Non-toxic toxoid molecule antigen vaccine based on protective antigen functional domain structure and preparation method and application thereof

By constructing a non-toxic toxoid molecular vaccine and using genetic engineering technology to mutate the L-HN and Hc domains, the problems of complex production and insufficient immunogenicity of existing vaccines have been solved, achieving a highly efficient and safe immunoprotective effect, and applicable to the prevention of a variety of biological toxin pathogens.

CN116270997BActive Publication Date: 2026-03-24ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202310204201.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-06
Publication Date
2026-03-24
Estimated Expiration
2043-03-06

AI Technical Summary

Technical Problem

Existing botulinum toxin and tetanus toxin vaccines have problems such as complex production processes, unstable antigen components, potential for excessive immune responses, and insufficient immune protection. Traditional recombinant subunit vaccines contain only some epitopes and their immune protection efficacy is not as good as that of toxoid vaccines.

Method used

Non-toxic toxoid molecular vaccines were constructed using genetic engineering technology. By mutating the L-HN and Hc domains of tetanus toxin and botulinum toxin, fusion proteins or recombinant toxins were formed, and non-toxic genetically engineered toxoid molecular antigen vaccines containing mL-HN and mHc antigen mutants were prepared. Highly effective vaccine components were obtained by expressing and purifying the vaccines using E. coli.

Benefits of technology

It achieves highly efficient and safe immune protection, can generate a strong immune response, replaces traditional inactivated vaccines, has broad-spectrum protective efficacy, and is suitable for the prevention of a variety of biological toxin pathogens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses a non-toxic genetically engineered toxoid molecule antigen vaccine based on a protective antigen functional domain structure and a preparation method and application thereof. It is determined that botulinum toxin and tetanus toxin both have two key protective antigen molecules, i.e. a receptor binding region Hc and a light chain-transmembrane region L-HN. Based on the important role of the functional domain in immunoprotective efficacy, a non-toxic genetically engineered toxoid or chimeric toxoid multivalent vaccine molecule is designed and prepared by using a biosynthesis technology. The vaccine has two important protective antigens of biological toxins, can produce strong complete protection at a low dose and a small number of immunization times, and can be used as a high-efficiency genetically engineered toxoid vaccine to replace formaldehyde inactivated toxoids for biological toxin prevention. The vaccine has important protective antigens of two different biological toxins, can produce protective efficacy against a plurality of different toxin biological agents, and can be used as a broad-spectrum multivalent vaccine for biological toxin prevention.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biopharmaceuticals, specifically to a non-toxic toxoid molecular antigen vaccine based on the construction of protective antigen functional domains, its preparation method, and its application. Background Technology

[0002] Botulinum neurotoxin (BoNTs) is a neurotoxin secreted by Clostridium botulinum. It is the most potent known biological and chemical toxin in humans, with a median lethal dose (LD50) of only 0.1-1 ng / kg. Botulinum toxin can be classified into eight serotypes (AH) based on its antigenic properties. Types A, B, E, F, and H can cause botulism in humans. The novel H serotype, discovered in 2013, is a hybrid of types A and F. Its Hc is similar to BoNT / A1, with 84% homology, and can be partially neutralized by anti-A toxin antibodies. HN and L share 64% and 81% homology with BoNT / F1 and BoNT / F5, respectively. Because Clostridium botulinum, which produces botulinum toxin, is widespread in nature and its spores have strong resistance to the external environment, botulism remains a very serious public health problem. Therefore, the development of botulinum toxin-based preventive drugs is of great practical significance for national biosecurity, public health security, and people's life and health.

[0003] Tetanus toxin (TeNT) is a toxin produced by Clostridium tetani, which enters the human body through skin or mucous membrane wounds and multiplies in an anaerobic environment. Tetanus is highly toxic; the estimated lethal dose for humans is less than 2.5 ng / kg, and the mortality rate without treatment is as high as 40%. Tetanus is a life-threatening disease characterized by muscle spasms, caused by the neurotoxin of Clostridium tetani. It often occurs secondary to various traumas and can also occur in mothers and newborns who give birth under unsanitary conditions.

[0004] Tetanus toxin and botulinum toxin share the same structural features and similar mechanisms of poisoning. Mature active botulinum toxin and tetanus toxin are long peptide chains consisting of light chains (L chain, 50 kDa) and heavy chains (H chain, 100 kDa) linked together by non-covalent disulfide bonds. The light chain is the toxic domain, possessing zinc ion endopeptide activity. HEXXH is an important conserved sequence site for enzyme activity; mutating the H, E, and H amino acids in HEXXH to A results in the light chain lacking enzymatic activity. The N-terminus of the heavy chain is the HN domain, a transport region primarily composed of α-helices, playing a crucial role in the transmembrane transport of toxins. The C-terminus of the heavy chain is the Hc domain, a nerve cell-specific binding domain composed of two subdomains (Hc-N and Hc-C). It can interact with dual-receptor gangliosides and receptor protein molecules, facilitating neurotoxin entry into cells. The ganglioside binding site (GBS) is a highly conserved sequence site SXWY; mutating the relevant WY amino acid to SXLF prevents the receptor-binding domain (RBD) from being bound by dual-receptor molecules into nerve cells, thus rendering the biotoxin molecule ineffective. Botulinum toxin, as the most potent known protein, has attracted significant attention for the development of vaccines and neutralizing antibodies. However, currently researched or limited-use toxin-like vaccines have many drawbacks, hindering their widespread application. In recent years, research on botulinum toxin vaccines has been strengthened both domestically and internationally in an attempt to find safe and effective vaccines. Among them, the most promising research prospect is the novel recombinant subunit vaccine.

