Nucleic acid detection composition, kit and method based on template-primer role switching
By combining site-specific cleavage nucleases and universal primers, and utilizing the binding of captured oligonucleotides to target molecules for linear extension and exponential amplification, the complexity and low sensitivity of existing DNA methylation detection methods are solved, enabling efficient and convenient detection of trace amounts of nucleic acid methylation status.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHANGHAI SCI-TECH INNO CENTER FOR INFECTION & IMMUNITY
- Filing Date
- 2025-12-11
- Publication Date
- 2026-06-25
AI Technical Summary
Existing DNA methylation detection methods suffer from problems such as complex operation, low sensitivity, and poor specificity, especially in the detection of trace amounts of nucleic acids.
This invention employs site-specific nucleases and a nucleic acid detection system based on universal primers. It utilizes the binding of captured oligonucleotides to target molecules for linear extension and exponential amplification, combined with enzyme recognition markers and nucleic acid extension blocking modifications, to achieve highly sensitive and specific detection.
It achieves highly sensitive and specific detection of trace amounts of nucleic acid and its methylation state, simplifies the operation process, and improves detection efficiency and accuracy.
Smart Images

Figure CN2025141785_25062026_PF_FP_ABST
Abstract
Description
Nucleic acid detection compositions, kits, and methods based on template and primer role interchangeability Technical Field
[0001] This invention relates to the field of detection technology, and more specifically, to a nucleic acid detection composition, kit, and method based on the interchangeability of template and primer roles. Background Technology
[0002] Nucleic acid amplification has not only driven the development of basic biological research but also revolutionized analytical techniques in clinical science. In clinical research, due to sample scarcity, single-reaction detection methods are costly and inefficient as project scales up. Therefore, developing nucleic acid amplification detection reagents applicable to clinical settings is of paramount importance.
[0003] Meanwhile, with the deepening of research, the biological significance of various chemical modifications on DNA sequences, such as DNA methylation, is receiving increasing attention. DNA methylation, a form of DNA chemical modification, can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent bonding of a methyl group to the 5th carbon position of the cytosine of a CpG dinucleotide in the genome, under the action of DNA methyltransferases. Numerous studies have shown that DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression. DNA methylation plays an important role in the development and progression of many human diseases, such as tumors, cardiovascular diseases, and diabetes, and is currently one of the hot topics in basic research and clinical application research.
[0004] Currently, bisulfite conversion is the mainstream method for DNA methylation detection. However, bisulfite conversion requires stringent chemical conditions and therefore has several drawbacks: 1) incomplete conversion can lead to false positives; 2) the conversion process can cause DNA degradation and fragmentation, resulting in decreased sensitivity; and 3) the conversion process alters the base information in the sequence, leading to a loss of sequence complexity and amplification bias.
[0005] Therefore, developing a simple, rapid, highly sensitive, and highly specific method for detecting trace amounts of nucleic acids and their methylation status is a pressing challenge and pain point that needs to be addressed in this field. Summary of the Invention
[0006] The purpose of this invention is to provide a simple, rapid, highly sensitive, and highly specific method for detecting trace amounts of nucleic acids and their methylation status.
[0007] The inventors have developed a nucleic acid detection system that utilizes site-specific cleavage nucleases and universal primer amplification to detect trace amounts of nucleic acid and their methylation status. This system is simple, fast, highly sensitive, and highly specific.
[0008] In a first aspect of the invention, a capture oligonucleotide for nucleic acid amplification is provided, the capture oligonucleotide comprising, from the 5' end to the 3' end, a first universal sequence (U2a), a folded sequence (1s), a second universal sequence (U1a), and a binding capture sequence (2a); wherein,
[0009] (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule;
[0010] (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule;
[0011] (3) The capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and
[0012] (4) The capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence.
[0013] The universal sequence is independent of the target molecule sequence.
[0014] In another preferred embodiment, the capturing oligonucleotide further includes nucleic acid analog modification:
[0015] Preferably, (5) the 3' end of the binding capture sequence is modified with a nucleic acid analog;
[0016] Preferably, (6) the 3' end of the folded sequence is modified with a nucleic acid analog.
[0017] In another preferred embodiment, the capturing oligonucleotide further includes nucleic acid analog modification:
[0018] (5) The binding capture sequence has a nucleic acid analog modification at its 3' end; and / or
[0019] (6) The 3' end of the folded sequence is modified with a nucleic acid analog.
[0020] In another preferred embodiment, the 3' end of the folded sequence of the captured oligonucleotide has a nucleic acid analog modification.
[0021] In another preferred embodiment, the binding capture sequence of the capturing oligonucleotide contains a nucleic acid extension blocking modification at its 3' end and a nucleic acid analog modification at its 3' end.
[0022] In another preferred embodiment, the capturing oligonucleotide has a nucleic acid extension blocking modification at the 3' end of its binding capturing sequence and a nucleic acid analog modification at the 3' end. The capturing oligonucleotide further includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence, and the folded sequence has a nucleic acid analog modification at the 3' end.
[0023] In another preferred embodiment, the capturing oligonucleotide further includes: (7) an enzyme cleavage recognition marker located at the 3' end of the universal sequence or bound to the 5' end of the capturing sequence.
[0024] In another preferred embodiment, the capturing oligonucleotide further includes: (7) an enzyme cleavage recognition marker located at the 3' end of the second universal sequence or bound to the 5' end of the capturing sequence.
[0025] In another preferred embodiment, the target molecule is a target molecule with well-defined 3' and 5' end sequences.
[0026] In another preferred embodiment, the target molecule is the cleavage product of a site-specific cleavage nuclease, for example, a target molecule with a defined sequence at both ends due to cleavage by a site-specific cleavage nuclease.
[0027] In another preferred embodiment, the site-specific cleaving nuclease is an exonuclease and / or an endonuclease.
[0028] In another preferred embodiment, the site-specific cleaving nuclease is selected from the group consisting of: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonucleases (e.g., restriction endonucleases MspⅠ, Xmal, etc.), methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, cleavage enzymes, giant nucleases, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0029] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0030] In another preferred embodiment, the CRISPR-Cas system comprises a guide short RNA that matches the target DNA fragment and an endonuclease that can recognize and cleave a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12, or Cas13.
[0031] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspE I, MspJI, LpnPI, or combinations thereof.
[0032] In another preferred embodiment, the enzyme digestion recognition marker is selected from the group consisting of / idsP / , RNA base modification, or a combination thereof.
[0033] In another preferred embodiment, the enzyme that identifies the enzyme digestion recognition marker is selected from the group consisting of: 3'Tth endonuclease, thermostable RNase H, mismatch repair enzyme, or a combination thereof.
[0034] In another preferred embodiment, the nucleic acid extension blocking modification is selected from the group consisting of: Spacer, amino, C6, methyl, azide, phosphoramide, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or combinations thereof.
[0035] In another preferred embodiment, the nucleic acid analog modification is selected from the group consisting of: peptide nucleic acid, locked nucleic acid, transposed base, spacer, 2'-O,4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoroRNA, 2'-fluoroRNA, or combinations thereof.
[0036] In a second aspect of the invention, a composition or kit for nucleic acid amplification is provided, the composition or kit comprising the capture oligonucleotides described in the first aspect of the invention.
[0037] In another preferred embodiment, the composition or kit is a composition or kit for nucleic acid detection.
[0038] In another preferred embodiment, the composition or kit further includes a target molecule pre-sequence pretreatment reagent.
[0039] In another preferred embodiment, the target molecule pre-sequence pretreatment reagent includes a site-specific cleavage nuclease.
[0040] In another preferred embodiment, the site-specific cleaving nuclease is selected from the group consisting of: exonucleases, endonucleases, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0041] In another preferred embodiment, the endonuclease is a restriction endonuclease.
[0042] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0043] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of GlaI, FspEI, MspJI, LpnPI, or combinations thereof.
[0044] In another preferred embodiment, the composition or kit further includes universal primers.
[0045] In another preferred embodiment, the universal primer is independent of the target molecule sequence.
[0046] In another preferred embodiment, the composition or kit further includes a detection probe.
[0047] In another preferred embodiment, the detection probe is labeled with a fluorescent group and / or a quenching group.
[0048] In another preferred embodiment, the fluorescent group is labeled on the 5' end of the detection probe; the quenching group is labeled on the 3' end of the detection probe.
[0049] In another preferred embodiment, the fluorescent group is selected from the group consisting of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LC RED460, or combinations thereof; the quenching group is selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or combinations thereof.
