Vector for editing nicotiana benthamiana genes based on crisper / cas9 and construction method and application thereof

By constructing CRISPR/Cas9 editing vectors targeting the UbEF1B and CCR4/NOT genes of Nicotiana benthamiana, the problems of time-consuming, labor-intensive, and ineffective breeding of disease-resistant varieties in existing technologies have been solved. This has enabled efficient inhibition of TLCYnV and rapid acquisition of disease-resistant materials, which is suitable for research on resistance to geminiviruses.

CN111041043BActive Publication Date: 2026-04-07INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN201911411237.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2019-12-31
Publication Date
2026-04-07
Estimated Expiration
2039-12-31

AI Technical Summary

Technical Problem

Existing technologies for controlling Yunnan tomato leaf curl virus (TLCYnV) mainly rely on preventive measures, and chemical control causes serious pollution. Breeding disease-resistant varieties is time-consuming, labor-intensive, and ineffective. Existing vectors have unstable disease resistance and are difficult to effectively resist geminitrovirus infection.

Method used

We designed gRNAs targeting the UbEF1B and CCR4/NOT genes of Nicotiana benthamiana, constructed a CRISPR/Cas9 editing vector, and used these genes to resist TLCYnV infection by targeted editing. We then used the CRISPR/Cas9 system to achieve site-specific editing of endogenous genes in Nicotiana benthamiana and constructed an Agrobacterium-infectious cloning vector.

Benefits of technology

It achieved highly efficient inhibition of TLCYnV, significantly reduced virus accumulation, maintained normal plant growth, and did not affect phenotype. It provides a rapid and effective disease-resistant material, suitable for research on resistance to Nicotiana benthamiana and other geminiviruses dependent on the UbEF1B and CCR4/NOT genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN111041043B_ABST
    Figure CN111041043B_ABST
Patent Text Reader

Abstract

The application discloses a vector for editing Nicotiana benthamiana genes based on CRISPR / Cas9 and a construction method and application thereof, and comprises BKG-g10 and / or BKG-g11 vectors constructed for a UbEF1B gene of the Nicotiana benthamiana and / or BKG-g12 and / or BKG-g13 vectors constructed for a CCR4 / NOT gene of the Nicotiana benthamiana. After the UbEF1B gene or the CCR4 / NOT gene is edited by the vectors, the growth state of the Nicotiana benthamiana is normal, and the phenotype does not obviously change compared with a wild type; the vectors do not affect the traits of the Nicotiana benthamiana, and are beneficial to the continuation of offspring. Compared with a traditional breeding method, the CRISPR / Cas9 system can more quickly and effectively obtain disease-resistant materials by editing endogenous genes of the Nicotiana benthamiana.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of genetic engineering, in particular to a vector for editing Nicotiana benthamiana genes based on CRISPR / Cas9 and a construction method and application thereof. BACKGROUND

[0002] Tomato leaf curl Yunnan virus (TLCYnV) is mainly transmitted by Bemisia tabaci, and infected plants grow slowly, leaves fade and twist, and the harm is light to cause yield reduction and heavy to cause absolute yield reduction. At present, the disease caused by the virus has caused serious harm on many crops due to difficult management, and in addition to the prevention-based control measures, more effective control measures such as breeding and planting of disease-resistant varieties need to be sought.

[0003] At present, although some endogenous genes related to geminivirus have been identified in host plants, their further application value has not been improved in agricultural production and life. Moreover, as an important model plant for geminivirus research, it is particularly important to obtain more disease-resistant varieties in the subsequent research on virus pathogenesis and host disease resistance mechanism.