[0005] Previous studies have largely shown that the Hc domain of botulinum toxin and tetanus toxin receptor-binding domains is a fundamental determinant of protective antigens, possessing complete protective efficacy and serving as a primary target antigen in biotoxin vaccine research. Our recent research also indicates that other functional domains of botulinum toxin and tetanus toxin, such as the light chain and HN domains, are also important protective antigens, particularly the L-HN domain, which exhibits strong immunoprotective activity. For example, our results demonstrate that the protective efficacy of the L-HN antigen of botulinum toxin type E as an immunogen is superior to that of other functional domain antigens, including the Hc antigen, as immunogens (see patent: ZL 201911292144.8). This characteristic effectively compensates for the insufficient immunoprotective efficacy of the recombinant Hc antigen of botulinum toxin type E.

[0006] Currently used tetanus or botulinum toxin vaccines are produced using a method that inactivates tetanus toxin or botulinum toxin (toxin-like) with formaldehyde. This is a time-consuming and technically demanding process. During formaldehyde inactivation, important neutralizing epitopes of the toxin molecule may be destroyed, and batch-to-batch consistency is inconsistent. Furthermore, these toxin-like vaccine formulations occasionally cause adverse reactions such as over-immunization. Recent recombinant genetically engineered subunit vaccines, on the other hand, do not require culturing pathogens or purifying active biological toxins, making the production process safer and more efficient. However, their drawback is that the vaccine antigen component only contains some or the main epitopes of the toxin molecule, and their immunoprotective efficacy may be lower than that of toxin-like vaccine formulations. Summary of the Invention

[0007] The purpose of this invention is to provide a non-toxic toxoid molecular antigen vaccine based on the construction of protective antigen functional domains, its preparation method, and its application.

[0008] In a first aspect, the present invention claims protection for a non-toxic genetically engineered toxin-like molecular antigen vaccine.

[0009] The non-toxic genetically engineered toxoid molecular antigen vaccine claimed in this invention has an active ingredient that is any one of the following:

[0010] (A) A fusion protein formed by fusing the following a1) and a2):

[0011] a1) The L-HN antigen of tetanus toxin or botulinum toxin or its mutant, the mutant being named mL-HN antigen; the mL-HN antigen has the following mutation compared with the L-HN antigen: the conserved enzyme activity sequence site HEXXH on the L chain of the L-HN antigen is mutated to AAXXA, where X is any amino acid;

[0012] a2) The Hc antigen of tetanus toxin or botulinum toxin or a mutant thereof, the mutant being named mHc antigen; the mHc antigen having the following mutation compared to the Hc antigen: the conserved sequence SXWY of the ganglioside binding site on the Hc antigen is mutated to SXLF, where X is any amino acid;

[0013] Furthermore, at least one of a1) and a2) constituting the fusion protein is a mutant;

[0014] (B) Recombinant tetanus toxoid or recombinant botulinum toxoid;

[0015] The recombinant tetanus toxoid has the following mutations compared to the original tetanus toxoid: the conserved enzyme activity sequence site HEXXH on the L chain of the original tetanus toxoid is mutated to AAXXA, and / or the conserved ganglioside binding site sequence SXWY on the Hc domain of the original tetanus toxoid is mutated to SXLF, where X is any amino acid, and R1226 is also mutated to L.

[0016] The recombinant botulinum toxin has the following mutations compared to the original botulinum toxin: the conserved enzyme activity sequence site HEXXH on the L chain of the original botulinum toxin is mutated to AAXXA, and / or the conserved ganglioside binding site sequence SXWY on the Hc domain of the original botulinum toxin is mutated to SXLF, where X is any amino acid.

[0017] The L-HN antigen is the fusion region (L chain and HN fusion region) of the light chain and heavy chain amino acids of tetanus toxin or botulinum toxin.

[0018] In a specific embodiment of the present invention, the botulinum toxin is type E botulinum toxin, type A botulinum toxin, or type B botulinum toxin.

[0019] In a specific embodiment of the present invention, the active ingredient of the non-toxic toxoid molecular antigen vaccine is any one of the following:

[0020] (A1) A fusion protein formed by fusing the mL-HN antigen of botulinum toxin type E and the mHc antigen of botulinum toxin type A in the order from amino acid to carboxyl terminus via a GS linker peptide, the fusion protein being named mE / mA.

[0021] (A2) A fusion protein formed by fusing the mL-HN antigen of botulinum toxin type E and the Hc antigen of botulinum toxin type A in the order from amino acid to carboxyl terminus via a GS linker peptide is named mE / A.

