*mA(SEQ ID NO:23)Attorney Docket: 10504- 109WO1 Table 2. HXMS data summary. Data concerning HXMS experiments. Only peptides determined to have good signal were used for HX analysis; only these peptides were used to calculate the values for back-exchange, sequence coverage, average peptide length, redundancy, and repeatability. Back-exchange was determined including all charge states for each peptide. Average peptide length counts all amino acids in the peptide, including the two N-terminal amino acids and proline residues. Average peptide length was determined based on only unique peptide sequences; additional charge states for the same peptide sequence were excluded from the calculation. Redundancy was determined based on the total number of peptides used for HX analysis, including all charge states for each peptide. Redundancy was calculated as the total number of peptides multiplied by the average number of deuterons per peptide (peptide length excluding the two N-tenninal amino acids and proline residues), divided by the total number of available amides in the protein (excluding the two N-terminal amino acids and proline residues). Repeatability was determined including all charge states for each peptide and was calculated based on percent deuteration values for each peptide (rather than for tire absolute number of deuterons).Table 2. HXMS data summaryDataset TDP-43 (free) TDP-43 + Clip34 RNA (bound) HX reaction details 150 mM NaCl, 20 mM HEPES- 150 mM NaCl, 20 mM HEPES- NaOD, 1 mM DTT in D2O, pDread6.0 NaOD, 1 mM DTT in D O. pDread6.0 or 7.0, at 25°C; 80% D2O or 7.0, at 25°C; 80% D2OHX time course pDread 6.0: 1 s, 2 s, 6 s, 18 s, 1 min, 3 pDread 6.0: 1 s, 2 s, 6 s, 18 s, 1 min, 3 min. pDread 7.0: 20 s, 1 min, 3 min, 10 min. pDread 7.0: 20 s, 1 min, 3 min, 10 min, 30 min, 1.5 h, 4.5 h, 14.5 h min, 30 min, 1.5 h, 4.5 h, 14.5 h HX control samples 6 Non -deuterated (ND) and 1 fully 6 Non-deuterated (ND) and 1 fully deuterated (FD; 30°C for 18 h) deuterated (FD; 30°C for 18 h) Back-exchange Mean: 17%; interquartile range: 11% Mean: 17%; interquartile range: 11% Number of peptides MS / MS identified 246 unique MS / MS identified 246 unique peptides. 137 peptides were found to peptides. 135 peptides were found to have good signal and used for HX have good signal and used for FIX analysis (a subset of these peptides analysis (a subset of these peptides were analyzed at multiple charge were analyzed at multiple charge states). Some peptides were not states). Some peptides were not recovered at all timepoints. recovered at all timepoints.Sequence coverage 92.7-97.1% (differences in sequence 87.9-97.1% (differences in sequence coverage at each timepoint are coverage at each timepoint are displayed in figS4A) displayed in figS4B)Average peptide 15.8 / 5.24 15.9 / 5.20length / redundancyReplicates 3 (1 s, 18 s, 20 s, 10 min, 30 min, 1.5 3 (1 s, 18 s, 20 s, 10 min, 30 min, 1.5 h, 4.5 h, 14.5 h); 5 (2 s, 6 s); 6 (3 min; h, 4.5 h, 14.5 h); 5 (2 s, 6 s); 6 (1 min, 3 replicates at each pD); or 7 (1 min; 3 min; 3 replicates at each pD) 4 replicates at pD 7.0, 3 at pD 6.0)Repeatability 2.67% (average standard deviation 1.34% (average standard deviation from replicate measurements of from replicate measurements of percent deuteration of peptides at 10 percent deuteration of peptides at 10 min timepoint) min timepoint) Significant Unpaired t-test with Welch’s Unpaired t-test with Welch’s differences in HX correction of a difference between correction of a difference between free and bound states using p-value < free and bound states using p-value <0.05 0.05Attorney Docket: 10504- 109WO1 Table 3. TDP-435FLHXMS data summary. Data concerning HXMS experiments performed with TDP-435FL-MBP-His is provided as previously suggested. Only peptides determined to have