[0050] In another preferred embodiment, the composition or kit further includes DNA polymerase, dNTPs, and Mg. 2+ , or combinations thereof.
[0051] In another preferred embodiment, the composition or kit further includes an enzyme digestion buffer and / or a PCR buffer.
[0052] In another preferred embodiment, the composition or kit includes a capturing oligonucleotide and a universal primer, wherein the capturing oligonucleotide comprises, from 5' to 3' (sequentially), a first universal sequence (U2a), a folded sequence (1s), a second universal sequence (U1a), and a binding capturing sequence (2a); wherein,
[0053] (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule;
[0054] (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule;
[0055] (3) The capturing oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence;
[0056] (4) The capturing oligonucleotide further includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence; and
[0057] (5) The 3' end of the folded sequence of the captured oligonucleotide is modified with a nucleic acid analog;
[0058] The universal sequence and universal primers are independent of the target molecule sequence.
[0059] In another preferred embodiment, the composition or kit includes a capturing oligonucleotide and a universal primer, the capturing oligonucleotide comprising, from 5' to 3' (in sequence): a first universal sequence (U2a), a folded sequence (1s), a second universal sequence (U1a), and a binding capturing sequence (2a); wherein,
[0060] (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule;
[0061] (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule;
[0062] (3) The capturing oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence;
[0063] (4) The capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence.
[0064] (5) The 3' end of the folded sequence of the captured oligonucleotide is modified with a nucleic acid analog; and
[0065] (6) The capture oligonucleotide also includes an enzyme cleavage recognition marker located at the 3' end of the second universal sequence or bound to the 5' end of the capture sequence;
[0066] The universal sequence and universal primers are independent of the target molecule sequence.
[0067] In a third aspect of the invention, a method for non-diagnostic nucleic acid amplification or detection is provided, the method comprising the step of employing a capture oligonucleotide to bind a target molecule, the capture oligonucleotide being as described in the first aspect of the invention.
[0068] In another preferred embodiment, the method includes the steps of:
[0069] (a) Using capture oligonucleotides to bind to target molecules (i.e., using capture oligonucleotides to bind to target molecules);
[0070] (b) Linear elongation of the target molecule;
[0071] (d) Exponential amplification using universal primers,
[0072] The capturing oligonucleotide from 5' to 3' includes a first universal sequence (U2a), a 1s fold sequence, a second universal sequence (U1a), and a binding capture sequence (2a); wherein,
[0073] (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule;
[0074] (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule;
[0075] (3) The capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and
[0076] (4) The capture oligonucleotide also includes nucleic acid extension blocking modification located between the folded sequence and the second universal sequence;
[0077] Optionally, the 3' end of the folded sequence is modified with a nucleic acid analog;
[0078] The universal sequence and universal primers are independent of the target molecule sequence.
[0079] In another preferred embodiment, the 3' terminal sequence of the universal primer is the same as or partially the same as the universal sequence.
[0080] In another preferred embodiment, the 3' terminal sequence of the universal primer has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 identical bases to the universal sequence.
[0081] In another preferred embodiment, the 3' end sequence of the universal primer is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the universal sequence.
[0082] In another preferred embodiment, the capturing oligonucleotide is the capturing oligonucleotide described in the first aspect of the present invention.
[0083] In another preferred embodiment, the method (direct method) includes:
[0084] (1) Capture oligonucleotides bind to target molecules with well-defined 3' end sequences by binding to the capture sequence.
[0085] (2) The target molecule extends using the captured oligonucleotide as a template. A sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain the linear extension product of the target molecule.
[0086] (3) The second universal primer (U1a) binds to the linear extension product of the target molecule, and uses the linear extension product of the target molecule as a template to extend and terminate at the 5' end of the target molecule, thus obtaining the linear extension product of the second universal primer.
[0087] (4) The linear extension product of the second universal primer binds to and extends the folded sequence of the captured oligonucleotide, and the complementary sequence of the first universal sequence (U2a) is added to the 3' end to obtain the linear extension product of the first universal primer.
[0088] (5) Based on the first universal primer and the second universal primer, exponential amplification is performed to obtain an amplification product with the first universal primer sequence (U2a) and the complementary sequence of the second universal primer (U1s) at the 5' and 3' ends, respectively, and the target molecule sequence in the middle.
[0089] In another preferred embodiment, the method further includes the step of: (6) using a probe and detecting a probe signal.
[0090] In another preferred embodiment, the method includes the steps of:
[0091] (a) Using capture oligonucleotides to bind to target molecules (i.e., using capture oligonucleotides to bind to target molecules);
[0092] (b) Linear elongation of the target molecule;
[0093] (c) Enzyme-specific recognition and cleavage;
[0094] (d) Exponential amplification using universal primers;
[0095] The capturing oligonucleotide from 5' to 3' includes a first universal sequence (U2a), a folded sequence (1s), a second universal sequence (U1a), and a binding capture sequence (2a); wherein,
[0096] (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule;
[0097] (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule.
[0098] (3) The capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence;
[0099] (4) The capture oligonucleotide also includes nucleic acid extension blocking modification located between the folded sequence and the second universal sequence;
[0100] Optionally, the 3' end of the folded sequence is modified with a nucleic acid analog; and
[0101] (5) The capturing oligonucleotide also includes an enzyme recognition marker located at the 3' end of the second universal sequence or bound to the 5' end of the capturing sequence.
[0102] The universal sequence and universal primers are independent of the target molecule sequence.
[0103] In another preferred embodiment, the 3' terminal sequence of the universal primer is the same as or partially the same as the universal sequence.
[0104] In another preferred embodiment, the 3' terminal sequence of the universal primer has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 identical bases to the universal sequence.
[0105] In another preferred embodiment, the 3' end sequence of the universal primer is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the universal sequence.
[0106] In another preferred embodiment, the method (cutting method) includes the steps of:
[0107] (1) Capture oligonucleotides bind to target molecules with well-defined 3' end sequences by binding the capture sequence;
[0108] (2) The target molecule extends using the captured oligonucleotide as a template. A sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain the linear extension product of the target molecule.
[0109] (3) The enzyme specifically recognizes the target molecule's linear elongation product and the enzyme cleavage site in the capture oligonucleotide binding dimer and cleaves it to obtain the capture oligonucleotide cleavage product containing the free 3' end.
[0110] (4) The capture oligonucleotide cleavage product containing a free 3' end is extended using the linear extension product of the target molecule as a template. A sequence complementary to the target molecule is added to the 3' end of the capture oligonucleotide cleavage product containing a free 3' end and terminated at the 5' end of the target molecule to obtain the capture oligonucleotide extension product.
[0111] (5) Capture oligonucleotide extension products bind to the folded sequence within the capture oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule, forming a half-hairpin structure product.
[0112] (6) The half-hairpin structure product undergoes an extension reaction under the action of polymerase, and a nucleotide complementary to the first universal sequence in the molecule is added to the 3' end to form a complete hairpin structure product.
[0113] (7) Using the complete hairpin structure product as a template, amplification was performed using universal primers to obtain an amplification product with the first universal primer sequence (U2a) and the complementary sequence of the second universal primer (U1s) at the 5' and 3' ends, respectively, and the target molecule sequence in the middle.
[0114] In another preferred embodiment, the method further includes the step of: (8) using a probe and detecting a probe signal.
[0115] In another preferred embodiment, the universal sequence and universal primer are independent of the target molecule sequence.
[0116] In another preferred embodiment, the target molecule is a target molecule with well-defined 3' and 5' end sequences.
[0117] In another preferred embodiment, the target molecule with well-defined 3' and 5' end sequences is a DNA digestion product of a site-specific cleavage nuclease, preferably a target molecule with well-defined sequences at both ends due to site-specific cleavage nuclease digestion.
[0118] In another preferred embodiment, the site-specific cleaving nuclease is an exonuclease and / or an endonuclease.
[0119] In another preferred embodiment, the endonuclease is a restriction endonuclease.
[0120] In another preferred embodiment, the endonuclease is selected from any one or more of methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, or mismatch repair enzymes.
[0121] In another preferred embodiment, the methylation-dependent restriction endonuclease includes any one or two or more selected from Gla I, FspEI, MspJI, and LpnPI.
[0122] In another preferred embodiment, the enzyme that identifies the cleavage recognition marker contained in the captured oligonucleotide is selected from one or more of the following: 3'Tth endonuclease, thermostable mismatch repair enzyme, and thermostable RNase H.