[0022] (A3) A fusion protein formed by fusing the mL-HN antigen of botulinum toxin type E and the mHc antigen of botulinum toxin type B in the order from amino acid to carboxyl terminus via a GS linker peptide is named mE / mB.

[0023] (A4) A fusion protein formed by fusing the mL-HN antigen of tetanus toxin and the mHc antigen of botulinum toxin type A in the order from amino acid to carboxyl terminus via a GS linker peptide is named mT / mA.

[0024] (A5) A fusion protein formed by fusing the mHc antigen of botulinum toxin type A and the mL-HN antigen of tetanus toxin in the order from amino acid to carboxyl terminus via a GS linker peptide, the fusion protein being named mA / mT.

[0025] The recombinant tetanus toxoid described in (A6) is named mTeNT;

[0026] (A7) The recombinant botulinum toxin of type A is named mA;

[0027] The recombinant botulinum toxin of type (A8)B is named mB.

[0028] The mL-HN antigen of botulinum toxin type E is named mEL-HN, and the amino acid sequence of mEL-HN is shown in SEQ ID No. 30.

[0029] The mHc antigen of botulinum toxin type A is named mAHc, and the amino acid sequence of mAHc is shown in SEQ ID No. 23.

[0030] The Hc antigen of botulinum toxin type A is named AHc, and the amino acid sequence of AHc is shown in SEQ ID No. 22.

[0031] The mL-HN antigen of type A botulinum toxin is named mAL-HN, and the amino acid sequence of mAL-HN is shown in SEQ ID No. 28.

[0032] The mHc antigen of botulinum toxin type B is named mBHc, and the amino acid sequence of mBHc is shown in SEQ ID No. 24.

[0033] The mL-HN antigen of tetanus toxin is named mTL-HN, and the amino acid sequence of mTL-HN is shown in SEQ ID No. 21.

[0034] The mHc antigen of tetanus toxin is named mTHc, and the amino acid sequence of mTHc is shown in SEQ ID No. 20.

[0035] The amino acid sequence of the GS linker peptide is shown in SEQ ID No. 35.

[0036] Furthermore, the amino acid sequence of the mE / mA is shown in SEQ ID No. 34.

[0037] Furthermore, the amino acid sequence of mE / A is formed by sequentially linking SEQ ID No. 30 (amino acid sequence of mEL-HN), SEQ ID No. 35 (amino acid sequence of GS linker peptide) and SEQ ID No. 22 (amino acid sequence of AHc).

[0038] Furthermore, the amino acid sequence of mE / mB is formed by sequentially linking SEQ ID No. 30 (amino acid sequence of mEL-HN), SEQ ID No. 35 (amino acid sequence of GS linker peptide) and SEQ ID No. 24 (amino acid sequence of mBHc).

[0039] Furthermore, the amino acid sequence of mT / mA is formed by sequentially linking SEQ ID No. 21 (amino acid sequence of mTL-HN), SEQ ID No. 35 (amino acid sequence of GS linker peptide) and SEQ ID No. 23 (amino acid sequence of mAHc).

[0040] Furthermore, the amino acid sequence of mA / mT is formed by sequentially linking SEQ ID No. 28 (amino acid sequence of mAL-HN), SEQ ID No. 35 (amino acid sequence of GS linker peptide), and SEQ ID No. 20 (amino acid sequence of mTHc).

[0041] Furthermore, the amino acid sequence of the mTeNT is shown in SEQ ID No. 32.

[0042] Furthermore, the amino acid sequence of mA is formed by sequentially linking SEQ ID No. 28 (amino acid sequence of mAL-HN), GS (amino acid sequence of GS small linker peptide) and SEQ ID No. 23 (amino acid sequence of mAHc).

[0043] Furthermore, the amino acid sequence of mB is formed by sequentially linking SEQ ID No. 29 (amino acid sequence of mBL-HN), GS (amino acid sequence of GS small linker peptide) and SEQ ID No. 24 (amino acid sequence of mBHc).

[0044] Secondly, the present invention claims a method for preparing a non-toxic genetically engineered toxoid molecular antigen vaccine as described in the first aspect above.

[0045] The method for preparing the non-toxic genetically engineered toxoid molecular antigen vaccine described in the first aspect above, as claimed in this invention, may include the following steps: introducing a nucleic acid molecule encoding a protein as the active ingredient into Escherichia coli recipient cells to obtain recombinant Escherichia coli; culturing the recombinant Escherichia coli to obtain the protein as the active ingredient, thereby preparing the non-toxic genetically engineered toxoid molecular antigen vaccine.

[0046] The sequence of the nucleic acid molecule encoding the mEL-HN is shown in SEQ ID No. 19.

[0047] The sequence of the nucleic acid molecule encoding the mAHc is shown in SEQ ID No. 12.

[0048] The sequence of the nucleic acid molecule encoding the AHc is shown in SEQ ID No. 11.

[0049] The nucleic acid molecule sequence encoding the mAL-HN is shown in SEQ ID No. 17.