[0004] Under the current background conditions, there is still a great gap in the prevention and control of geminivirus:

[0005] (1) Under the current conditions, field virus-resistant engineering is mainly prevention, combined with control, and field breeding of disease-resistant varieties is time-consuming and laborious, and often does not achieve the desired effect;

[0006] (2) As an important model plant for geminivirus research, related geminivirus-resistant varieties need to be further improved, so as to better reveal the mechanism of virus-plant interaction;

[0007] (3) Geminivirus is mainly transmitted by insect vectors, and the use of a large amount of chemical reagents has seriously polluted the environment and biological safety;

[0008] (4) At present, the vectors for virus-resistant research using endogenous genes of Nicotiana benthamiana are mostly unstable in disease-resistant effect or affect the original phenotype of the host plant, and the effect is not ideal. SUMMARY

[0009] The application aims to provide a vector for editing Nicotiana benthamiana genes based on CRISPR / Cas9 and a construction method and application thereof. The application designs gRNAs for UbEF1B and CCR4 / NOT genes of the model plant Nicotiana benthamiana for TLCYnV research, and constructs an agrobacterium infectious cloning vector for realizing geminivirus resistance by editing the above endogenous genes.

[0010] To achieve the above object, the technical scheme adopted by the present application is as follows:

[0011] A vector for editing Nicotiana benthamiana genes based on CRISPR / Cas9, comprising pCambia 1300-BKG-g10, pCambia 1300-BKG-g11 (referred to as BKG-g10, BKG-g11) constructed for Nicotiana benthamiana UbEF1B gene and / or pCambia 1300-BKG-g12, pCambia 1300-BKG-g13 vector (referred to as BKG-g12, BKG-g13) constructed for Nicotiana benthamiana CCR4 / NOT gene.

[0012] The construction method of the above-mentioned vector is: selecting PAM sites in the sequence of the CDS region of the UbEF1B gene of Nicotiana benthamiana and designing gRNA; including four gRNA chains required for two target points of the BKG-g10 and BKG-g11 vectors, as shown in SEQ ID: NO. 1-NO. 4; and the above-mentioned single-stranded gRNA is synthesized into double-stranded;

[0013] Selecting PAM sites in the CDS region sequence of the CCR4 / NOT gene of Nicotiana benthamiana and designing gRNA; including four gRNA chains required for two target points of the BKG-g12 and BKG-g13 vectors, as shown in SEQ ID: NO. 5-NO. 8; and the above-mentioned single-stranded gRNA is synthesized into double-stranded.

[0014] The construction of the BKG-g10 vector comprises the following steps:

[0015] ①BsaI enzyme cuts BKG plasmid, then purifies and recovers the DNA fragment, and stores at -20℃;

[0016] ②The enzyme-cut BKG vector and the double-stranded gRNA are connected with T4 DNA ligase;

[0017] ③The connection product is transformed into DH5α E. coli, kanamycin is selected, single colonies are selected for colony PCR identification and sequencing, and whether the target point is connected into the vector is confirmed; the identification primer is as shown in SEQ ID: NO. 9, NO. 2;

[0018] ④Extract the plasmid and sequence with the primers as shown in SEQ ID: NO. 9-NO. 10 to obtain the BKG-g10 vector with g10 target point.

[0019] The construction of the BKG-g11 vector comprises the following steps:

[0020] ①BsaI enzyme cuts BKG plasmid, then purifies and recovers the DNA fragment, and stores at -20℃;

[0021] ②The enzyme cut BKG vector and double-stranded gRNA are connected with T4 DNA ligase;

[0022] ③The connection product is transformed into DH5a E. coli, and kanamycin is selected. Single colonies are selected for colony PCR identification and sequencing to confirm whether the target point is connected to the vector. The identification primer is shown in SEQ ID: NO. 9, NO. 4;

[0023] ④The plasmid is extracted and sequenced with the primer shown in SEQ ID: NO. 9-NO. 10 to obtain the BKG-g11 vector with g11 target points.

[0024] The construction of the BKG-g12 vector includes the following steps:

[0025] ①BsaI enzyme cuts BKG plasmid, then purifies and recovers DNA fragments, and stores at-20℃;

[0026] ②The enzyme cut BKG vector and double-stranded gRNA are connected with T4 DNA ligase;

[0027] ③The connection product is transformed into DH5a E. coli, and kanamycin is selected. Single colonies are selected for colony PCR identification and sequencing to confirm whether the target point is connected to the vector. The identification primer is shown in SEQ ID: NO. 9, NO. 6;

[0028] ④The plasmid is extracted and sequenced with the primer shown in SEQ ID: NO. 9-NO. 10 to obtain the BKG-g12 vector with g12 target points.

