Compositions and methods of using peptides for skin rejuvenation

Abstract

This invention relates generally to the fields of skin rejuvenation of human skin, maintenance of healthy skin, restoration of damaged skin, wound healing, treatment of atrophy of any human tissue, and / or treatment of conditions, disorders, and diseases of the skin and mucosa associated with changes in extracellular matrix components. More particularly, the invention relates to compositions and methods of using such compositions to improve the appearance of aged skin by stimulating extracellular matrix components including, for example, collagens, elastin and hyaluronic acid in humans.

Description

Attorney Docket No. 13720.0069P1COMPOSITIONS AND METHODS OF USING PEPTIDES FOR SKIN REJUVENATION CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of the filing date of U. S. Patent Application No.63 / 734,076, filed on December 14, 2024, which is hereby incorporated herein by reference in its entirety.SEQUENCE LISTING

[0002] The contents of the electronic sequence listing named “ 13720.0069P1. xml,” created on December 15, 2025, and having a size of 59 kB is hereby incorporated by reference in its entirety.ABSTRACT

[0003] This invention relates generally to the fields of skin rejuvenation of human skin, maintenance of healthy skin, restoration of damaged skin, wound healing, treatment of atrophy of any human tissue, and / or treatment of conditions, disorders, and diseases of the skin and mucosa associated with changes in extracellular matrix components. More particularly, the invention relates to compositions and methods of using such compositions to improve the appearance of aged skin by stimulating extracellular matrix components including, for example, collagens, elastin and hyaluronic acid in humans.BACKGROUND OF THE INVENTION

[0004] Although the type of skin can vary' over a person's body, skin is generally composed of two main layers of tissue. The epidermis, the outermost layer, is composed of several layers. The dermis, also called corium or cutis vera, is composed of a papillary layer above and a reticular layer below,

[0005] The human epidermis is principally composed of keratinocytes but contains also other types of cells including the melanocytes and the Langerhans' cells. Each of these cell types contribute, through their specific function, to the essential role played by the skin.

[0006] The dermis provides a solid support for the epidermis. It is also its feeder layer. The dermis consists mainly of fibroblasts but leukocytes, mast cells or tissue macrophages are alsoAttorney Docket No. 13720.0069P1present. The dermis further contains blood vessels and nerve fibers The acellular part (i.e., the area in between the cells) of the dermis is called extracellular matrix. The extracellular matrix of skin is composed of various extracellular components including proteins; in particular collagen fibers and elastin. Other extracellular matrix components of skin include glycosaminoglycans (e.g., hyaluronic acid, chondroitin sulfate, dermatan sulfate, keratan sulfate, heparan sulfate, etc.), proteoglycans (e.g., fibromodulin, decorin, biglycan, perlecan, heparan sulfate proteoglycan 2, agrin, versican, aggrecan, lumican, collagen type IX, collagen type XII, collagen type XIV, testican 1, testican 2, etc.) and various glycoproteins (e.g., fibrillin 1, thrombospondin- 1 and -2, tenascin-C and -X, osteopontin, fibronectin, laminin-5 and -6, vitronectin, etc.). These extracellular components are synthesized by dermal fibroblasts, which make dermal fibroblasts the primary constituent in the structural assembly of the dermis.

[0007] The extracellular matrix is a highly heterogeneous amalgam of morphologically diverse architectural entities. It organizes and imparts structural integrity to individual tissues, in addition to modulating cell behavior by interacting with cell surface receptors and soluble growth factors. Dysfunctions and changes in components of the extracellular matrix can therefore interfere with both tissue integrity and cell performance. Dysfunctions and changes in components of the extracellular matrix of skin and mucosa in humans can lead to skin aging, skin atrophy, damaged skin, wounded skin, atrophy of vulva and vagina (vulvovaginal atrophy), or to any other conditions, disorders and diseases of skin and mucosa associated with changes in extracellular matrix components.

[0008] Therefore, a need exists in the art for compositions having improved activity that maintain or even increase the level of a rather large number of extracellular matrix components, including those that are altered in aged, damaged, wounded, atrophic skin, atrophy of vulva and vagina, or in any other conditions, disorders and diseases of skin and mucosa in humans associated with changes in extracellular matrix components.SUMMARY OF THE INVENTION

[0009] The present disclosure is directed to methods and compositions for stimulating the formation of one or more extracellular matrix components in skin or mucosa, wherein the composition to be administered comprises an effective amount of a cationic peptide having at leastAttorney Docket No. 13720.0069P150% Arg and Lys residues and an HIV-TAT or a reverse HIV-TAT to stimulate the formation of one or more extracellular matrix components in skin or mucosa.

[0010] The cationic peptide can be an N- terminal portion that is an HIV-TAT or reverse HIV-TAT sequence, a C-terminal portion that is an HIV-TAT or reverse HIV-TAT sequence, and one or more lysine residues between said N-terminal portion and said C-terminal portion, wherein said peptide has from 5 to 50 lysine residues between said N-terminal portion and said C-terminal portion, optionally wherein said N-terminal portion is an HIV-TAT sequence and said C-terminal portion is an HIV-TAT sequence or optionally wherein said N-terminal portion is a reverse HIV- TAT sequence and said C-terminal portion is a reverse HIV-TAT sequence.

[0011] The method and composition described herein stimulates the formation of one or more extracellular matrix components predominantly associated with skin aging selected from the group consisting of collagen I, collagen III, collagen IV, collagen V, collagen XI, elastin, fibronectin, hyaluronic acid, and combinations thereof. The method and composition described herein stimulates the formation of collagen III. The method and composition described herein stimulates the formation of collagen IV. The method and composition described herein stimulates the formation of collagen XI. The method and composition described herein stimulates the formation of elastin. The method and composition described herein stimulates the formation of collagen I. The method and composition described herein stimulates the formation of hyaluron. The method and composition described herein stimulates the formation of hyaluron. The method and composition described herein stimulates the formation of collagen I and elastin. The method and composition described herein stimulates the formation of collagen I, collagen IV, hyaluron, and elastin, and preferably the composition is applied to skin or mucosa of a person of 45 years, 50 years, or more.

[0012] Embodiments include a composition with the cationic peptide that further comprises an effective amount of botulinum toxin, optionally botulinum toxin Type A complex or botulinum toxin Type A, 150 kD for treating keloids.

[0013] Embodiments include a composition comprising an effective amount of the cationic peptide and an effective amount of an anti-inflammatory steroid.Attorney Docket No. 13720.0069P1

[0014] Embodiments include a composition with an effective amount of the cationic peptide and an effective amount of estradiol and / or estriol to treat symptoms of skin or mucosal aging.DESCRIPTION OF FIGURES

[0015] FIG. 1 A is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in young human fibroblast cells exposed to RTP004 at increasing concentrations as compared to the control (left most column for each protein).

[0016] FIG. IB is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to RTP004 at increasing concentrations as compared to the control (left most column for each protein).

[0017] FIG. 2A is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in young human fibroblast cells exposed to Daxxify® at increasing concentrations as compared to the control (left most column for each protein)

[0018] FIG. 2B is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to Daxxify® at increasing concentrations as compared to the control (left most column for each protein).

[0019] FIG. 3 A is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in young human fibroblast cells exposed to botulinum toxin at increasing concentrations as compared to the control (left most column for each protein).

[0020] FIG. 3B is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to botulinum toxin at increasing concentrations as compared to the control (left most column for each protein).

[0021] FIGS. 4A-D are a comparison of expression of COL1 Al and COL3A1 mRNA of FIGS 1A, IB, 2A, and 2B in young HDF culture media treated with RTP004 versus DAXXIFY.

[0022] FIGS. 4E-H are a comparison of elastin and hyaluronic acid release of FIGS 1A, IB, 2A, and 2B in young HDF culture media treated with RTP004 versus DAXXIFY.

[0023] FIGS. 4I-L are a comparison of MMP1 and laminin of FIGS 1A, IB, 2A, and 2B in young HDF culture media treated with RTP004 versus DAXXIFY.Attorney Docket No. 13720.0069P1

[0024] FIGS. 5A-D are a comparison of expression of COL1A1 and COL3A1 mRNA of FIGS 1 A, IB, 2A, and 2B in old HDF culture media treated with RTP004 versus DAXXIFY.

[0025] FIGS. 5E-H are a comparison of expression of elastin and hyaluronic acid of FIGS 1 A, IB, 2A, and 2B in old HDF culture media treated with RTP004 versus DAXXIFY.

[0026] FIG. 6 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to P3 peptide at increasing concentrations as compared to the control (left most column for each protein).

[0027] FIG. 7 A is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to P5 (TAT) peptide at increasing concentrations as compared to the control (left most column for each protein), FIG. 7B for RTP004 peptide, and FIG. 7C for TAT at 1 / 3 amount as that of FIG. 7A.

[0028] FIG. 8 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to P6 peptide at increasing concentrations as compared to the control (left most column for each protein).

[0029] FIG. 9 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to P7 peptide at increasing concentrations as compared to the control (left most column for each protein).

[0030] FIG. 10 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to PH peptide at increasing concentrations as compared to the control (left most column for each protein).

[0031] FIG. 11 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to Scrambled peptide (a random rearrangement of the amino acids of RTP004) at increasing concentrations as compared to the control (left most column for each protein),DETAILED DESCRIPTION OF THE INVENTION

[0032] The present invention is directed toward methods and compositions for increasing collagen, elastin, and / or hyaluronic acid in a tissue, particularly, in the extracellular matrix of skin and mucosa by administering a positively charged peptide as described herein. The invention is also directed to methods and compositions for increasing human collagen type 1A1 (COL1A1),Attorney Docket No. 13720.0069P1collagen type 3A1 (COL3A1). elastin, and / or hyaluronan proteins by administering a positively charged peptide as described herein

[0033] Extracellular Matrix Components

[0034] Collagen occurs in many places throughout the body. So far, at least 28 types of collagens have been identified and described which provide a variety of structural and functional properties that collagen exhibits throughout the body. The five most common types are collagen I, II, III, IV and V. However, over 90% of the collagen in the body is of type I.

[0035] In human skin, collagen types I and III are the predominant types of collagens They are present as fibrils and are responsible for the solidity and the strength of the dermis. Since type I collagen is the predominant collagen in adult human skin, comprising about 80% of the total bulk of collagen, it plays a major role in providing tensile strength to the skin. It is clear, however, that type III collagen, which comprises some 10% of the total dermal collagen, also plays a critical role in providing additional tensile properties to the skin and other tissues. (See Journal of Dermatological Science, 24, Suppl. 1, 2000, S60-S69, which is hereby incorporated by reference in its entirety),

[0036] Structurally, three collagen polypeptides wrap around each other in a helix to form a triple helix collagen I or III molecule. These molecules are packed in a five-stranded rope-like structure wherein each collagen molecule is quarter-staggered with respect to the next to form a microfibril. Microfibrils are subsequently wrapped around other microfibrils to form fibrils, which in turn wrap around other fibrils to produce even larger fibers.

[0037] Using histological and ultrastructural approaches in the past, it has been well-described that chronologically aged skin manifests in a reduced synthesis of both collagen types I and III, With respect to photoaging, Schwarz et al. (Photochem Photobiol 1993, 58, 841-844, which is hereby incorporated by reference in its entirety) demonstrated that the loss in collagen in sun-damaged human skin is due to increased degradation of both types I and III collagens. Additionally, it was shown that fibroblasts derived from sun-exposed skin synthesize a lower proportion of collagen III than cells from sun-protected skin. (See J Photochem Photobiol B. 1995, 27: 33-38, which is hereby incorporated by reference in its entirety).Attorney Docket No. 13720.0069P1

[0038] Other collagen types are also present in skin, and a few of them have been described to change with skin aging. For instance, collagen VII, which is responsible for anchoring the basement membrane onto dermal matrix, decreases with aging. (See Eur J Dermatol 2008; 18: 297-302). One of the additional major morphological features of aged skin is an altered dermal epidermal junction which structurally manifests as flattening of the dermal epidermal junction outline with the loss of rete pegs and re-duplication of the lamina densa. Since the dermal epidermal junction is involved in the cohesion between the dermis and epidermis, age-related alterations in the dermal epidermal junction as a result of collagen VII decrease entail functional changes in skin resistance to mechanical stress and tissue homeostasis This may contribute to wrinkle formation.

[0039] Collagen V assembles into diverse molecular forms and studies indicated that it is expressed in skin as different subtypes with important but distinct roles in matrix organization and stability. (See J Invest Dermatol 2012, 132: 1841-1849, which is hereby incorporated by reference in its entirety). Whereas collagen V is the defective product in most cases of classical Ehlers-Danlos syndrome, which is an extracellular matrix component disorder typically characterized by skin fragility and abnormal wound healing, it does not seem to significantly change with skin aging.

[0040] Further collagen types such as collagens VI, XIV and XVI are also expressed in the collagen-rich dermis. Although the structural features of these collagens are now well-characterized, their functions still remain mostly elusive.

[0041] The production of collagen in vivo requires activation of the collagen biosynthesis pathway by which transcription in the cell nucleus promotes polypeptide synthesis via translation from mRNA, organization of the polypeptides into a pro-collagen triple helix in the cytoplasm, secretion of pro-collagen from the cell, and then cleavage reactions, fibril assembly, and crosslinking extracellularly. Unlike many proteins that are stored in secretory granules and then secreted from the cell upon demand, collagen is secreted continuously.

[0042] Alterations in content and structure of collagen and other components of the extracellular matrix, including but not limited to, elastin and hyaluronic acid are characteristic of aged human skinAttorney Docket No. 13720.0069P1

[0043] Elastin is a vital component of the extracellular matrix of vertebrates and provides exceptional properties including elasticity and tensile strength to many tissues and organs including the skin. Mature elastin is an insoluble and extremely durable protein that undergoes little turnover, but sustained exposure to proteases may lead to irreversible and severe damage, and thus to functional loss of the elastic fiber network. In general, elastin content decreased with age in sun unexposed skin (i.e., buttock) (i.e., elastin content decreased by about 44% between 50 and 70 years of age). A similar decrease was seen in severe sun-exposed skin (i.e., face) (i.e., elastin content decreased by about 31% between 50 and 70 years of age). Interestingly, the elastin content in moderately sun-exposed areas (i.e., forearm) did not significantly change during aging. This phenomenon might be explained by a combination of age-induced reduction and sun-dependent increase in elastin, what appears to be at least partially regulated by UV-induced deposition of lysozyme in elastin fibers. (See JEADV 2006, 20, 980-987, which is hereby incorporated by reference in its entirety).

[0044] Fibrillins (e.g., fibrillin 1) are ubiquitous glycoproteins of the extracellular matrix that self-polymerize into filamentous microfibrils in which individual molecules are organized in longitudinal head-to-tail arrays and associate laterally as well. (See Fibrogenesis & Tissue Repair 2010, 3, 24, which is hereby incorporated by reference in its entirety). Fibrillin microfibrils can additionally serve as the structural template for tropoelastin deposition and / or crosslinking during elastic fiber formation. Specific segments of the fibrillins interact in vitro with numerous extracellular signaling and cell surface molecules, including fibronectin, fibulins, syndecans and integrins. The multiple molecular interactions of fibrillins are believed to drive the assembly of morphologically distinct macroaggregates, which contribute to imparting the structural integrity to individual tissues and organs (structural role), and to target TGF-beta and BMP complexes to the architectural matrix, which contributes to instructing the behavior of cells (instructive role). TGF -betas and BMPs are potent modulators of extracellular matrix metabolism that are under the control of a complex network of relays and servomechanisms operating within and outside the cell, and at the cell surface. Thus, fibrillins are important components of the extracellular matrix which are necessary for the formation of other extracellular matrix components such as elastin and elastic fiber formation.

[0045] Glycosaminoglycans (e.g., hyaluronic acid, chondroitin sulfate, heparan sulfate, dermatan sulfate, keratan sulfate, etc.) and particularly hyaluronic acid are major components ofAttorney Docket No. 13720.0069P1the cutaneous extracellular matrix involved in wound healing and tissue regeneration Wound healing is a dynamic interactive process involving many precisely interrelated phases, overlapping in time and leading to the restoration of tissue integrity. The healing process reflects the complex and coordinated body response to tissue injury resulting from the interaction of different cell types and extracellular matrix components. Hyaluronan plays a key role in each phase of wound healing by stimulating cell migration, differentiation, and proliferation as well as regulating extracellular matrix organization and metabolism. Glycosaminoglycans and particularly hyaluronic acid are also involved in skin aging.

[0046] Hyaluronic acid (also called hyaluronan) is an anionic, non-sulfated glycosaminoglycan. It is unique among glycosaminoglycans since it is non-sulfated and can be very large, with its molecular weight (g mol-1) often reaching the millions. As a predominant voluminous molecule, hyaluronic acid is a major component of the extracellular matrix of the skin. It provides structure, volume (which is associated with hyaluronic acid’s excellent water holding properties), and organization (e.g., facilitates the transport of ion solutes and nutrients) but also contributes significantly to cell proliferation and migration in the dermis. In addition, through the water-attaining properties of hyaluronic acid, it contributes to the hydration of the skin.

[0047] Though dermal hyaluronic acid is responsible for most hyaluronic acid in skin, epidermal cells (e.g.; keratinocytes) are also able to synthesize hyaluronic acid. The most dramatic histochemical change observed in aged skin is the marked decrease in epidermal hyaluronic acid A. In skin of an elderly person, hyaluronic acid is still present in the dermis, while the hyaluronic acid of the epidermis has disappeared entirely. The reasons for this precipitous fall with aging are unknown. It has been described that the synthesis of epidermal hyaluronic acid is influenced by the underlying dermis, thereby indicating that epidermal hyaluronic acid is under separate controls from dermal hyaluronic acid.

[0048] In contrast with previous in vitro and in vivo observations, studies document that the total level of hyaluronic acid remains about constant in human skin with aging. However, the major age-related change is the increasing avidity of hyaluronic acid with tissue structures with the concomitant loss of hyaluronic acid extractability. Such intercalated hyaluronic acid may result in a diminished ability to take on water, what results in a decreased volume and, obviously, a loss in skin moisture. Progressive loss in the size of the hyaluronic acid polymer in skin as a functionAttorney Docket No. 13720.0069P1of age has also been reported The increased binding of hyaluronic acid with tissue as a function of age parallels the progressive cross-linking of collagen and the steady loss of collagen extractability with age. Each of these phenomena contributes to the apparent dehydration, atrophy, and loss of volume and elasticity that characterizes aged skin.

[0049] Other than in skin aging, collagens I and III are also major extracellular matrix components involved in scar formation. Scarring occurs after trauma, injury or surgery to any tissue or organ in the body. Such scars are a consequence of a repair mechanism that replaces the missing normal tissue with an extracellular matrix consisting predominantly of collagen types I and III as well as fibronectin and some other extracellular matrix components. Scarring represents imperfect tissue regeneration. Whereas skin wounds on early mammalian embryos (e.g., up to about 24 weeks of gestation in humans) heal perfectly with no signs of scarring and complete restitution of the normal skin architecture, postnatal wounds heal with scars. (See Dang C et al., Clin Plast Surg 2003: 30, 13-23, which is hereby incorporated by reference in its entirety).

[0050] There are phenotypic differences between the collagen content and cross-linking patterns in fetal and postnatal wounds (See Clin Plast Surg 2003, 30, 13-23 and Curr Opin Pediatr 2012, 24, 371-378, which is hereby incorporated by reference in its entirety). In fetal wounds, type III collagen is rapidly deposited in a fine reticular network that is indistinguishable from uninjured skin. Post-natally, the ratio of type I to type III collagen in wounds increases. Of the many different types of collagens identified, fetal skin i s known to contain a greater proportion of type III collagen, whereas adult skin consists predominantly of type I collagen. The predominance of type I collagen in postnatal wounds provides regenerating tissue with more strength and rigidity. Early scar formation in late gestation fetal wounds demonstrates larger collagen fibers with greater interfiber space.

[0051] In addition, fetal skin generally contains more hyaluronic acid than adult skin Further, the hyaluronic acid content of the extracellular matrix in scarless fetal wounds is increased more rapidly than in adult wounds. Because fetal skin contains more hyaluronic acid than adult skin, several investigators have therefore proposed also a role of hyaluronic acid in scarless healing. The precise mechanisms of scarless healing remain unknown, however, despite the great increase in knowledge gained over the past decade.Attorney Docket No. 13720.0069P1

[0052] The importance of extracellular matrix components collagen I, collagen III. collagen V, elastin and hyaluronic acid in the skin and the importance of maintaining, or even increasing, the amount thereof, thus, are self-evident for skin rejuvenation and maintaining healthy skin In addition, collagen I, collagen III and hyaluronic acid have been particularly recognized to be important in wound healing and restoration of damaged skin without scarring or with reduced scarring.

[0053] Conditions Associated with Changes in Extracellular Matrix Components

[0054] All terms such as "skin aging", "signs of skin aging", "topical application", and the like are used in the sense in which they are generally and widely used in the art of developing, testing and marketing cosmetic and personal care products, as well as for medicaments which are indicated for skin aging (e.g., cream with tretinoin).