[0050] The sequence of the nucleic acid molecule encoding the mBHc is shown in SEQ ID No. 13.

[0051] The sequence of the nucleic acid molecule encoding the mTL-HN is shown in SEQ ID No. 10.

[0052] The sequence of the nucleic acid molecule encoding the mTHc is shown in SEQ ID No. 9.

[0053] The nucleic acid sequence encoding the GS linker peptide is shown in SEQ ID No. 36.

[0054] Furthermore, the sequence of the nucleic acid molecule encoding the mE / mA is shown in SEQ ID No. 33.

[0055] Furthermore, the sequence of the nucleic acid molecule encoding the mE / A is formed by sequentially linking SEQ ID No. 19 (nucleotide sequence of mEL-HN), SEQ ID No. 36 (nucleotide sequence of GS linker peptide) and SEQ ID No. 11 (nucleotide sequence of AHc).

[0056] Furthermore, the sequence encoding the nucleic acid molecule of the mE / mB is formed by sequentially linking SEQ ID No. 19 (nucleotide sequence of mEL-HN), SEQ ID No. 36 (nucleotide sequence of GS linker peptide) and SEQ ID No. 13 (nucleotide sequence of mBHc).

[0057] Furthermore, the sequence encoding the mT / mA nucleic acid molecule is formed by sequentially linking SEQ ID No. 10 (nucleotide sequence of mTL-HN), SEQ ID No. 36 (nucleotide sequence of GS linker peptide) and SEQ ID No. 12 (nucleotide sequence of mAHc).

[0058] Furthermore, the sequence encoding the mA / mT nucleic acid molecule is formed by sequentially linking SEQ ID No. 17 (nucleotide sequence of mAL-HN), SEQ ID No. 36 (nucleotide sequence of GS linker peptide) and SEQ ID No. 9 (nucleotide sequence of mTHc).

[0059] Furthermore, the sequence of the nucleic acid molecule encoding the mTeNT is shown in SEQ ID No. 31.

[0060] Furthermore, the sequence of the nucleic acid molecule encoding mA is formed by sequentially linking SEQ ID No. 17 (nucleotide sequence of mAL-HN), GGATCC (nucleotide sequence of GS small linker peptide) and SEQ ID No. 12 (nucleotide sequence of mAHc).

[0061] Furthermore, the sequence of the nucleic acid molecule encoding mB is formed by sequentially linking SEQ ID No. 18 (nucleotide sequence of mBL-HN), GGATCC (nucleotide sequence of GS small linker peptide) and SEQ ID No. 13 (nucleotide sequence of mBHc).

[0062] In the method, during the cultivation of the recombinant Escherichia coli, IPTG is added to a final concentration of 0.4 mmol / L when the culture reaches the logarithmic growth phase, and then the culture is carried out at 30°C for 4-5 hours or at 18°C ​​overnight. After the culture is completed, the bacterial cells are collected, sonicated, and the supernatant is collected by centrifugation. The protein, which is the active ingredient, can be obtained from the supernatant.

[0063] Furthermore, after centrifuging and collecting the supernatant, the process further includes a purification step using a Ni-NTA affinity chromatography column or a streptomycin affinity chromatography column.

[0064] In both of the above aspects, the non-toxic genetically engineered toxin molecular antigen vaccine contains an adjuvant in addition to the active ingredient.

[0065] Furthermore, aluminum adjuvants.

[0066] Thirdly, the present invention claims protection for any of the following substances:

[0067] (B1) Protein, which is the protein mentioned as the active ingredient in the first aspect above;

[0068] (B2) Nucleic acid molecules, which are the nucleic acid molecules described in the second aspect above, encoding the protein described in (B1);

[0069] (B3) Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the nucleic acid molecules described in (B2);

[0070] (B4) Products for the prevention and / or treatment of poisoning symptoms caused by botulinum toxin and / or tetanus toxin, containing the protein described in (B1) or the nucleic acid molecule described in (B2) or the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria described in (B3).

[0071] Fourthly, the present invention claims protection for the use of the protein described in (B1) of the third aspect above, or the nucleic acid molecule described in (B2) above, or the recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria described in (B3) above, in the preparation of products for the prevention and / or treatment of poisoning symptoms caused by botulinum toxin and / or tetanus toxin.

[0072] The applicant's team has established a cutting-edge basic research platform for the functional domains of biotoxins and their immunogenicity. They have systematically studied the biological activity and immunogenicity of various functional epitopes of botulinum toxins (types A, B, E, and F) and tetanus toxin. This research has identified two key protective antigen molecules in both botulinum toxin and tetanus toxin: the receptor-binding domain (Hc) and the light chain-transmembrane domain (L-HN). Both can serve as vaccine antigen molecules to produce strong protective efficacy. Given that the botulinum toxin receptor-binding domain (Hc) and the light chain-transmembrane domain (L-HN) are important protective antigens, they can not only be used individually as subunit candidate vaccines but also provide a wealth of candidate protective antigen molecules for the development of novel, highly effective botulinum toxin vaccines. This technical approach, using botulinum toxin and tetanus toxin as research subjects, has established a technology for the construction and biosynthesis of full-length molecular vaccine antigens of biotoxins and toxoids. A series of non-toxic full-length toxoid molecules prepared through biosynthesis can serve as highly effective novel vaccines for the prevention of various biotoxin pathogens.