[0029] The construction of the BKG-g13 vector includes the following steps:

[0030] ①BsaI enzyme cuts BKG plasmid, then purifies and recovers DNA fragments, and stores at-20℃;

[0031] ②The enzyme cut BKG vector and double-stranded gRNA are connected with T4 DNA ligase;

[0032] ③The connection product is transformed into DH5a E. coli, and kanamycin is selected. Single colonies are selected for colony PCR identification and sequencing to confirm whether the target point is connected to the vector. The identification primer is shown in SEQ ID: NO. 9, NO. 8;

[0033] ④The plasmid is extracted and sequenced with the primer shown in SEQ ID: NO. 9-NO. 10 to obtain the BKG-g13 vector with g13 target points.

[0034] Any of the above vectors can be used to resist any plant virus infection that relies on the Nicotiana benthamiana UbEF1B gene and CCR4 / NOT gene to complete replication and infection.

[0035] Any of the above vectors can be applied in the acquisition of transient expression of the above vectors in Nicotiana benthamiana or the above vector-transfected Nicotiana benthamiana material.

[0036] Any of the above vectors can be applied in the resistance to geminiviruses by finding homologous genes of Nicotiana benthamiana UbEF1B and CCR4 / NOT genes in geminivirus hosts, and modifying the gRNA of the target.

[0037] The present application is based on the CRISPR / Cas9 system targeting and editing the UbEF1B gene and CCR4 / NOT gene of Nicotiana benthamiana to inhibit TLCYnV infection. The UbEF1B and CCR4 / NOT genes of Nicotiana benthamiana are recently identified genes directly related to viral replication and infection, especially the Rep protein of TLCYnV. By editing the above genes, the virus is hindered from relying on them for replication, thereby achieving an antiviral effect.

[0038] The vectors BKG-g10, BKG-g11, BKG-g12, and BKG-g13 constructed by the present application to inhibit TLCYnV infection have the following characteristics and advantages:

[0039] (1) The above vectors rely on the classic CRISPR / Cas9 system to achieve site-directed editing of the UbEF1B gene and CCR4 / NOT gene sequences of Nicotiana benthamiana, and have high editing efficiency;

[0040] (2) Compared with traditional breeding methods, editing endogenous genes in Nicotiana benthamiana using the CRISPR / Cas9 system can more quickly and effectively obtain resistant materials;

[0041] (3) The sgRNA design of the above vector targets key host genes relied on by TLCYnV during replication, which are important participants in viral replication. Compared with other vectors targeting endogenous genes in Nicotiana benthamiana, this vector has a more obvious antiviral effect, and the virus accumulation amount is significantly reduced after detection;

[0042] (4) After editing the UbEF1B gene or CCR4 / NOT gene, the growth state of Nicotiana benthamiana is normal, and the phenotype does not change significantly compared with the wild type; it does not affect its traits and is beneficial to the continuation of offspring;

[0043] (5) Nicotiana benthamiana is the most common model species for studying geminiviruses, and obtaining its virus-resistant strains has broad application space in the subsequent study of the replication and infection mechanism of geminiviruses in hosts and the breeding of virus-resistant varieties;

[0044] (6) The above-mentioned vector can be popularized to the research of resistance to other geminiviruses that depend on the host N. benthamiana UbEF1B and CCR4 / NOT genes. The system is resistant to other geminiviruses that use UbEF1B and CCR4 / NOT for replication and infection due to the targeting of endogenous genes of the host.