[0055] Skin aging is classified into intrinsic aging and extrinsic aging depending on its cause. Intrinsic aging is a process by which the skin structure and the physiological functions of the skin deteriorate regardless of environmental changes as a human gets older. Extrinsic aging is caused by continuous exposure to external environment such as sunlight and air pollutants. Especially, skin aging caused by sun light is called photoaging. Ultraviolet (UV) light from the sun is the main cause of the physiological and morphological changes in aged skin.

[0093] As intrinsic skin aging proceeds, the skin becomes dry, and fine lines and wrinkles form which become more visible and deepen with age. Further, because of structural and functional changes of the epidermis and the dermis, the skin loses its elasticity and looks drooping. The dermis becomes thinner and well visible skin folds (e.g., nasolabial fold) form with age. It is estimated that the total quantity of collagen lost each year for adults is about 1 %. In addition, the remaining collagen fibers gradually become thicker, while the cross-linking of the collagen fibers increases, so that the solubility, elasticity and like thereof decrease. Furthermore, elastin fibers become thicker, and the cross-linking thereof also increases. Moreover, the proliferative activity of fibroblasts in the dermis decreases with time, and the ability of the aging fibroblasts to form (i.e., synthesize) new collagen, elastin, hyaluronic acid and other components of the extracellular matrix also decreases.

[0056] Continuous exposure to the sun is the main cause of extrinsic aging of skin. The UV component of sunlight, particularly UVA and UVB, is generally believed to be the principalAttorney Docket No. 13720.0069P1causative agent in this process called photoaging. The extent of UV exposure required to cause "photoaging" is not currently known, although the amount sufficient to cause erythema (reddening, commonly described as sunburn) in human skin is quantified as the "minimal erythema dose" (MED) from a given UV light source. Repeated exposure to sunlight UV at levels that cause erythema and tanning are, nevertheless, commonly associated with photoaging.

[0057] There is a difference between the physiology of intrinsically aged (i.e., chronologically aged) skin in comparison with that of photoaged skin. Chronologically aged skin typically maintains a smooth and unblemished appearance, in comparison with the leathery, blotchy, and often deep wrinkling of photoaged skin. Photoaging is characterized clinically by coarseness, wrinkles, mottled pigmentation, sallowness, laxity, telangiectasia, lentigines, purpura and relative ease of bruising, atrophy, depigmented areas, eventually premalignant, and ultimately malignant neoplasm (i.e., abnormal mass of tissue as a result of neoplasia, which is the abnormal proliferation of cells). Photoaging commonly occurs in skin that is generally exposed to sunlight such as the face, ears, bald areas of the scalp, neck, decollete, forearms, and hands,

[0058] Although the typical appearance of photoaged and chronologically aged human skin can be readily distinguished, recent evidence indicates that chronologically aged and UV-irradiated skin share important molecular features including altered signal transduction pathways that promote matrix-metalloproteinase expression (e.g., collagenase, gelatinase) causing extracellular matrix degradation, decreased collagen formation, and alteration or damage to extracellular matrix of skin such as the accumulation of amorphous elastin-containing material residing beneath the epidermal dermal junction. This concordance of molecular mechanisms suggests that UV irradiation accelerates many key aspects of the chronological aging process in human skin.

[0059] Moreover, in women after menopause, the coll gen amount and the skin thickness gradually decrease what causes a sensation of dry or tight skin and a marked increase in skin fine lines and wrinkles. In fact, in addition of wrinkling and loss of elasticity, aging of the skin is also associated with skin thinning (called atrophy) and delayed wound healing. These undesirable aging effects are exacerbated by declining estrogen levels in postmenopausal women. (See Am J Clin Dermatol 2011, 12, 297-311). Estrogens (e.g., 17-beta-estradiol) stimulate keratinocyte proliferation, leading to a thicker epidermis, and the formation of collagens and other extracellularAttorney Docket No. 13720.0069P1matrix components Estrogen products can be therefore used for the prevention and treatment of skin aging due to estrogen decline with menopause. Although topical estrogen products and systemic estrogen replacement therapy has been shown to improve some aspects of postmenopausal skin, long-term estrogen treatment has been associated with significant harmful systemic effects such as increase of breast cancer rate and cardio- toxic events). Therefore, a need for safe and effective, non-hormonal alternatives for the treatment of post-menopausal skin exists.

[0060] Furthermore, vulvar-vaginal atrophy (also called vulvovaginal atrophy) is another common consequence of menopause women. (See Adv Nurse Pract 2010, 18, 31-32, 34, 55). Vulvovaginal atrophy often manifests with discomfort what can be experienced as dryness, lack of lubrication, rawness, burning, irritation, inflammation, atrophic vaginitis, and pain. This can ultimately lead to sexual dysfunction. Today, hormone therapy is the only treatment approved by the US Food and Drug Administration for vulvovaginal atrophy. Because both physicians and women are concerned with the tolerability and safety profile of hormonal (i.e., estrogen, estrogen plus progestin) treatments, alternative, non-hormonal menopause therapies for the treatment of vulvar-vaginal atrophy are needed.

[0061] Vulvovaginal atrophy occurs most often after menopause, but it can also develop during breast-feeding, because of breast cancer treatment, or at any other time the women’s estrogen production declines. Furthermore, recent evidence indicates that women taking oral contraceptives (which can cause a decline in the production of certain sex hormones such as testosterone) may also experience vulvovaginal atrophy. (See Sex Med 2012, 9, 2213-2223; Sex Med 2010, 7, 1585-1587). Vulvovaginal atrophy can lead to syndromes described as vulvodynia and vestibulodynia.

[0062] Vulvodynia is a pain syndrome that affects the vulvar area and often occurs without an identifiable cause or visible pathology. It refers to pain of the vulva unexplained by vulvar or vaginal infection or skin disease. Pain is the most notable symptom of vulvodynia, and can be characterized as a burning, stinging, irritation or sharp pain that occurs in the vulva, including the labia and entrance to the vagina. It may be constant, intermittent or happen only when the vulva is touched, but vulvodynia is usually defined as lasting for months to years. Symptoms of vulvodynia may occur in one place or the entire vulvar area It can occur during or after sexual activity, when tampons are inserted, or when prolonged pressure is applied to the vulva, such as during sitting,Attorney Docket No. 13720.0069P1bike riding, or horseback riding. Some cases of vulvodynia are idiopathic where no particular cause can be determined. Vestibulodynia, or simply vulvar vestibulitis is vulvodynia localized to the vestibular region. It tends to be associated with a highly localized "burning" or "cutting" type of pain. The pain of vulvodynia may extend into the clitoris, which is referred to as clitorodynia. Vestibulodynia is the most common subtype of vulvodynia that affects premenopausal women - the syndrome has been cited as affecting about 10% to 15% of women seeking gynecological care.

[0063] Moreover, tissues from women with vulvodynia have been shown to have a significant increase in subepithelial heparanase activity what may lead to increased intraepithelial hyperinnervation as compared with healthy women. (See Int J Gynecol Pathol 2008, 27, 136- 141). Heparanase, which is degranulated from mast cells, is capable of degrading the vestibular stroma and epithelial basement membrane, thus permitting stromal proliferation and intraepithelial extension of nerve fibers. Heparanase is an enzyme that acts within the extracellular matrix to degrade heparan sulfate. Heparan sulfate glycosaminoglycans (which are other examples of extracellular matrix components of skin) are abundant components of basement membranes and cell surfaces where they are present associated with specific core-proteins to form proteoglycans, mainly perlecan, glypicans and syndecans. They play many roles such as modulation of cell proliferation and differentiation, cell- matrix adhesion and assembly. Heparan sulfate content has been also shown to be altered (decrease) during skin aging. This is mainly the result of an increased formation and activity ofits degrading enzyme, heparanase (e.g., Hpse-I), due to UV-B irradiation. (See J Photochem Photobiol B, 2012, 106. 107-112). Heparanase activation and the consequent decrease of heparan sulfate are associated with wrinkle formation. (See Experimental Derm 2010, 19, 965-972).

[0064] Therefore, vulvodynia is a condition, disorder and disease of the vulva (which is composed of both keratinized and non- keratinized epithelial tissue) that can be also associated with changes in extracellular matrix components.

[0065] Vulvar lichen sclerosus, a chronic inflammatory disease which affects genital labial, perineal and perianal areas, is another disorder associated with changes in extracellular matrix components of the vulva. The histopathology of lichen sclerosus suggests abnormalities in extracellular matrix composition and in particular of proteoglycans. (See J Eur Acad Dermatol Venereol, 2012,26, 207-212).Attorney Docket No. 13720.0069P1

[0066] Vulvar lichen sclerosus produces significant discomfort and psychological distress in peri- and post-menopausal women. Other vulvar disorders associated with changes in extracellular matrix components include vulvar lichen planus, erosive lichen planus, vulvar eczema, vulvar lichen simplex chronicus, ulcers of the vulva, Behcet's disease, and vulvar intraepithelial neoplasia.

[0067] Finally, it is also accepted that emotional stress (see Brain Behav Immun 2009, 23, 1089-1095), tobacco smoke (see J Investig Dermatol Symp Proc 2009, 14, 53-55), air pollution, and certain medications (e.g., corticosteroids) (see Clin Exp Dermatol 1991, 16, 416-419) have an adverse effect on the skin and lead to changes (e.g., decreased formation and / or increased degradation) of collagen and other extracellular matrix components

[0068] Peptides for Stimulating Formation of Extracellular Components

[0069] The present inventors discovered that a cationic peptide having an isoelectric point greater than 12, preferably at least 12,4, more preferably greater than 12.8, that has about 10 to 100 amino acids can stimulate the formation of various extracellular matrix proteins, such as various types of collagens, hyaluronan, laminin, and / or elastin

[0070] In a particularly preferred embodiment, the cationic peptide comprises one or more HIV- TAT or reverse TAT sequences and an isoelectric point greater than 12.3. Such peptides can stimulate the formation of human collagen type I (encoded by gene COL1 Al), collagen type I V (encoded by gene COL4A1), collagen type III (encoded by gene COL3A1), collagen type V (encoded by gene COL5A1), collagen type XI (encoded by gene COL11A1), elastin, and / or hyaluronan proteins, and are useful as active ingredients in pharmaceutical and cosmetic compositions.

[0071] Such cationic peptide can comprise an HI V- TAT sequence or reverse HIV-TAT sequence at the N- or C -terminus, or both the N-terminus and the C -terminus. For example, the peptide may have an HIV-TAT sequence, such as Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-Arg (SEQ ID NO:1), or reverse HIV TAT sequence, such as Arg-Arg-Arg-Gln-Arg-Arg-Lys-Lys-Arg (SEQ ID NO:2), at the N- or C -terminus or both the N-terminus and the C-terminus.

[0072] In one embodiment, the cationic peptide comprises an N-terminal portion that is an HIV-TAT or reverse HIV-TAT sequence, a C-terminal portion that is an HIV-TAT or reverse HIV-Attorney Docket No. 13720.0069P1TAT sequence, and one or more cationic residues (e g., Lys or Arg) between the N- terminal portion and the C-terminal portion. For example, the peptide may have from 5 to 50 cationic residues such as Lys or Arg, between the N-terminal portion and the C -terminal portion, such as 12, 15, 17, 20, 25, 30, 35, 40, 45, or 50 cationic residues. In an embodiment, the residue is lysine and is present in an amount of 12, 15, 17, 20, 25, 30, 35, 40, 45, or 50 residues. In another embodiment, the residue is arginine and is present in an amount of 12, 15, 17, 20, 25, 30, 35, 40, 45, or 50 residues.

[0073] In an exemplary embodiment, the invention is a cationic peptide having the following sequence: Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-Arg-Gly-(Lys)n-Gly-Arg-Lys-Lys-Arg-Arg-Gln-Arg-Arg-Arg (SEQ ID NO: 3), or Arg-Arg-Arg-Gln-Arg-Arg-Lys-Lys-Arg-Gly-(Lys)n-Gly-Arg-Arg-Arg-Gln-Arg-Arg-Lys-Lys-Arg (SEQ ID NO:4), where n is from about 5 to about 30, such as from about 10 to about 20.

[0074] In one embodiment of the invention, the N-terminal portion of the peptide is an HIV- TAT sequence and the C-terminal portion of the peptide is an HIV-TAT sequence. In another embodiment, the N-terminal portion is a reverse HIV-TAT sequence and the C- terminal portion is a reverse HIV-TAT sequence. For example, the antimicrobial peptide may have the following amino acid sequence: Arg-Lys-Lys- Arg- Arg-Gin- Arg- Arg- Arg-Gly-(Lys)i s-Gly-Arg-Lys-Ly s-Arg-Arg-Gln-Arg-Arg-Arg (SEQ ID NO:5).

[0075] Generally, derivatives of the HIV- TAT and reverse HIV-TAT sequence, which are contemplated by the instant invention, are characterized as having a particularly high content of Arg and Lys residues. For example, the cationic peptide of the invention may contain at least about 50%, collectively, of Arg and Lys amino acid residues, or may contain at least about 75%, or at least about 80%, Arg and Lys residues. In these or other embodiments, such derivatives may have the amino acid sequence of SEQ ID NO: 3 or 4, with from 1 to 5 amino acid substitutions, insertions, or deletions (collectively), including 1, 2, 3, or 4 amino acid substitutions, insertions, or deletions with respect to SEQ ID NO: 3 or 4 In certain embodiments, such substitutions, insertions, or deletions, are located within the HIV-TAT or reverse HIV-TAT sequence. With such peptides, the isoelectric point is greater than 12, preferably greater than 12.5, a more preferably greater than 12.8

[0076] The cationic peptides described herein for use in stimulating production human collagen type 1A1 (COL1A1), collagen type 3A1 (COL3A1), elastin, and / or hyaluronan proteinsAttorney Docket No. 13720.0069P1have a length of from about 15 amino acids to about 100 amino acids. In certain embodiments, the cationic peptide is from about 25 to about 50, or from about 25 to about 40 amino acids in length In an exemplary embodiment of the invention, the peptide is about 35 amino acids in length.

[0077] Peptide fragments of HIV- TAT containing compositions are disclosed in a PCT Publication No W02008 / 082889, entitled " Compositions and Methods of Topical Application and Transdermal Delivery of Botulinum Toxins Stabilized with Polypeptide Fragments Derived From HIV- TAT," which is hereby incorporated by reference in its entirety.

[0078] In an embodiment, the cationic peptide comprises one or more PF sequences derived from C-terminal region of influenza A viral protein PB1-F2 flanking one or more cationic residues (e.g., lysine or arginine). The cationic peptide comprises both a N-terminal and C-terminal portion that have the PF sequences derived from C-terminal region of influenza A viral protein PB1-F2 and one or more cationic residues (e g., Lys or Arg) between the N- terminal portion and the C-terminal portion. For example, the peptide may have from 5 to 50 cationic residues such as Lys or Arg, between the N-terminal portion and the C-terminal portion, such as 12, 15, 17, 20, 25, 30, 35, 40, 45, or 50 cationic residues. In an embodiment, the residue is lysine and is present in an amount of 12, 15, 17, 20, 25, 30, 35, 40, 45, or 50 residues. In another embodiment, the residue is arginine and is present in an amount of 12, 15, 17, 20, 25, 30, 35, 40, 45, or 50 residues. An example of this peptide is shown in SEQ ID NO: 50.

[0079] Use of the Peptides for Stimulating Formation of Extracellular Components

[0080] Preferably, the compositions of the present disclosure contain a cationic peptide as described above in an effective amount for use in methods for improving skin appearance such as by skin smoothening or treating other skin disorders and diseases associated with skin aging.

[0081] The compositions of the present invention incorporate the cationic peptide as described above at an effective amount for use in wound healing of skin, and / or for enhancing the restoration of skin after cosmetic and dermatological procedures. The compositions of the present invention can incorporate a peptide as described herein at a concentration effective for scarless wound healing of wounded skin.Attorney Docket No. 13720.0069P1

[0082] In another example, the compositions of the present invention incorporate the cationic peptide as described above an effective amount for the treatment of aging vulvar and vaginal tissue.

[0083] In another example, the compositions of the present invention incorporate the cationic peptide as described above an effective amount for treating symptoms, disorders and diseases of the vulvar and the vaginal tissue which can be associated with vulvovaginal atrophy.

[0084] In yet another example, the compositions of the present invention incorporate the cationic peptide as described above at an effective amount for treating vulvodynia.

[0085] In yet another example, the compositions of the present invention incorporate the cationic peptide as described above at an effective amount for treating lichen sclerosus.

[0086] The compositions of the present invention incorporate peptide as described above at an effective amount for treating other conditions, disorders and diseases of skin and mucosa in humans associated with changes in extracellular matrix components, including but not limited to the treatment of atrophy of any human tissue.

[0087] For example, the compositions of the invention contain the peptide at a concentration between 0.1 to 100 micrograms per mL of composition orO.l to 15 micrograms per mL of composition or I to 10 micrograms per mL of composition. Such concentrations may be for topical, subcutaneous, or intramuscular formulations. In other embodiments, to account for transdermal delivery in a topical composition, the compositions of the invention contain the peptide at a concentration sufficient to deliver a local concentration between 0.1 to 100 micrograms per mL of composition or 0.1 to 15 micrograms per m L of composition or 1 to 10 micrograms per mL of composition.

[0088] One or more additional ingredients, including one or more additional substances (eg., acceptable carriers and / or excipients) suitable for topical application can also preferably be used in these compositions. The one or more additional ingredients may also include additional substances with biological activities (i.e., biologically active agents),

[0089] The compositions can be an aerosol, emulsion, liquid, lotion, cream, paste, ointment, foam, patch, microneedle device or any other cosmetic, dermatological and pharmaceutically acceptable formulation or device. Generally, an acceptable formulation forAttorney Docket No. 13720.0069P1cosmetic, dermatological, and / or pharmaceutically use would include any acceptable earner, excipient, and / or substance suitable for use on human skin or mucosa. The compositions may also contain one or more other biologically active agents including, but not limited to, retinoids, growth factors, and / or other peptides.

[0090] Any of the compositions of the present invention may also be used in combination with other cosmetic, skin care, feminine, hygiene, dermatological, pharmaceutical products, and / or medical devices.

[0091] Steroids are known to cause skin thinning Thus, the presently described peptides can be used in combination with steroid therapies to counter-act the skin-thinning. In some embodiment, the composition with an effective amount peptide as described above may further comprise an anti-inflammatory steroid used in topical and subcutaneous injection formulations. Such steroids can be hydrocortisone, clobetasone, betamethasone, fluticasone, mometasone, beclometasone, clobetasol, amcinonide, desoxi metasone, fluocinonide, or halcinonide:

[0092] The invention also provides methods of reducing scarring of skin damaged by normal aging, di sease, injury, trauma, or by surgery or other medical or cosmetic procedures Such methods can involve administering to the wound of a human a composition, wherein the composition contains any of the above-described peptides, singularly or in combination. The compositions may also be used in combination with other therapeutic agents, for example, such as tissue grafts, tissue culture products, oxygen or dressings.

[0093] The compositions of the invention can be used in humans. Alternatively, the composition may also be used in any kind of animal, preferably in mammals, and more preferably in cows, horses, cats, dogs, pigs, goats, or sheep. In an embodiment, the human patient is at least 35, 40, 45, or 50 years of age or the human patient is at least 60 years of age. The human patient can have sun-damaged skin or damaged skin from chemotherapy.

[0094] Skin Aging

[0095] " Signs of skin aging" include, but are not limited to, all outward visibly and tactilely perceptible manifestations as well as any other macro or micro effects due to skin aging. Such signs may be induced or caused by intrinsic factors (showing as chronological aged skin) or extrinsic factors (showing as environmental skin damage including but not limited photo-aged skinAttorney Docket No. 13720.0069P1or damaged skin caused by long term use corticosteroids, chemotherapy, or excessive, prolonged alcohol use or illicit drug use). These signs may result from processes which include, but are not limited to, the development of textural discontinuities such as wrinkles and coarse deep wrinkles, fine or skin lines, crevices, bumps, large pores (e.g., associated with adnexal structures such as sweat gland ducts, sebaceous glands, or hair follicles), or unevenness or roughness, loss of skin elasticity (loss and / or inactivation of functional skin elastin), sagging (including puffiness in the eye area and jowls), loss of skin firmness, loss of skin tightness, loss of skin recoil from deformation, discoloration (including under eye circles), blotching, sallowness, hyperpigmented skin regions such as age spots and freckles, keratoses, abnormal differentiation, hyperkeratinization, elastosis, collagen breakdown, and other histological changes in the stratum corneum, dermis, epidermis, the skin vascular system (e.g., telangiectasia or spider vessels), and underlying tissues, especially those proximate to the skin. In an embodiment, the human patient is at least 35, 40, 45, or 50 years of age or the human patient is at least 60 years of age.