[0073] Based on this concept and technology, this invention uses tetanus toxin and botulinum toxin as model organisms to explore the construction and biosynthesis technology of non-toxic toxoid full-length molecular vaccines. This invention utilizes genetic engineering and biosynthesis techniques to prepare various non-toxic biotoxin toxoid molecules and investigates the immunoprotective efficacy of each recombinant toxoid antigen vaccine molecule. The results show that this series of novel toxoid molecular antigen vaccines has strong immunoprotective effects, superior to Hc antigen or L-HN antigen alone, producing stronger and more effective immunogenicity. In particular, it can produce strong complete protection with low doses and fewer immunizations. These novel recombinant non-toxic biotoxin toxoids, such as genetically engineered tetanus toxoid and botulinum toxoid vaccines, can replace traditional inactivated toxoid vaccines. These vaccine molecules do not require formaldehyde to inactivate biotoxins and can be directly used as recombinant protein antigen vaccines for highly effective immunization to prevent or treat tetanus toxin poisoning.

[0074] More importantly, chimeric toxoid multivalent or multiplex vaccines assembled based on protective antigen functional domains have broad application prospects. By selecting and assembling the L-HN and Hc functional domains of different serotype toxins with high protective efficacy, non-toxic toxoid molecules can be synthesized. These protein molecules, as novel biological toxin vaccines, can exhibit the structure and characteristics of biological toxins but lack the toxicity of biological toxins themselves, while also including the most important protective antigens. Therefore, they can simultaneously protect against multiple biological toxin pathogens. For example, by selecting the strongest protective antigens of botulinum toxin type E (EL-HN) and botulinum toxin type A (AHc), and assembling and constructing them, non-toxic mEL-HN-mAHc series molecules were biosynthesized using genetic engineering technology. This series of toxoid molecules, mEL-HN-mAHc, all possess the correct structural characteristics and immunogenicity. As subunit vaccines, they can produce strong protection against botulinum toxin type A and type E, and also provide cross-protection against novel botulinum toxin type H. Through examples and research results, the single-gene-engineered toxoid antigen molecule vaccine of this invention can produce protective efficacy against three different toxin biological agents, and can be used as a broad-spectrum multivalent vaccine for biotoxin prophylaxis. This invention verifies the feasibility of this technical solution and the effectiveness of the protective efficacy of the multivalent vaccine antigen molecule, proving that this technology is feasible and can be applied to the research and development of multivalent vaccines against various biotoxin pathogens.

[0075] The invention provides a novel biotoxin vaccine construction and biosynthesis technology based on the functional domain of protective antigens. It verifies the effectiveness of this series of non-toxic full-length toxoid molecules as novel biotoxin vaccine antigens. When used as a monovalent single-molecule vaccine, it can replace formaldehyde-inactivated toxoid vaccines. When used as a chimeric multivalent single-molecule toxoid vaccine, it can simultaneously protect against 2 or 3 biotoxin pathogens. Both are highly effective biotoxin vaccine varieties. Attached Figure Description

[0076] Figure 1 SDS-PAGE electrophoresis and Western blot identification of the TL, THN, TL-HN, TL-GS-HN, TL-2A-HN, and THc proteins of the purified tetanus toxin functional domains are shown in Figure A. Lanes 1-6 show the SDS-PAGE identification of each protein in each tetanus toxin functional domain. Lanes 1-6 show the results of reduced SDS-PAGE electrophoresis of TL, THN, TL-HN, TL-GS-HN, TL-2A-HN, and THc protein samples, respectively; lanes 7-9 show the results of non-reduced SDS-PAGE electrophoresis of TL-HN, TL-GS-HN, and TL-2A-HN protein samples, respectively; M represents the protein markers (from top to bottom: 170, 130, 100, 70, 55, 40, 35, and 25 kDa). Lanes B and C show the Western blot identification of each protein in each tetanus toxin functional domain (using the primary antibody as the standard for equine tetanus toxin antitoxin). Lanes 1-6 represent TL, THN, TL-HN, TL-GS-HN, TL-2A-HN, and THc protein samples, respectively. Black arrows indicate the locations of specific functional domains. Red arrows (the arrows at the relatively smaller bands in lane 5 of lanes A and B) show that the partially double-stranded TL-2A-HN protein separated into TL (50 kDa) and THN (50 kDa) during reducing electrophoresis.

[0077] Figure 2 This diagram illustrates the molecular structures of various recombinant biological toxins and toxins. Note: The selected functional domains and assembly sequences of botulinum toxin and tetanus toxin are shown in the figure. The numbers in parentheses indicate the amino acid sequence information of that functional domain. The receptor-binding region Hc-RBD and the L chain, along with the HN functional domain, are assembled into a non-toxic, full-length biological toxin molecule via a (G4S)3 linker peptide. Molecules marked with 'm' are mutants; detailed information is shown in Table 2. The GS linker represents the (G4S)3 linker peptide.