[0123] In a fourth aspect of the invention, a nucleic acid detection system is provided, the system comprising the capture oligonucleotides described in the first aspect of the invention or the composition or kit described in the second aspect of the invention, Taq polymerase, dNTPs, MgCl2, and PCR buffer.
[0124] In another preferred embodiment, the system comprises 1–100 nM of the capture oligonucleotides described in the first aspect of the invention, 1–5 U (preferably 1–2 U) of Taq polymerase, 50–500 μM (preferably 100–300 μM) of dNTPs, 1–5 mM (preferably 1–3 mM) of MgCl2, and PCR buffer.
[0125] In another preferred embodiment, the system further includes primers (universal primers) and probes.
[0126] In another preferred embodiment, the probe includes a specific probe, a universal probe, or a combination thereof.
[0127] In another preferred embodiment, the system further includes 100–800 nM (preferably 100–400 nM) universal primers.
[0128] In another preferred embodiment, the system further includes a 100–600 nM (preferably 100–300 nM) probe.
[0129] In another preferred embodiment, the system further includes at least 20 U (preferably 1–10 U) of 3'Tth endonuclease, a thermostable mismatch repair enzyme, and / or a thermostable RNase H enzyme.
[0130] In another preferred embodiment, the system further includes 1-20 U (preferably 5-15 U) of site-specific cleaving nuclease; preferably exonuclease and / or endonuclease.
[0131] In another preferred embodiment, the universal primers and probes are as described in the second aspect of the invention.
[0132] In another preferred embodiment, the endonuclease is a restriction endonuclease.
[0133] In another preferred embodiment, the endonuclease is selected from the group consisting of: methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
[0134] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspEI, MspJI, LpnPI, or combinations thereof.
[0135] In a fifth aspect of the invention, the application of the capture oligonucleotides described in the first aspect of the invention, the composition or kit described in the second aspect of the invention, and / or the nucleic acid detection system described in the fourth aspect of the invention in the preparation of nucleic acid detection products is provided.
[0136] In another preferred embodiment, the nucleic acid detection product is a DNA methylation detection product.
[0137] In another preferred embodiment, the product is selected from the group consisting of: reagent kits, devices, computer-readable media, or combinations thereof.
[0138] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and are not intended to limit this disclosure. Attached Figure Description
[0139] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention. It is obvious that the drawings described below are merely some embodiments of the invention, and those skilled in the art can obtain other drawings based on these drawings without any inventive effort.
[0140] Figure 1 shows (A) the amplification principle of capturing oligonucleotides containing enzyme digestion recognition markers; (B) the amplification principle of capturing oligonucleotides without enzyme digestion recognition markers; and (C) the amplification results of the two methods involved in this study, i.e., amplification plots, where ΔRn is the fluorescence intensity difference between the two amplifications. Wherein, 1 represents the amplification result of method 1 (cutting method, containing enzyme digestion recognition markers) combined with the target sequence after processing; 2 represents the amplification result of method 2 (direct method, without enzyme digestion recognition markers) combined with the target sequence after processing; 3 represents the amplification result of method 1 (cutting method, containing enzyme digestion recognition markers) combined with the target sequence without processing; and 4 represents the amplification result of method 2 (direct method, without enzyme digestion recognition markers) combined with the target sequence without processing.
[0141] Figure 2 shows a comparison between the capture oligonucleotides involved in this invention and the prior art (CN114717298A). (A) The capture oligonucleotide design involved in this invention; (B) The capture oligonucleotide design involved in the prior art (CN114717298A).
[0142] Figure 3 shows the addition of a universal probe sequence to the captured oligonucleotide; 1 / 3 / 5 are target molecule-specific probe detections; 2 / 4 / 6 are universal probe detections. 1 / 2 represents 2000 copies / reaction; 3 / 4 represents 200 copies / reaction; 5 / 6 are negative controls.
[0143] Figure 4 shows the sensitivity test results. The target molecule concentrations for 1 / 2 / 3 / 4 were 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, with a negative control.
[0144] Figure 5 shows the methylation detection of oligonucleotides captured by locked nucleic acid modification. The target molecule concentrations for 1 / 2 / 3 / 4 were 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, with a negative control.
[0145] Figure 6 shows the results of LINE-1 gene demethylation based on methylation-sensitive restriction endonuclease treatment.
[0146] Figure 7 shows the detection of Mycobacterium tuberculosis based on methylation-sensitive restriction endonuclease treatment. The target molecule concentrations for 1 / 2 / 3 / 4 were 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, with a negative control.
[0147] Figure 8 illustrates the amplification principle without Tth Endonuclease IV. In the figure, 1 represents the amplification result of a hypermethylated target sequence with 100 copies / reaction after GlaI treatment; 2 represents the amplification result of a hypomethylated target sequence with 10,000 copies / reaction after GlaI treatment; and 3 represents the negative control. Detailed Implementation
[0148] Exemplary embodiments will now be described more fully with reference to the accompanying drawings. However, these exemplary embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, they are provided so that the invention will be thorough and complete, and the concept of the exemplary embodiments will be fully conveyed to those skilled in the art.
[0149] Unless otherwise defined, all terms and phrases used herein include their meanings as they have in the art, unless explicitly stated otherwise or clearly indicated from the context of their use. While any methods and materials similar to or equivalent to those described herein may be used in carrying out or testing the invention, specific methods and materials are now described.
[0150] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as embodiments) can be combined with each other to form preferred technical solutions.
[0151] Through extensive and in-depth research, the inventors unexpectedly discovered for the first time the method of capturing target molecules using capture oligonucleotides, followed by extension of the target molecules using the capture oligonucleotides as templates, and then linear amplification using universal primers. This yields an intermediate sequence containing different universal primer sequences at both ends, which can be exponentially amplified by universal primers, with the target molecule sequence in the middle. Subsequently, exponential amplification guided by universal primers and / or capture oligonucleotides is performed on the intermediate sequence obtained from linear amplification. Based on this, the present invention was completed.
[0152] Capture oligonucleotides
[0153] This invention provides a capture oligonucleotide for nucleic acid amplification, wherein the capture oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence (U2a), a folded sequence (1s), a second universal sequence (U1a), and a binding capture sequence (2a); wherein,
[0154] (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule;
[0155] (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule;
[0156] (3) The capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and
[0157] (4) The capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence.
[0158] The universal sequence is independent of the target molecule sequence.
[0159] Typically, the capture oligonucleotides described in this invention also include nucleic acid analog modifications:
[0160] Preferably, (5) the 3' end of the binding capture sequence is modified with a nucleic acid analog; and / or
[0161] Preferably, (6) the 3' end of the folded sequence is modified with a nucleic acid analog.
[0162] Typically, there are two options for capturing oligonucleotides as described in this article.
[0163] In a preferred embodiment of the present invention, the first selection of the capturing oligonucleotide may be a first universal sequence, a folded sequence, a second universal sequence, and a binding capture sequence from 5' to 3'; wherein, the folded sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, the capturing oligonucleotide further includes an enzyme cleavage recognition marker located at the 3' end of the second universal sequence or the 5' end of the binding capture sequence, the capturing oligonucleotide further includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence, the 3' end of the folded sequence of the capturing oligonucleotide has a nucleic acid analog modification, and the universal primer is independent of the target molecule sequence.
[0164] In another preferred embodiment of the invention, the second choice of the capturing oligonucleotide may be a first universal sequence, a folded sequence, a second universal sequence, and a binding capture sequence from 5' to 3', wherein the folded sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, the capturing oligonucleotide further includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence, the 3' end of the folded sequence of the capturing oligonucleotide has a nucleic acid analog modification, and the universal primer is independent of the target molecule sequence.
[0165] The complementarity described herein includes complete complementarity and partial complementarity. Generally, for a nucleic acid strand requiring extension, its 3' end sequence must be at least 90% complementary to the corresponding complementary strand, for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or completely complementary, as long as it does not affect the extension of the nucleic acid strand. For example, in the complementarity of the binding capture sequence of a target molecule and a capturing oligonucleotide, the target molecule is the nucleic acid strand requiring extension, and its 3' end sequence is at least 90% complementary or completely complementary to the binding capture sequence (i.e., the 3' end nucleic acid of the target molecule has a paired base on the capturing oligonucleotide). As another example, in the complementarity of a universal primer and the linear extension product of a target molecule, the universal primer is the nucleic acid strand requiring extension, and its 3' end sequence is at least 90% complementary or completely complementary to the linear extension product sequence of the target molecule.