[0096] As used herein, prophylactically regulating a skin condition includes delaying, minimizing and / or preventing visible and / or tactile discontinuities in skin (e.g., texture irregularities in the skin which may be detected visually or by feel), including signs of skin aging As used herein, therapeutically regulating skin condition includes ameliorating, e.g., diminishing, minimizing and / or effacing, discontinuities in skin, including signs of skin aging. Some of the compositions of the present invention may be used for prophylactically and / or therapeutically regulating a skin condition.

[0097] Some of the compositions and methods of the present invention are useful for improving skin appearance and / or feel. For example, some preferred compositions and methods of the present invention are useful for regulating the appearance of skin condition by providing a visual improvement in skin appearance following application of the composition to the skin over a period of time such as weeks or months. In embodiments, the composition is applied to the skin of a subject that is at least 35, 45, 50, 55, or 60 years of age over a period of time of weeks or months.

[0098] Assessing Efficacy

[0099] Prevention, amelioration, and / or treating of the signs of skin aging, protection and / or improving skin condition, and the prevention and / or treatment of skin imperfections areAttorney Docket No. 13720.0069P1functional features which can be visualized, analyzed, measured and quantified using many techniques known by the specialist in cosmetic or skin rejuvenation treatments. Decrease of fine lines, wrinkles, skin folds, and of skin roughness can be quantified either directly on the person contact-free using fringe projection (FOITS™ Fast Optical In vivo Topometry System, DermatopTM or PrimosTM system), or by silicon replicas of the skin area which are then analyzed by the technique called "drop shadows" or by a FOITS system, or by a Canfield VISIATM device. Changes in volume and shape of the face can be quantified using a relief obtaining system without contact using a fringe projection FOITS system. Alteration of the skin barrier can be quantified by measuring transepidermal water loss (TEWL.) using a TewameterTM, a VapometerTM, a Dermalab TM, and / or an AquafluxTM device. Loss of firmness and / or elasticity and / or tone and fatigue of the skin can be quantified using a CutometerTM, a Reviscometer TM, an Aeroflexmeter TM, a DynaskinTM, a BallistometerTM, a TwistometerTM and / or a DermalabTM device. Dull complexion, loss of uniformity of skin tone, pigmentation changes (hypo and hyper pigmentation), local reddening, loss of clarity and brightness of the complexion, pigmentation spots, rosacea, dark circles are directly measurable using a MexameterTM, a ChromameterTM, a ColormeterTM, a Canfield VISIATM, a Canfield VISIA-CRTM, a SIAscopeTM, a GonioluxTM or a confocal laser microscope device, and / or by specific color analysis on photo (enabled by the technique of photographing in polarized crossed and parallel light). The number and size of facial pores can be quantified by the silicon replica technology described above, or by specific analysis on photo (enabled by using a video microscope or a macroscopic photographing system) Atrophy and thinning of the skin, epidermis, dermis, or hypodermis (e.g., in case of studying slimming agents) is measurable by measuring TEWL (e.g., in case of studying the epidermis), or by an ultrasound echographic device, and / or a confocal laser microscope device. Density of skin fibers can be quantified by ultrasound and then by image analysis. Cellulite is quantified either directly by a relief obtaining system without contact using fringe projection (FOITS) or indirectly by measuring the length of the dermo-hypodermal junction by an ultrasound echographic device. Stretch marks are either directly quantified using a relief obtaining system without contact using fringe projection (FOITS) or by the silicon replica technology. Skin softness is directly measurable by techniques of friction study as with a frictiometer device or indirectly by the silicon replica technology. Changes in collagen, extracellular matrix components, and / or in connective tissue fibers may be quantified by histology, confocal laser microscopy, UV spectroscopy, SIAscope,Attorney Docket No. 13720.0069P1and / or by multiphoton spectroscopy All changes visible to the eye (including but not limited to fine lines, wrinkles, folds, texture, sagging, loss of elasticity color, tone, pigmentation, redness) can be quantified in direct or on photography, by a trained judge person or not, with or without visual scoring system (e.g., using a 4- point severity scale.)

[0100] Cosmetic Composition and Medicament

[0101] The terms "cosmetic composition" and "cosmetic product" are used interchangeably herein relate formulations that can be used for cosmetic purposes or purposes of hygiene or as a basis for delivery of one or more cosmetic and / or pharmaceutical substances, products, and / or ingredients.

[0102] The terms "pharmaceutical composition" and "medicament" is used herein to refer to a formulation that can be used for medical purposes or as a basis for delivery of one or more cosmetic and / or pharmaceutical substances, products, and / or ingredients.

[0103] It is possible that any of the formulations, compositions, medicaments, and / or products described herein can be used for two or more of these same purposes at one time.

[0104] Preferably, the compositions described herein are suitable for topical or subcutaneous administration Topical refers to on top of skin surface or on top of a mucosal surface. As used herein, topical application includes, but is not limited to, cutaneous; ocular; mucosal; buccal, vaginal; vulvar administration; administration onto skin, scar, keloid, scalp, eye, mouth, nose, vulva, vagina, rectum; and / or administration into a wound, ulcer, and granulation tissue

[0105] The compositions may be suitable for administration to hair, and onto finger or toenails. Alternatively, the compositions may be suitable for subcutaneous administration

[0106] Cosmetic Product

[0107] A "cosmetic product," as used herein, include without limitation, personal care product, skin product, skin cream, skin gel, skin ointment, skin lotion, anti -aging product, skin rejuvenation product, skin conditioner, moisturizer, feminine product, hygiene product, skin patch, skin mask, tissue wipe, lipstick, mascara, rouge, foundation, blush, eyeliner, lip liner, lip gloss, lip balm, facial or body powder, sunscreens, sunblocks, nail polish, mousse, sprays, styling gels, nail conditioner, bath and shower gels, shampoos, conditioners, cream rinses, hair sprays, hair dyes andAttorney Docket No. 13720.0069P1coloring products, soaps, body scrubs, exfoliants, astringents, depilatories and permanent waving solutions, antidandruff formulations, anti-sweat and antiperspirant compositions, shaving, preshaving and after shaving products, leave-on conditioners, deodorants, cold creams, deodorants, cleansers, rinses, vulvar product, vaginal product, or the like; whether in the form of creams, lotions, gels, ointments, macro-emulsions, micro-emulsions, nano-emulsions, serums, balms, colloids, solutions, liquids, suspensions, dispersions, compacts, solids, powders, pencils, spray-on formulations, brush-on formulations, patches, iontophoretic patches, microprojection patches, microneedle patches, skin delivery enhancing systems, bandage, tissue cloths, wipes, masks, aerosols, pastes, soap bars, cosmetic devices, and / or any other forms readily known to those skilled in the art.

[0108] Medicament

[0109] A "medicament," as used herein, include without limitation pharmaceutical preparations, carriers for dermatological purposes, including topical and transdermal application of pharmaceutical ingredients. These can be in the form of creams, lotions, gels, ointments, macro¬ emulsions, micro-emulsions, nano-emulsions, serums, balms, colloids, solutions, liquids, suspensions, dispersions, compacts, solids, powders, pencils, spray-on formulations, brush-on formulations, patches, iontophoretic patches, microprojection patches, microneedle patches, skin delivery enhancing systems, bandages, tissue cloths, wipes, masks, aerosols, pastes, soap bars, medical devices, and / or any other forms readily known to those skilled in the art.

[0110] Suitability for Topical Application

[0111] The term "acceptable substance(s) for topical application", as used herein, mean that the composition(s) comprising "acceptable substance(s) for topical application" according to the invention are suitable for use in contact with human skin and / or human mucosa; where the skin or the mucosa can be healthy, newborn, young, old, aged, appear visually different than normal, damaged, photo-damaged, sunburned, wrinkled, pathologic, diseased, wounded, atrophic, irritated, compromised, treated with cosmetic product(s), treated with pharmaceutical product / s), treated with cosmetic procedure(s), treated with dermatological procedure(s), treated with a pharmaceutical or medical device(s), surgically treated, etc. and are absent of significant (consumer-unacceptable) local intolerabilities to skin or mucosa (i.e., corrosivity, irritation, allergy), and the like after repeated topical application for cosmetic, skin care, feminine, or similarAttorney Docket No. 13720.0069P1uses; or with maximally low and acceptable (consumer-acceptable) local intolerabilities to skin or mucosa skin irritation (i.e., irritation, allergy), and the like after repeated topical application for medical uses of the composition.

[0112] Local tolerability (e.g., irritation and allergy to skin; also called contact dermatitis and allergy) in humans can be determined by acute (1 day) and repetitive (4 to 21 days) patch testing on the back of humans, and / or during in use tests where the composition is used as indicated (e g, for topical use on face, vulva, vagina, mucosal surface, and / or other body surface areas; or for wound healing). In case of a medication, safety studies generally also include animal studies.

[0113] Furthermore, acceptable substance(s) for topical application means that the compositions comprising "acceptable substance(s) for topical application" in accordance with the present invention are without significant physicochemical instability (e.g., significant changes in color, odor, viscosity, pH, and / or appearance) in the final packaging (e.g., bottle, tube, pump, jar, airless container, spray, patch, etc.) during the shelf-life of the product according to the recommended storage conditions of the product. Significant physicochemical instability means, that the color, odor, viscosity, pH, or the appearance changed (increased, decreased) more than 10% from the time when the composition was prepared and filled into the final packaging.

[0114] Any of the compositions of the present invention may also provide good aesthetics and be cosmetically elegant.

[0115] Acceptable substances for topical application or administration may include suitable excipients and / or earners known in the art.

[0116] Additional Substances

[0117] The compositions described herein comprise the cationic peptide as described above, optionally in combination with at least one additional substance suitable for topical application and / or subcutaneous application. Additional substance(s) can be inert (e g., carriers and / or excipients) or can be with biological activities (i.e., biologically active agents and / or active pharmaceutical ingredient).

[0118] Preferably, the compositions of the invention may also include additional biological active agents, including, but not limited to, anti-inflammatory steroids or botulinum toxin,Attorney Docket No. 13720.0069P1complexed or non-complexed, type A, B, C, D, E, F, G, or H. In embodiments, toxin is type A In embodiments, toxin is type A and 150 kD (non-complexed).

[0119] The terms "substance", "ingredient", "agent" and the like are used interchangeably herein.

[0120] In particular examples, the compositions of the present invention may contain a wide range of additional ingredients. The 2012 International Cosmetic Ingredient Dictionary & Handbook, 14th Edition, as well as the Cosmetic Bench Reference - Directory of Cosmetic Ingredients (published by Cosmetics & Toiletries) describes a wide variety of non-limiting cosmetic and pharmaceutical ingredients commonly used in the skin care, personal care, feminine care, and dermatology and pharmaceutical industry, which are available for use in the present invention.

[0121] Additional examples can be found in the books provided by the United States Pharmacopeia (USP), the National Formulary (NF), and other references for cosmetic and pharmaceutical ingredients known in the art. Each of these references is herein incorporated by reference in its entirety. This information is regularly updated by the addition of new ingredients.

[0122] Exemplary functional classes of such ingredients are, but are not limited to, abrasive agent, absorbent powder, absorption base, acidulent, activator, adhesion promoter, agent modulating cell differentiation, agent modulating cell proliferation, agent stimulating synthesis of dermal or epidermal macromolecules, agent preventing degradation of dermal or epidermal macromolecules, agent acting on microcirculation, agent acting on skin barrier, agent acting on energy metabolism of cells, agent increasing the substantivity, antimicrobial sequestering agent, analgesic agent, anesthetic agent, antacid agent, anti-acne agent, anti-aging agent, anti-wrinkle agent, anti-atrophy agent, anti- androgen agent, anti-bacterial agent, anti-scar agent, anti- seborrheic agent, anti-cracking agent, anti- cellulite agent, anti-stretch mark agent anti-dandruff agent, anti-foam agent, anti-fungal agent, antihistamine agent, anti-inflammatory agent, antiirritant agent, anti-microbial agent, anti-mite agents, antibiotic agent, antiviral agent, antioxidant agent, anti-glycation agent, anti-neoplastic agent, anticancer agent, anti-skin cancer agent, antieczema agent, anti-psoriasis agent, antipollution agent, antiperspirant agent, anti-pruriginous agent, anti-pruritic agent, antiseptic agent, antistat agent, astringent, a-adrenergic receptor agonist, barrier agent, binding agent, bio-adhesive agents, botanical agent, botanical extract, biologicalAttorney Docket No. 13720.0069P1additive, buffer agent, bulking agent, calcium sequestering agent, calming agent, carrier agent, chemical additive, cell lysate, cell culture medium, conditioned cell culture medium, chelating agent, circulatory stimulant agent, cleansing agent, collagen stimulating agent, co-emulsifier agent, colorant, conditioning agent, controlled release agent, cooling agent, co- solvent, coupling agent, curative agent, denaturant, deodorant agent, depilatory agent, desquamating agent, detangler agent, detergent, disinfectant, dispersant, dye stabilizer, dermatologically acceptable carrier, elastin stimulating agent, extracellular matrix stimulating agent, emollient, emulsifier, emulsion stabilizer, enzyme, enzymatic inhibitor, enzyme-inducing agent, coenzyme, cofactor, essential oil, exfoliant, fat soluble agent, fiber, film former, fixative, flavor, foam booster, foam stabilizer, foaming agent, fragrance, free radicals scavenger, fungicide, gellant, glosser, hair bleaching agent, hair growth promoter, hair colorant, hair conditioning agent, hair-set polymer, hormone, hormone-like agent, humectant, hydrophobic agent, hydrotropic agents intermediate agent, hyaluronic acid stimulating agent, keratolytic agent, lathering agent, lipolytic agent, lubricant, make-up agent, moisture barrier agent, moisturizer, muco-adhesive agents, muscle relaxant, natural moisturizing factor, neutralizer, odor-masking agent, oil, oil absorbent agent, ointment base, opacifier, organosilicone, oxidant, oxygen carrier, pearlant agent, perfume, perfume solvent, perfume stabilizer, peroxide stabilizer, pharmaceutical drug, photo-sensitizer agent, pigment, pigmenting agent, pearlescent aid, plant extract, plant derivative, plant tissue extract, plant root extract, plant seed extract, plant oil, plasticizer, polish agent, polymer, polymer film former, powder, preservative agent, propellant, peptide agent, protein agent, reducing agent, refatting agent, regenerator, resin, rosacea inhibitory agent, scar prevention agent, scalp agent, scrub agent, sabostatic agent, sequestrant, sex hormone, sex stimulating agent, silicone agent, silicone replacement agent, skin barrier agent, skin barrier restoration agent, skin calming agent, skin clarifier, skin cleanser, skin conditioning agent, skin exfoliating agent, skin peeling agent, skin healing agent, skin lipid, skin lightening agent, skin bleaching agent, skin protectant agent, skin purifier agent, skin smoothing agent, skin calming agent, skin soothing agent, skin sensate, skin treatment agent, skin penetration enhancing agent, skin penetration retarding agent, mucosa penetration enhancing agent, solubilizer, solvent, suspending agent, sun protection factor booster, soothing agent, spreading agent, stabilizer, stimulant agent, slimming agent, sunless tanning agent, sunscreen, sunscreen UVA, sunscreen UVB, broad-band sunscreen, super-fatting agent, surfactant, amphoteric surfactant, anionic surfactant, cationic surfactant, non-ionic surfactant, siliconeAttorney Docket No. 13720.0069P1surfactant, suspending agent, sweetener, tanning accelerator, thickening agent, thixotrope, tightening agent, toner, tonic agent, topical delivery system, vasoconstrictor agent, vulvar soothing agent, vaginal soothing agent, vegetable oil, volatile agent, viscosity stabilizer, vitamin, vaccine, water proofing agent, water-soluble agent, water-proofing agent, wax, wetting agent, whitening agent, wound healing agent, and / or the like.

[0123] Preferably, the additional ingredients should be suitable for use in contact with human keratinous tissue (hair, nails, skin, lips, external vulva (mons pubis, labia majora, labia minora)) and / or non-keratinous tissue (vagina, introitus, inner vulva (vulvar vestibule, clitoris), mouth, anus, etc.), without undue systemic toxicity local intolerability, and chemical instability.

[0124] In most instances, the additional substances will include a cosmetic, dermatologically, and / or pharmaceutically acceptable carrier either alone or in combination with still other additional (e.g., inert and / or biologically active) ingredients. The total amounts of additional ingredients may range from about 90% to about 99.9999%, preferably from about 98% to about 99.999%, and more preferably from about 99% to about 99.99% by weight of the composition. In short, it is the balance of the composition. If carriers (either singularly, such as water, or complex co-solvents) are used, they may make up the entire balance of the compositions.

[0125] Non-limiting examples of additional ingredients for some of the functional classes listed above are provided herein. Additional examples of additional ingredients can be found in The International Cosmetic Ingredient Dictionary and Handbook, the Cosmetic Bench Reference - Directory of Cosmetic Ingredients, the books provided by the United States Pharmacopeia (USP) and the National Formulary (NF), and other references for cosmetic and pharmaceutical ingredients known (and commonly used) in the art.

[0126] Ascorbates and other vitamins

[0127] The compositions of the present invention may contain one or more vitamins, such as ascorbates (e.g., vitamin C, vitamin C derivatives, ascorbic acid, ascorbyl glucoside, ascorbyl palmitate, magnesium ascorbyl phosphate, sodium ascorbyl phosphate, tetrahexadecyl ascorbate, ascorbyl 3-aminopropyl phosphate), vitamin B, vitamin B derivatives, vitamin Bl to vitamin B 12 and theirs derivatives, vitamin K, vitamin K derivatives, vitamin H, vitamin D, vitamin D3, vitamin D derivatives, vitamin E, vitamin E derivatives, and pro-vitamins thereof, such aspanthenol and mixtures thereof. The vitamin compounds may be included as the substantiallyAttorney Docket No. 13720.0069P1pure material, or as an extract obtained by suitable physical and / or chemical isolation from natural (e g, plant) sources. In one example, when vitamin compounds are present in the compositions of the instant invention, the compositions contain from about 0.0001% to about 25%, more preferably from about 0.001% to about 10%, still more preferably from about 0.01% to about 5%, and still more preferably from about 0.1% to about 1%, by weight of the composition, of the vitamin compound. The exact content (%) of ascorbates and other vitamins to be used in the compositions will depend on the particular ascorbate and vitamin utilized since such agents vary widely in potency.

[0128] Sunscreen actives

[0129] The compositions of the subject invention may optionally contain a sunscreen active.

[0130] As used herein, "sunscreen active" includes both sunscreen agents and physical sunblocks. Suitable sunscreen actives may be organic or inorganic. A wide variety of conventional organic or inorganic sunscreen actives are suitable for use herein. In one example, the composition contains from about 0.1 % to about 25%, more typically from about 0.5% to about 10% by weight of the composition, of the sunscreen active. Exact amounts will vary depending upon the sunscreen chosen and the desired Sun Protection Factor (SPF). The organic UV-screening agents which are more particularly preferred are chosen from the following compounds: ethylhexyl salicylate, butyl methoxydibenzoylmethane, ethylhexyl methoxycinnamate, octocrylene, phenylbenzimidazole sulphonic acid, terephthalylidene dicamphor sulphonic, benzophenone-3, benzophenone-4, benzophenone-5,4-methylbenzylidene camphor, benzimidazilate, anisotri azine, Ethylhexyl triazone, diethylhexyl butamido triazone, methylene bis-benzotriazolyl tetramethyl butyl phenol, drometrizole trisiloxane, and mixtures thereof.

[0131] The inorganic sunscreen agents which may be used in the composition according to the invention are in particular nanopigments (mean size of the primary particles: generally between 5 nm and 100 nm, preferably between 10 nm and 50 nm; or their aggregates) of coated or uncoated metal oxides such as for example nanopigments of titanium oxide (amorphous or crystallized in the form of rutile and / or anatase), iron, zinc, zirconium or cerium oxides and mixtures thereof. Coating agents are moreover alumina and / or aluminum stearate, and silicones

[0132] Anti -wrinkle actives and anti-atrophy activesAttorney Docket No. 13720.0069P1

[0133] The compositions of the present invention can contain a one or more anti- wrinkle actives or anti-atrophy actives. Exemplary anti-wrinkle / anti-atrophy actives suitable for use in the compositions of the present invention include amino acids, N-acetyl derivatives of amino acids (e.g, N-acetyl-cysteine), estradiol, estriol, hydroxy acids (e.g., alpha-hydroxy acids such as lactic acid and glycolic acid or beta-hydroxy acids such as salicylic acid and salicylic acid derivatives such as the octanoyl derivative, lactobionic acid), keto acids (e.g., pyruvic acid), phytic acid, ascorbic acid (vitamin C), retinoids (e.g., retinoic acid, tretinoin, isotretinoin, adapalene, retinol, retinylaldehyde, retinylpalmitate, and other retinoid derivatives), kinetin (N6-furfuryladenine), zeatin and their derivatives (e.g., furfuryl ami no- tetrahydropyranyladenine), niacinamide (nicotinamide); growth factors and cytokines (e.g., TGF-beta 1, 2 and 3, EGF, FGF-2, PDGF, IL-1, IL-6, IL-8, IGF-1, IGF-2, etc.), cell lysates (e.g., dermal fibroblast cell lysate, stem cell lysate, processed skin cell proteins (PSP®), etc ), conditioned cell culture mediums (e.g, conditioned cell culture medium from dermal fibroblasts, conditioned cell culture medium from stem cells (e.g., epidermal stem cells, adipose stem cells, mesenchymal stem cells, etc.); cosmetic ingredients marketed under the trade names Nouricel-MD®, TNS®, or CCM™ Complex; etc.); cell extracts, stem cell extracts, components from stem cells,; ingredients stimulating epidermal or other human adult stem cells; skin conditioning agents, stilbenes, cinnamates, ingredients activating sirtuin 1 (e.g, resveratrol); ingredients improving the functioning of the mitochondria, dimethylaminoethanol, synthetic anti-aging peptides, peptides from natural sources (e.g., soy peptides), and salts of sugar acids (e.g., Mn gluconate, Zn gluconate), lipoic acid; lysophosphatidic acid, vitamin B3 compounds, and other vitamin B compounds (e.g., thiamine (vitamin Bl), pantothenic acid (vitamin B5), riboflavin (vitamin B2), and their derivatives and salts (e.g., HCI salts or calcium salts).