[0078] Figure 3This image shows SDS-PAGE electrophoresis and Western Blot identification of the non-toxic tetanus toxoid mTeNT protein obtained after biosynthesis and purification. Lane A shows the SDS-PAGE identification of each functional domain of tetanus toxoid; lane 1 shows strains that did not express mA toxoid protein molecules; lane 2 shows strains that biosynthesized and expressed mTeNT toxoid protein molecules; lanes 3-5 show the purified mTeNT toxoid protein molecules, with lanes 3-4 showing electrophoresis results under reducing conditions; lane 5 showing electrophoresis results under non-reducing conditions; M is the protein marker (kDa). Black arrows indicate the positions of mA and mB toxoid protein molecules (150 kDa). B and C are Western Blot identification images of the non-toxic tetanus toxoid mTeNT protein. B shows the results of serum antibody detection in anti-TL mice; C shows the results of serum antibody detection in anti-THc mice. Black arrows indicate the positions of proteins in specific functional domains. M stands for protein marker (from top to bottom: 170, 130, 100, 70, 55, 40, 35 and 25 kDa).

[0079] Figure 4 This is an SDS-PAGE electrophoresis image of the non-toxic botulinum toxin type A and type B (mA and mB) proteins obtained after biosynthesis and purification. Lanes 1 and 2 show the strains that biosynthesized and expressed the mA toxin protein molecule; lane 3 shows the purified mA toxin protein molecule; lane 4 shows the strains that biosynthesized and expressed the mB toxin protein molecule; lane 5 shows the control strains that did not express the target protein; lane 6 shows the purified mB toxin protein molecule; M is the protein marker (kDa). The black arrows indicate the positions of the mA and mB toxin protein molecules (150 kDa).

[0080] Figure 5 This is an SDS-PAGE electrophoresis image of the non-toxic E / A type toxoid vaccine molecular protein obtained after biosynthesis and purification. Lane 1 shows the control strain that did not express the target protein; lanes 2-4 show the strains that expressed the biosynthesized E / A type toxoid protein molecule, respectively; lanes 5-8 show the purified mE / mA, mE / A, mA / mE, and mA / E toxoid vaccine molecular proteins, respectively; M is the protein marker (kDa). The black arrow indicates the location of the E / A type toxoid protein molecule (150 kDa).

[0081] Figure 6This is an SDS-PAGE electrophoresis image of the non-toxic T / A, A / T, and E / B type toxoid vaccine molecules obtained after biosynthesis and purification. In lane A, lanes 1, 4, and 8 show control strains that do not express the target protein, respectively; lanes 2, 3, 6, and 7 show strains that biosynthesized and expressed T / A and A / T type toxoid protein molecules, respectively; lanes 5 and 9 show the purified mT / mA and mA / mT toxoid vaccine molecules, respectively. In lane B, lane 1 shows the strain that biosynthesized and expressed the E / B type toxoid protein molecule; lane 2 shows the control strain that did not express the target protein; lane 3 shows the purified mE / mB toxoid vaccine protein molecule. M is the protein marker (kDa). The black arrows indicate the positions (150 kDa) of the mT / mA, mA / mT, and mE / mB toxoid protein molecules.

[0082] Figure 7 The results show the antibody levels in mice immunized with tetanus toxin's functional domains TL, THN, TL-HN, TL-GS-HN, TL-2A-HN, and THc. A shows the antibody titers against each recombinant antigen detected by ELISA at a dose of 1 μg; B shows the antibody titers against each recombinant antigen detected by ELISA at a dose of 10 μg.

[0083] Figure 8 The results show the antibody levels in mice immunized with a tetanus toxoid molecular vaccine. A shows the antibody titers of mTeNT, TT, and TL-HN+THc against the TL-HN antigen detected by ELISA; B shows the antibody titers of mTeNT, TT, and TL-HN+THc against the THc antigen detected by ELISA.

[0084] Figure 9 The results show the antibody levels in mice immunized with the E / A type toxoid molecular vaccine. A shows the antibody titer against each recombinant protein antigen in the 1 μg dose immunized group detected by ELISA; B shows the antibody titer against each recombinant protein antigen in the 10 μg dose immunized group detected by ELISA.

[0085] Note: All data in this experiment were analyzed using GraphPad Prism 5.0. The experimental results are expressed as mean ± standard error (mean ± SD). The differences between paired experiments were analyzed using t-tests or chi-square tests to determine their statistical significance. Detailed Implementation

[0086] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0087] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0088] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: *Molecular Cloning: A Laboratory Manual* (Sambrook, J., Russell, David W., *Molecular Cloning: A Laboratory Manual*, 3rd edition). rd (edition, 2001, NY, Cold Spring Harbor) and the Pharmacopoeia of the People's Republic of China (edited by the National Pharmacopoeia Commission, Vol. 3, 2020, Chemical Industry Press).