[0045] The vector for editing the gene of N. benthamiana based on the CRISPR / Cas9 system, the construction method and application thereof will be further described in combination with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 The schematic diagram of the vectors BKG-g10, BKG-g11, BKG-g12 and BKG-g13;

[0047] Figure 2 The flow chart of the construction of each vector for targeting and editing the key site of the UbEF1B gene of N. benthamiana based on the CRISPR / Cas9 system to resist TLCYnV infection;

[0048] Figure 3 The flow chart of the construction of each vector for targeting and editing the key site of the CCR4 / NOT gene of N. benthamiana based on the CRISPR / Cas9 system to resist TLCYnV infection;

[0049] Figure 4 The antiviral effect of the editing vectors BKG-g10 and g12 for the UbEF1B gene and the CCR4 / NOT gene was detected. (A) The vectors containing BKG-g10, BKG-g12 and empty vectors (Mock) were mixed with TLCYnV infectious clone Agrobacterium, and then inoculated on wild-type N. benthamiana. The DNA of the leaves of the N. benthamiana plants 60 hours after the inoculation was extracted, and the change in the accumulation amount of the virus TLCYnV was analyzed by qPCR to determine that the accumulation amount of the virus TLCYnV was significantly reduced compared with the control group. (B) After the above vectors were inoculated on the N. benthamiana plants for 9 days, the differences in the phenotypes of the plants were observed to determine that the vectors BKG-g10 and BKG-g12 indeed had the effect of inhibiting TLCYnV. (C) The system leaf DNA was extracted, and the change in the accumulation amount of the virus TLCYnV was analyzed by qPCR.

[0050] Figure 5To obtain the N. benthamiana material containing the vector system by tissue culture technology, the vectors containing BKG-g10 and BKG-g12 were used. The plants positive for transgene were further identified, and it was found that the BKG-g10 and BKG-g12 vectors could effectively edit the UbEF1B or CCR4 / NOT gene. WT represents the original sequence of UbEF1B and CCR4 / NOT gene on the healthy plant. Different lines represent different transgenic plants, and the horizontal line indicates the edited sequence. DETAILED DESCRIPTION

[0051] As shown in Figure 1 , a vector BKG-g10, BKG-g11 based on the CRISPR / Cas9 system targets and edits the UbEF1B gene of N. benthamiana to inhibit TLCYnV infection, and a vector BKG-g12, BKG-g13 targets and edits the CCR4 / NOT gene of N. benthamiana to inhibit TLCYnV infection.

[0052] The construction method specifically includes the following steps:

[0053] (1) As shown in Figure 2 , select PAM sites in the CDS region sequence of the UbEF1B gene of N. benthamiana and design gRNA; four gRNA chains of two target points required by BKG-g10 and BKG-g11 vectors respectively: g10-A / B, g11-A / B; as shown in SEQ ID: NO. 1-NO. 4;

[0054] g10-A: TGATTGCTGGTCTGCCGTACATCGG

[0055] g10-B: AAACCCGATGTACGGCAGACCAGCA

[0056] g11-A: TGATTGGATGTGGAGCGCCGGTTGC

[0057] g11-B: AAACGCAACCGGCGCTCCACATCCA

[0058] (2) Synthesize the single-stranded gRNA in (1) into double-stranded, the specific method is as follows:

[0059] ① First, dilute the above single-stranded gRNA to 50 μM / μL;

[0060] ② According to 5x Oligo buffer: 4 μL; single-stranded A: 4 μL; single-stranded B: 4 μL; H2O: 8 μL to make 20 μL system;

[0061] ③PCR instrument temperature control: 95℃ 2min; decrease to 25℃ at 0.1℃ / s; 5min cooling at 4℃;

[0062] ④The obtained fragment was diluted 50 times and stored at -20℃;

[0063] (3) Construction of BKG-g10 vector with g10 target point:

[0064] ①1μg BKG plasmid, BsaI enzyme 1μL, 10×buffer 2μL; the rest of the system was supplemented with ddH2O; 37℃ enzyme cutting for 30min, then purified DNA, -20℃ freezing preservation;

[0065] ②10×T4 DNA ligase buffer 2μL, 80ng of enzyme-cut BKG vector, 1μL of double-stranded gRNA, 1μL of T4 DNA ligase, ddH2O to 20μL; PCR instrument temperature control 22℃ reaction for 15min;