[0134] When anti-wrinkle / anti-atrophy compounds are present in the compositions of the instant invention, the compositions comprise from about 0.0001% to about 25%, more preferably from about 0.001% to about 10%, still more preferably from about 0.01% to about 5%, and still more preferably from about 0.1 % to about 1 %, by weight of the composition, of the anti- wrinkle / anti- atrophy compound. The exact content (%) of anti-wrinkle / anti-atrophy agents to be used in the compositions will depend on the particular anti-wrinkle / anti-atrophy agent utilized since such agents vary widely in potency.Attorney Docket No. 13720.0069P1

[0135] In embodiments, a composition comprises an effective amount of a positively charged peptide and an effective amount of a retinoid (e.g., retinoic acid, tretinoin, isotretinoin, adapalene, retinol, retinylaldehyde, retinylpalmitate, and other retinoid derivatives) to treat symptoms of skin aging, and a pharmaceutically acceptable carrier.

[0136] In embodiments, a composition comprises an effective amount of a positively charged peptide and an effective amount of estriol and / or estradiol to treat symptoms of skin or mucosal aging, and a pharmaceutically acceptable carrier. The estriol may be present in an amount between about 0.01% to about 3.0% w / w of the composition. The estradiol may be present in an amount between about 0.005% w / w and about 1.0% w / w of the composition.

[0137] Humectants, moisturizers, and conditioning agents

[0138] The compositions of the present invention can contain a safe and effective amount of a conditioning agent selected from, for example, humectants, moisturizers, and skin conditioners, A variety of these materials can be employed and can be present at a level of from about 0.01% to about 80%, more preferably from about 0.1% to about 25%, and still more preferably from about 05% to about. 10%, by weight of the composition. The exact content (%) of humectants, moisturizers, and conditioning agents to be used in the compositions will depend on the humectant, moisturizer, and conditioning agent utilized since such agents vary widely in potency.

[0139] Humectants are ingredients that help maintain moisture levels in skin. Humectants can be selected from the group consisting of polyhydric alcohols, water soluble alkoxylated nonionic polymers, and mixtures thereof Polyhydric alcohols useful herein include polyhydroxy alcohols aforementioned and glycerin, hexylene glycol, ethoxylated glucose, 1,2-hexane diol, dipropylene glycol, trehalose, diglycerin, maltitol, maltose, glucose, fructose, sodium chondroitin sulfate, sodium hyaluronate, sodium adenosine phosphate, sodium lactate, pyrrolidone carbonate, glucosamine, cyclodextrin, and mixtures thereof Water soluble alkoxylated nonionic polymers useful herein include polyethylene glycols and polypropylene glycols having a molecular weight of up to about 1000 such as those with CTFA names PEG-200, PEG-400, PEG-600, PEG- 1000, and mixtures thereof. Additional humectants include acetyl arginine, algae extract, aloe barbadensis leaf extract, 2,3-butanediol, chitosan lauroyl glycinate, diglycereth-7 malate, diglycerin, diglycol guanidine succinate, erythritol, fructose, glucose, glycerin, honey, hydrolyzedAttorney Docket No. 13720.0069P1proteins, hydroxypropyltrimonium hyaluronate, inositol, lactitol, maltitol, maltose, mannitol, mannose, methoxy polyethylene glycol, myristamidobutyl guanidine acetate, polyglyceryl sorbitol, potassium pyrollidone carboxylic acid (PCA), propylene glycol, butylene glycol, sodium pyrollidone carboxylic acid (PCA), sorbitol, sucrose, dextran sulfate (i.e., of any molecular weight), natural moisturizing factors, and / or urea.

[0140] Skin conditioners can include, but are not limited to, guanidine, urea, glycolic acid, glycolate salts (e.g., ammonium and quaternary alkyl ammonium), salicylic acid, lactic acid, lactate salts (e.g., ammonium and quaternary alkyl ammonium), aloe vera in any of its variety of forms (e.g., aloe vera gel), polyhydroxy alcohols such as sorbitol, mannitol, xylitol, erythritol, hexanetriol, butanetriol, propylene glycol, butylene glycol, hexylene glycol and the like, polyethylene glycols, propoxylated glycerols, sugars (e.g., melibiose), starches, sugar and starch derivatives (e.g., alkoxy lated glucose, fructose, glucosamine), C1-C30 monoesters and polyesters of sugars and related materials, hyaluronic acid, lactamide monoethanolamine, acetamide monoethanol amine, panthenol, dexpanthenol, allantoin, and mixtures thereof. Skin conditioners can also include fatty acids, fatty acid esters, lipids, ceramides, cholesterol, cholesterol esters, bee wax, petrolatum, and mineral oil.

[0141] Emollients

[0142] One or more emollients may also be included in the topical compositions described herein. An emollient generally refers to an ingredient that can help skin maintain a soft, smooth, and pliable appearance. Emollients typically remain on the skin surface, or in the stratum corneum, and act as a moisturizer, or lubricant and reduce flaking. Some examples of emollients include acetyl arginine, acetylated lanolin, algae extract, apricot kernel oil polyethylene gly col-6 esters, avocado oil polyethylene glycol- 11 esters, bis-polyethylene glycol-4 dimethicone, butoxy ethyl stearate, glycol esters, alkyl lactates, caprylyl glycol, cetyl esters, cetyl laurate, coconut oil polyethylene glycol- 10 esters, alkyl tartrates, diethyl sebacate, dihydrocholesteryl butyrate, dimethiconol, dimyristyl tartrate, disteareth-5 lauroyl glutamate, ethyl avocadate, ethylhexyl myristate, glyceryl isostearates, glyceryl oleate, hexyldecyl stearate, hexyl isostearate, hydrogenated palm glycerides, hydrogenated soy glycerides, hydrogenated tallow glycerides, isostearyl neopentanoate, isostearyl palmitate, isotridecyl isononanoate, laureth-2 acetate, lauryl polyglyceryl-6 cetearyl glycol ether, methyl gluceth-20 benzoate, mineral oil, palm oil, coconutAttorney Docket No. 13720.0069P1oil, myreth-3 palmitate, octyldecanol, octyldodecanol, odontella aurita oil, 2-oleamido-l,3 octadecanediol, palm glycerides, polyethylene glycol avocado glycerides, polyethylene glycol castor oil, polyethylene glycol-22 / dodecyl glycol copolymer, polyethylene glycol shea butter glycerides, phytol, raffinose, steatyl citrate, sunflower seed oil glycerides, petrolatum, silicon oils including but not limited to caprylyl methicone, and / or tocopheryl glucoside.

[0143] Antioxidants, and radical scavengers

[0144] The compositions of the present invention may include an antioxidant / radical scavenger. In one example, the composition contains from about 0.001% to about 25%, more preferably from about 0.01% to about 10%, and still more preferably from about 0.1 % to about 5% of an antioxidant / radical scavenger by weight of the composition. The exact content (%) of antioxidant / radical scavengers to be used in the compositions will depend on the particular antioxidant / radical scavenger utilized since such agents vary widely in potency.

[0145] Anti -oxi dants / radi cal scavengers may include but are not limited to ascorbic acid (vitamin C) and its salts, ascorbyl esters of fatty acids, and other ascorbic acid derivatives (e.g., magnesium ascorbyl phosphate, sodium ascorbyl phosphate, ascorbyl sorbate, ascorbyl palmitate, tetrahexyldecyl ascorbate, etc.), tocopherol (vitamin E), tocopherol sorbate, tocopherol acetate, other esters of tocopherol, beta-carotene, butylated hydroxy benzoic acids and their salts, ferulic acid, peroxides including hydrogen peroxide, perborate, thioglycolates, persulfate salts, 6- hydroxy-2,5,7,8- tetramethylchroman-2 -carboxylic acid (commercially available under the trade name Trolox™), gallic acid and its alkyl esters, especially propyl gallate, uric acid and its salts and alkyl esters, amines (e.g., N, N-diethylhydroxylamine, amino-guanidine), nordihydroguaiaretic acid, bioflavonoids, sulfhydryl compounds (e.g., glutathione), dihydroxy fumaric acid and its salts, lysine pidolate, arginine pidolate, amino acids, silymarin, lysine, 1 -methionine, proline, superoxide dismutase, sorbic acids and its salts, lipoic acid, olive extracts, tea extracts, resveratrol, polyphenols such as proanthocyanidine from pine bark, carotenoids, curcumin compounds such as tetrahydrocurcumin, coenzyme Q10, OCT A (L -2- oxo-4-thiazolidine carboxylic acid), selenium, creatine, glutathione, N-acetyl cysteine, N-acetyl cysteine esters, dimethylmethoxy chromanol, lipoic acid, melanin; plant extracts containing polyphenols including but not limited to coffee berry extracts, green tea extracts, rosemary extracts, witch hazel extracts, and grape skin / seed extracts, may be used. Preferred antioxidants / radical scavengers can be selected from esters of ascorbicAttorney Docket No. 13720.0069P1acid, tocopherol, ferulic acid, polyphenols, creatine, and their derivatives; as well as plant extracts containing polyphenols such as green tea extract,

[0146] Rosacea inhibitory agents and X-adrenergic receptor agonists

[0147] Rosacea inhibitory agents, include but are not limited to, metronidazole, sulfacetamide, sodium sulfacetamide, sulfur, dapson, doxycycline, minocycline, clindamycin, clindamycin phosphate, erythromycin, tetracyl clines, azelaic acid, calcium dobesilate, maleic acid, and any compatible combinations thereof), a-adrenergic receptor agonists (e.g., clonidine, amphetamine, dextroamphetamine, apraclonidine, dipivefrin, a-methyldopa, oxymetazoline, oxymetazoline hydrochloride, methoxamine, metaraminol, medetomidine, dexmedetomidine, ethylnorepinephrine, guanfacine, guanabenz, phenylephrine, phenylephrine hydrochloride, ephedrine, epinine, epinephrine, ethylnorepinephrine, levarterenol, lofexidine, norepinephrine, norphenylephrine, norephedrine, phenylpropanolamine, pemoline, propylhexadrine, pseudoephedrine, methamphetamine, a-methylnorepinephrine, methylphenidate, mephentermine, midodrine, mivazerol, moxonidine, desglymidodrine, tetrahydrozoline, tetrahydrozoline hydrochloride, cirazoline, amidephrine, brimonidine, brimonidine tartrate, naphazoline, isoproterenol, xylazine, xylometazoline, and / or tizanidine), chemicals and botanical extracts with vasoconstrictor properties including, but not limited to, corticosteroids, ephedrine, pseudoephedrine, caffeine, and / or escin; ephedra, phedra sinica, hamamelis viginiana, hydrastis canadensis, lycopus virginicus, aspidosperma quebracho, cytisus scoparius, raphanus sativus linn (radish leave extracts), horse chestnut extracts, etc., as well as any compatible combinations thereof; and / or a nasal and / or sinus decongestant.

[0148] Skin lightening agents, and skin bleaching agents

[0149] The compositions of the present invention may contain a skin lightening agent.

[0150] Suitable skin lightening agents include, but are not limited to, ascorbic acid and derivatives thereof; kojic acid and derivatives thereof; resorcinol and derivatives thereof (including but not limited to 4- ethyl resorcinol, 4-butyl resorcinol, 4-hexyl resorcinol, 4-octyl resorcinol, 4- decyl resorcinol, 6- methyl resorcinol, 6-ethyl resorcinol, 6-butyl resorcinol, 6-hexyl resorcinol, 6-octyl resorcinol, 6- decyl resorcinol, 4-phenylethyl resorcinol), retinoic acid and derivatives thereof (e.g., retinol, retinyl palmitate), L-leucine and derivatives thereof (e.g., N-acyl derivatives of L-leucine, esters of L- leucine, etc.), glycine and derivatives thereof, disodium glycerophosphateAttorney Docket No. 13720.0069P1and derivatives thereof undecenoyl phenylalanine, arbutin and derivatives thereof (e g., dehydroxy arbutin), niacinamide and derivatives thereof, hydroquinone; mequinol, glabridin, aleosin, curcumin, genistein, ethyl linoleate, tranexaminic acid, azelaic acid, resveratrol and derivatives thereof (e.g., oxy es eratrol), N-acetyl glucosamine, 4-isopropylcetchol, 4-ethoxybenzaldehyde, 2-ethoxybenzaldehyde, 4- propoxybenzaldehyde, alpha-hydroxyacids (e.g., glycolic acid, lactic acid, etc.), salicylic acid, polyphenols, and / or various plant extracts, such as those from licorice, grape seed, mulberry, soy, green tea, and / or bear berry; and / or any ingredient or combination thereof.

[0151] When used, the compositions preferably contain from about 0.01% to about 15%, more preferably from about 0.1% to about 10%, also preferably from about 0.5% to about 5%, by weight of the composition, of a skin lightening agent. The exact content (%) of skin lightening agents to be used in the compositions will depend on the particular skin lightening agent utilized since such agents vary widely in potency.

[0152] Skin protectants

[0153] Suitable skin protectant agents for use in the compositions described herein include, for example, a compound that protects injured or exposed skin or mucous membrane surfaces from harmful or irritating external compounds. Representative examples include algae extract, allantoin, camellia sinensis leaf extract, cerebrosides, dimethicone, glucuronolactone, glycerin, kaolin, lanolin, malt extract, mineral oil, petrolatum, white petrolatum, potassium gluconate, colloidal oatmeal, calamine, cocoa butter, starch, zinc oxide, zinc carbonate, zinc acetate, and / or talc

[0154] Desquamation actives, keratolytic agents, and peeling agents

[0155] A desquamating keratolytic active may be added to the compositions of the present invention. In one example, the composition contains from about 0.01% to about 30%, preferably from about 0.1 % to about 10%, more preferably from about 0.5% to about 5%, by weight of the composition, of a desquamating / keratolytic active. The exact content (%) of desquamating / keratolytic agents to be used in the compositions will depend on the particular desquamating / keratolytic agent utilized since such agents vary widely in potency.

[0156] Examples of useful keratolytic and / or desquamating agents include urea, salicylic acid and alkyl derivatives thereof, saturated and unsaturated monocarboxylic acids, saturated andAttorney Docket No. 13720.0069P1unsaturated bicarboxylic acids, tricarboxylic acids, alpha hydroxyacids and beta hydroxyacids of monocarboxylic acids, alpha hydroxyacids and beta hydroxyacids of bicarboxylic acids, alpha hydroxyacids and beta hydroxyacids of tricarboxylic acids, ketoacids, alpha ketoacids, beta ketoacids, of the polycarboxylic acids, of the polyhydroxy monocarboxylic acids, of the polyhydroxy bicarboxylic acids, of the polyhydroxy tricarboxylic acids. Resorcinol and its low- molecular weight derivatives are other examples of useful keratolytic and / or desquamating agents.

[0157] Preferred keratolytic agents are selected from the group containing glycolic acid, tartaric acid, salicylic acid, citric acid, lactic acid, pyruvic acid, gluconic acid, glucuronic acid, malic acid, mandelic acid, oxalic acid, malonic acid, succinic acid, acetic acid, phenol, resorcinol, retinoic acid, adapalene, trichloroacetic acid, 5-fluoro uracil, azelaic acid. Keratolytic agents are also the salts, esters, possible cis- or trans- forms, racemic mixtures and / or the relative dextrorotatory or levorotatory forms of the above listed compounds. Such substances can be used singularly or in associations with each other.

[0158] Anti-inflammatory agents

[0159] An anti-inflammatory agent may be added to the compositions of the present invention. In one example, an anti-inflammatory agent is added at a level of from about 0.01 % to about 10%, preferably from about 0.5% to about 5%, by weight of the composition. The exact content (%) of anti-inflammatory agents to be used in the compositions will depend on the particular anti-inflammatory agent utilized since such agents vary widely in potency.

[0160] Steroidal anti-inflammatory agents can include, but are not limited to, corticosteroids such as hydrocortisone, hydroxyltriamcinolone, alpha-methyl dexamethasone, dexamethasone- phosphate, beclomethasone dipropionates, clobetasol valerate, desonide, desoxymethasone, desoxycorticosterone acetate, dexamethasone, dichlorisone, diflorasone diacetate, diflucortolone valerate, fluadrenolone, fluclorolone acetonide, fludrocortisone, flumethasone pivalate, fluosinolone acetonide, fluocinonide, flucortine butylesters, fluocortolone, fluprednidene (fluprednylidene) acetate, fluradrenolone, halcinonide, hydrocortisone acetate, hydrocortisone butyrate, methylprednisolone, triamcinolone acetonide, cortisone, cortodoxone, flucetonide, fludrocortisone, difluorosone diacetate, fluradrenolone, fludrocortisone, diflurosone diacetate, fluradrenolone acetonide, medrysone, amcinafel, amcinafide, betamethasone and the balance of its esters, chloroprednisone, chlorprednisone acetate, clocortelone, clescinolone,Attorney Docket No. 13720.0069P1dichlorisone, diflurprednate, flucloronide, flunisolide, fluoromethalone, fluperolone, fluprednisolone, hydrocortisone valerate, hydrocortisone cyclopentylpropionate, hydrocortamate, meprednisone, paramethasone, prednisolone, prednisone, beclomethasone dipropionate, trimcinolone, and mixtures thereof may be used. One of the preferred steroidal anti-inflammatory for use is hydrocortisone.

[0161] In addition, non-steroidal anti-inflammatory agents can be useful herein. The varieties of compounds encompassed by this group are well known to those skilled in the art Specific nonsteroidal anti-inflammatory agents that can be useful in the composition of the present invention include, but are not limited to, diclofenac, indomethacin, oxicams such as piroxicam, salicylates such as aspirin; acetic acid derivatives such as felbinac, fenamates such as etofenamate, flufenamic acid, mefenamic acid, meclofenamic acid, tolfenamic acid; propionic acid derivatives such as ibuprofen, naproxen, pyrazoles, and mixtures thereof. Mixtures of these non-steroidal anti¬ inflammatory' agents may also be employed, as well as the dermatologically acceptable salts and esters of these agents. For detailed disclosure of the chemical structure, synthesis, side effects, etc. of non-steroidal anti-inflammatory agents, one may refer to standard texts, including Anti-inflammatory and Anti-Rheumatic Drugs, K. D. Rainsford, Vol, I-I1I, CRC Press, Boca Raton, (1985), and Anti-inflammatory Agents, Chemistry and Pharmacology, 1, R. A. Scherrer, et al., Academic Press, New York (1974).

[0162] Finally, so-called "natural" anti-inflammatory agents are useful in methods of the present invention. Such agents may suitably be obtained as an extract by suitable physical and / or chemical isolation from natural sources (e.g., plants, fungi, by-products of microorganisms) or can be synthetically prepared. For example, candelilla wax, bisabolol (e.g., alpha bisabolol), aloe vera, plant sterols (e.g., phytosterol), kola extract, chamomile, red clover extract, sea whip extract, licorice extract, and tea extract may be used.

[0163] Anti-inflammatory agents useful herein include allantoin and compounds of the Licorice, including glycyrrhetic acid, glycyrrhizic acid, and derivatives thereof (e.g., salts and suitable esters). Additional anti-inflammatory agents include diosgenol, saponines, sapogenines, lignanes, triterpenes saponosides and genines.

[0164] Additional examples of anti-inflammatory agents can include anti-inflammatory interleukins (e.g., IL-lra, IL-10); anti-inflammatory fatty acids (e.g., linoleic acid, linolenic acid)Attorney Docket No. 13720.0069P1and their derivatives (e g., esters), isoprenylcysteine analogues (i.e., N-acetyl-S-farnesyl-L-cysteine), aromatic aldehydes with anti-inflammatory properties (e.g., 4-methoxy benzaldehyde, 4-ethoxy benzaldehyde, 4-butoxy benzaldehyde, 4-penthoxy benzaldehyde), as well as any compatible combinations thereof

[0165] Anti -acne actives

[0166] The compositions of the present invention can contain one or more anti-acne actives.