[0166] The target molecule, with clearly defined 3' and 5' sequence information, binds complementary to the binding capture sequence of the capturing oligonucleotide. Subsequently, using the capturing oligonucleotide as a template, the target molecule extends by adding a complementary strand of a second universal sequence to its 3' end (as shown in Figure 1). To prevent the capturing oligonucleotide itself from extending, it may optionally include a nucleic acid extension-blocking modification. This modification is typically located at the 3' end of the binding capture sequence. The modification contains substances that can block DNA polymerase extension, preventing the capturing oligonucleotide from extending to the 3' end and thus forming a complementary strand of the target molecule that affects subsequent binding and extension of the capturing oligonucleotide. Modifications that block DNA polymerase extension include: spacers, thio groups, thiol groups, amino or uracil bases.
[0167] In this embodiment of the invention, the capture oligonucleotide having the aforementioned nucleic acid extension modification is modified with a spacer to bind the capture sequence. To further enhance the effect of nucleic acid extension blocking, a nucleic acid analog modification may also be included at the 3' end of the binding capture sequence of the capture oligonucleotide. The nucleic acid analog comprises one or more selected from the following: peptide nucleic acid, locked nucleic acid, 2'-O,4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine, or 2'-fluoroRNA.
[0168] In this invention, in embodiments requiring enzyme recognition and cleavage for amplification, an enzyme recognition marker can be added to the 3' end of the second universal sequence of the captured oligonucleotide or to the 5' end of the binding capture sequence. This generates free ends through enzyme recognition and cleavage, thereby enabling extension and amplification. The enzyme recognition marker modification includes / idsP / and RNA base modification. The recognition enzyme includes a 3' Tth endonuclease, a thermostable mismatch repair enzyme, and a thermostable RNase H.
[0169] In this invention, the first universal sequence and the second universal sequence can be artificially synthesized sequences. Therefore, when detecting different target molecules, only the binding capture sequence of the capturing oligonucleotide needs to be designed according to the target molecule, while the first universal sequence and the second universal sequence can remain unchanged. In some embodiments, to reduce non-specific amplification, the binding capture sequence of the capturing oligonucleotide is designed according to different target molecules, while the first universal sequence and the second universal sequence remain unchanged, thereby achieving multiplex amplification detection. The length or base ratio of the universal sequence (universal primer) can be routinely adjusted according to the composition, length, and required specificity of the sequence to be amplified.
[0170] target molecules
[0171] In this invention, the target molecule can be a target molecule with clearly defined 3' and 5' sequence information (i.e., a well-defined sequence), or a target molecule with clearly defined 3' and 5' sequence information generated through biological treatment. The types of nucleic acid sequences with clearly defined 3' and 5' sequence information include normal nucleic acid sequences, modified nucleic acid sequences, single nucleotide mutations, sequence transpositions, sequence deletions, and sequence recombinations, among others.
[0172] Target molecules with clearly defined 3' and 5' end sequences, such as mature microRNAs, microRNA precursors, and cfDNA.
[0173] Intermediate products of target molecules with clearly defined 3' and 5' sequence information can be obtained through biological methods of cutting or blocking. These include products cleaved by site-specific nucleases, such as AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), restriction endonucleases, methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, giant nucleases, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), CRISPR-Cas systems, and mismatch repair enzymes. Methylation-dependent restriction endonucleases include GlaI, FspEI, MspJI, and LpnPI; methylation-sensitive restriction endonucleases include HpaII and SmaI; restriction endonucleases include MspI and Xmal; and CRISPR-Cas systems contain a guide short RNA that matches the target DNA fragment and an endonuclease that recognizes and cuts a specific sequence, such as CRISPR-Cas systems based on Cas9, Cas12, or Cas13.
[0174] Compositions, reagent kits
[0175] The present invention provides a composition or kit for nucleic acid amplification, the composition or kit comprising the capture oligonucleotides described above.
[0176] Typically, the present invention provides compositions or kits comprising the capturing oligonucleotides described in any embodiment herein for amplifying or detecting nucleic acids. Exemplary capturing oligonucleotides include capturing oligonucleotide 1 (BH1, SEQ ID NO:1-spacer18-SEQ ID NO:2), capturing oligonucleotide 3 (BH3, SEQ ID NO:1-spacer18-SEQ ID NO:9), capturing oligonucleotide 4 (BH4, SEQ ID NO:1-spacer18-SEQ ID NO:11), capturing oligonucleotide 5 (BH5, SEQ ID NO:12-spacer18-SEQ ID NO:13), capturing oligonucleotide 6 (BH6, SEQ ID NO:16-spacer18-SEQ ID NO:17), or capturing oligonucleotide 7 (BH7, SEQ ID NO:1-spacer18-SEQ ID NO:21). Exemplary modified capturing oligonucleotides include capturing oligonucleotide 1, capturing oligonucleotide 3, capturing oligonucleotide 4, capturing oligonucleotide 5, capturing oligonucleotide 6, or capturing oligonucleotide 7. The kit also includes reagents for generating target molecules with well-defined 3' and 5' end sequence information (e.g., target molecule pre-sequence pretreatment reagents), such as the aforementioned site-specific cleavage nucleases. The kit also includes DNA polymerase, dNTPs, and Mg... 2+ Any one or more of the following: enzyme digestion buffer, PCR buffer.
[0177] In addition, the kit includes universal primers. Specifically, the kit includes universal primers as described above. Exemplary universal primers are shown in SEQ ID NO:2 and 3.
[0178] When detecting different target molecules, it is only necessary to design the binding capture sequence of specific capture oligonucleotides according to the target molecules, while the universal primers can remain unchanged.
[0179] To detect nucleic acids, the kit may also include probes. In some embodiments, the probes are labeled with a fluorescent group and / or a quencher group. Typically, the fluorescent group is labeled at the 5' end of the detection probe, and the quencher group is labeled at the 3' end. The fluorescent group includes any one or more of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; the quencher group includes any one or more of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra. Exemplary probes are shown in SEQ ID NO: 5, 10, or 18.
[0180] The kit may also include reagents required for sequencing, which are well known to those skilled in the art, such as polymerases, sequencing primers, etc.
[0181] Nucleic acid amplification or detection methods
[0182] The present invention provides a method for nucleic acid amplification or detection, the method comprising the step of using a capture oligonucleotide to bind a target molecule, wherein the capture oligonucleotide is as described in the first aspect of the present invention.
[0183] Typically, the present invention provides a method for nucleic acid amplification or detection, the method comprising the steps of:
[0184] (a) Using capture oligonucleotides to bind to target molecules (i.e., using capture oligonucleotides to bind to target molecules);
[0185] (b) Linear elongation of the target molecule;
[0186] (d) Exponential amplification using universal primers,
[0187] The capturing oligonucleotide from 5' to 3' includes a first universal sequence (U2a), a 1s fold sequence, a second universal sequence (U1a), and a binding capture sequence (2a); wherein,
[0188] (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule;
[0189] (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule;
[0190] (3) The capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and
[0191] (4) The capture oligonucleotide also includes nucleic acid extension blocking modification located between the folded sequence and the second universal sequence;
[0192] Optionally, the 3' end of the folded sequence is modified with a nucleic acid analog;
[0193] Optionally, the capturing oligonucleotide further includes an enzyme cleavage recognition tag located at the 3' end of the second universal sequence or binding to the 5' end of the capturing sequence;
[0194] The universal sequence and universal primers are independent of the target molecule sequence.
[0195] In a preferred embodiment of the present invention, the 3' end sequence of the universal primer is the same as or partially the same as the universal sequence.
[0196] Typically, “partially identical” means that two sequences are 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0197] Typically, "partially identical" means that the two sequences have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 identical bases. In a preferred embodiment of the invention, the 3' terminal sequence of the universal primer has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 identical bases to the universal sequence.
[0198] In a preferred embodiment of the present invention, the nucleic acid amplification or detection method is a non-diagnostic nucleic acid amplification or detection method.
[0199] The nucleic acid amplification or detection methods can be further divided into cutting methods that include enzyme step (c) enzyme-specific recognition and cutting steps, and direct methods that do not include step (c).
[0200] In a preferred embodiment of the present invention, the cleavage method includes the steps of capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of target molecules, enzyme-specific recognition and cleavage, and exponential amplification using universal primers. Specifically, the method includes the following steps:
[0201] (1) Capture oligonucleotides bind to target molecules with well-defined 3' end sequences by binding the capture sequence;
[0202] (2) The target molecule extends using the captured oligonucleotide as a template. A sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain the linear extension product of the target molecule.