good signal were used for HX analysis; only these peptides were used to calculate the values for back-exchange, sequence coverage, average peptide length, redundancy, and repeatability. Back-exchange was determined including all charge states for each peptide.Average peptide length counts all amino acids in the peptide, including the two N-terminal amino acids and proline residues. Average peptide length was determined based on only unique peptide sequences; additional charge states for the same peptide sequence were excluded from the calculation. Redundancy was determined based on the total number of peptides used for HX analysis, including all charge states for each peptide. Redundancy was calculated as the total number of peptides multiplied by the average number of deuterons per peptide (peptide length excluding the two N-terminal amino acids and proline residues), divided by the total number of available amides in the protein (excluding the two N-terminal amino acids and proline residues). Repeatability was determined including all charge states for each peptide, and was calculated based on percent deuteration values for each peptide (rather than for the absolute number of deuterons).Table 3. TDP-435FLHXMS data summaryDataset TDP-435*1(free) TDP-43SFL+ Clip34 RNA (bound) HX reaction details 150 mM NaCl, 20 mM HEPES- 150 mM NaCl, 20 mM HEPES- NaOD, 1 mM DTT in D2O, pDread6.0 NaOD, 1 mM DTT in D2O, pDread6.0 or 7.0, at 25°C; 80% D2O or 7.0, at 25°C; 80% D2OHX time course pDread 6.0: 2 s; pDread 7.0: 4.5 h pDread 6.0: 2 s; pDread 7.0: 4.5 h HX control samples 3 Non-deuterated (ND) and 1 fully 3 Non-deuterated (ND) and 1 fully deuterated (FD; 30°C for 18 h) deuterated (FD; 30°C for 18 h) Back-exchange Mean: 22%; interquartile range: 11% Mean: 22%; interquartile range: 11% Number of peptides MS / MS identified 197 unique MS / MS identified 197 unique peptides. 153 peptides were found to peptides. 153 peptides were found to have good signal and used for HX have good signal and used for HX analysis (a subset of these peptides analysis (a subset of these peptides were analyzed at multiple charge were analyzed at multiple charge states). Some peptides were not states). Some peptides were not recovered at all timepoints. recovered at all timepoints.Sequence coverage 96.1% (differences in sequence 96.1% (differences in sequence coverage at each timepoint are coverage at each timepoint are displayed in figS8A) displayed in figS8B)Average peptide 16.3 / 7.71 16.3 / 7.74length / redundancyReplicates 3 (2 s) or 4 (4.5 h) 3 (4.5 h) or 4 (2 s) Repeatability 2.82% (average standard deviation 1.93%' (average standard deviation from replicate measurements of from replicate measurements of percent deuteration of peptides at 4.5 percent deuteration of peptides at 4.5 h timepoint) h time point)Significant Unpaired t-test with Welch’s Unpaired t-test with Welch’sdifferences in HX correction of a difference between correction of a difference betweenAttorney Docket: 10504- 109WO1 free and bound states using p-value < free and bound states using p-value <0.05 0.05Attorney Docket: 10504- 109WO1 Table 4. Simulations conducted in this studyConstruct Condition Duration ANTD TDP-43 lacking the NTD (residues 102-414) without RNA 2.5 us * 3 replica ANTDRNATDP-43 lacking the NTD (residues 102-414) bound to 2.5 us * 3 replica ATJG12 RNA (5'-GUGUGAAUGAAU-3')ΔNTD 5FLRNATDP-43 lacking the NTD (residues 102-414) with 2.5 u s * 3 replica F 147 / 149 / 194 / 229 / 23 IL mutations and AUG12 RNA (5'- GUGUGAAUG AAU-3 ')FL TDP-43 full-length 2.5 u s * 3 replica FLRNATDP-43 full-length bound to AUG 12 RNA 2.5 p s * 3 replica (5 '-GUG UGAAUGAAU-3 ')FL 51 ' TDP-43 full-length with Fl 47 / 149 / 194 / 229 / 23 IL 2.5 jis * 3 replica mutations and AUG12 RNA(5 '-GUGUGAA UGAAU-3 ')