[0167] Examples of useful anti-acne actives include resorcinol, sulfur, erythromycin, salicylic acid, benzoyl peroxide, retinoic acid, tretinoin, alpha-hydroxy acids (e.g., glycolic acid, lactic acid), dehydroacetic acid and zinc. When anti-acne compounds are present in the compositions of the instant invention, the compositions contain from about 0.0001% to about 50%, more preferably from about 0.001 % to about 20%, still more preferably from about 0.01 % to about 10%, and still more preferably from about 0.1 % to about 5%, by weight of the composition, of the anti-acne compound. The exact content (%) of antiacne actives to be used in the compositions will depend on the particular antimicrobial, anti -bacterial and anti-acne active utilized since such agents vary widely in potency.

[0168] Antimicrobial, anti-bacterial and anti-fungal actives

[0169] The compositions of the present invention can contain one or more anti-fungal or anti-microbial actives. A safe and effective amount of an antimicrobial or antifungal active can be added to the present compositions. For example, the composition contains from about 0.001 % to about 10%, preferably from about 0.01% to about 5%, and more preferably from about 0.05% to about 2%, by weight of the composition, of an antimicrobial or antifungal active. The exact content (%) of antimicrobial, anti-bacterial and anti-fungal actives to be used in the compositions will depend on the particular antimicrobial, anti-bacterial and anti-fungal active utilized since such agents vary widely in potency.

[0170] Suitable anti-microbial actives include, but are not limited to coal tar, sulfur, aluminum chloride, gentian violet, octopirox (piroctone ol amine), 3, 4, 4'-tri chlorocarbanilide (trichlosan), triclocarban, ciclopirox olamine, undecylenic acid and it's metal salts, potassium permanganate, selenium sulphide, sodium thiosulfate, propylene glycol, oil of bitter orange, ureaAttorney Docket No. 13720.0069P1preparations, griseofulvin, 8 -hydroxy quinoline ciloquinol, thiobendazole, thiocarbamates, haloprogin, polyenes, hydroxypyridone, morpholine, benzylamine, allylamines (such as terbinafine), tea tree oil, clove leaf oil, coriander, palmarosa, berberine, thyme red, cinnamon oil, cinnamic aldehyde, citronellic acid, hinokitol, ichthyol pale, iodopropynyl butyl carbamate, azelaic acid, isothiazalinones such as octyl isothiazolinone and azoles, parabens (e.g., methylparaben, ethylparaben, etc.), glycols (e.g., hexylenglycol, ethylhexylglycerin), and combinations thereof.

[0171] For example, suitable agents with anti-fungal properties are ketoconazole, naftifine hydrochloride, oxiconazole nitrate, sulconazole nitrate, urea, terbinafine hydrochloride, selenium sulfide. Suitable agents with anti-mite properties are crotamiton, ivermectin, and permethrin.

[0172] One or more anti-fungal or anti-microbial active is combined with an anti-dandruff active selected from polyvalent metal salts of pyrithione

[0173] Anesthetics

[0174] The compositions of the present invention may also contain a safe and effective amount of a topical anesthetic. Examples of topical anesthetic drugs include benzocaine, lidocaine, bupivacaine, chlorprocaine, dibucaine, etidocaine, mepivacaine, tetracaine, dyclonine, hexylcaine, procaine, cocaine, ketamine, pramoxine, phenol; and pharmaceutically acceptable salts thereof; benzyl alcohol, camphor, menthol, resorcinol; and appropriate combinations thereof.

[0175] Plant extracts and vegetable extracts

[0176] The compositions of the present invention may also contain a safe amount of a plant extract and vegetable extract. Examples of plant or vegetable extracts include extracts obtained from ivy (in particular English Ivy (Hedera Helix)), Chinese thorowax (Bupleurum chinensis), barley, Bupleurum Falcatum, arnica ( Arnica Montana L), rosemary (Rosmarinus officinalis N), marigold (Calendula officinalis), sage (Salvia officinalis L), soy, ginseng (Panax ginseng), ginko biloba, St.- John's-Wort (Hyperycum Perforatum), butcher's-broom (Ruscus aculeatus L), European meadowsweet (Filipendula ulmaria L), big-flowered Jarva tea (Orthosiphon Stamincus Benth), algae (Fucus Vesiculosus), birch (Betula alba), green tea, white tea, fermented tea, cola nuts (Cola Nipida), horse-chestnut, bamboo, spadeleaf (Centella asiatica), heather, fucus, willow, witch hazel, wild yam, mouse-ear, escine, cangzhu, chrysanthellum indicura, plants of the Armeniacea genus, Atractylodis Platicodon, Sinnomenum, Pharbitidis, Flemingia, Coleus such asAttorney Docket No. 13720.0069P1C. Forskohlii, C. blumei, C. esquirolii, C scutellaroides, C. xanthantus and C, Barbatus, root of Coleus barbatus, Ballote, Guioa, Davallia, Tenninalia, Barringtonia, Trema, antirobia, cecropia, argania, dioscoreae such as Dioscorea opposita or Mexican, Ammi visnaga, Centella asiatica and Siegesbeckia, in particular Siegesbeckia orientalis, the family of Ericaceae in particular bilberry extracts (Vaccinium angustifollium) or Arctostaphylos uva ursi, aloe vera, plant sterols (e.g., phytosterol), Manjistha (extracted from plants in the genus Rubia, particularly Rubia Cordifolia), and Guggal (extracted from plants in the genus Commiphora, particularly Commiphora Mukul), kola extract, chamomile, red clover extract, Piper methysticum, Bacopa monieri extract, sea whip, Glycyrrhiza glabra, mulberry, melaleuca (tea tree), mushroom extracts, Larrea divaricata, Rabdosia rubescens, euglena gracilis, Fibraurea recisa

[0177] Hirudinea, Chaparral Sorghum, sun flower extract, Enantia chlorantha, Mitracarpe of Spermacocea genus, Buchu barosma, Lawsonia inermis L., Adiantium Capillus- Veneris L., Chelidonium majus, Luffa cylindrical, Japanese Mandarin (Citrus reticulata Blanco var. unshiu), broccoli extract, Camelia sinensis, Imperata cylindrical, Glaucium Flavum, Cupressus Sempervirens, Polygonatum multiflorum, loveyly hemsleya, Sambucus Nigra, Phaseolus lunatus, Centaurium, Macrocystis Pyrifera, Turnera Diffusa, Anemarrhena asphodeloides, Portulaca pilosa, Humulus lupulus, Coffee Arabica, coffee berry, black berry, Ilex Paraguariensis, and so on.

[0178] Oils and lipids

[0179] The oil phase can contain any cosmetic or dermatological oil or a mixture thereof.

[0180] Examples of such oils include but are not limited to aliphatic hydrocarbons such as liquid paraffin, squalene, squalane, petroleum jelly (such as Vaseline) and ceresin; silicon oils such as dimethicone and cyclomethicones; vegetable oils such as avocado oil, apricot oil, almond oil, borage oil, borage seed oil, camellia oil, canola oil, castor oil, coconut oil, cocoa butter, corn oil, cottonseed oil, olive oil, evening primrose oil, flax seed oil, palm oil, palm kernel oil, peanut oil, rapeseed oil, safflower oil, sesame oil, sweet almond oil, rose hip oil, calendula oil, chamomile oil, eucalyptus oil, juniper oil, safflower oil, sandalwood oil, tea tree oil, sunflower oil, soybean oil, wheat germ oil; animal oils such as shark liver oil, cod liver oil, whale oil, beef tallow and butterfat; waxes such as beeswax, carnauba palm wax, spermaceti and lanolin; fatty acids such as lauric acid, myristic acid, palmitic, acid, stearic acid, oleic acid, behenic acid; omega-3 fatty acids such as alpha-linolenic acid, eicosapentaenoic acid, and docosahexaenoic acid; omega-6 fatty acids suchAttorney Docket No. 13720.0069P1as linoleic acid and gamma-linolenic acid; aliphatic alcohols such as lauryl, stearyl, cetyl, and oleyl alcohol; and aliphatic esters such as isopropyl, isocetyl, or octadecyl myristate, butyl stearate, hexyl laureate, diisopropyl ester of adipic acid, or diisopropyl sebacate; and / or mixtures thereof. Generally, the oils are refined and / or hydrogenated. Lipids include monoglycerides, diglycerides, triglycerides, phospholipids, and ceramides.

[0181] Suspending agents

[0182] The compositions of the present invention may further contain a suspending agent preferably at concentrations effective for suspending water-insoluble material in dispersed form in the compositions or for modifying the viscosity of the composition. Such concentrations can preferably range from about 0.1% to about 10%, more preferably from about 0.25% to about 5.0% by weight of the composition. Suspending agents useful herein include anionic polymers and nonionic polymers. Useful herein are vinyl polymers such as cross linked acrylic acid polymers with the CTFA name Carbomer, cellulose derivatives and modified cellulose polymers such as methyl cellulose, ethyl cellulose, nitro cellulose, sodium carboxymethyl cellulose, crystalline cellulose, cellulose powder, polyvinylpyrrolidone, polyvinyl alcohol, guar gum, hydroxypropyl guar gum, arabia gum, galactan, carob gum, pectin, agar, starch (rice, corn, potato, wheat), algae colloids (algae extract), microbiological polymers such as dextran, succinoglucan, pulleran, starch- based polymers such as carboxymethyl starch, methylhydroxypropyl starch, alginic acid-based polymers such as sodium alginate, alginic acid propylene glycol esters, acrylate polymers such as sodium polyacrylate, polyethylacrylate, polyacrylamide, polyethyleneimine, and inorganic water soluble material such as bentonite, aluminum magnesium silicate, laponite, hectonite, and anhydrous silicic acid. Actives aforementioned as thickening agents can also be used herein as suspending agents.

[0183] Other optional suspending agents include crystalline suspending agents which can be categorized as acyl derivatives, long chain amine oxides, long chain acyl derivatives and mixtures thereof. These preferred suspending agents include ethylene glycol esters of fatty acids, alkanol amides of fatty acids, long chain esters of long chain fatty acids (e.g., stearyl stearate, cetyl palmitate, etc.); long chain esters of long chain alkanol amides (e.g., stearamide diethanolamide distearate, stearamide monoethanolamide stearate); and glyceryl esters (e.g., glyceryl distearate, trihydroxystearin, tribehenin). Other suitable suspending agents include primary amines having aAttorney Docket No. 13720.0069P1fatty alkyl moiety having at least about 16 carbon atoms, examples of which include palmitamine or stearamine, and secondary amines having two fatty alkyl moieties each having at least about 12 carbon atoms, examples of which include dipalmitoylamine or di (hydrogenated tallowjamine. Still other suitable suspending agents include di(hydrogenated tallow)phthalic acid amide, and crosslinked maleic anhydride-methyl vinyl ether copolymer.

[0184] Emulsifying agents

[0185] Emulsifying agents include a wide variety of nonionic, cationic, anionic, zwitterionic, and amphoteric surfactants such as are known in the art and discussed below. The hydrophilic surfactants (cationic, anionic, zwitterionic, amphoteric) useful herein can contain a single surfactant, or any combination of suitable surfactants. The exact surfactant (or surfactants) chosen will depend upon the pH of the composition and the other components present. The amount of the emulsifying agent is that effective for emulsifying the components of the composition into an emulsion.

[0186] Useful nonionic surfactants include the condensation products of alkylene oxides with fatty acids (i.e., alkylene oxide esters of fatty acids), the condensation products of alkylene oxides with 2 moles of fatty acids (i.e., alkylene oxide diesters of fatty acids), the condensation products of alkylene oxides with fatty alcohols (i.e., alkylene oxide ethers of fatty alcohols), the condensation products of alkylene oxides with both fatty acids and fatty alcohols [i.e., wherein the polyalkylene oxide portion is esterified on one end with a fatty acid and etherified (i.e., connected via an ether linkage) on the other end with a fatty alcohol] Nonlimiting examples of these alkylene oxide derived nonionic surfactants include ceteth-6, ceteth-10, ceteth-12, ceteareth-6, ceteareth-10, ceteareth-12, steareth-6, steareth- 10, steareth- 12, steareth-21, PEG-6 stearate, PEG- 10 stearate, PEG- 100 stearate, PEG- 12 stearate, PEG-20 glyceryl stearate, PEG- 80 glyceryl tallowate, PEG- 10 glyceryl stearate, PEG-30 glyceryl cocoate, PEG-80 glyceryl cocoate, PEG-200 glyceryl tallowate, PEG-8 dilaurate, PEG- 10 di stearate, and mixtures thereof. Still other useful nonionic surfactants include polyhydroxy fatty acid amide surfactants. An especially preferred surfactant corresponding to the above structure is coconut alkyl N-methyl glucoside amide. Preferred among the nonionic surfactants are those selected from the group consisting of steareth-21, ceteareth-20, ceteareth-12, sucrose cocotte, steareth- 100, PEG- 100 stearate, and mixtures thereof. Other nonionic surfactants suitable for use herein include sugar esters and polyesters.Attorney Docket No. 13720.0069P1alkoxylated sugar esters and polyesters, C1-C30 fatty acid esters of C1-C30 fatty alcohols, alkoxylated derivatives of C1-C30 fatty acid esters of C1-C30 fatty alcohols, alkoxylated ethers of C1-C30 fatty alcohols, polyglyceryl esters of C1-C30 fatty acids, C1-C30 esters of polyols, Cl-C30 ethers of polyols, alkyl phosphates, polyoxyalkylene fatty ether phosphates, fatty acid amides, acyl lactylates, and mixtures thereof. Nonlimiting examples of these emulsifiers include: polyethylene glycol 20 sorbitan monolaurate (Polysorbate 20), polyethylene glycol 5 soya sterol, Steareth-20, Ceteareth-20, PPG-2 methyl glucose ether di stearate, Ceteth-10, Polysorbate 80, cetyl phosphate, potassium cetyl phosphate, diethanolamine cetyl phosphate, Polysorbate 60, glyceryl stearate, polyoxyethylene 20 sorbitan trioleate (Polysorbate 85), sorbitan monolaurate, polyoxyethylene 4 lauryl ether sodium stearate, polyglyceryl-4 isostearate, hexyl laurate, PPG-2 methyl glucose ether di stearate, PEG- 100 stearate, and mixtures thereof. Another group of nonionic surfactants useful herein are fatty acid ester blends based on a mixture of sorbitan or sorbitol fatty acid ester and sucrose fatty acid ester, the fatty' acid in each instance being preferably C8-C24, more preferably C 10-C20. The preferred fatty acid ester emulsifier is a blend of sorbitan or sorbitol C 16-C20 fatty acid ester with sucrose C 10-C 16 fatty acid ester, especially sorbitan stearate and sucrose cocoate. This is commercially available from ICT under the trade name Ariatone 2121.

[0187] Also useful herein are cationic surfactants, especially dialkyl quaternary' ammonium compounds. Nonlimiting examples of these cationic emulsifiers include stearamidopropyl PG- dimonium chloride phosphate, behenamidopropyl PG dimonium chloride, stearamidopropyl ethyldimonium ethosulfate, stearamidopropyl dimethyl (myristyl acetate) ammonium chloride, stearamidopropyl dimethyl cetearyl ammonium tosylate, stearamidopropyl dimethyl ammonium chloride, stearamidopropyl dimethyl ammonium lactate, and mixtures thereof. Especially preferred is behenamidopropyl PG dimonium chloride. Nonlimiting examples of quaternary ammonium salt cationic surfactants include those selected from cetyl ammonium chloride, cetyl ammonium bromide, lauryl ammonium chloride, lauryl ammonium bromide, steaiyl ammonium chloride, stearyl ammonium bromide, cetyl dimethyl ammonium chloride, cetyl dimethyl ammonium bromide, lauryl dimethyl ammonium chloride, lauryl dimethyl ammonium bromide, steaiyl dimethyl ammonium chloride, stearyl dimethyl ammonium bromide, cetyl trimethyl ammonium chloride, cetyl trimethyl ammonium bromide, lauryl trimethyl ammonium chloride, lauiyl trimethyl ammonium bromide, stearyl trimethyl ammonium chloride, stearyl trimethyl ammonium bromide, lauiyl dimethyl ammonium chloride, stearyl dimethyl cetylAttorney Docket No. 13720.0069P1ditallow dimethyl ammonium chloride, dicetyl ammonium chloride, dicetyl ammonium bromide, dilauryl ammonium chloride, dilauryl ammonium bromide, distearyl ammonium chloride, distearyl ammonium bromide, dicetyl methyl ammonium chloride, dicetyl methyl ammonium bromide, dilauryl methyl ammonium chloride, dilauryl methyl ammonium bromide, distearyl methyl ammonium chloride, distearyl methyl ammonium bromide, and mixtures thereof. Additional quaternary ammonium salts include those wherein the C12 to C30 alkyl carbon chain is derived from a tallow fatty acid or from a coconut fatty acid. The term "tallow" refers to an alkyl group derived from tallow fatty acids (usually hydrogenated tallow fatty acids), which generally have mixtures of alkyl chains in the C16 to C18 range. The term "coconut" refers to an alkyl group derived from a coconut fatty acid, which generally have mixtures of alkyl chains in the C 12 to C 14 range. Examples of quaternary ammonium salts derived from these tallow and coconut sources include ditallow dimethyl ammonium chloride, ditallow dimethyl ammonium methyl sulfate, di(hydrogenated tallow) dimethyl ammonium chloride, di(hydrogenated tallow) dimethyl ammonium acetate, ditallow dipropyl ammonium phosphate, ditallow dimethyl ammonium nitrate, di(coconutalkyl)dimethyl ammonium chloride, di(coconutalkyl)dimethyl ammonium bromide, tallow ammonium chloride, coconut ammonium chloride, and mixtures thereof. An example of a quaternary ammonium compound having an alkyl group with an ester linkage is ditallowyl oxyethyl dimethyl ammonium chloride. More preferred cationic surfactants are those selected from behenamidopropyl PG dimonium chloride, dilauryl dimethyl ammonium chloride, distearyl dimethyl ammonium chloride, dimyristyl dimethyl ammonium chloride, dipalmityl dimethyl ammonium chloride, distearyl dimethyl ammonium chloride, stearamidopropyl PG-dimonium chloride phosphate, stearamidopropyl ethyldiammonium ethosulfate, stearamidopropyl dimethyl (myristyl acetate) ammonium chloride, stearamidopropyl dimethyl cetearyl ammonium tosylate, stearamidopropyl dimethyl ammonium chloride, stearamidopropyl dimethyl ammonium lactate, and mixtures thereof. Still more preferred cationic surfactants are those selected from behenamidopropyl PG dimonium chloride, dilauryl dimethyl ammonium chloride, distearyl dimethyl ammonium chloride, dimyristyl dimethyl ammonium chloride, dipalmityl dimethyl ammonium chloride, and mixtures thereof. A preferred combination of cationic surfactant and structuring agent is behenamidopropyl PG dimonium chloride and / or behenyl alcohol, wherein the ratio is preferably optimized to maintain or to enhance physical and chemical stability, especially when such a combination contains ionic and / or highly polar solvents.Attorney Docket No. 13720.0069P1

[0188] A wide variety of anionic surfactants can also be useful herein. Nonlimiting examples of anionic surfactants include the alkoyl isethionates, and the alkyl and alkyl ether sulfates. The reaction products of fatty acids esterified with isethianonic acid and neutralized, i.e., the alkoyl isethionates typically have the formula RCOOCH2CII2SO3M wherein R is alkyl or alkenyl of from about 10 to about 30 carbon atoms, and M is a water-soluble cation such as ammonium, sodium, potassium and triethanolamine. For example, the fatty acids are derivated from coconut or palm kernel oil. Nonlimiting examples of these isethionates include those alkoyl isethionates selected from ammonium cocoyl isethionate, sodium cocoyl isethionate, sodium lauroyl isethionate, sodium stearoyl isethionate, and mixtures thereof. Also suitable are salts of fatty acids, amids of methyl taurides. The alkyl and alkyl ether sulfates typically have the respective formulae ROSO3M and RO(C2H4o)xS03M, wherein R is alkyl or alkenyl of from about 10 to about 30 carbon atoms, x is from about 1 to about 10, and M is a water-soluble cation such as ammonium, alkanolamines such as triethanolamine, monovalent metals, such as sodium and potassium, and polyvalent metal cations such as magnesium and calcium Preferably, R has from about 8 to about 18 carbon atoms, more preferably from about 10 to about 16 carbon atoms, even more preferably from about 12 to about 14 carbon atoms, in both the alkyl and alkyl ether sulfates. The alkyl ether sulfates are typically made as condensation products of ethylene oxide and monohydric alcohols having from about 8 to about 24 carbon atoms. The alcohols can be synthetic, or they can be derived from fats, e.g., coconut oil, palm kernel oil, tallow. Lauryl alcohol and straight chain alcohols derived from coconut oil or palm kernel oil are preferred Such alcohols are reacted with between about 0 and about 10, preferably from about 2 to about 5, more preferably about 3, molar proportions of ethylene oxide, and the resulting mixture of molecular species having, for example, an average of 3 moles of ethylene oxide per mole of alcohol, is sulfated and neutralized. Another suitable class of anionic surfactants are the water-soluble salts of the organic, sulfuric acid reaction products of the general formula RI-SO3-M, wherein R1 is chosen from the group including a straight or branched chain, saturated aliphatic hydrocarbon radical having from about 8 to about 24, preferably about 10 to about 16, carbon atoms, and M is a cation described hereinbefore. Still other anionic synthetic surfactants include the class designated as succinamates, olefin sulfonates having about 12 to about 24 carbon atoms, and beta-alkyloxy alkane sulfonates. Examples of these materials are sodium lauryl sulfate and ammonium lauryl sulfate. Other anionic surfactants suitable for use in the compositions are the succinnates, examples of which includeAttorney Docket No. 13720.0069P1disodium N-octadecylsulfosuccinnate; disodium lauryl sulfosuccinate; diammonium lauryl sulfosuccinate; tetrasodium N-(l,2-dicarboxyethyl)-N-octadecylsulfosuccinnate; diamyl ester of sodium sulfosuccinic acid; dihexyl ester of sodium sulfosuccinic acid; and dioctyl esters of sodium sulfosuccinic acid. Other suitable anionic surfactants include olefin sulfonates having about 10 to about 24 carbon atoms. In addition to the true alkene sulfonates and a proportion of hydroxy¬ alkanesulfonates, the olefin sulfonates can contain minor amounts of other materials, such as alkene disulfonates depending upon the reaction conditions, proportion of reactants, the nature of the starting olefins and impurities in the olefin stock and side reactions during the sulfonation process. Another class of anionic surfactants suitable for use in the compositions is the betaalkyloxy alkane sulfonate class. Other anionic materials useful herein are soaps (i.e., alkali metal salts, e.g., sodium or potassium salts) of fatty acids, typically having from about 8 to about 24 carbon atoms, preferably from about 10 to about 20 carbon atoms. The fatty acids used in making the soaps can be obtained from natural sources such as, for instance, plant or animal-derived glycerides (e.g., palm oil, coconut oil, soybean oil, castor oil, tallow, lard, etc.) The fatty acids can also be synthetically prepared.