[0066] ③10μL of ligation product was transformed into DH5α E. coli, kanamycin selection, single clone was selected for colony PCR identification and sequencing to confirm whether the target point was connected to the vector;

[0067] Identification primer: as shown in SEQ ID: NO. 9 and NO. 2;

[0068] F: M13F: GTTGTAAAACGACGGCCAG;

[0069] R: g10-B: AAACCCGATGTACGGCAGACCAGCA;

[0070] The correct clone was shaken in a bacterial culture, the plasmid was extracted, and sequencing was performed with M13F / R primers, thus obtaining the BKG-g10 vector with g10 target point;

[0071] (4) Construction of BKG-g11 vector with g11 target point:

[0072] ①1μg BKG plasmid, BsaI enzyme 1μL, 10×buffer 2μL; the rest of the system was supplemented with ddH2O; 37℃ enzyme cutting for 30min, then purified DNA, -20℃ freezing preservation;

[0073] ②10×T4 DNA ligase buffer 2μL, 80ng of enzyme-cut BKG vector, 1μL of double-stranded gRNA, 1μL of T4 DNA ligase, ddH2O to 20μL; PCR instrument temperature control 22℃ reaction for 15min;

[0074] ③ Transform 10 μL of the ligation product into DH5α Escherichia coli, screen with kanamycin, select single clones for colony PCR identification and sequencing to confirm whether the target site has been ligated into the vector.

[0075] Identification primers: as shown in SEQ ID: NO.9 and NO.4;

[0076] F: M13F: GTTGTAAAACGACGGCCAG;

[0077] R: g11-B: AAACGCAACCGGCGCTCCACATCCA;

[0078] The correct clone was cultured in a shaker, the plasmid was extracted, and sequenced using M13F / R primers to obtain the BKG-g11 vector with g11 target.

[0079] (5) Figure 3 As shown, the PAM site was selected in the CDS region sequence of the Nicotiana benthamiana CCR4 / NOT gene and gRNA was designed; including four gRNA chains for the two target sites required by the BKG-g12 and BKG-g13 vectors respectively: g12-A / B, g13-A / B; as shown in SEQ ID: NO.5-NO.8;

[0080] g12-A:TGATTGGTGTTGCATGACTGCCAGC

[0081] g12-B:AAACGCTGGCAGTCATGCAACACCA

[0082] g13-A:TGATTGAGGGGAAGGCTTTCGACCA

[0083] g13-B:AAACTGGTCGAAAGCCTTCCCCTCA

[0084] (6) The single-stranded gRNA described in (5) is synthesized into a double-stranded form, as follows:

[0085] ① First, dilute the above single-stranded gRNA to 50 μM / μL;

[0086] ② Prepare a 20 μL system using the following formula: 5×Oligo buffer: 4 μL; single-chain A: 4 μL; single-chain B: 4 μL; H2O: 8 μL.

[0087] ③PCR instrument temperature control: 95℃ for 2 min; decrease to 25℃ at 0.1℃ / s; decrease to 4℃ for 5 min.

[0088] ④ The obtained fragment was diluted 50 times and stored at -20℃;

[0089] (7) Construction of the BKG-g12 vector with g12 target:

[0090] ① 1 μg BKG plasmid, 1 μL BsaI enzyme, 2 μL 10× buffer; the remaining volume is made up with ddH2O; digest at 37℃ for 30 min, then purify the DNA and store at -20℃.

[0091] ② 2 μL of 10×T4 DNA ligase buffer, 80 ng of enzyme-digested BKG vector, 1 μL of double-stranded gRNA, 1 μL of T4 DNA ligase, and ddH2O to a final volume of 20 μL; PCR reaction at 22℃ for 15 min.

[0092] ③ Transform 10 μL of the ligation product into DH5α Escherichia coli, screen with kanamycin, select single clones for colony PCR identification and sequencing to confirm whether the target site has been ligated into the vector.