Claims

Attorney Docket: 10504- 109WO1CLAIMSWhat is claimed is,1. A composition for reducing a proteinopathy or neurodegeneration in a subject comprising, an oligonucleotide that binds to or reduces aggregation of one or more TDP- 43 and / or one or more TDP-43 variants, wherein the oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, SEQ ID NO: 19, or a modification or fragment thereof.

2. The composition of claim I, wherein oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO:5, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16, or a modification or fragment thereof.

3. The composition of claim 1, wherein the oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 10, or a modification or fragment thereof.

4. The composition of any one of claims 1-3, wherein the modification is a 2’ OMe modification.

5. The composition of any one of claims 1-4, wherein the proteinopathy or neurodegeneration comprises Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), and Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), Limbic-predominant Age-related TDP-43 Encephalopathy (LATE), Multisystem Proteinopathy, Traumatic Brain Injury, Cortical Basal Degeneration, and Huntington’s Disease.

6. The composition of any one of claims 1-4, wherein the proteinopathy or neurodegeneration comprises Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), and Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), or Limbic-predominant Age-related TDP-43 Encephalopathy (LATE).

7. The composition of any one of claims 1-6, wherein the one or more TDP-43 variants are P112H, KI 8 IE, G295T, G298S, A321V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, or S292 / 409 / 410E.

8. The composition of claim 7, wherein the oligonucleotide reduces aggregation of more than one TDP-43 variants.Attorney Docket: 10504- 109WO1 9. The composition of any one of claims 1-8, wherein the oligonucleotide is selected from a group comprising a short RNA, a small interfering (si) ribonucleic acid (RNA) (siRNA), a microRNA (miRNA), a long noncoding RNA (IncRNA), a short hairpin RNA (shRNA), and an antisense oligonucleotide.

10. A method of treating a proteinopathy or a neurodegeneration in a subject comprising administering to the subject an oligonucleotide that binds to or reduces aggregation of TDP-43 or a variant of TDP-43, wherein the oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NOT, or SEQ ID NO: 8, SEQ ID NO: 19, or a modification or fragment thereof.

11. The method of claim 10, wherein oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO: 16, or a modification or fragment thereof.

12. The method of claim 10, wherein the oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 10, or a modification or fragment thereof.

13. The method of any one of claims 10-12, wherein the modification is a 2’ OMe modification.

14. The method of any one of claims 10-13, wherein the proteinopathy or neurodegeneration comprises Amyotrophic lateral sclerosis (AES), Frontotemporal dementia (FTD), and Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), Limbic- predominant Age-related TDP-43 Encephalopathy (LATE), Multisystem Proteinopathy, Traumatic Brain Injury, Cortical Basal Degeneration, and Huntington’s Disease.

15. The method of any one of claims 10-13, wherein the proteinopathy or neurodegeneration comprises Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), and Alzheimer's Disease (AD), chronic traumatic encephalopathy (CTE), or Iambic- predominant Age-related TDP-43 Encephalopathy (LATE).

16. The method of any one of claims 10-15, wherein the one or more TDP-43 variants are P112H, KI 8 IE, G295T, G298S, A321V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, or S292 / 409 / 410E.

17. The method of any one of claims 10-16, wherein the subject is a human.Attorney Docket: 10504- 109WO1 18. A method of reducing protein aggregation in a neuronal cell comprising contacting the neuronal cell with a composition comprising an oligonucleotide having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 10, SEQ ID NO:9, SEQ ID NO 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, SEQ ID NO: 19, or a modification or fragment thereof.

19. The method of claim 18, wherein oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95%’ sequence identity to SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO: 16, or a modification or fragment thereof.

20. The method of claim 18, wherein the oligonucleotide comprises a sequence having at least 70%, at least 80%, at least 90%, or at least 95% sequence identity to SEQ ID NO:10, or a modification or fragment thereof.

21. The method of any one of claims 18-20, wherein the modification is a 2’ OMe modification.

22. The method of any one of claims 18-21, wherein the protein is TDP-43.

23. The method of claim 22, wherein the TDP-43 comprises SEQ ID NOT.

24. The method of any one of claims 18- 1, wherein the protein is a TDP-43 variant.

25. The method of claim 24, wherein the TDP-43 variant comprises Pl 12H, K181E, G295T, G298S, A321V, Q331K, M337V, A382T, K145 / 192Q, S292E, R293F, S409 / 410E, or S292 / 409 / 410E.

26. The method of any one of claims 18-25, wherein the neuronal cell is a sensory neuron, motor neuron, interneuron, or anoxic neuron.

Images