PCR specific primers and PCR detection method for detecting Populus sibiricum genome
By designing specific PCR primer pair 1 and primer pair 2, the problem of difficulty in distinguishing Populus sphenanthera from other Populus species in the existing technology was solved, and rapid and accurate Populus sphenanthera genome detection was achieved, which is suitable for the classification of poplar planting resources and the identification of hybrids.
Patent Information
- Application Number
- CN202210934869.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-04
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2042-08-04
AI Technical Summary
Existing technologies lack identification primers specific to the Populus rapa genome, making it difficult to quickly distinguish Populus rapa from other Populus species.
Specific PCR primer pair 1 and primer pair 2 were designed and provided for distinguishing Populus siliqua from other Populus species. Specific amplified bands were detected by PCR amplification and agarose gel electrophoresis.
It can quickly and accurately distinguish Populus rapa from other Populus species, saving manpower and material resources, and is suitable for the classification of poplar planting resources and the identification of hybrids.
Smart Images

Figure CN115058539B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to primers and a detection method for detecting poplar species, in particular to PCR specific primers and a PCR detection method for detecting a Populus adenopoda Maxim. genome, and belongs to the field of PCR detection of the Populus adenopoda genome. Background Art
[0002] Currently, the primers used to identify different tree species are mainly SSR, but SSR primers exist in all species and are not specific enough at the genomic level. So far, there is a lack of identification primers that are specific only to the genome of Populus rapa. Such specific primers can quickly identify whether a certain tree species has the genomic components of Populus rapa, and thus infer whether Populus rapa was involved in the formation of the tree species. Summary of the Invention
[0003] One of the purposes of the present invention is to provide a specific PCR primer pair for accurately identifying the genome of Populus siliquae;
[0004] The second object of the present invention is to provide a PCR detection method for quickly distinguishing Populus siliqua from other Populus species;
[0005] The third object of the present invention is to provide a PCR detection kit for detecting the genome of Populus sibiricus.
[0006] The above-mentioned object of the present invention is achieved through the following technical solutions:
[0007] One aspect of the present invention is to provide a specific PCR primer pair for distinguishing Populus siliqua from the genomes of other Populus species, selected from either primer pair 1 or primer pair 2; the nucleotide sequence of the upstream primer of primer pair 1 is: CATGAAATTTTTAGCTGCGAGA, and the nucleotide sequence of the downstream primer of primer pair 1 is: TGCATAGATCCAGTTAAGAGTTGA;
[0008] The nucleotide sequence of the upstream primer of the primer pair 2 is: TAAAAGCAACGAGAGTGACACC, and the nucleotide sequence of the downstream primer of the primer pair 2 is: CCATGCACCATAATATCAAACA.
[0009] The second aspect of the present invention is to provide a PCR detection method for distinguishing Populus siliqua from other Populus species, comprising:
[0010] (1) extracting DNA from the poplar sample to be tested;
[0011] (2) using the extracted poplar sample DNA as a template and the upstream primer and downstream primer of primer pair 1 or primer pair 2 as a PCR amplification primer pair to establish a PCR reaction system for PCR amplification;
[0012] (3) If a specific amplification band appears, it indicates that the poplar sample to be tested contains the genome component of Populus spondias; wherein, a PCR reaction system is established using the upstream primer and downstream primer of primer pair 1 as PCR amplification primers for PCR amplification. If a specific amplification band of 500 bp appears, it indicates that the poplar sample to be tested contains the genome component of Populus spondias; a PCR reaction system is established using the upstream primer and downstream primer of primer pair 2 as PCR amplification primers for PCR amplification. If a specific amplification band of 594 bp appears, it indicates that the poplar sample to be tested contains the genome component of Populus spondias.
[0013] As a preferred embodiment of the present invention, the PCR reaction system established in step (2) includes: 2 μL of sample DNA to be detected, 10 μL of PCR Mix, 0.5 μL of the upstream primer shown in SEQ ID No. 3, 0.5 μL of the downstream primer shown in SEQ ID No. 4, and 7 μL of double-distilled water.
[0014] As a preferred embodiment of the present invention, the PCR amplification procedure in step (2) includes: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞.
[0015] The third aspect of the present invention is to provide a PCR detection kit for detecting the genome of Populus siliqua, comprising: Taq enzyme, dNTP, Mg 2+ , ddH2O and PCR amplification primers; wherein the PCR amplification primer pair is selected from any pair of primer pair 1 or primer pair 2.
[0016] The specific PCR primer pair for identifying the genome of Populus rapa provided by the present invention can quickly distinguish Populus rapa from other Populus species. The PCR detection method amplification and agarose gel electrophoresis are convenient to operate, the banding pattern is simple, and the specific genome fragments of Populus rapa can be distinguished directly through the amplified fragments without sequencing, which effectively saves manpower and material resources. It has a good application prospect in the classification and utilization of poplar planting resources and the identification of hybrids. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 Electrophoresis results of specific bands amplified by PCR using specific primers of the screened Populus siliqua genome; 1-5 are Populus alba, Populus xinjiangensis, Populus siliqua, Populus tremula and water (negative control), respectively.
