PCR specific primers for detecting Populus tremula genome and PCR detection method

By designing specific PCR primer pairs, the problem of difficulty in distinguishing poplar from other Populus species in existing technologies was solved, and rapid and accurate Populus genome identification was achieved, which is suitable for the classification of poplar planting resources and the identification of hybrids.

CN115074460BActive Publication Date: 2025-09-19BEIJING FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210934876.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-04
Publication Date
2025-09-19
Estimated Expiration
2042-08-04

AI Technical Summary

Technical Problem

Existing technologies lack PCR primers that can specifically identify the Populus davidiana genome, making it difficult to quickly distinguish Populus davidiana from other Populus species.

Method used

Specific PCR primer pairs (primer pair 1 and primer pair 2) were designed and provided for PCR amplification of the Populus davidiana genome. Specific amplified bands were used to distinguish Populus davidiana from other Populus species, and PCR detection combined with agarose gel electrophoresis analysis was used.

Benefits of technology

It can quickly and accurately distinguish poplar from other Populus species, saving manpower and material resources, and is suitable for the classification of poplar planting resources and the identification of hybrids.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115074460B_ABST
    Figure CN115074460B_ABST
Patent Text Reader

Abstract

The present invention discloses PCR-specific primers and a PCR detection method for detecting the genome of Populus davidiana. The present invention is based on the genomes of Populus alba, Populus xinjiangensis, Populus siliquae and Populus davidiana, and through whole genome sequence comparison analysis, finds fragments with large differences in the genome, and accordingly designs specific primers for each poplar, from which specific primers that can accurately distinguish the genome of Populus davidiana from the genomes of other poplars are screened. The present invention further provides a PCR detection method for quickly distinguishing Populus davidiana from other Populus species using the specific primers. The method of the present invention can quickly distinguish Populus davidiana from other Populus species, and the PCR detection method is easy to operate, has a simple banding pattern, and can distinguish Populus davidiana-specific genomic fragments directly by amplifying fragments without sequencing. It has application prospects in the classification and utilization of poplar planting resources and the identification of hybrids.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to primers and a PCR detection method for detecting poplar species, in particular to PCR-specific primers and a PCR detection method for detecting the genome of Populus davidiana Dode, belonging to the field of PCR detection of Populus davidiana genome. Background Art

[0002] Currently, primers for identifying different tree species are mainly SSR-based, but SSR primers exist in all species and are not specific enough at the genomic level. So far, there is a lack of identification primers that are specific only to the genome of Populus davidiana. Such specific primers can quickly identify whether a certain tree species contains genomic components of Populus davidiana, thereby inferring whether Populus davidiana is involved in the formation of the tree species. Summary of the Invention

[0003] One of the objects of the present invention is to provide a specific PCR primer pair for accurately identifying the genome of Populus tremula;

[0004] The second object of the present invention is to provide a PCR detection method for quickly distinguishing Populus tremula from other Populus species;

[0005] The third object of the present invention is to provide a PCR detection kit for detecting the Populus tremula genome.

[0006] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0007] One aspect of the present invention is to provide a specific PCR primer pair for distinguishing Populus tremula from other poplar genomes, selected from any pair of primer pair 1 or primer pair 2; the nucleotide sequence of the upstream primer of the primer pair 1 is: CCGAAAATGAGCTGGGGGAT, and the nucleotide sequence of the downstream primer of the primer pair 1 is: AGCAGACAGTGACCTGCTTC; the nucleotide sequence of the upstream primer of the primer pair 2 is: AGTACCTCATAAGACCACCATTC, and the nucleotide sequence of the downstream primer of the primer pair 2 is: GAGCAGCATTAGCCATCAGTTTA.

[0008] The second aspect of the present invention is to provide a PCR detection method for rapidly distinguishing Populus tremula from other Populus species, comprising:

[0009] (1) extracting DNA from the poplar sample to be tested;

[0010] (2) using the extracted poplar sample DNA as a template, and using the upstream primer and downstream primer of primer pair 1 or the upstream primer and downstream primer shown in primer pair 2 as PCR amplification primers to establish a PCR reaction system for PCR amplification;

[0011] (3) If characteristic amplification bands appear in the amplification results, it indicates that the poplar sample to be tested contains Populus davidianus genome components.