[0203] (3) The enzyme specifically recognizes the target molecule's linear elongation product and the enzyme cleavage site in the capture oligonucleotide binding dimer and cleaves it to obtain the capture oligonucleotide cleavage product containing the free 3' end.
[0204] (4) The capture oligonucleotide cleavage product containing a free 3' end is extended using the linear extension product of the target molecule as a template. A sequence complementary to the target molecule is added to the 3' end of the capture oligonucleotide cleavage product containing a free 3' end and terminated at the 5' end of the target molecule to obtain the capture oligonucleotide extension product.
[0205] (5) Capture oligonucleotide extension products bind to the folded sequence within the capture oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule, forming a half-hairpin structure product.
[0206] (6) The half-hairpin structure product undergoes an extension reaction under the action of polymerase, and a nucleotide complementary to the first universal sequence in the molecule is added to the 3' end to form a complete hairpin structure product.
[0207] (7) Using the complete hairpin structure product as a template, amplification was performed using universal primers to obtain an amplification product with the first universal primer sequence (U2a) and the complementary sequence of the second universal primer (U1s) at the 5' and 3' ends, respectively, and the target molecule sequence in the middle.
[0208] The amplification may optionally also include the use of probes.
[0209] In a preferred embodiment of the present invention, the direct method includes the steps of capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of the target molecule, and exponential amplification using universal primers. Specifically, the method includes:
[0210] (1) Capture oligonucleotides bind to target molecules with well-defined 3' end sequences by binding the capture sequence;
[0211] (2) The target molecule extends using the captured oligonucleotide as a template. A sequence complementary to the second universal sequence is added to the 3' end of the target molecule to obtain the linear extension product of the target molecule.
[0212] (3) The second universal primer binds to the linear extension product of the target molecule, and the linear extension product of the target molecule is used as a template to extend and terminate at the 5' end of the target molecule to obtain the linear extension product of the second universal primer.
[0213] (4) The linear extension product of the second universal primer binds to and extends the folded sequence of the captured oligonucleotide, and the complementary sequence of the first universal sequence (U2a) is added to the 3' end to obtain the linear extension product of the first universal primer;
[0214] (5) Based on the first universal primer and the second universal primer, exponential amplification is performed to obtain an amplification product with the first universal primer sequence (U2a) and the complementary sequence of the second universal primer (U1s) at the 5' and 3' ends, respectively, and the target molecule sequence in the middle.
[0215] The amplification may optionally also include the use of probes.
[0216] Testing system
[0217] The present invention provides a nucleic acid detection system, the system comprising the capture oligonucleotides described in the first aspect of the present invention or the composition or kit described in the second aspect of the present invention, Taq polymerase, dNTPs, MgCl2 and PCR buffer.
[0218] Typically, the detection system also includes primers (universal primers) and probes (specific probes, universal probes).
[0219] Methylation detection system
[0220] In a specific implementation, the present invention relates to a methylation detection system, mainly comprising two parts: methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonuclease treatment, and fluorescent PCR technology based on capture oligonucleotides and / or universal primers for amplification. This methylation detection system involves enzymatic digestion of target gene sequences using methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonucleases; and involves fluorescent PCR amplification of the digestion products of methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonucleases. Preferably, the methylation detection system includes capture oligonucleotides, probes, and universal primers, as described elsewhere herein.
[0221] The methylation detection system involves two choices of capture oligonucleotides:
[0222] The first option may be a sequence from 5' to 3' including a first universal sequence, a folded sequence, a second universal sequence, and a binding capture sequence, wherein the folded sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, the capturing oligonucleotide further includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence, preferably, the 3' end of the folded sequence of the capturing oligonucleotide has a nucleic acid analog modification, the capturing oligonucleotide further includes an enzyme cleavage recognition tag located at the 3' end of the second universal sequence or the 5' end of the binding capture sequence, and the universal primer is independent of the target molecule sequence.
[0223] In a preferred embodiment of the invention, the 3' end of the binding capture sequence is modified with a nucleic acid analog.
[0224] In another preferred embodiment of the invention, the binding capture sequence 3' end is modified with a nucleic acid analog, and the folded sequence 3' end is modified with a nucleic acid analog.
[0225] The second option can be a sequence from 5' to 3' including a first universal sequence, a folded sequence, a second universal sequence, and a binding capture sequence, wherein the folded sequence is at least partially identical to the 5' end sequence of the target molecule, the binding capture sequence is complementary to the 3' end sequence of the target molecule, the capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the capturing oligonucleotide further includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence. Preferably, the 3' end of the folded sequence of the capturing oligonucleotide has a nucleic acid analog modification, and the universal primer is independent of the target molecule sequence.
[0226] In a preferred embodiment of the invention, the 3' end of the binding capture sequence is modified with a nucleic acid analog.
[0227] In another preferred embodiment of the invention, the binding capture sequence 3' end is modified with a nucleic acid analog, and the folded sequence 3' end is modified with a nucleic acid analog.
[0228] Typically, the capture oligonucleotides involved in the methylation detection system are modified with nucleic acid analogs; preferably, the nucleic acid analogs include any one or a combination of at least two of peptide nucleic acids, locked nucleic acids, transposed bases, spacers, 2'-O,4'-C-methylated bridging RNA, 2'-methoxy modified bases, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoroRNA, or 2'-fluoroRNA. The preferred nucleic acid analog modifications described above are applied to the 3' end of the capture sequence or the 3' end of the folded sequence of the capture oligonucleotide.
[0229] In an embodiment of the present invention, the probes (including specific probes and universal probes) involved in the methylation detection system are labeled with a fluorescent group and a quenching group at both ends.
[0230] Preferred fluorescent detection groups are selected from the following group: FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LC RED460, or combinations thereof.
[0231] The preferred quenching groups are selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or combinations thereof.
[0232] This invention provides two methods for the above-mentioned fluorescence PCR amplification detection:
[0233] The first method includes the steps of capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of target molecules, enzyme-specific recognition and cleavage, and exponential amplification with universal primers.
[0234] Specifically, the method includes: (1) capturing oligonucleotides binding to target molecules with clearly defined 3' end sequences by binding capture sequences; (2) extending the target molecule using the capturing oligonucleotide as a template by adding a sequence complementary to the second universal sequence to the 3' end of the target molecule to obtain a linear extension product of the target molecule; (3) enzyme-specifically recognizing and cleaving the target molecule linear extension product and the capturing oligonucleotide binding dimer to obtain a capturing oligonucleotide cleavage product containing a free 3' end; (4) using the target molecule linear extension product as a template to perform an extension reaction, adding a sequence complementary to the target sequence to the 3' end of the capturing oligonucleotide cleavage product containing the free 3' end. The target molecule terminates at its 5' end with a complementary sequence to the target molecule, yielding a capture oligonucleotide extension product. (5) The capture oligonucleotide extension product binds to the folded sequence within the capture oligonucleotide through the extended sequence complementary to the 5' end sequence of the target molecule, forming a half-hairpin structure product. (6) The half-hairpin structure product undergoes an extension reaction under the action of polymerase, adding a nucleotide complementary to the first universal sequence within the molecule at the 3' end to form a complete hairpin structure product. (7) Using the complete hairpin structure product as a template, amplification is performed using universal primers to obtain an amplification product containing the first universal primer sequence (U2a) and the second universal primer complementary sequence (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle. The amplification optionally also includes the use of a probe.
[0235] The second method involves steps including capturing oligonucleotides to bind to target molecules (i.e., capturing oligonucleotides to bind to target molecules), linear extension of target molecules, and exponential amplification using universal primers.
[0236] Specifically, the method includes: (1) capturing oligonucleotides by binding the capture sequence to a target molecule with a clearly defined 3' end sequence; (2) extending the target molecule using the capture oligonucleotide as a template, adding a sequence complementary to the second universal sequence to the 3' end of the target molecule to obtain a linear extension product of the target molecule; (3) binding the second universal primer to the linear extension product of the target molecule, extending it using the linear extension product of the target molecule as a template, and terminating at the 5' end of the target molecule to obtain a linear extension product of the second universal primer; (4) binding the linear extension product of the second universal primer to the folded sequence of the capture oligonucleotide and extending it, adding a complementary sequence of the first universal sequence (U2a) to the 3' end to obtain a linear extension product of the first universal primer; and (5) performing exponential amplification based on the first universal primer and the second universal primer to obtain an amplification product containing the first universal primer sequence (U2a) and the complementary sequence of the second universal primer (U1s) at the 5' and 3' ends, respectively, and containing the target molecule sequence in the middle. The amplification optionally also includes the use of a probe.