[0189] Amphoteric and zwitterionic surfactants are also useful herein. Examples of amphoteric and zwitterionic surfactants which can be used in the compositions of the present invention are those w ich are broadly described as derivatives of aliphatic secondary and tertiary amines in which the aliphatic radical can be straight or branched chain and wherein one of the aliphatic substituents contains from about 8 to about 22 carbon atoms (preferably Cs-C ) and one contains an anionic water solubilizing group, e.g., carboxy, sulfonate, sulfate, phosphate, or phosphonate. Examples are alkyl imino acetates, and iminodialkanoates and aminoalkanoates of the formulas RN[CH2)mCO2M]2 and RNH(CH2)mCO2M wherein m is from 1 to 4, R is a C8-C22 alkyl or alkenyl, and M is H, alkali metal, alkaline earth metal ammonium, or alkanolammonium. Preferred amphoteric surfactants for use in the present invention include cocoamphoacetate, cocoamphodiacetate, lauroamphoacetate, I auroamphodi acetate, and mixtures thereof. Also included are imidazolinium and ammonium derivatives. Specific examples of suitable amphoteric surfactants include sodium 3 -dodecyl -aminopropionate, sodium 3 -dodecylaminopropane sulfonate, N- alkyltaurines such as the one prepared by reacting dodecylamine with sodium isethionate; N-higher alkyl aspartic acids; and the products sold under the trade name " Miranol" Other examples of useful amphoterics include phosphates, such as coamidopropyl PG-dimoniumAttorney Docket No. 13720.0069P1chloride phosphate (commercially available as Monaquat PTC, from Mona Corp.). Zwitterionic surfactants suitable for use in the composition are well known in the art, and include those surfactants broadly described as derivatives of aliphatic quaternary ammonium, phosphonium, and sulfonium compounds, in which the aliphatic radicals can be straight or branched chain, and wherein one of the aliphatic substituents contains from about 8 to about 18 carbon atoms and one contains an anionic group such as carboxy, sulfonate, sulfate, phosphate or phosphonate. Zwitterionics such as betaines are preferred. Examples of betaines include the higher alkyl betaines, such as coco dimethyl carboxymethyl betaine, lauryl dimethyl carboxymethyl betaine, lauryl dimethyl alphacarboxy ethyl betaine, cetyl dimethyl carboxymethyl betaine, cetyl dimethyl betaine (available as Lonzaine 16SP from Lonza Corp.), lauryl bis-(2-hydroxy ethyl) carboxymethyl betaine, stearyl bis-(2-hydroxypropyl) carboxymethyl betaine, oleyl dimethyl gamma-carboxypropyl betaine, lauryl bis-(2-hydroxypropyl)alpha-carboxyethyl betaine, coco dimethyl sulfopropyl betaine, stearyl dimethyl sulfopropyl betaine, lauryl dimethyl sulfoethyl betaine, lauryl bis-(2-hydroxyethyl) sulfopropyl betaine, and amidobetaines and amidosulfobetaines (wherein the RC0NH(CH2)r radical is attached to the nitrogen atom of the betaine), oleyl betaine (available as amphoteric Velvetex OLB-50 from Henkel), and cocamidopropyl betaine (available as Velvetex BK-35 and BA-35 from Henkel). Other useful amphoteric and zwitterionic surfactants include the sultaines and hydroxysultaines such as cocamidopropyl hydroxysultaine (available as Mirataine CBS from Rhone-Poulenc), and the alkanoyl sarcosinates corresponding to the formula RCON(CH3)CH2CH2C02M wherein R is alkyl or alkenyl of about 10 to about 20 carbon atoms, and M is a water-soluble cation such as ammonium, sodium, potassium and trialkanolamine (e.g., triethanolamine), a preferred example of wdiich is sodium lauroyl sarcosinate.

[0190] Thickening agents

[0191] Thickening agents suitable for inclusion in a composition described herein include those agents commonly used as an excipient or a earner for topical application to increase the viscosity of the formulation. Thickening agents may also be used to improve the stability of the formulation and the product.

[0192] More specifically, such examples include but are not limited to, acrylamides copolymer, agarose, amylopectin, bentonite, calcium alginate, calcium carboxymethyl cellulose,Attorney Docket No. 13720.0069P1carbomer, carboxymethyl chitin, cellulose gum, dextrin, gelatin, hydrogenated tallow, hydroxyl ethyl- cellulose, hydroxy propyl cellulose, hydroxypropyl starch, magnesium alginate, methylcellulose, microcrystalline cellulose, pectin, various polyethylene glycol's, polyacrylic acid, poly-methacryli c acid, polyvinyl alcohol, various polypropylene glycols, sodium acrylates copolymer, sodium carrageenan, xanthan gum, and / or yeast beta-glucan.

[0193] More generally, carboxylic acid polymers useful thickening agents. Carboxylic acid polymers are cross-linked compounds containing one or more monomers derived from acrylic acid, substituted acrylic acids, and salts and esters of these acrylic acids and the substituted acrylic acids, wherein the cross-linking agent contains two or more carbon-carbon double bonds and is derived from a polyhydric alcohol. Examples of commerci lly avail ble carboxylic acid polymers useful herein include the carbomers, which are homopolymers of acrylic acid cross-linked with allyl ethers of sucrose or pentaerytritol. The carbomers are available as the Carbopol® 900 series from B. F. Goodrich (e.g., Carbopol® 954). In addition, other suitable carboxylic acid polymeric agents include copolymers of CI 0-30 alkyl acrylates with one or more monomers of acrylic acid, methacrylic acid, or one of their short chain (i.e., CI -4 alcohol) esters, wherein the cross-linking agent is an allyl ether of sucrose or pentaerytritol. These copolymers are known as acrylates / C 10-30 alkyl acrylate crosspolymers and are commercially available as Carbopol® 1342, Carbopol® 1382, Pemulen TR-1, and Pemulen TR-2, from B. F. Goodrich. Examples of preferred carboxylic acid polymer thickeners useful herein include those selected from carbomers, acrylates / C10-30 alkyl acrylate crosspolymers, and mixtures thereof.

[0194] Moreover, a wide variety of polysaccharides are useful herein as thickening agents.

[0195] Non-limiting examples of pol saccharide gelling agents include those selected from cellulose, carboxymethyl hydroxyethylcellulose, cellulose acetate propionate carboxylate, hydroxyethylcellulose, hydroxyethyl ethylcellulose, hydroxypropylcellulose, hydroxypropyl methylcellulose, methyl hydroxy ethylcellulose, microcrystalline cellulose, sodium cellulose sulfate, and mixtures thereof. Also useful herein are the alkyl substituted celluloses. In these polymers, the hydroxy groups of the cellulose polymer is hydroxyal ylated (preferably hydroxyethylated or hydroxypropyl ted) to form a hydroxyalkylated cellulose which is then further modified with a CIO- 30 straight chain or branched chain alkyl group through an ether linkage. Typically, these polymers are ethers of C 10-30 straight or branched chain alcohols withAttorney Docket No. 13720.0069P1hydroxyalkylcelluloses. Examples of alkyl groups useful herein include those selected from stearyl, isostearyl, lauryl, myristyl, cetyl, isocetyl, cocoyl (e.g., alkyl groups derived from the alcohols of coconut oil), palmityl, oleyl, linoleyl, linolenyl, ricinoleyl, behenyl, and mixtures thereof. Preferred among the alkyl hydroxyalkyl cellulose ethers is the material given the CTFA designation cetyl hydroxyethylcellulose, which is the ether of cetyl alcohol and hydroxyethylcellulose. This material is sold under the trade name Natrosol® CS Plus from Aquaion Corporation (Wilmington, Del.). Additional examples can be found in The International Cosmetic Ingredient Dictionary and Handbook, the Cosmetic Bench Reference - Directory of Cosmetic Ingredients, the books provided by the United States Pharmacopeia (USP) and the National Formulary (NF), and other references for cosmetic and pharmaceutical ingredients known in the art. Other useful polysaccharides include scleroglucans which are a linear chain of (1-3) linked glucose units with a (1-6) linked glucose every three units, a commercially available example of which is ClearogelTM CS 11 from Michel Mercier Products Inc (Mountainside, N. J.).

[0196] Other thickening and gelling agents useful herein include materials which are primarily derived from natural sources. Non-limiting examples of these gelling agent gums include acacia, agar, algin, alginic acid, ammonium alginate, amylopectin, calcium alginate, calcium carrageenan, carnitine, carrageenan, dextrin, gelatin, gellan gum, guar gum, guar hydroxypropyltrimonium chloride, hectorite, hyaluronic acid, hydrated silica, hydroxypropyl chitosan, hydroxypropyl guar, karaya gum, kelp, locust bean gum, natto gum, potassium alginate, potassium carrageenan, propylene glycol alginate, sclerotium gum, sodium carboyxmethyl dextran, dextran sulfate, sodium carrageenan, tragacanth gum, xanthan gum, and / or mixtures thereof. In addition, the compositions of the present invention can also optionally contain polyacryl amide polymers, especially nonionic polyacrylamide polymers including substituted branched or unbranched polymers. More preferred among these polyacrylamide polymers is the nonionic polymer given the CTFA designation polyacrylamide and isoparaffin and laureth-7, available under the trade name Sepigel 305 from Seppic Corporation (Fairfield, N. J.). Other polyacrylamide polymers useful herein include multi-block copolymers of acrylamides and substituted acrylamides with acrylic acids and substituted acrylic acids.

[0197] Preferred compositions of the present invention include a thickening agent selected from carboxylic acid polymers, cross-linked polyacrylate polymers, polyacrylamide polymers, andAttorney Docket No. 13720.0069P1mixtures thereof, more preferably selected from carboxylic acid polymers, polyacryl mide polymers, and mixtures thereof

[0198] Penetration enhancers

[0199] Penetration enhancers are the substances that facilitate the absorption of penetrant through the skin or mucosal membranes by temporarily diminishing the impermeability of the skin or, respectively, the mucosa. Ideally, these materials should be pharmacologically inert, nontoxic, nonirritating, non-allergenic, compatible with the cationic peptides described herein, odorless, tasteless, colorless, and inexpensive and have good solvent properties. The enhancer should not lead to the significant loss of body fluids, electrolytes, and other endogenous materials, and skin or mucosa should regain its barrier properties on its removal within an acceptable period of time No single penetration enhancer can possess all the required properties. However, many enhancers exhibit many of these attributes, and they have been described (for example as reviewed in Drug Development and Industrial Pharmacy 2000, 26, 1131-1140) or are being currently researched.

[0200] Antihistamines

[0201] Antihistamines, also called histamine antagonists, are substances that inhibit the action of histamine by blocking it from attaching to histamine receptors; or by inhibiting the enzymatic activity of histidine decarboxylase, catalyzing the transformation of histidine into histamine; or similar. Examples of anti -histamines are acrivastine, azelastine, brompheniramine, buclizine, bromodiphenhydramine, carbinoxamine, cetirizine, chlorpromazine, cyclizine, chlorpheniramine, chlorodiphenhydramine, cimetidine, clemastine, cyproheptadine, deslo atadine, dexbrom-pheniramine, deschlorpheniramine, dexchlorpheniramine, dimenhydrinate, dimetindene, diphenhydramine, doxylamine, ebastine, embramine, famotidine, fexofenadine, lafutidine, levocetirizine, loratadine, meclozine, mirtazapine, nizatidine, olopatadine, orphenadrine, phenindamine, pheniramine, phenyltoloxamine, promethazine, pyrilamine, quetiapine, ranitidine, roxatidine, rupatadine, tripelennamine, and triprolidine

[0202] The choice of additional substances to be included in the composition is made depending on the constraints relating to the cationic peptide as described herein (e.g., stability, solubilization, etc.), if enhanced and / or additional benefits and properties (e.g., anti-acne, anti¬ microbial, anti -wrinkle, skin lightening, anti-redness, antioxidant, skin protectant, sunscreen, hair growth, anti-inflammatory, emollient, moisturization, enhanced skin penetration, etc.) of theAttorney Docket No. 13720.0069P1composition are desired, and, where applicable, the use subsequently envisaged for the composition,

[0203] As mentioned, the compositions of the invention may include one or more additional substances, various, conventional or not, which will provide some benefit to the object of the composition More specifically, the combination of cationic peptide with selected additional substances may lead to an enhanced efficacy as compared to the use of cationic peptide alone. The enhanced efficacy can be additive (the sum of efficacies of the individual agents alone), or it can be synergistic (larger than the sum of efficacies of the individual agents alone). Of course, a decision to include an additional ingredient or substance and the choice of a specific ingredient or substance depends on the specific use of the composition and the product formulation.

[0204] For example, the use of one or more suitable anti-wrinkling substance (e g., retinoic acid, retinol, transforming growth factor beta-1, selected peptides, etc.) will increase the clinical efficacy (e g., reduced skin wrinkles) of the composition containing the cationic peptide as described herein after topical administration; the use of one or more suitable emollient substance (e.g., octyldodecanol, etc.) will increase the clinical efficacy (e.g., improved skin feel or sensations) of the composition containing the cationic peptide as described herein after topical administration; the use of one or more suitable humectant substance (e.g., glycerin, hyaluronic acid, etc.) will increase the clinical efficacy (e.g., increased skin moisturization) of the composition containing the cationic peptide as described herein after topical administration; the use of one or more suitable skin penetration enhancer substance (e.g., propylene glycol, butylene glycol, ethanol, oleic acid, lauric acid, palmitic acid, isopropyl palmitate, DMSO, sodium lauryl sulfate, Azone®, etc.) for the cationic peptide as described herein will increase the clinical efficacy (e g., reduced skin wrinkles) of the composition containing the cationic peptide as described herein after topical administration; the use of one or more suitable anti-inflammatory substance (e.g., bisabolol, glycyrrhetinic acid, linoleic acid, borage seed oil, wheat germ oil, etc.) will increase the clinical efficacy (e.g., reduced irritation or redness of skin or mucosa) of the composition containing the cationic peptide as described herein after topical administration; the use of one or more suitable topical anesthetic substance (e.g,, lidocaine, pramoxine hydrochloride, etc.) will increase the clinical efficacy (e.g., reduced local pain) of the composition containing the cationic peptide as described herein after topical administration; and the use of one or more suitable topical anti¬ histamine substance (e.g., diphenhydramine, etc.) will increase the clinical efficacy (e.g., reducedAttorney Docket No. 13720.0069P1local itch) of the composition containing the cationic peptide as described herein after topical administration.

[0205] ( Carriers and Excipients

[0206] The compositions of the present invention can also contain one or more carriers and / or excipients acceptable for a mode of administration (i.e., for topical application and / or for subcutaneous administration). Those skilled in the art will be able to routinely select an appropriate carrier and / or excipient for the mode of administration. Depending in the use and the way of administration, the compositions of the present invention can also contain a carrier and / or excipient acceptable for injection, implantation, or subcutaneous placement.

[0207] The carrier and / or excipient can be in a wide variety of forms. Non-limiting examples of suitable carriers and / or excipients include simple solutions (water or oil based), emulsions, dispersions, multi-phase systems, semi-solid forms, solid forms (powder, sticks, patches), skin masks, tissues, foams, and aerosols. For example, emulsion carriers and / or excipients can include, but are not limited to, oil-in-water, silicone-in-water, water-in-oil, water-in-silicone, water-in-oil-in-water, oil-in- water-in-oil, and oil-in-water-in-silicone emulsions.

[0208] Depending upon the desired product form, preferred carriers and / or excipients can contain an emulsion such as oil-in-water emulsions (e.g., silicone-in-water) and water-in-oil emulsions, (e.g., water-in-silicone emulsions). In one example, oil-in-water emulsions are especially preferred. Emulsions according to the present invention can contain an aqueous phase and a lipid or oil. Lipids and oils may be derived from animals, plants, or petroleum and may be natural or synthetic (e.g., man-made).

[0209] Preferred emulsions can also contain a humectant, such as glycerin. Emulsions can further contain from about 0.1 % to about 25%, more preferably from about 02% to about 10%, of an emulsifying agent (emulsifier), based on the weight of the composition. Emulsifier agents may be nonionic, anionic, or cationic. Suitable emulsifiers are disclosed for example in McCutcheon's Detergents and Emulsifiers, North American Edition, pages 317-324 (1986).

[0210] Suitable emulsions may have a wide range of viscosities, depending on the desired product form. The compositions of the present invention can be in the form of pourable liquids, semisolids, to highly viscous systems (e.g., solids) under ambient conditions.Attorney Docket No. 13720.0069P1

[0211] Any of the compositions can contain an aqueous carrier and / or excipient, which is typically present at a level of from about 20% to about 99%, preferably from about 60% to about 90%. The aqueous carrier and / or excipient may contain water, or a miscible mixture of water and organic solvent (e.g., alcohols, including but not limited to ethanol, glycerin, propylene glycol, butylene glycol, other glycols, etc.), but preferably contain water with significant lower or no concentrations of organic solvent, except as otherwise incidentally incorporated into the composition as minor ingredients of other essential or optional components.

[0212] The compositions of the subject invention, including but not limited to solutions, lotions, serums and creams, may contain an acceptable emollient. Such compositions preferably contain from about 1% to about 80% of the emollient As used herein, "emollient" refers to a material useful for the prevention or relief of dryness, as well as for the protection of the skin. A wide variety of suitable emollients is known and may be used herein. In addition to the examples of emollients provided above, Sagarin, Cosmetics, Science and Technology, 2nd Edition, Vol. 1, pp. 32-43 (1972) contains numerous other examples of materials suitable as an emollient. A preferred emollient is glycerin. Glycerin is preferably used in an amount of from or about 0.001% to or about 80%, more preferably from or about 0.01 % to or about 25%, still more preferably from or about 0.1% to or about 10%, and even more preferably from or about 2% to or about 5%.

[0213] Lotions, serums and creams according to the present invention generally contain a carrier and / or excipient and one or more emollients. Lotions and creams typically contain from about 1% to about 50%, preferably from about 1% to about 20%, of emollient; from about 50% to about 90%, preferably from about 60% to about 80%, water; and, optionally, additional substances in amounts sufficient to provide additional benefits. Creams are generally thicker than lotions and serums due to higher levels of emollients, higher levels of thickeners, and / or differences in the emulsifying system.

[0214] Ointments of the present invention may contain a simple base of animal or vegetable oils or semi-solid hydrocarbons such as petrolatum, absorption ointment bases which absorb water to form emulsions, or water-soluble carriers, e.g., a water-soluble solution carrier. Ointments may further contain a thickening agent, such as described above and in Sagarin, Cosmetics, Science and Technology, 2nd Edition, Vol. 1, pp. 72-73 (1972), and / or an emollient. For example, an ointment may contain from about 2% to about 10% of an emollient; from aboutAttorney Docket No. 13720.0069P10.1% to about 2% of a thickening agent as well as one or more additional substances(s) in amounts sufficient to provide additional benefits.