[0012] As a preferred embodiment of the present invention, the PCR reaction system established in step (2) includes: 2 μL of sample DNA to be detected, 10 μL of PCR Mix, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 7 μL of double-distilled water.

[0013] As a preferred embodiment of the present invention, the PCR amplification procedure in step (2) includes: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞.

[0014] As a preferred specific embodiment of the present invention, in step (3), if the upstream primer and downstream primer of primer pair 1 are used as PCR amplification primers to establish a PCR reaction system for PCR amplification, the base length of the specific amplification band is 739 bp; if the upstream primer and downstream primer of primer pair 2 are used as PCR amplification primers to establish a PCR reaction system for PCR amplification, the base length of the specific amplification band is 484 bp.

[0015] The third aspect of the present invention is to provide a PCR detection kit for detecting the genome of Populus tremula, comprising: Taq enzyme, dNTP, Mg 2+ , ddH2O and PCR amplification primers; wherein the PCR amplification primers are selected from any one pair of primer pair 1 or primer 2; the nucleotide sequence of the upstream primer of the primer pair 1 is: CCGAAAATGAGCTGGGGGAT, and the nucleotide sequence of the downstream primer of the primer pair 1 is: AGCAGACAGTGACCTGCTTC; the nucleotide sequence of the upstream primer of the primer pair 2 is: AGTACCTCATAAGACCACCATTC, and the nucleotide sequence of the downstream primer of the primer pair 2 is: GAGCAGCATTAGCCATCAGTTTA.

[0016] The specific PCR primer pair for identifying the poplar genome provided by the present invention can quickly distinguish poplar from other poplar species. The PCR detection method amplification and agarose gel electrophoresis are convenient to operate, the banding pattern is simple, and the poplar-specific genome fragments can be distinguished directly through the amplified fragments without sequencing, which effectively saves manpower and material resources. It has a good application prospect in the classification and utilization of poplar planting resources and the identification of hybrids. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1Results of PCR amplification using specific primers and some non-specific primers during the screening of specific primers for the Populus davidiana genome; 1-5 are Populus alba, Populus xinjiangensis, Populus scolopendra, Populus davidiana, and water (negative control), respectively. DETAILED DESCRIPTION

[0018] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0019] Experimental Example 1 Screening of specific PCR primers for identifying Populus tremula genome

[0020] 1. Test materials

[0021] Genomic DNA of Populus alba L., Populus alba var. pyramidalis Bge., Populus adenopoda Maxim., Populus davidiana Dode, and water (negative control).

[0022] Based on the genomes of four poplar species (Populus alba, Populus xinjiangensis, Populus siliqua, and Populus davidiana) obtained in the inventor's laboratory in the early stage, whole genome sequence comparison analysis was performed to identify fragments with significant differences in the genome. Based on these fragments, specific primers for each poplar species were designed, and 100 pairs of primers were designed for each chromosome (only the nucleotide sequences of some of the designed primers are listed in Table 1). Primers were then screened by PCR amplification to select primers that specifically amplify the Populus davidiana genome.

[0023] Table 1 lists some of the amplification primers designed using the same design principles and methods to distinguish the Populus davidiana genome.

[0024] Table 1 Some PCR primers designed for specific amplification of Populus tremula genome

[0025]

[0026] 2. Test methods

[0027] The above-screened primer sets were used to perform PCR amplification on the genomes of four poplar species (Populus alba, Populus xinjiangensis, Populus scolopendra, and Populus tremula).

[0028] PCR reaction system (20 μL): DNA 2 μL (10-30 ng / μL), PCR Mix 10 μL (Sangon Biotech, Shanghai), upstream primer 0.5 μL (10 μM), downstream primer 0.5 μL (10 μM), pure water 7 μL.

[0029] The PCR reaction procedure was as follows: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞. The products were electrophoresed on a 1.5% agarose gel, and primers that produced specific bands in the Populus tremula genome were selected based on the banding results.

[0030] 3. Test results

[0031] The distinction criterion is the presence or absence of bands. If a band appears in lane 4, the Populus davidiana genome component is detected.