[0093] Identification primers: as shown in SEQ ID: NO.9 and NO.6;

[0094] F: M13F: GTTGTAAAACGACGGCCAG;

[0095] R: g12-B: AAACGCTGGCAGTCATGCAACACCA;

[0096] The correct clone was cultured in a shaker, the plasmid was extracted, and sequenced using M13F / R primers to obtain the BKG-g12 vector with g12 target.

[0097] (8) Construction of the BKG-g13 vector with g13 target:

[0098] ① 1 μg BKG plasmid, 1 μL BsaI enzyme, 2 μL 10× buffer; the remaining volume is made up with ddH2O; digest at 37℃ for 30 min, then purify the DNA and store at -20℃.

[0099] ② 2 μL of 10×T4 DNA ligase buffer, 80 ng of enzyme-digested BKG vector, 1 μL of double-stranded gRNA, 1 μL of T4 DNA ligase, and ddH2O to a final volume of 20 μL; PCR reaction at 22℃ for 15 min.

[0100] ③ Transform 10 μL of the ligation product into DH5α Escherichia coli, screen with kanamycin, select single clones for colony PCR identification and sequencing to confirm whether the target site has been ligated into the vector.

[0101] Identification primers: as shown in SEQ ID: NO.9 and NO.8;

[0102] F: M13F: GTTGTAAAACGACGGCCAG;

[0103] R: g13-B: AAACTGGTCGAAAGCCTTCCCCTCA;

[0104] The correct clone was cultured in a shaker, the plasmid was extracted, and sequenced using M13F / R primers, thus obtaining the BKG-g13 vector with g13 target.

[0105] Agrobacterium-mediated transformation of BKG-g10 and BKG-g11 vectors targeting the UbEF1B gene of Nicotiana benthamiana, and BKG-g12 and BKG-g13 vectors targeting CCR4 / NOT:

[0106] Agrobacterium LBA4404 strain 50 μL, plasmid 5 μL, electroporation transformation; incubation at 28℃ for 90 min; kanamycin plus rifampin resistance screening, single clones selected for colony PCR identification, identification primers are the same as those used for transforming Escherichia coli; strain stored at -80℃.

[0107] Activation of Agrobacterium: Agrobacterium containing vectors BKG-g10 and BKG-g12, as well as empty vectors (Mock), were mixed with TLCYnV-infecting clones of Agrobacterium and inoculated onto wild-type Nicotiana benthamiana. DNA was extracted from leaves of Nicotiana benthamiana plants 65 hours after inoculation, and changes in TLCYnV viral accumulation were analyzed by qPCR. Figure 4 As shown in Figure A, the accumulation of viral TLCYnV was significantly lower than that in the control group.

[0108] Seven days after inoculating *Nicotiana benthamiana* plants with the above vectors, the differences in plant symptom phenotypes were observed, such as... Figure 4 As shown in Figure B, the constructed vectors BKG-g10 and BKG-g12 were confirmed to have antiviral activity against Yunnan tomato leaf curl virus (TLCYnV). DNA was extracted from systemic leaves, and changes in TLCYnV accumulation were analyzed using qPCR. Figure 4 As shown in Figure C, the accumulation of viral TLCYnV was significantly reduced compared to the control group. The results confirm that the editing vectors BKG-g10 and BKG-g12 targeting the UbEF1B gene and the CCR4 / NOT gene have a significant ability to inhibit TLCYnV infection.

[0109] Various vectors were used to obtain Nicotiana benthamiana materials containing this vector system through tissue culture technology. Further identification of transgenic positive plants revealed that BKG-g10 and BKG-g12 vector transfer effectively edited the UbEF1B and CCR4 / NOT genes (e.g., ...). Figure 5 (As shown).