[0089] Example 1: Expression, purification and identification of various functional domains of tetanus toxin in Escherichia coli

[0090] I. Design and Synthesis of Tetanus Toxin Functional Epitope Antigens (L, HN, L-HN, Hc) Genes

[0091] Based on codon degeneracy, genes encoding functional epitopes of tetanus toxin were artificially optimized and synthesized, encoding TL, THN, TL-HN, THc, TL-GS-HN, and TL-2A-HN, respectively (detailed antigen and sequence information are shown in Table 1; gene sequences were directly synthesized by BGI Genomics). These genes were first directly cloned into cloning vectors such as pMD18-T (TaKaRa) for later use. To facilitate subsequent operations, EcoRI restriction sites were introduced at the 5' end and XhoI restriction sites at the 3' end of each functional epitope antigen gene during cloning.

[0092] The above gene design uses codons commonly used in E. coli and ensures that the encoded amino acid residue sequence remains unchanged. Based on the full-length tetanus toxin gene sequence and amino acid residue sequence (reference strain: Clostridium tetani CMCC64008, tetanus toxin has a full length of 1315 amino acids), all functional epitope antigen genes were optimized, which is more conducive to the recombinant expression and biosynthesis of tetanus toxin genes.

[0093] Table 1. Basic Information on Epitopes of Each Functional Domain of Tetanus Toxin

[0094]

[0095] Note: The gene sequence of the GS linker peptide (G4S) is GGCGGTGGCGGTAGTGGCGGTGGCGGTAGCGGCGGTGGCGGTAGT; the amino acid sequence is GGGGSGGGGSGGGGS. The gene sequence of the 2A linker peptide is CTCTTGAACTTTGACCTACTTAAGTTGGCGGGTGACGTTGAGTCCAACCTTGGTCCA; the amino acid sequence is LLNFDLLKLAGDVESNLGP.

[0096] II. Construction of various recombinant prokaryotic expression vectors

[0097] The plasmids obtained above were double-digested with EcoRI and XhoI, respectively. The corresponding target gene fragments were recovered using a DNA recovery kit and ligated with the prokaryotic expression vector pTIG-Trx (see patent: ZL200710089588.2) that had been double-digested with the same enzymes. The ligation product was transformed into E. coli DH5α competent cells, positive clones were screened, plasmids were extracted, and sequencing was performed to obtain recombinant prokaryotic expression vectors with correct sequences and insertion positions. Based on the different inserted fragments, they were named pTIG-Trx-TL, pTIG-Trx-THN, pTIG-Trx-TL-HN, pTIG-Trx-THc, pTIG-Trx-TL-GS-HN, and pTIG-Trx-TL-2A-HN, respectively.

[0098] III. Expression of each recombinant antigen in Escherichia coli and purification and identification of expression products

[0099] 1. Expression of each recombinant antigen in Escherichia coli and SDS-PAGE detection of expression products

[0100] The six recombinant prokaryotic expression vectors constructed in step two were transformed into Escherichia coli BL21(DE3) competent cells (TIANGEN). Positive recombinants were screened, with recombinant bacteria transformed with the pTIG-Trx empty vector as a negative control. The positive recombinant bacteria were then inoculated at a ratio of 1:100 into 500 mL of LB liquid medium containing 100 mg / mL ampicillin and cultured in large quantities at 37 °C and 250 rpm. When the culture reached the logarithmic growth phase (OD600 approximately 0.6-0.8), the chemical inducer IPTG was added to a final concentration of 0.4 mmol / L, and the cells were cultured overnight at 18 °C with shaking at 220 rpm. After culture, the bacterial cells were collected by centrifugation, resuspended in 20 mM sodium phosphate buffer (pH 8.0), and the cells were broken up by sonication. The supernatant was collected by centrifugation and analyzed by 12% SDS-PAGE. The results showed that the recombinant proteins that were induced were expressed and could exist in a soluble form. However, no band of the target protein was found in the uninduced strains and the induced empty vector control. This indicates that the expressed protein may be the target protein, i.e., each recombinant antigen.

[0101] 2. Purification and identification of the expression product

[0102] Each recombinant antigen expressed in step 1 contains a six-histidine tag at its C-terminus. Therefore, the soluble expression product was purified using a Ni-NTA affinity chromatography column (Pharmacia) according to the manufacturer's instructions to obtain the eluted purified protein. The purified protein was then analyzed by 12% SDS-PAGE, and the results showed that the purified target protein was obtained. The obtained target protein was stored at -20℃ or -80℃ for later use. Figure 1 Figure A shows the SDS-PAGE electrophoresis image of the purified six target proteins (TL, THN, TL-HN, THc, TL-GS-HN, and TL-2A-HN).

[0103] 3. Western blot identification of the expressed product

[0104] Using equine tetanus antitoxin standard (purchased from the National Institutes for Food and Drug Control) as the primary antibody and horseradish peroxidase (HRP)-labeled rabbit anti-equine IgG (Sigma) as the secondary antibody, Western blot analysis was performed on the purified recombinant antigen proteins. The results showed that the expressed target protein specifically bound to the antibody in the tetanus antitoxin standard. The size and location of the positive bands were consistent with the electrophoretic positions and were comparable to the theoretical sizes of the recombinant proteins, indicating that the purified recombinant protein was indeed the target protein. Figure 1 (B and C in the middle).