[0032] Depend on Figure 1 It can be seen from the amplification results that among the 20 pairs of primers listed in Table 1, only Chr01b-4 and Chr19b-3 can specifically amplify a single specific band of the Populus tremula genome, and the remaining 18 pairs of primers can simultaneously amplify corresponding fragments of other poplars or cannot amplify a single specific band of the Populus tremula genome. Therefore, these 18 pairs of primers cannot be used for the detection of the Populus tremula genome; among them, among the two pairs of detection primers Chr01b-4 and Chr19b-3, Chr01b-4 has a better amplification effect, and its detection specificity and sensitivity are significantly better than Chr19b-3. Therefore, the present invention preferably uses Chr01b-4 as the specific primer for detecting the Populus tremula genome.

Claims

1. A specific PCR primer pair for distinguishing Populus davidiana Dode from other poplar genomes, characterized in that: Selected from any one pair of primer pair 1 or primer pair 2; the nucleotide sequence of the upstream primer of the primer pair 1 is: CCGAAAATGAGCTGGGGGAT, and the nucleotide sequence of the downstream primer of the primer pair 1 is: AGCAGACAGTGACCTGCTTC; The nucleotide sequence of the upstream primer of the primer pair 2 is: AGTACCTCATAAGACCACCATTC, and the nucleotide sequence of the downstream primer of the primer pair 2 is: GAGCAGCATTAGCCATCAGTTTA.

2. Use of the specific PCR primer pair according to claim 1 in detecting the Populus davidiana genome.

3. A PCR detection method for distinguishing Populus davidiana Dode from other Populus species, characterized in that: include: (1) extracting DNA from the poplar sample to be tested; (2) using the extracted poplar sample DNA as a template and the upstream primer and downstream primer of the primer pair 1 of claim 1 as a PCR amplification primer pair to establish a PCR reaction system for PCR amplification; (3) If a specific amplified band appears, it indicates that the poplar sample to be tested contains Populus davidianus genome components.

4. The PCR detection method according to claim 3, characterized in that The base length of the specific amplified band is 739 bp.

5. A PCR detection method for distinguishing Populus davidiana Dode from other Populus species, characterized in that: include: (1) extracting DNA from the poplar sample to be tested; (2) using the extracted poplar sample DNA as a template and the upstream primer and downstream primer of the primer pair 2 of claim 1 as a PCR amplification primer pair to establish a PCR reaction system for PCR amplification; (3) If a specific amplified band appears, it indicates that the poplar sample to be tested is Populus davidianus.

6. The PCR detection method according to claim 5, characterized in that The base length of the specific amplified band is 484 bp.

7. The PCR detection method according to claim 3 or 5, characterized in that The PCR reaction system established in step (2) includes: 2 μL of sample DNA to be detected, 10 μL of PCR Mix, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 7 μL of double-distilled water.

8. The PCR detection method according to claim 3 or 5, characterized in that The PCR amplification procedure described in step (2) includes: 95°C for 5 min, 95°C for 30 s, annealing for 30 s, 72°C for 30 s, 35 cycles, 72°C for 5 min, 12°C, ∞.

9. A PCR detection kit for detecting the genome of Populus tremula, comprising: Taq enzyme, dNTP, Mg 2+ , ddH2O and a PCR amplification primer pair; characterized in that the PCR amplification primer pair is selected from any one of primer pair 1 or primer 2; the nucleotide sequence of the upstream primer of primer pair 1 is: CCGAAAATGAGCTGGGGGAT, and the nucleotide sequence of the downstream primer of primer pair 1 is: AGCAGACAGTGACCTGCTTC; The nucleotide sequence of the upstream primer of the primer pair 2 is: AGTACCTCATAAGACCACCATTC, and the nucleotide sequence of the downstream primer of the primer pair 2 is: GAGCAGCATTAGCCATCAGTTTA.

10. Use of the PCR detection kit according to claim 9 in detecting the Populus davidiana genome.

Citation Information

Patent Citations

  • Specific genome DNA sequence of male plant of populus simonii and application thereof

    CN111269974A

  • SSR molecular marker for identifying sex of populus diversifolia and application of SSR molecular marker

    CN112725507A