PRNP-Targeting dsRNA Chemistry for Stronger mRNA Silencing
Find Innovative SolutionsGenerate Solutions
Solution Overview
Problem
Current technologies are inadequate in efficiently silencing PRNP mRNA expression to treat prion diseases such as Creutzfeldt-Jakob disease and Fatal familial insomnia, as misfolded prion proteins spread and cause neurodegeneration.
Innovation Solution
Development of double-stranded RNA (dsRNA) molecules with modified nucleotides and internucleotide linkages, specifically phosphorothioate linkages, targeting PRNP sequences to inhibit gene expression, administered via various routes including intrathecal and intracerebroventricular injections.
Engineering Contradictions & Design Principles
Engineering Contradiction Analysis
1Reliability
If conventional RNAi approaches are used to silence PRNP mRNA, then gene expression suppression is achieved, but the efficiency and potency are insufficient to effectively treat prion diseases
Solution Approach 1:
The patent applies parameter changes by modifying the chemical structure of RNA molecules through various nucleotide modifications (2'-O-methyl, 2'-fluoro, locked nucleic acids) and backbone modifications (phosphorothioate linkages). These chemical parameter changes enhance the stability, affinity, and immunomodulatory properties of the siRNA molecules, thereby improving both the reliability and efficiency of PRNP mRNA silencing while reducing off-target effects
Solution Approach 2:
The invention uses composite materials by creating chimeric siRNA molecules that combine different types of modified nucleotides and backbone linkages within a single RNA molecule. This composite approach allows optimization of multiple properties simultaneously: 2'-O-methyl modifications enhance stability, phosphorothioate linkages improve affinity and reduce degradation, and locked nucleic acids increase binding strength, collectively achieving superior silencing efficacy
2Stability of the object's composition
If modified nucleotides and phosphorothioate linkages are incorporated into dsRNA, then stability and affinity are improved, but manufacturing complexity increases
Solution Approach 1:
The patent applies segmentation by dividing the dsRNA molecule into distinct regions with different modifications: the antisense strand contains 2'-O-methyl and 2'-fluoro modifications for stability, the sense strand contains locked nucleic acid modifications for affinity, and specific positions contain phosphorothioate linkages for enhanced binding. This segmented modification strategy allows each region to be optimized independently while maintaining overall manufacturability through modular synthesis approaches
Applied Scientific Principles
This section explains which scientific principles are used to turn an abstract innovation direction into a practical engineering solution.
Function Achieved in This Case
The dsRNA effectively inhibits PRNP gene expression by at least 20-50% in targeted brain regions, reducing the spread of misfolded prion proteins and showing therapeutic potential in treating prion diseases.
Implementation Method 1
an antisense strand of UGAAUACUCACAAAGUGCAUU (SEQ ID NO: 1) and a sense strand of ACUUUGUGAGUAUUCA (SEQ ID NO: 2)
Implementation Method 2
the modified internucleotide linkage comprises a phosphorothioate internucleotide linkage
Data Source
AI summary
This disclosure relates to novel PRNP targeting sequences. Novel PRNP targeting oligonucleotides for the treatment of neurodegenerative diseases are also provided.