[0110] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention. sequence list <110> Institute of Plant Protection, Chinese Academy of Agricultural Sciences <120> Vectors for editing the Nicotiana benthamiana gene based on CRISPR / Cas9, their construction methods and applications <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> g10-A (Artificial Sequence) <400> 1 tgattgctgg tctgccgtac atcgg 25 <210> 2 <211> 25 <212> DNA <213> g10-B (Artificial Sequence) <400> 2 aaacccgatg tacggcagac cagca 25 <210> 3 <211> 25 <212> DNA <213> g11-A (Artificial Sequence) <400> 3 tgattggatg tggagcgccg gttgc 25 <210> 4 <211> 25 <212> DNA <213> g11-B (Artificial Sequence) <400> 4 aaacgcaacc ggcgctccac atcca 25 <210> 5 <211> 25 <212> DNA <213> g12‑A(Artificial Sequence) <400> 5 tgattggtgt tgcatgactg ccagc 25 <210> 6 <211> 25 <212> DNA <213> g12‑B(Artificial Sequence) <400> 6 aaacgctggc agtcatgcaa cacca 25 <210> 7 <211> 25 <212> DNA <213> g13‑A(Artificial Sequence) <400> 7 tgattgaggg gaaggctttc gacca 25 <210> 8 <211> 25 <212> DNA <213> g13‑B(Artificial Sequence) <400> 8 aaactggtcg aaagccttcc cctca 25 <210> 9 <211> 19 <212> DNA <213> M13F(Artificial Sequence) <400> 9 gttgtaaaac gacggccag 19 <210> 10 <211> 17 <212> DNA <213> M13R(Artificial Sequence) <400> 10 caggaaacag ctatgac 17

Claims

1. The application of a CRISPR / Cas9-based vector for editing the *Nicotiana benthamiana* gene in *Nicotiana benthamiana* to resist geminivirus infection, characterized in that: The twin virus is TLCYnV; the vector is specific to *Nycium benzoate*. UbEF1B Genetically constructed pCambia 1300-BKG-g10 and its target for Nicotiana benthamiana CCR4 / NOT The gene-constructed pCambia 1300-BKG-g12 is abbreviated as BKG-g10 and BKG-g12, respectively. The specific method for constructing the carrier is as follows: in Ben's tobacco UbEF1B PAM sites were selected from the CDS region sequence of the gene and gRNAs were designed; two gRNA strands, including one target site required for the BKG-g10 vector, were used as shown in SEQ ID: NO.1-NO.2; and the above single-stranded gRNAs were synthesized into double strands. Ben's tobacco CCR4 / NOT PAM sites were selected in the CDS region sequence of the gene and gRNAs were designed; two gRNA strands, including one target site required for the BKG-g12 vector, were used as shown in SEQ ID: NO.5-NO.6; and the above single-stranded gRNAs were synthesized into double strands. The construction of the BKG-g10 vector includes the following steps: ① Digest the BKG plasmid with BsaI, then purify and recover the DNA fragment, and store it frozen at -20℃; ② The enzyme-digested BKG vector was ligated with double-stranded gRNA using T4 DNA ligase; ③ The ligation product was transformed into DH5α Escherichia coli, screened with kanamycin, and single clones were selected for colony PCR identification and sequencing to confirm whether the target site was ligated into the vector; the identification primers are shown in SEQ ID: NO.9 and NO.

2. ④ Extract the plasmid and sequence it using primers as shown in SEQ ID: NO.9-NO.10 to obtain the BKG-g10 vector with g10 target. The construction of the BKG-g12 vector includes the following steps: ① Digest the BKG plasmid with BsaI, then purify and recover the DNA fragment, and store it frozen at -20℃; ② The enzyme-digested BKG vector was ligated with double-stranded gRNA using T4 DNA ligase; ③ The ligation product was transformed into DH5α Escherichia coli, screened with kanamycin, and single clones were selected for colony PCR identification and sequencing to confirm whether the target site was ligated into the vector. The identification primers are shown in SEQ ID: NO.9 and NO.

6. ④ Extract the plasmid and sequence it using primers as shown in SEQ ID: NO.9-NO.10 to obtain the BKG-g12 vector with g12 target.

Citation Information

Patent Citations

  • Geminivirus satellite DNA1 vector and breeding method thereof

    CN110157731A

  • Conferring resistance to geminiviruses in plants in alternative manner to gene drive, using crispr / cas systems

    CN110325644A

  • Application of soybean elongation factor family in soybean mosaic virus resistance

    CN105296531A