[0237] In a specific embodiment of the present invention, methylation sites in the Septine 9 gene, as described in SEQ ID NO:7, are detected using the following two methods:
[0238] Scheme 1: As shown in Figure 1A, capture oligonucleotide 1 (BH1) is contacted with GlaI-digested DNA. Capture oligonucleotide 1 (BH1) binds complementary to target molecule 1 as shown in SEQ ID NO:7. Target molecule 1 extends using capture oligonucleotide 1 (BH1) as a template by adding a sequence complementary to SEQ ID NO:2 of capture oligonucleotide 1 (BH1) to the 3' end of the target molecule, obtaining the extended target molecule (i.e., the linear extension product of the target molecule). The dimer of the extended target molecule and capture oligonucleotide 1 (BH1) as shown in SEQ ID NO:1-spacer18-SEQ ID NO:2 can be recognized and cleaved by 3'Tth endonuclease, thermostable mismatch repair enzyme, and thermostable RNase H. The cleaved product can be linearly extended using the extended target molecule as a template. The extended product folds due to the presence of the complementary sequence, thus forming a product with a complete hairpin structure. This hairpin structure product can be obtained using universal primers as shown in SEQ ID NO:3 and SEQ ID NO:4 and primers as shown in SEQ ID NO:7. The probe shown in NO:5 was amplified, and the probe signal was detected.
[0239] Scheme 2: As shown in Figure 1B, the capturing oligonucleotide 7 (BH7) is contacted with GlaI-digested DNA. The capturing oligonucleotide 7 (BH7) binds complementary to the target molecule 1 shown in SEQ ID NO:7. The target molecule 1 is extended using the capturing oligonucleotide 7 (BH7) as a template by adding a sequence complementary to SEQ ID NO:21 of the capturing oligonucleotide 7 (BH7) to the 3' end, obtaining the extended target molecule (i.e., the linear extension product of the target molecule). The extended target molecule binds complementary to the second universal primer SEQ ID NO:4. The second universal primer SEQ ID NO:4 is used as a template for the extension reaction to obtain a sequence complementary to the extended target molecule (i.e., 5'U1a-2a-1a 3'). This sequence can bind complementary to SEQ ID NO:21 of the capturing oligonucleotide 7 (BH7). NO:1 complementarity (i.e., 1a:1s complementarity) binding extension forms a single-stranded product (i.e., 5'U1a-2a-1a-U2s 3') with the second universal primer sequence (U1a) and the first universal primer complement sequence (U2s) at the 5' and 3' ends, respectively, and the target molecule sequence in the middle; finally, amplification is performed using the universal primers shown in SEQ ID NO:3 and SEQ ID NO:4 and the probe shown in SEQ ID NO:5, and the probe signal is detected.
[0240] The main advantages of this invention include:
[0241] Compared with existing methylation detection technologies based on the conversion of bisulfite, the present invention has the following advantages:
[0242] (1) The cfDNA methylation detection technology of the present invention does not require cumbersome chemical treatment and purification processes. The present invention can only trigger amplification when both the 3' end and 5' end are mediated by methylation sites. It can effectively suppress false positives caused by random fragmentation of cfDNA, improve the specificity of amplification, and is more suitable for the detection of methylation of cfDNA with a high degree of fragmentation.
[0243] (2) The capture oligonucleotides and universal primers in this invention are specially designed so that when target molecules are present in the environment, they can trigger an extension reaction mediated by the capture oligonucleotides and amplify the signal through subsequent exponential amplification to meet the sensitivity requirements for cfDNA methylation detection.
[0244] Compared with existing methylation-dependent restriction endonuclease-based technologies (ZL 202111389443.0) and multiplex amplification methods (CN114717298A), this invention has the following advantages:
[0245] (1) The amplification method described in this invention requires only one terminally extended and closed capture oligonucleotide and a pair of universal primers to detect methylation. This unique design structure, compared to the prior art (ZL 202111389443.0), not only eliminates the problem of simultaneous presence of oligonucleotide adapters and capture oligonucleotides required by the prior art, reducing the number of primers required, but also forms a hairpin structure and is treated with USER enzyme during the amplification process, making the operation simpler. Compared to the prior art (CN114717298A), the 3'-closed capture oligonucleotide designed in this invention can only initiate the extension of the target molecule when both the 3' and 5' end sequences are clearly defined, improving the detection specificity. Moreover, it can directly utilize 3'Tth endonuclease, thermostable mismatch repair enzyme, and thermostable RNase H-mediated exponential amplification based on capture oligonucleotides modified with enzyme recognition sites and universal primers, improving the amplification efficiency and detection sensitivity.
[0246] (2) When performing methylation detection on different target molecules, this invention only needs to design the binding capture sequence and folding region of the specific capture oligonucleotide according to the target molecule, while keeping the universal primer unchanged. This reduces the interference between multiple primers that are prone to occur during the amplification of multiple target molecules, improves the sensitivity of the reaction, and thus enables the detection of methylation of multiple target molecules.
[0247] The following detailed description of the long-term COVID-19 diagnostic biomarker set provided by the invention is illustrated with specific embodiments.
[0248] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in *Molecular Cloning: A Laboratory Guide* by Sambrook J. et al. (translated by Huang Peitang et al., Beijing: Science Press, 2002), or according to the manufacturer's recommendations (e.g., product instructions). Unless otherwise stated, percentages and parts are by weight. Unless otherwise specified, the experimental materials and reagents used in the following embodiments are commercially available or can be prepared according to literature methods.
[0249] Example 1: Detection of methylation of human Septine 9 gene fragment DNA by ultrasound based on the amplification principle of capturing oligonucleotides containing enzyme recognition markers.
[0250] (1) Obtain methylated Jurka genomic DNA and sequence it to identify the methylation status of the Septine9 gene.
[0251] (2) The DNA treated with the above-mentioned ultrasonic fragments was digested by the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10U GlaI, DNA (20000 copies / reaction), with a total volume of 10μL. The reaction conditions were: incubation at 37℃ for 1 hour. After the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.
[0252] (4) Add the capture oligonucleotide of the Septine 9 gene and universal primers to the above enzyme digestion system for amplification. The reaction system is as follows: enzyme-digested sonicated fragment DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 10 U Tth Endonuclease IV, 25 mM ZnCl2, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.
[0253] The combination of capture oligonucleotides, universal primers, and specific probes used includes:
[0254] Capture oligonucleotide 1, abbreviated as BH1 (the italicized form is the 2'-methoxy modified base).
[0255] The sequence to the left of spacer18:
[0256] The sequence number is SEQ ID NO:1;
[0257] The sequence to the right of spacer18:
[0258] The sequence number is SEQ ID NO:2;
[0259] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:2 are connected to spacer18, respectively.
[0260] First universal primer
[0261] Second universal primer
[0262] Specific probes
[0263] 5'FAM-ACCAGCCATCATGTCGGAC-MGB(SEQ ID NO:5)
[0264] The partial sequence of the human Septine 9 gene (pre-target sequence 1) is as follows: / / indicates the restriction site, and CG before and after it indicates the methylation site.
[0265] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC(SEQ ID NO:6, where positions 18 to 62 are the sequence of target molecule 1, and the sequence number of target molecule 1 is SEQ ID NO:7)
[0266] The 3' end of the captured oligonucleotide has a spacer C3 to block elongation. The enzyme digestion recognition cleavage is mediated by a 3'Tth endonuclease, used at a concentration of 10 U during amplification. Figure 1C illustrates that this invention can detect the Septine 9 gene in methylated DNA.
[0267] Example 2: Detection of human Septine 9 gene DNA methylation based on the amplification principle of capturing oligonucleotides containing enzyme cleavage recognition markers.
[0268] (1) Obtain methylated Jurka genomic DNA and sequence it to identify the methylation status of the Septine9 gene.
[0269] (2) The DNA treated with the above-mentioned ultrasonic fragments was digested by the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10U GlaI, DNA (20000 copies / reaction), with a total volume of 10μL. The reaction conditions were: incubation at 37℃ for 1 hour. After the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.
[0270] (3) Add the capture oligonucleotide of the Septine 9 gene and universal primers to the above enzyme digestion system for amplification. The reaction system is as follows: enzyme-digested sonicated fragment DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 10 U Tth Endonuclease IV, 25 mM ZnCl2, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.