[0215] Compositions of this invention useful for cleansing ("cleansers") can be formulated with a suitable carrier, e.g., as described above, and preferably contain from about 1 % to about 30%, more preferably from about 5% to about 10%, of an acceptable surfactant. The surfactant is suitably selected from anionic, nonionic, zwitterionic, amphoteric and ampholytic surfactants, as well as mixtures of these surfactants. Such surfactants are well known to those skilled in the detergency art. Examples of a broad variety of surfactants useful herein are described above and in McCutcheon's Detergents and Emulsifiers, North American Edition (1986), published by Allured Publishing Corporation. The cleansing compositions can optionally contain, at their art- established levels, other materials which are conventionally used in cleansing compositions.

[0216] As used herein, the term "foundation" refers to a liquid, semi-liquid, semi-solid, or solid skin cosmetic which includes, but is not limited to lotions, creams, gels, pastes, cakes, and the like. Typically, the foundation is used over a large area of the skin, such as over the face, to provide a particular look. Foundations are typically used to provide an adherent base for color cosmetics such as rouge, blusher, powder and the like, and tend to hide skin imperfections and impart a smooth, even appearance to the skin Foundations of the present invention include a dermatologically acceptable carrier and may include conventional ingredients such as oils, colorants, pigments, emollients, fragrances, waxes, stabilizers, and the like.

[0217] The compositions of the present invention can also contain a liquid that is acceptable for injection to and / or under the skin if the composition is to be injected. Any suitable acceptable liquid as known in the art or otherwise can be used. Composition Preparation

[0218] The compositions of the present invention are generally prepared by conventional methods such as are known in the art of making compositions suitable for topical application. Such methods can typically be conducted in one or more steps, with or without heating, cooling, and the like.

[0219] In addition, the compositions of the present invention can also be prepared by conventional methods such as are known in the art of making compositions suitable for injections.Attorney Docket No. 13720.0069P1

[0220] They may be in any galenic form such aerosols, creams, lotions, milk or cream ointments, gels, emulsions, dispersions, solutions, suspensions, cleansers, foundations, anhydrous preparations (sticks, in particular lip balm, body and bath oils), shower and bath gels, shampoos and scalp treatment lotions, cream or lotion for care of skin or hair, gel or solution for care of skin or hair, cream or lotion for care of the genitals (e.g., vulva, vagina, penis, scrotum), gel or solution for care of genitals, makeup removing lotions or creams, sunscreen lotions, milks, artificial suntan lotions; pre-shave, shave or after shave creams, foams, gels or lotions; make-up, lipsticks, mascaras or nail varnishes; skin essences, serums; adhesive or absorbent materials, skin masks; tissues; hydrating patches, transdermal patches, iontophoretic patches, microneedle patches, powders; emollient lotion, sprays, oils for the body and the bath, foundation tint bases, pomade, colloid, compact or solid suspension, pencil, sprayable or brossable formulation, blush, rouge, eyeliner, lip liner, lip gloss, facial or body powder, mousse or styling gels, nail conditioner, lip balms, skin conditioners, anorectal creams, hygiene cream, moisturizers, hair sprays, hair conditioners, soaps, body exfoliants, astringents, depilatories and permanent waving solutions, anti-dandruff formulations, anti-hair loss formulations, anti-sweat and anti-perspirant formulations, nose sprays; and so on.

[0221] These compositions can also be presented in the form of lipsticks intended to apply color or to protect the lips from cracking, or of make-up products for the eyes or tints and tint bases for the face. Compositions in accordance wzith the invention include cosmetics, personal care products, feminine products, male products, hygiene products, and dermatological or pharmaceutical preparations.

[0222] The compositions of the present invention may also be applied on animal skin when wounds or defects or disorders of animal skin affecting the extracellular matrix are present.

[0223] The compositions according to the present invention may be prepared in the form of solution, dispersion, emulsion, paste, or powder, individually or as a premix or in vehicles individually or as a premix in vectors such as macro-, micro-, or nanocapsules, macro-, micro- or, nanospheres, liposomes, oleosomes, cubosomes; macro-, micro-, or nanoparticles; or macro-, micro or nanosponges; or macro-, micro-, and nanocapsules; or macro-, micro- or nanospheres, micro- or nano- emulsions; or adsorbed onto tip of needles; or adsorbed onto microneedles or ontoAttorney Docket No. 13720.0069P1microneedle arrays; or adsorbed to organic polymer powders, talcs, bentonites, or other inorganic or organic supports.

[0224] Furthermore, the compositions according to the present invention may be used in any form whatsoever, in a form bound to or incorporated in or absorbed in or adsorbed on macro-, micro-, and nanoparticles; or macro-, micro or nanosponges; or macro-, micro-, and nanocapsules, or macro-, micro- or nanospheres; or adsorbed (e.g., by coating) onto microneedle patches or arrays (such as described by Ameri M. et al., Pharm Res 2010, 27: 303-313); for the treatment of textiles, natural or synthetic fibers, wools, and any materials that may be used for clothing or underwear for day or night intended to come into contact with the skin, handkerchiefs or cloths, to exert their effect via this skin / textile contact and to permit continuous topical deliver.

[0225] The compositions according to the present invention may also be prepared or used in a form of a device (e g., medical device, combination between drug and medical device) Preferred devices include, but are not limited to, devices for overcoming biological barriers such as ultrasound devices (i.e., sonophoresis, sonoporation, acoustic ablation), electric devices (iontophoresis, electroporation), high pressure devices (i.e., liquid injection, powder injection), microneedles (i.e., solid, hollow, degradable, coated), thermal and optical devices (i.e., light, infrared, laser, radio- frequency), other physical devices reducing the skin barrier (i.e., plasma devices, micro-dermabrasion, dermabrasion, suction devices, macro-needle devices, etc.), devices reducing the skin barrier by chemical means (i.e., chemical exfoliating devices, skin corrosion (e.g., using NaOH) devices), and / or any combination or combination device thereof. Some examples of methods and devices for overcoming biological barriers have been described in Advanced Drug Delivery Reviews 2013, 65, 100-103 (incorporated herein as reference).

[0226] In addition, the compositions according to the present invention may be used in any form intended to be placed into the skin or mucosal tissue, or under the skin or mucosal tissue (e.g., topical application, by injection, implantation, or subcutaneous placement).

[0227] Method of Treatment

[0228] The present invention concerns compositions for their application as a cosmetic, personal care, or a medicinal product and methods of using the same, topically or by injection.Attorney Docket No. 13720.0069P1

[0229] The composition according to the invention can be applied topically onto any areas of the face, neck, neckline, decollete, scalp, hand, palm, arm, leg, foot, sole, chest, breast, back, abdomen, buttock, vulva, or penis and scrotum, anus, and / or any other skin areas of the human body.

[0230] Further, the composition according to the invention can be also applied locally or topically onto any areas of the eye, mouth, nose; breast nippies, vulva, vagina and introitus; or penis and scrotum, rectum, and / or any other mucosal areas of the human body.

[0231] Furthermore, the composition according to the invention can also be applied locally or topically to other surfaces of the human body, including hair and nail, or any wound, scar, or skin and mucosal surface areas affected by atrophy, or other conditions, disorders and diseases associated with changes in extracellular matrix components.

[0232] In addition, the compositions according to the present invention may also be applied by injection, implantation, or subcutaneous pl cement.

[0233] For example, compositions described herein can be applied using a syringe, a micro-cannula, a patch, an iontophoretic patch, microneedles, and / or a microneedle array or patch. In addition, the composition can be also applied in conjunction (i.e., before, after, or simultaneously) with the use of other skin devices changing the penetration characteristics of skin such as, for example, laser, light, infrared, radiofrequency, ultrasound, electroporation, sonophoresis, thermal, plasma, and / or high-pressure devices, and / or any combination(s) (including combination devices) thereof. Any other commonly used means of administration can also be utilized.

[0234] In embodiment, the composition comprising an effective amount of the positively charged peptide as described herein is applied to the skin after a microneedling procedure. After the procedure can be immediately after the procedure and optionally for a series of days after the procedure, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after the procedure, 1-2 times each day.

[0235] In addition to humans, the compositions according to the present invention may also be applied in animalsAttorney Docket No. 13720.0069P1

[0236] In one example, the present invention concerns cosmetic treatment methods to improve the general state of the skin involving topical or subcutaneous application of an effective amount of the composition as defined above to the skin. More specifically, these methods can be used to prevent and / or treat the signs of intrinsic and extrinsic skin aging; to prevent and / or treat skin slackening and / or improve tone and / or firmness and / or elasticity of the skin; to prevent and / or treat skin atrophy and / or improve the density of the dermis and epidermis; to give or return volume to the dermis and epidermis; to prevent and / or treat skin dehydration; to prevent and / or treat skin roughness; to prevent and / or treat cellulite, to prevent and / or treat stretch marks, to reduce expansion and / or prevent the development of adipose tissue within the hypodermis, to lighten and / or whiten the skin; to prevent and / or treat glycation of molecules in the skin; and / or to prevent and / or treat degradation of the skin due to the effects of oxidation.

[0237] The present invention also provides methods to improve the general state of the atrophic tissue involving topical or subcutaneous application of an effective amount of the composition as defined above to the tissue. More specifically, such methods can be used to restore damaged skin; to restore skin after cosmetic and dermatological procedures; to prevent and / or treat atrophy of the female genitals, to prevent and / or treat vulvovaginal atrophy; to prevent and / or treat skin conditions and disorders related to menopause; to prevent and / or treat skin conditions and disorders associated with reduced estrogen levels in females; to prevent and / or treat vulvodynia, to prevent and / or treat vulvar lichen sclerosus; to prevent and / ortreat vulvar dermatoses; to prevent and / or treat the signs of intrinsic and extrinsic aging of the female genitals; and / or to prevent and / or treat the signs of intrinsic and extrinsic aging of male genitals.

[0238] Some benefits (e.g., moisturization, soothing, calming, tightening, smooth feel, etc.) can be noticed within a few hours to a few days after topically applying the compositions according to the present invention on the affected human skin or human tissue (for example vulva and / or vagina). However, it takes generally at least 30 days to notice benefits (e.g., anti-aging, wrinkle reducing, skin lightening, anti-redness, improving atrophy, wound healing, etc.). Thereby, the composition should be applied to the affected human skin or human tissue at least once to twice a day.

[0239] Kits and Dosage FormsAttorney Docket No. 13720.0069P1

[0240] According to the invention, products or devices with several compartments or kits (having one or more containers) may be proposed to apply the compositions of the invention By way of non-limiting example, a first compartment or container having a composition including the cationic peptide as described herein, and one or more additional substances (e g., one or more biologically active ingredients and / or one or more inactive ingredients such as an excipient and / or a carrier) in a second compartment or container, the compositions contained in the said first and second compartments in this case being considered to be a combination composition for simultaneous, separate or step-wise use in time, particularly in any one of the treatments defined above. Alternatively, kits according to the invention may include the components of the compositions in separate compartments or containers or certain components can be in the same compartments or containers while others are in separate compartments or containers. Such kits will also preferably include instructions for use.

[0241] Any of the compositions described herein may be supplied in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of the cationic peptide as described herein calculated to produce the desired cosmetic, personal care or therapeutic effect in association with the required cosmetic and / or pharmaceutical carrier(s). The specification for the dosage unit forms of the invention is dictated by and directly dependent on (a) the unique characteristics of the compositions and the particular maintenance, therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the art of compounding the cationic peptide as described herein for the treatment of individuals.

[0242] The unit dosage form is any of a variety of forms, including, for example, but not limited to, a solution, any semi-solid form, a capsule, a bag, a tablet, a single pump on an aerosol or a vial. The quantity of active ingredient(s) in a unit dose of composition is an effective amount and is varied according to the particular treatment involved.

[0243] One skilled in the art will appreciate that it is sometimes necessary to make routine variations to the dosage depending on the age and condition of the patient. The dosage will also depend on the route of administration.Attorney Docket No. 13720.0069P1

[0244] Compositions of the present disclosure can comprise peptide of SEQ ID NO: 50 or SEQ ID NO: 51.EXAMPLESExample 1 - Effect of RTP0004 on Human Dermal Fibroblast Ceils in CultureA. Cell culture'.

[0245] Commercially available human dermal fibroblast (HDF) cell line from young (25yr) and elderly (71yr) donor was purchased from National Human Genetic Research repository at the Coriell Institute for Medical Research (Camden, NJ, USA). HDF cells were cultured in Minimal essential Medium (MEM, Gibco; cat# 11095-080) supplemented with 15% fetal bovine serum (Gibco; Cat # 16140-071) and maintained at 37°C in a humidified CO2 incubator (PHCbi corp). Cells at passage 15-20 were seeded into 6-well plates (surface area 9,6cm2) at a density of 1.6 x 105cells / well. Young and old HDF cells were studied. The HDF cells were grown for 24-48 hr. and then starved for 24hr in a serum free media (MEM media without fetal bovine serum) and then treated for 48 hours with DAXXIFY, 150 Kd BoNT / A or RTP004 alone in duplicates (n=2). Cells were treated with DAXXIFY at a dosage range of 5 units / ml, 8 units / ml, and 10 units / ml; with RTP004 at dose ranges of 0 1 mg / ml, 0,5 mg / ml, and 1 mg / ral, and with 150kD BoNT / A at dose ranges of 0.025 mg / ml, 0.04 mg / ml, and 0.05 mg / ml respectively. After 48 hr. of drug treatment, cell culture supernatant was collected for protein analysis and cells were harvested for mRNA expression. RTP004 has a sequence shown in Table 2.B. RNA extraction cDNA synthesis and Quantitative RT-PCR:

[0246] Total RNA was isolated from HDFs using RNeasy Mini Kit (Qiagen; cat # 74104) according to the manufacturer’s instructions and its quality and quantity were checked using a NanoDrop one spectrophotometer (Thermo scientific). Following RNA isolation, 200ng of RNA was used for cDNA library preparation using Superscript III first-strand synthesis supermix for qRT-PCR (Invitrogen; cat#l 1752050) and quality and quantity w?ere checked using a NanoDrop one spectrophotometer (Thermo scientific),

[0247] Quantitative RT-PCR (real-time PCR) was performed with individually reverse transcribed DNA in triplicate using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad; cat# 1725271) on CFX96 real-time system (Cl 000 touch Thermal Cycler; Bio-Rad) The reactionAttorney Docket No. 13720.0069P1conditions included an initial denaturing step (95 °C for 3 min) followed by 40 amplification cycles (95 °C for lOsec, 60 °C for 30 sec). All samples were analyzed in the single analysis (RT-qPCR reaction) to exclude any potential differences in results due to inter-run changes. To verify the specificity of each primer pair, a melting curve was produced with a heat gradient ranging from 65 °C t o 95 °C to confirm absence of the primer dimer formation. No Template Control (NTC) reactions were included in the experiment to control the DNA contamination in the reagents.

[0248] The relative mR A level of a specific gene is normalized to GAPDII, a housekeeping gene served as an internal control and Relative fold changes in gene expression were calculated using the comparative 2~AACTmethod. The sequences of all gene primers used in this study are listed in Table 1 below:Table 1Name Sequence SEQ ID NO:Col lai FP1 ATCAACCGGAGGAATTTCCGT SEQ ID NO: 6Col lai RP1 CACCAGGACGACCAGGTTTTC SEQ ID NO: 7Col3al FP1 GCCAAATATGTGTCTGTGACTCA SEQ ID NO: 8Col 3a 1 RP1 GGGCGAGTAGGAGCAGTTG SEQ ID NO: 9Col4al FP1 CCAGGGGTCGGAGAGAAAG SEQ ID NO: 10Col4al RP1 GGTCCTGTGCCTATAACAATTCC SEQ ID NO: 11Col5al FP1 TACAACGAGCAGGGTATCCAG SEQ ID NO: 12Col5al RP1 ACTTGCCATCTGACAGGTTGA SEQ ID NO: 13Col8al FP1 CACACGTTCACCAACTCACC SEQ ID NO: 14ColSal RP1 GACAGGACTGCTGAATCAAATCA SEQ ID NO: 15Coll lai FP1 TAACATCGCTGACGGGAAGTG SEQ ID NO: 16Col 11 al RP1 CCGTGATTCCATTGGTATCAACA SEQ ID NO: 17Mmpl FP1 CTCTGGAGTAATGTC AC ACCTCT SEQ ID NO: 18Mmpl RP1 TGTTGGTCCACCTTTCATCTTC SEQ ID NO: 19Mmp2 FP 1 TACAGGATCATTGGCTACACACC SEQ ID NO: 20Mmp2 RP1 GGTC AC ATCGCTC C AG ACT SEQ ID NO: 21Mmp3 F P1 AGTCTTCCAATCCTACTGTTGCT SEQ ID NO: 22Mmp3 RP1 TCCCCGTCACCTCCAATCC SEQ ID NO: 23Timpl FP1 AGAGTGTCTGCGGATACTTCC SEQ ID NO: 24limpl RP 1 CCAACAGTGTAGGTCTTGGTG SEQ ID NO: 25Timp2 FP1 AAGCGGTCAGTGAGAAGGAAG SEQ ID NO: 26Attorney Docket No. 13720.0069P1Timp2 RP1 GGGGCCGTGTAGATAAACTCTAT SEQ ID NO: 27Gapdh FP1 GGAGCGAGATCCCTCCAAAAT SEQ ID NO: 28Gapdh RP 1 GGCTGTTGTCATACTTCTCATGG SEQ ID NO: 29116 FP1 ACTCACCTCTTCAGAACGAATTG SEQ ID NO: 30116 RP1 CCATCTTTGGAAGGTTCAGGTTG SEQ ID NO: 31Tgfbl FP1 C TAATGGTGGAAACCCACAACG SEQ ID NO: 32 Tg / 6 / RPl TATCGCCAGGAATTGTTGCTG SEQ ID NO: 33 TnfaFPl CCTCTCTCTAATCAGCCCTCTG SEQ ID NO: 34 TnfaRPl GAGGACCTGGGAGTAGATGAG SEQ ID NO: 35 Vegf FPl AGGGCAGAATCATCACGAAGT SEQ ID NO: 36 VegfRPl AGGGTCTCGATTGGATGGCA SEQ ID NO: 37 PdgfFPl GCAAGACCAGGACGGTCATTT SEQ ID NO: 38 Pdgf RPl GGC ACTTG AC ACTGCTCGT SEQ ID NO: 39Lmna FP1 AGCAGCGT GAGTTTGAGAGC SEQ ID NO: 40Lmna RP1 AGAC TGCCTGGC ATTGTCC SEQ ID NO: 41Fril FP1 GATAAATCAACAGTGGGAGC SEQ ID NO: 427;7? / RP1 CCCAGATCATGGAGTCTTTA SEQ ID NO: 43Eln FP 1 5’-GGCCATTCCTGGTGGAGTTCC-3 SEQ ID NO: 44E / nRPl 5'-AACTGGCTTAAGAGGTTTGCCTCCA-3' SEQ ID NO: 45C. Enzyme-Linked Immunosorbent Assay Results

[0249] As shown in Figures 1A, IB, 2A, and 2B, human collagen type I Al (COL1A1), type 3A1 (COL3A1) and elastin (ELN) protein production in cell culture supernatant were detected. The kits used for detection were Cusabio Biotech ELISA kits Cat # E13445h-96, Cat # E13446h-96, Cat# CSB-E09338h respectively. ELISA was performed according to the manufacturer’s instruct! ons.

[0250] Also as shown in Figure 1A, IB, 2A, and 2B, human matrix etal loprotease I, laminin alpha (LMNA) and hyaluronan protein production was detected. The kits used for detection were RayBio human MMP1 ELISA kit (cat # ELH-MMP1), human Laminin ELIS A kit (cat # AB 119599) and Hyaluronan ELISA kit (cat # DHYALO) respectively.Attorney Docket No. 13720.0069P1

[0251] All kits were used according to the manufacturer’s instructions. The absorbance detection was performed using an ELISA microplate reader Varioskan lux; Thermoscientific) at 450 nm.

[0252] Results, as can be appreciated from comparing Figures 1A and IB to Figures 2A, 2B, 3 A, and 3C, RTP004 stimulated the production of human collagen type 1 Al (COL1 Al), type 4A1, type 5A1, type 3A1 (COL3A1), elastin (ELN) and hyaluronan protein. The magnitude of such increase is shown in Figures 4. Figure 5 shows that MMP1 and laminin expression is decreased.