[0018] Figure 2 Results of PCR amplification using some nonspecific primers during the screening of specific primers for the Populus scottii genome; 1-5 are Populus alba, Populus xinjiangensis, Populus scottii, Populus tremula, and water (negative control), respectively. DETAILED DESCRIPTION
[0019] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.
[0020] Experimental Example 1 Screening of specific PCR primers for identifying the genome of Populus siliqua
[0021] 1. Test materials
[0022] Genomic DNA from Populus alba L., Populus alba var. pyramidalis Bge., Populus adenopoda Maxim., and Populus davidiana Dode, and water (negative control) were used. Based on the genomes of these four poplar species previously obtained by our laboratory, whole-genome sequence alignment analysis revealed highly divergent segments within the genomes. Specific primers were designed for each species accordingly, with 100 pairs of primers designed for each chromosome (Table 1 lists only a portion of the designed primer sequences). Primers were then screened by PCR amplification to select primers that specifically amplify the Populus davidiana genome.
[0023] Table 1 lists some of the amplification primers designed using the same design principles and methods to distinguish the genome of Populus sibiricus.
[0024] Table 1 PCR primers used for amplification and screening of specific fragments of the Populus siliqua genome
[0025]
[0026] 2. Test methods
[0027] The above four genomes were amplified by PCR using the primer sets screened above.
[0028] PCR reaction system (20 μL): DNA 2 μL (10-30 ng / μL), PCR Mix 10 μL (Sangon Biotech, Shanghai), upstream primer 0.5 μL (10 μM), downstream primer 0.5 μL (10 μM), pure water 7 μL.
[0029] The PCR reaction procedure was as follows: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞. The products were electrophoresed on a 1.5% agarose gel, and primers that produced specific bands in the Populus siliqua genome were selected based on the banding results.
[0030] 3. Test results
[0031] The amplification results of the specific primers designed in Table 1 are shown in Figure 1 and Figure 2 The distinction standard is the presence or absence of bands. If a band appears in lane 3, the genome component of Populus scolopendra is detected.
[0032] Depend on Figure 1 The amplification results show that Chr17D-1 and Chr13D-1 can specifically amplify a single Populus scolopendra genome band, among which Chr17D-1 has better amplification effect, higher sensitivity, and the results are easier to distinguish.
[0033] according to Figure 2 It can be seen that the 16 pairs of primers in Table 1 are not specific to the Populus quascens genome and can simultaneously amplify corresponding fragments of other poplars, indicating that the two pairs of primers (Chr17D-1 and Chr13D-1) that can specifically amplify Populus quascens are difficult to screen and require a lot of work, so they are not easy to obtain.
Claims
1. A specific PCR primer pair for distinguishing the genome of Populus adenopoda Maxim. from that of other Populus species, characterized in that: The nucleotide sequence of the upstream primer of the primer pair is: CATGAAATTTTTAGCTGCGAGA, and the nucleotide sequence of the downstream primer of the primer pair is: TGCATAGATCCAGTTAAGAGTTGA.
2. The specific PCR primer pair according to claim 1, characterized in that Other Populus species include Populus alba L., Populus alba var. pyramidalis Bge, and Populus davidiana Dode.
3. Use of the specific PCR primer pair according to claim 1 in detecting the genome of Populus siliqua.
4. A PCR detection method for distinguishing Populus adenopoda Maxim. from other Populus species, characterized by: include: (1) extracting DNA from the poplar sample to be tested; (2) using the extracted poplar sample DNA as a template and the upstream primer and downstream primer of the primer pair of claim 1 as a PCR amplification primer pair to establish a PCR reaction system for PCR amplification; if a specific amplification band appears, it indicates that the poplar sample to be tested contains the Populus scolopendra genome component; The other Populus species include Populus alba L., Populus albavar. pyramidalis Bge., and Populus davidiana Dode.
5. The PCR detection method according to claim 4, characterized in that A PCR reaction system is established using the upstream primer and the downstream primer of the primer pair of claim 1 as PCR amplification primers for PCR amplification. If a 500 bp specific amplification band appears, it indicates that the poplar sample to be tested contains the Populus scolopendra genome component.
6. The PCR detection method according to claim 4, characterized in that The PCR reaction system established in step (2) includes: 2 μL of sample DNA to be detected, 10 μL of PCR Mix, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 7 μL of double-distilled water.
7. The PCR detection method according to claim 4, characterized in that The PCR amplification procedure described in step (2) includes: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞.
8. The PCR detection method according to claim 4, characterized in that The other Populus species include Populus alba L., Populus alba var. pyramidalis Bge., and Populus davidiana Dode.
9. A PCR detection kit for detecting the genome of Populus sibiricus, comprising: Taq enzyme, dNTP, Mg 2+ , ddH2O and a PCR amplification primer pair; characterized in that the nucleotide sequence of the upstream primer of the primer pair is: CATGAAATTTTTAGCTGCGAGA, and the nucleotide sequence of the downstream primer of the primer pair is: TGCATAGATCCAGTTAAGAGTTGA.
10. Use of the PCR detection kit according to claim 9 in detecting the genome of Populus scolopendra.
Citation Information
Patent Citations
Chloroplast genome capable of identifying populus species as well as PCR amplification primer and application of chloroplast genome
CN112921111A
Genetic maker derived chloroplast genome for distinguishing Berberis koreana Palib. or Berberis amurensis Rupr
KR1020170060717A