[0271] The combination of capture oligonucleotides, universal primers, and specific probes used includes:
[0272] Capture oligonucleotide 1, abbreviated as BH1 (the italicized form is the 2'-methoxy modified base).
[0273] The sequence to the left of spacer18:
[0274] The sequence number is SEQ ID NO:1;
[0275] The sequence to the right of spacer18:
[0276] The sequence number is SEQ ID NO:2;
[0277] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:2 are connected to spacer18, respectively.
[0278] The capture oligonucleotide 2, abbreviated as BH2 (the italicized form is the 2' methoxy modified base), in the reference file (CN114717298A) is compared to this.
[0279] The sequence to the left of spacer18:
[0280] The sequence number is SEQ ID NO:1;
[0281] The sequence to the right of spacer18:
[0282] TCATCGCAGTGTCGCCGTGG GCGACCCGCTGCCCA, sequence number SEQ ID NO:8;
[0283] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:8 are connected to spacer18, respectively.
[0284] First universal primer
[0285] Second universal primer
[0286] Specific probes
[0287] 5'FAM-ACCAGCCATCATGTCGGAC-MGB(SEQ ID NO:5)
[0288] The partial sequence of the human Septine 9 gene (pre-target sequence 1) is as follows: / / indicates the restriction site, and CG before and after it indicates the methylation site.
[0289] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC(SEQ ID NO:6, where positions 18 to 62 are the sequence of target molecule 1, and the sequence number of target molecule 1 is SEQ ID NO:7)
[0290] The differences between this invention and the prior art are as follows: (1) The target molecule described in this invention requires processing of its two ends to obtain a target molecule with a defined 3' and 5' end sequence, while the target molecule described in the prior art is a target molecule with a defined 5' end sequence. This design improves the specificity of detection. (2) The 3' end of the binding capture region of the capture oligonucleotide described in this invention has a Spacer C3 to block extension. Only when a specific target molecule binds to it can the target molecule be linearly extended. The 3' end of the binding capture region of the capture oligonucleotide described in the prior art has no modification. It only needs to bind to the target molecule to cause the capture oligonucleotide to extend. This design improves the specificity of detection. (3) The 3' end of the universal sequence or the 5' end of the binding capture sequence enzyme recognition marker contained in the capture oligonucleotide described in this invention is selected from one or more of the following: / idsP / and RNA base modification. Only when a specific target molecule binds to it can specific enzyme recognition and cleavage be caused, thereby causing the capture oligonucleotide to extend and subsequently exponentially amplify. The capture oligonucleotide described in the prior art does not have such a design. Figure 2 illustrates that, compared to the prior art design, the present invention can only be amplified by methylation-dependent restriction endonucleases, demonstrating high specificity; while the system described in the prior art can amplify even when faced with a high number of undigested target molecules.
[0291] Example 3: Experiments with different probe selections
[0292] To improve the flexibility of capture oligonucleotide detection, this embodiment adds a universal probe sequence between a universal primer sequence for capturing oligonucleotides and the binding capture sequence. The other capturing oligonucleotides and universal primers used are the same as in Example 1, as are the enzyme digestion and amplification conditions.
[0293] The captured oligonucleotides used include:
[0294] The capture oligonucleotides without a universal probe sequence are the same as in Example 1.
[0295] The capture oligonucleotide 3 containing a universal probe sequence, abbreviated as BH3 (the underlined region is the folded region, the 3' end of the folded sequence is a 2' methoxy modified base with italics, and the 3' end of the binding capture sequence is a 2' methoxy modified base with italics).
[0296] The sequence to the left of spacer18:
[0297] The sequence number is SEQ ID NO:1;
[0298] The sequence to the right of spacer18: The sequence number is SEQ ID NO:9;
[0299] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:9 are connected to spacer18, respectively.
[0300] Universal probe sequence
[0301] FAM-CGATGGCTGAGGATTCTG-MGB(SEQ ID NO:10)
[0302] The partial sequence of the human Septine 9 gene is shown in Example 1.
[0303] As shown in Figure 3, both capture oligonucleotides without and containing universal probe sequences showed amplification curves in the detection of 2000 copies and 200 copies of methylation-positive genomic DNA, indicating positive results. This demonstrates that both universal probe sequences and specific target molecule probe sequences can achieve highly sensitive methylation detection. However, in this embodiment, there was no significant difference between the two.
[0304] Example 4: Sensitivity Test
[0305] To test the sensitivity of this invention in detecting NA methylation, the capturing oligonucleotides, universal primers, and specific probes used in this embodiment were the same as in Example 1, as were the enzyme digestion and amplification conditions. As shown in Figure 4, positive results were observed when methylated positive genomic DNA was present at 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, while the negative control NC showed no amplification.
[0306] Example 5: Detection of methylation of locked nucleic acid-modified oligonucleotides
[0307] (1) Obtain methylated Jurka genomic DNA and sequence it to identify the methylation status of the Septine9 gene.
[0308] (2) The DNA treated with the above-mentioned ultrasonic fragments was digested by the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10U GlaI, DNA (20000 copies / reaction), with a total volume of 10μL. The reaction conditions were: incubation at 37℃ for 1 hour. After the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.
[0309] (3) Add the capture oligonucleotide of the Septine 9 gene and universal primers to the above enzyme digestion system for amplification. The reaction system is as follows: enzyme-digested sonicated fragment DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 10 U Tth Endonuclease IV, 25 mM ZnCl2, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.
[0310] The combination of universal primers, specific probes, and target molecule sequences used is the same as in Example 1, and the captured oligonucleotides include:
[0311] Capture oligonucleotide 4, abbreviated as BH4 (the base before the + is a locked nucleic acid modification, and the italicized 3' end of the folded sequence is a 2' methoxy modified base).
[0312] The sequence to the left of spacer18:
[0313] The sequence number is SEQ ID NO:1;
[0314] The sequence to the right of spacer18:
[0315] TCATCGCAGTGTCGCCGTGG GCGACC / idSp / GCTG+C+C+CA-Spacer C3, sequence number SEQ ID NO:11;
[0316] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:11 are connected to spacer18, respectively.
[0317] The capturing oligonucleotides have a spacer C3 at the 3' end of the folded sequence to block elongation. As shown in Figure 5, 200 copies and 100 copies of the positive template showed amplification curves, indicating positive results, while the negative control NC showed no amplification curve, indicating a negative result. This demonstrates that the capturing oligonucleotides modified with locked nucleic acids can be used in this invention for DNA methylation detection.
[0318] Example 6: Detection of DNA methylation of human LINE-1 gene fragments by ultrasound based on the amplification principle of capturing oligonucleotides without enzyme recognition markers.
[0319] (1) Obtain HELA genomic DNA and sequence it to identify the methylation status.
[0320] (2) DNA was digested using the methylation-sensitive restriction endonuclease HinP1I. The reaction system consisted of 1× digestion buffer, 10U HinP1I, and genomic DNA, with a total volume of 10μL. The reaction conditions were incubation at 37℃ for 1 hour.
[0321] (3) The captured oligonucleotides and universal primers of the treated gene were added to the above enzyme digestion system for amplification. The reaction system was as follows: enzyme-digested genomic DNA, 5 nM captured oligonucleotides, 0.5 U Taq DNA polymerase, 10 U Tth Endonuclease IV, 25 mM ZnCl2, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values were collected.
[0322] The combination of capture oligonucleotides, specific primers, universal primers, and specific probes used includes:
[0323] Capture oligonucleotide 5, abbreviated as BH5 (the italicized form is the 2'-methoxy modified base).
[0324] The sequence to the left of spacer18:
[0325] The sequence number is SEQ ID NO:12;
[0326] The sequence to the right of spacer18: The sequence number is SEQ ID NO:13;
[0327] The 3' end G of SEQ ID NO:12 and the 5' end C of SEQ ID NO:13 are connected to spacer18, respectively.
[0328] First universal primer
[0329] Second universal primer
[0330] Universal probe sequence
[0331] FAM-CGATGGCTGAGGATTCTG-MGB(SEQ ID NO:10)
[0332] The partial sequence of the human LINE-1 gene (pre-target sequence 2) is as follows: / / indicates the enzyme cleavage position, and CG before and after it indicates the methylation position.
[0333] CGAATATTGC / / GCTTTTCAGACCGGCTTAAGAAACGGC / / GCACCACGAGA(SEQ ID NO:14, where positions 11 to 37 are the sequence of target molecule 2, and the sequence number of target molecule 2 is SEQ ID NO:15)
[0334] The 3' end of the captured oligonucleotide has a spacer C3 to block elongation. Figure 6 illustrates that methylation-sensitive restriction endonuclease treatment can detect results for the unmethylated state.