[0253] Example 2 Assay of Other Positively Charged Peptides in

[0254] The expression assay described in Example 1 was performed to measure the effect of the positively charged peptides of Table 2, shown below.Table 2Peptide Sequence piRTP004 RKKRRQRRRGKKKKKKKKKKKKKKKGRKKRRQRRR 13 (SEQ ID NO: 5)P3 (KI 5) KKKKKKKKKKKKKKK (SEQ ID NO: 46) 12.5P5 (TAT) YGRKKRRQRRR (SEQ ID NO: 47) 12.5P6 (P T D-R 15-PTD) RKKRRQRRRGRRRRRRRRRRRRRRRGRKKRRQRRR 12.8(SEQ ID NO: 48)P7 (PTD-EI5-PTD) RKKRRQRRRGEEEEEEEEEEEEEEEGRKKRRQRRR 6.3(SEQ ID NO: 49)Pll (PF5-K15-PF5) TRVLKRWKLFGKKKKKKKKKKKKKKKGTRVLKRWKLF 12.4(SEQ ID NO: 50)Scrambled RTP004 KRKKRGKKRKKKRQKRRKKRKKKRKKKGRKRRQRK13 (SEQ ID NO: 51)

[0255] Table 2 also includes the isoelectric point of the studied positive charge peptides. The peptides were each used in an assay as described in Example 1 with elderly HFC.Attorney Docket No. 13720.0069P1

[0256] FIG. 6 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to P3 peptide at increasing concentrations as compared to the control (left most column for each protein). Collagen I, Collagen IV, and elastin increase with a dose dependent increase in expression.

[0257] FIG. 7A is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to P5 (TAT) peptide at increasing concentrations as compared to the control (left most column for each protein). The graph demonstrates a dose dependent increase in expression of the gene encoding elastin. The volume of the TAT solution was the same as that used to collect the data for the RTP-004 solution shown in FIG. 7B. The volume of TAT solution used to produce the data of FIG. 7C is 1 / 3 of that for FIG. 7A. As can be appreciated from the comparison of FIG. 7A and 7C, TAT peptides are not as potent at generating elastin as RTP004 and does not increase expression of other studied genes. In comparison, RTP004 data demonstrates a dose dependent increase in expression of the gene encoding Collagen IV, Collagen XI, and elastin,

[0258] FIG. 8 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to P6 peptide at increasing concentrations as compared to the control (left most column for each protein). The graph demonstrates a dose dependent increase in expression in Collagen IV, Collagen XI, and elastin. A dose dependent increase in laminin alpha production is also demonstrated.

[0259] FIG. 9 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to P7 peptide at increasing concentrations as compared to the control (left most column for each protein). P7 is a negatively charged peptide (pl of 6.3) and does not demonstrate increasing expression of extracellular matrix proteins,

[0260] FIG. 10 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to PH peptide at increasing concentrations as compared to the control (left most column for each protein). The graph demonstrates a dose dependent increase in expression in Collagen IV, Collagen V, and elastin.

[0261] FIG. 11 is a bar graph showing the increase in expression of mRNA for the proteins listed on the y-axis in elderly human fibroblast cells exposed to Scrambled peptide (a randomAttorney Docket No. 13720.0069P1rearrangement of the amino acids of RTP004) at increasing concentrations as compared to the control (left most column for each protein). The graph demonstrates a dose dependent increase in expression in Collagen XI and elastin.

Claims

1. 13720.0069P12.CLAIMS3.We claim:

1. A composition for stimulating the formation of one or more extracellular matrix components in skin or mucosa, comprising an effective amount of a cationic peptide comprising 10 to 100 amino acids and an isoelectric point (pl) of at least 12 to stimulate expression of genes encoding one or more extracellular matrix components in skin or mucosa.

2. The composition of claim 1, wherein the cationic peptide has at least 50% Arg and Lys residues and an HIV-TAT or a reverse HIV-TAT, optionally wherein the cationic peptide is an N- terminal portion that is an HIV-TAT or reverse HIV-TAT sequence, a C-terminal portion that is an HIV-TAT or reverse HIV-TAT sequence, and one or more lysine residues between said N-terminal portion and said C-terminal portion, wherein said peptide has from 5 to 50 lysine residues between said N-terminal portion and said C-terminal portion, optionally wherein said N-terminal portion is an HIV-TAT sequence and said C-terminal portion is an HIV-TAT sequence or optionally wherein said N- terminal portion is a reverse HIV- TAT sequence and said C-terminal portion is a reverse HIV-TAT sequence.

3. The composition of claim 2, wherein said peptide has about 10 to 20 lysine residues between said N-terminal and C-terminal portions or wherein said peptide has the amino acid sequence of SEQ ID NO: 5.

4. The composition of claim 1 or 2 or 3, wherein the composition further comprises one or more carriers or excipients suitable for topical administration or one or more carriers or excipients suitable for subcutaneous administration.

5. The composition of any one of claims 1 to 4, wherein the one or more extracellular matrix components comprise collagen I, collagen III, collagen IV, collagen V, collagen VIII, collage XI, elastin, hyaluronic acid, or combinations thereof or the one or more extracellular matrix components are selected from a group consisting of collagen I, collagen III, collagen IV, collagen V, collagen VIII, collage XI, elastin, hyaluronic acid, and combinations thereof.13720.0069P16. The composition of any one of claim 1 to 5, wherein the composition further comprises an effective amount of botulinum toxin for treating keloids, optionally botulinum toxin is botulinum toxin Type A complex or botulinum toxin Type A, 150 Kd (non¬ complexed), preferably non-complexed.

7. The composition of any one of claim 1 to 5, wherein the composition further comprises an effective amount of an anti-inflammatory steroid, optionally a corticosteroid, for reducing inflammation in the skin, optionally wherein the skin is irritated or damaged skin or skin after a cosmetic or dermatological procedure.

8. The composition of any one of claim 1 to 5, wherein the composition further comprises an effective amount of an estradiol or estriol.

9. The composition of any one of claim 1 to 5, wherein the composition further comprises an effective amount of a retinoid for treating a symptom of aging skin.

10. The composition of any one of claims 1 to 9, wherein the composition is suitable for topical administration in humans on skin, aged skin, irritated or damaged skin, skin after cosmetic and dermatological procedures, atrophic skin, atrophic mucosa, wounded skin, vulva, vagina, atrophic vulva, atrophic vagina, vulvovaginal atrophy, or on skin and mucosa with a decline in concentration of one or more extracellular matrix components, such as components selected from collagen I, collagen 111, elastin, hyaluronic acid, and combinations thereof.

11. The composition of any one of claims 1 to 9, wherein the composition is suitable for subcutaneous administration in humans on skin, aged skin, damaged skin, skin after cosmetic and dermatological procedures, atrophic skin, wounded skin, vulva, vagina, atrophic vulva, atrophic vagina, or on skin and mucosa with a decline in concentration of one or more extracellular matrix components.

12. The composition of any one of claims 1 to 11, wherein the cationic peptide has a concentration of 10 to 100 micrograms per mL of composition.13720.0069P113. The composition of any one of claims 1 to 12, wherein the cationic peptide has a concentration of 10 to 100 micrograms per mL of composition and wherein the composition comprises one or more acceptable carriers or excipients suitable for topical application in humans on skin, aged skin, damaged skin, skin after cosmetic and dermatological procedures, wounded skin, atrophic skin, atrophic mucosa, atrophic vulva, atrophic vagina, or for skin and mucosa with a decline in concentration of one or more extracellular matrix components.

14. A method of treating, alleviating, or ameliorating a symptom, condition, disorder, or disease of the skin or mucosa, wherein the symptom, condition, disorder, or disease is associated with changes in extracellular matrix components, the method comprising comprising administering, to a patient in need thereof, a composition accordinog to any one of claims 1 to 13 and 51-58 to treat, alleviate, or ameliorate a symptom, condition, disorder, or disease of the skin or mucosa15. The method of claim 14, wherein the symptom, condition, disorder, or disease of the skin or mucosa associated with changes in extracellular matrix components is selected from the group consisting of wounds, damaged skin, atrophic skin, atrophic mucosa, aging, age-associated disorders and diseases, atrophy of any human tissue, disorders and diseases of vulvar tissue, vulvovaginal atrophy, and disorders and diseases of vaginal tissue.

16. The method of claim 14, wherein treating, alleviating, or ameliorating the wound results in scarless wound healing.

17. The method of claim 14, wherein treating, alleviating, or ameliorating atrophy of any human tissue comprises the treatment of vulvovaginal atrophy.

18. The method of claim 14, wherein treating, alleviating, or ameliorating skin and mucosa associated with changes in extracellular matrix components comprises the treatment of vulvodynia, lichen sclerosus, vulvar lichen planus, erosive lichen planus, vulvar eczema, vulvar lichen simplex chronicus, ulcers of the vulva, Behcet’s disease, vulvar intraepithelial neoplasia, or any combination thereof.13720.0069P119. The method of any one of claims 14 to 18, wherein the method comprises the repeated topical administration of the composition to the patient.

20. The method of claim 19, wherein the composition is administered to the patient at least once or twice a day for at least 30 days.

21. The method of any one of claims 14 to 18, wherein the method comprises the repeated subcutaneous administration of the composition to the patient.

22. The method of any one of claims 14 to 18, wherein the composition is administered to the patient at least once or twice a day for at least 30 days.

23. The method of any one of claims 14 to 22, wherein the administration of the composition treats, alleviates, or ameliorates one or more visible signs of aging associated with changes in extracellular matrix components selected from the group consisting of fine lines, wrinkles, enlarged pores, roughness, dryness, loss of elasticity, loss of volume, atrophic skin, atrophic vulva, atrophic vagina, stretch marks, puffy eyes, dark (under eye) circles caused by thinning of the skin, dark (under eye) circles caused by insufficient blood circulation and slack tissue, and any combinations thereof.

24. A method of improving appearance of or rejuvenating skin or mucosa comprising administering, to a patient in need thereof, a composition according to any one of claims 1 to 13 and 51-58 to improve or rejuvenate the appearance of skin.

25. The method of claim 24, wherein the method results in one or more of the following:29.a. improving the appearance of aged skin, improving the state of aged skin, reducing the signs of aging, preventing aging, reducing scarring of damaged skin, restoring damaged skin, enhancing the restoration of skin after cosmetic and dermatological procedures, restoring aging vulvar vaginal tissue, reducing scarring of damaged skin, or restoring damaged or pathological skin.

26. The method of claim 24 or 25, wherein the composition is administered to the patient in the form of a cosmetic, a personal care product, a feminine care product, a hygiene13720.0069P131.product, a dermatology product, a pharmaceutical preparation, a medicament, or any combination thereof.

27. The method of claim any one of claims 24 to 26, wherein the composition is administered topically to the skin or mucosa of the patient.

28. The method of claim any one of claims 24 to 27, wherein the composition is administered subcutaneously, such as by injection, to the patient.

29. A method of maintaining healthy skin or of preventing, ameliorating, or delaying aging of skin, the method comprising a composition according to any one of claims 1 to 13 and 51-58 to maintain healthey skin or prevent, ameliorate, or delay aging of skin.

30. The method of claim 29, wherein the composition is administered to the patient in the form of a cosmetic, a personal care product, a feminine care product, a hygiene product, a dermatology product, a pharmaceutical preparation, a medicament, or any combination thereof.

31. The method of claim 29 or 30, wherein the composition is administered topically to the skin or mucosa of the patient.

32. The method of any one of claims 29 to 31, wherein the administration of the composition prevents, ameliorates, or delays the development of one or more signs of aging selected from tire group consisting of fine lines, wrinkles, enlarged pores, roughness, dryness, loss of elasticity, loss of volume, atrophic skin, atrophic vulva, atrophic vagina, stretch marks, puffy eyes, dark (under eye) circles caused by thinning of the skin, dark (under eye) circles caused by insufficient blood circulation and slack tissue, and any combinations thereof.

33. A method of treating, alleviating, or ameliorating a symptom, condition, disorder, or disease of the skin or mucosa, wherein the symptom, condition, disorder, or disease is associated with changes in extracellular matrix components which are not related to aging, the method comprising administering an effective amount of the composition of according to any one of claims 1 to 13 and 51-58 to a patient in need thereof, wherein13720.0069P138.the symptom, condition, disorder, or disease of the skin or mucosa associated with changes in extracellular matrix components not related to aging is selected from the group consisting of wounded skin, damaged skin after cosmetic and dermatological procedures, and atrophy of skin and mucosa due to causes other than aging.

34. The method of claim 33, wherein the atrophy of skin and mucosa is caused by emotional stress, use of oral contraceptive pills, use of aromatase inhibitors, or any combination thereof.

35. The method of claim 33 or 34, wherein the method comprises the repeated topical administration of the composition to the pati ent.

36. The method of any one of claims 33 to 35, wherein the composition is administered to the patient at least once or twice a day for at least 30 days.

37. The method of any one of claims 33 to 36, wherein the method comprises the repeated subcutaneous administration of the composition to the patient.

38. A method of increasing production of one or more extracellular matrix components in fibroblasts cells, the method comprising administering to fibroblast cells of a patient in need thereof, a composition according to any one of claims 1 to 13 and 51-58, wherein the one or more extracellular matrix components comprise collagen I, collagen 111, collagen IV, collagen V, collagen VIII, collagen XI, elastin, hyaluronic acid, or a combination thereof.

39. The method of claim 38, wherein the patient has a symptom, condition, disorder, or disease of the skin or mucosa associated with a decline in the extracellular matrix components or wherein the patient has a condition selected from the group consisting of wounds, damaged skin, atrophic skin, atrophic mucosa, aging, age-associated disorders and diseases, atrophy of any human tissue, disorders and diseases of vulvar tissue, vulvovaginal atrophy, and disorders and diseases of vaginal tissue.

40. The method of claim 38, wherein the administration is to a wound of the skin of the patient and the wound heals with a reduced amount of scarring.13720.0069P141. The method of claim 38, wherein the administration is to vaginal tissue and vulvovaginal atrophy is treated.

42. The method of claim 38, wherein vulvodynia, lichen sclerosus, vulvar lichen planus, erosive lichen planus, vulvar eczema, vulvar lichen simplex chronicus, ulcers of the vulva, Behcet's disease, or vulvar intraepithelial neoplasia is treated by the administration of the composition.

43. The method of any one of claims 38 to 42, wherein the method comprises the repeated topical administration of the composition to the patient.

44. The method of claim 43, wherein the composition is administered to the patient at least once or twice a day for at least 30 days.

45. The method of any one of claims 38 to 44, wherein the method comprises the repeated subcutaneous administration of the composition to the patient.

46. The method of any one of claims 45, wherein the composition is administered to the patient at least once or twice a day for at least 30 days.

47. The method of any one of claims 38 and 43-46, wherein the administration of the composition treats, alleviates, or ameliorates one or more visible signs of aging associated with changes in extracellular matrix components selected from the group consisting of fine lines, wrinkles, enlarged pores, roughness, dryness, loss of elasticity, loss of volume, atrophic skin, atrophic vulva, atrophic vagina, stretch marks, puffy eyes, dark (under eye) circles caused by thinning of the skin, dark (under eye) circles caused by insufficient blood circulation and slack tissue, and any combinations thereof.

48. The method of any one of claims 14 to 47, wherein administration of the composition stimulates the formation of collagen and elastin.

49. The method of any one of claims 14 to 48, wherein administration of the composition stimulates the formation of collagen I / 11I / I V, hyaluron, and elastin.13720.0069P150. The method of any one of claims 14 to 49, wherein administration of the composition is to a patient of at least 35, 40, 45, or 50 years of age or to a patient that is at least 60 years of age.

51. The composition of any one of claims 1 to 13, wherein the cationic peptide has a concentration of 1 to 50 micrograms per mL of composition and wherein the composition comprises one or more acceptable carriers or excipients suitable for topical application in humans on skin, aged skin, damaged skin, skin after cosmetic and dermatological procedures, wounded skin, atrophic skin, atrophic mucosa, atrophic vulva, atrophic vagina, or for skin and mucosa with a decline in concentration of one or more extracellular matrix components.

52. The composition of any one of claims 1 to 13 and 51, wherein the composition is an injectable formulation.

53. The composition of any one of claims 1 to 13 and 51, wherein the composition is a topical formulation.

54. The composition of claim 53, wherein the composition has a viscosity'' of 10 to 5,000 cP.

55. The composition of claim 53, wherein the composition has a viscosity of 5,000 to 25,000 cP.

56. The composition of any one of claims 1 to 13 and 51 to 55, wherein the peptide consists of an amino acid sequence of SEQ ID NO: 48, 50, or 51.

57. The composition of any one of claims 1 to 13 and 51 to 56, wherein the effective amount of peptide is 30 micrograms / mL to 100 micrograms / mL.

58. The composition of any one of claims 1 to 5 and 7 to 13 and 51 to 56, wherein the composition does not comprise a protein.

59. The composition of any one of claims 1 to 2 and 4 to 13 and 51 to 56, wherein the composition does not comprise a peptide of the sequence SEQ ID NO: 5 (RTP004)13720.0069P160. A composition comprising a peptide consisting of an amino acid sequence of SEQ ID NO: 48, 50, or 51.

61. A composition comprising an effective amount of a cationic peptide comprising 10 to 100 amino acids and an isoelectric point (pl) of at least 12 to stimulate the formation of one or more extracellular matrix components in skin or mucosa and further comprising an effective amount of an anti-inflammatory steroid, optionally a corticosteroid, for reducing inflammation in the skin, an effective amount of an estradiol or estriol for treating a symptom of aging skin or mucosa, or an effective amount of a retinoid for treating a symptom of aging skin.

62. The composition of claim 61, wherein the cationic peptide has at least 50% Arg and Lys residues and an HIV-TAT or a reverse HIV-TAT, optionally wherein the cationic peptide is an N- terminal portion that is an HIV-TAT or reverse HIV-TAT sequence, a C-terminal portion that is an HIV-TAT or reverse HIV-TAT sequence, and one or more lysine residues between said N-terminal portion and said C-terminal portion, wherein said peptide has from 5 to 50 lysine residues between said N-terminal portion and said C-terminal portion, optionally wherein said N-terminal portion is an HIV-TAT sequence and said C-terminal portion is an HIV-TAT sequence or optionally wherein said N- terminal portion is a reverse HIV- TAT sequence and said C-terminal portion is a reverse HIV-TAT sequence.

63. The composition of claim 62, wherein said peptide has about 10 to 20 lysine residues between said N-terminal and C-terminal portions or wherein said peptide has the amino acid sequence of SEQ ID NO: 5.

64. The composition of any one of claims 61-63, wherein the composition further comprises one or more carriers or excipients suitable for topical administration or one or more carriers or excipients suitable for subcutaneous administration.

65. The composition of any one of claims 61-64, wherein the one or more extracellular matrix components comprise collagen I, collagen 111, collagen IV, collagen V, collagen VIII, collage XI, elastin, hyaluronic acid, or combinations thereof or the one or more extracellular matrix components are selected from a group consisting of collagen I,13720.0069P171.collagen III, collagen IV, collagen V, collagen VIII, collage XI, elastin, hyaluronic acid, and combinations thereof.

66. The composition of any one of claims 61-65, wherein the composition is suitable for topical administration in humans on skin, aged skin, irritated or damaged skin, skin after cosmetic and dermatological procedures, atrophic skin, atrophic mucosa, wounded skin, vulva, vagina, atrophic vulva, atrophic vagina, vulvovaginal atrophy, or on skin and mucosa with a decline in concentration of one or more extracellular matrix components, such as components selected from collagen I, collagen III, elastin, hyaluronic acid, and combinations thereof.

67. The composition of any one of claims 61 to 65, wherein the composition is suitable for subcutaneous administration in humans on skin, aged skin, damaged skin, skin after cosmetic and dermatological procedures, atrophic skin, wounded skin, vulva, vagina, atrophic vulva, atrophic vagina, or on skin and mucosa with a decline in concentration of one or more extracellular matrix components.

68. The composition of any one of claims 61 to 67, wherein the cationic peptide has a concentration of 10 to 100 micrograms per mL of composition.

69. The composition of any one of claims 61 to 67, wherein the cationic peptide has a concentration of 10 to 100 micrograms per mL of composition and wherein the composition comprises one or more acceptable carriers or excipients suitable for topical application in humans on skin, aged skin, damaged skin, skin after cosmetic and dermatological procedures, wounded skin, atrophic skin, atrophic mucosa, atrophic vulva, atrophic vagina, or for skin and mucosa with a decline in concentration of one or more extracellular matrix components.

70. The composition of any one of claims 61-69, wherein the composition is an injectable formulation.

71. The composition of any one of claims 61-69, wherein the composition is a topical formulation.13720.0069P172. The composition of claim 71, wherein the composition has a viscosity of 10 to 5,000 cP.

73. The composition of claim 71, wherein the composition has a viscosity of 5,000 to 25,000 cP.

74. The composition of any one of claims 61 to 73, wherein the peptide consists of an amino acid sequence of SEQ ID NO: 48, 50, or 51.

75. The composition of any one of claims 61 to 74, wherein the effective amount of peptide is 30 micrograms / mL to 100 micrograms / mL.

76. The composition of any one of claims 61 to 74, wherein the composition does not comprise a protein.

Images