[0335] Example 7: Detection of the IS6110 fragment of Mycobacterium tuberculosis based on the present invention
[0336] (1) Obtain Mycobacterium tuberculosis genomic DNA.
[0337] (2) DNA was digested using the restriction endonuclease FokI. The reaction system consisted of 1× digestion buffer, 10U FokI, and Mycobacterium tuberculosis genomic DNA, with a total volume of 10μL. The reaction conditions were incubation at 37℃ for 1 hour.
[0338] (3) Capture oligonucleotides and universal primers of the treated gene were added to the above enzyme digestion system for amplification. The reaction system was as follows: Mycobacterium tuberculosis genome after enzyme digestion, 5 nM capture oligonucleotides, 0.5 U Taq DNA polymerase, 10 U Tth Endonuclease IV, 25 mM ZnCl2, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values were collected.
[0339] The combination of capture oligonucleotides, specific primers, universal primers, and specific probes used includes:
[0340] Capture oligonucleotide 6, abbreviated as BH6 (the italicized form is the 2'-methoxy modified base).
[0341] The sequence to the left of spacer18:
[0342] The sequence number is SEQ ID NO:16;
[0343] The sequence to the right of spacer18: The sequence number is SEQ ID NO:17;
[0344] The 3' end G of SEQ ID NO:16 and the 5' end C of SEQ ID NO:17 are connected to spacer18, respectively.
[0345] First universal primer
[0346] Second universal primer
[0347] Specific probes
[0348] FAM-cgccggagctgcgtga-MGB(SEQ ID NO:18)
[0349] The partial sequence of the IS6110 gene of Mycobacterium tuberculosis (pre-target sequence 3) is as follows: / / indicates the enzyme cleavage site.
[0350] Gactccagttcttggaaaggatggggtcatgt / / caggtggttcatcgaggaggtaccc gccggagctgcgtgagcgggcggtgcggatggtcgcagag / / atc(SEQ ID NO:19, where positions 33 to 97 are the sequence of target molecule 3, and the sequence number of target molecule 3 is SEQ ID NO:20)
[0351] The 3' end of the captured oligonucleotide has a spacer C3 to block elongation. Figure 7 illustrates that, based on specific restriction endonuclease treatment, this invention can detect pathogenic microorganisms.
[0352] Example 8: Detection of methylation of human Septine 9 gene fragment DNA by ultrasound based on the amplification principle of capturing oligonucleotides without enzyme recognition markers.
[0353] (1) Obtain methylated Jurka genomic DNA and sequence it to identify the methylation status of the Septine9 gene.
[0354] (2) The DNA treated with the above-mentioned ultrasonic fragments was digested by the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10U GlaI, DNA (20000 copies / reaction), with a total volume of 10μL. The reaction conditions were: incubation at 37℃ for 1 hour. After the digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.
[0355] (4) Add the capture oligonucleotide of the Septine 9 gene and universal primers to the above enzyme digestion system for amplification. The reaction system is as follows: enzyme-digested sonicated fragment DNA, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl. The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ for 10 s, 66℃ for 90 s, 5 cycles; 95℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time fluorescence PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values are collected.
[0356] The combination of capture oligonucleotides, universal primers, and specific probes used includes:
[0357] Capture oligonucleotide 7, abbreviated as BH7 (the italicized form is the 2'-methoxy modified base).
[0358] The sequence to the left of spacer18:
[0359] The sequence number is SEQ ID NO:1;
[0360] The sequence to the right of spacer18:
[0361] The sequence number is SEQ ID NO:21;
[0362] The 3' end C of SEQ ID NO:1 and the 5' end T of SEQ ID NO:21 are connected to spacer18, respectively.
[0363] First universal primer
[0364] Second universal primer
[0365] Specific probes
[0366] 5'FAM-ACCAGCCATCATGTCGGAC-MGB(SEQ ID NO:5)
[0367] The partial sequence of the human Septine 9 gene (pre-target sequence 1) is as follows: / / indicates the restriction site, and CG before and after it indicates the methylation site.
[0368] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC(SEQ ID NO:6, where positions 18 to 62 are the sequence of target molecule 1, and the sequence number of target molecule 1 is SEQ ID NO:7)
[0369] The 3' end of the capturing oligonucleotide has a spacer C3 to block elongation. Figure 8 illustrates that this invention can detect the Septine 9 gene in methylated DNA.
[0370] Other embodiments of the invention will readily occur to those skilled in the art upon consideration of the specification and practice of the invention disclosed herein. This application is intended to cover any variations, uses, or adaptations of the invention that follow the general principles of the invention and include common knowledge or customary techniques in the art not disclosed herein. The specification and examples are to be considered exemplary only, and the true scope and spirit of the invention are indicated by the appended claims.
Claims
1. A capture oligonucleotide for nucleic acid amplification, characterized in that, The capturing oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence, a folded sequence, a second universal sequence, and a binding capture sequence; wherein... (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule; (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule; (3) The capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and (4) The capture oligonucleotide also includes a nucleic acid extension blocking modification located between the folded sequence and the second universal sequence. The universal sequence is independent of the target molecule sequence.
2. The captured oligonucleotide according to claim 1, characterized in that, The captured oligonucleotide also includes nucleic acid analog modifications: Preferably, (5) the 3' end of the binding capture sequence is modified with a nucleic acid analog; and / or, Preferably, (6) the 3' end of the folded sequence is modified with a nucleic acid analog.
3. The captured oligonucleotide according to claim 1, characterized in that, The nucleic acid extension blocking modification is selected from the group consisting of: Spacer, amino, C6, methyl, azide, phosphoramide, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or combinations thereof.
4. The captured oligonucleotide according to claim 2, characterized in that, The nucleic acid analog modification is selected from the group consisting of: peptide nucleic acid, locked nucleic acid, transposed base, spacer, 2'-O,4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine, 2-fluoroRNA, 2'-fluoroRNA, or combinations thereof.
5. A composition or kit for nucleic acid amplification, characterized in that, The composition or kit comprises the capture oligonucleotide as described in any one of claims 1-4.
6. The composition or kit according to claim 5, characterized in that, The composition or kit further includes a target molecule pre-sequence pretreatment reagent to obtain target molecules with well-defined 3' and 5' end sequences. Preferably, the pretreatment reagent comprises methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, nicking enzymes, CRISPR-Cas systems, mismatch repair enzymes, or combinations thereof.
7. The composition or kit according to claim 5 or 6, characterized in that, The composition or kit also includes universal primers and / or detection probes.
8. A method for nucleic acid amplification or detection for non-diagnostic purposes, characterized in that, The method includes the step of using a capture oligonucleotide to bind a target molecule, said capture oligonucleotide as described in claim 1.
9. The nucleic acid amplification or detection method according to claim 8, characterized in that, The method includes the following steps: (a) Using the capture oligonucleotide to bind target molecules; (b) Linear elongation of the target molecule; (d) Exponential amplification using universal primers, The capturing oligonucleotide from 5' to 3' includes a first universal sequence, a folded sequence, a second universal sequence, and a binding capture sequence; wherein, (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule; (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule; (3) The capturing oligonucleotide further includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; and (4) The capture oligonucleotide also includes nucleic acid extension blocking modification located between the folded sequence and the second universal sequence; Optionally, the 3' end of the folded sequence is modified with a nucleic acid analog; The universal sequence and universal primers are independent of the target molecule sequence.
10. The nucleic acid detection method according to claim 8, characterized in that, The method includes the following steps: (a) Using the capture oligonucleotide to bind target molecules; (b) Linear elongation of the target molecule; (c) Enzyme-specific recognition and cleavage; (d) Exponential amplification using universal primers; The capturing oligonucleotide from 5' to 3' includes a first universal sequence, a folded sequence, a second universal sequence, and a binding capture sequence; wherein, (1) The folded sequence is at least partially identical to the 5' end sequence of the target molecule; (2) The binding capture sequence is complementary to the 3' end sequence of the target molecule. (3) The capturing oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence; (4) The capture oligonucleotide also includes nucleic acid extension blocking modification located between the folded sequence and the second universal sequence; Optionally, the 3' end of the folded sequence is modified with a nucleic acid analog; and (5) The capturing oligonucleotide also includes an enzyme recognition marker located at the 3' end of the second universal sequence or bound to the 5' end of the capturing sequence. The universal sequence and universal primers are independent of the target molecule sequence.