[0105] In summary, the gene sequences of each functional domain of tetanus toxin were cloned using genetic engineering techniques and ligated into the prokaryotic expression vector pTIG-Trx to obtain a recombinant expression plasmid. Through optimization of the induction expression conditions, efficient soluble expression of the recombinant plasmid in *E. coli* was achieved, and the expression was validated using HisTrap. TM HP protein chromatography column purified recombinant proteins with high purity and good stability, providing a basis for comparing the immunoprotective efficacy of molecules with different functional domains of proteins.

[0106] Example 2: Expression, purification, and identification of various non-toxic biotoxin toxin molecules in Escherichia coli

[0107] I. Gene design and synthesis of functional domains (L-HN or Hc) of various types of botulinum toxin and tetanus toxin

[0108] Based on codon degeneracy, genes encoding functional domains (L-HN or Hc and their mutants mL-HN or mHc) of various botulinum toxin and tetanus toxin were artificially optimized and synthesized (detailed functional domains and sequence information are shown in Table 2; gene sequences were directly synthesized by BGI Genomics). These genes were first directly cloned into cloning vectors such as pMD18-T for later use. To facilitate subsequent operations, EcoRI and BamHI restriction sites were introduced at the 5' end and 3' end of each L-HN gene, respectively. Similarly, BamHI and XhoI restriction sites were introduced at the 5' end and 3' end of each Hc gene, respectively, for the other protective antigen.

[0109] The above gene design uses codons commonly used in E. coli and ensures that the encoded amino acid residue sequences remain unchanged. Based on the full-length gene sequences and amino acid residue sequences of various botulinum toxin types (reference: botulinum toxin type A, strain 62A, 1296 amino acids; botulinum toxin type B, strain Okra, 1291 amino acids; botulinum toxin type E, strain Beluga or NCTC 11219, 1252 amino acids), all functional epitope antigen genes were optimized to better facilitate the biosynthesis and expression of toxin genes.

[0110] Table 2. Basic Information on Protein Molecules and Mutants of Each Functional Domain of Tetanus Toxin and Various Types of Botulinum Toxin

[0111]

[0112]

[0113] II. Construction and Identification of Various Recombinant Prokaryotic Expression Vectors

[0114] First, to facilitate the cloning of multiple target genes into the prokaryotic expression vector pTIG-Trx (see patent: ZL200710089588.2), this invention first clones BamHI (GGATTC, encoding a small GS linker peptide) between EcoRI and XhoI in pTIG-Trx. This gives the entire vector three cloning restriction sites (EcoRI, BamHI, and XhoI), facilitating the cloning of two genes. This expression vector is named pTIG-Trx-M (used for subsequent expression of mTeNT, mA, and mB). Alternatively, the BamHI recognition sequence (GGATTC, encoding the GS small linker peptide) and a linker peptide Linker-(G4S)3 (sequence: GGCGGTGGCGGTAGTGGCGGTGGCGGTAGCGGCGGTGGCGGTAGT) can be cloned into the pTIG-Trx vector between EcoRI and XhoI. This gives the vector three cloning restriction sites (EcoRI, BamHI, and XhoI; with the linker peptide Linker-(G4S)3 preceding BamHI), facilitating the cloning of two genes. This expression vector is named pTIG-Trx-MS (for subsequent expression of antigens other than mTeNT, mA, and mB). Furthermore, to enrich the methods for purifying target proteins, this invention also replaces the his tag in the expression vectors pTIG-Trx-M and pTIG-Trx-MS with a Twin Strep streptase tag (gene sequence TGGAGCCACCCCCAGTTCGAGAAGGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCAGCGGCGGCTGGAGCCACCCCCAG TTCGAGAAG, encoding amino acid WSHPQFEK-(GGGS)2-GGSAWSHPQFEK) through the Xho I and Sac I restriction sites. The resulting expression vectors are named pTIG-Trx-M-TS and pTIG-Trx-MS-TS, respectively, thus allowing for the purification of target proteins via the Strep-tag.

[0115] The plasmids containing L-HN and mL-H sequences of each target gene obtained in step one were double-digested with EcoRI and BamHI, respectively. The corresponding target gene fragments were recovered using a DNA recovery kit and ligated with the prokaryotic expression vectors pTIG-Trx-M, pTIG-Trx-MS, pTIG-Trx-M-TS, or pTIG-Trx-MS-TS, which had been double-digested with the same enzymes. The ligation products were transformed into *E. coli* DH5α competent cells, positive clones were screened, plasmids were extracted, and sequencing was performed to obtain recombinant prokaryotic expression vectors with correct sequences and insertion positions. These vectors were named pTIG-Trx-mTL-HN, pTIG-Trx-mAL-HN, pTIG-Trx-mBL-HN, pTIG-Trx-EL-HN, pTIG-Trx-mEL-HN, and pTIG-Trx-AL-HN, respectively, based on the different inserted fragments. Then, using BamHI… The plasmids containing the target gene sequences Hc or mHc obtained above were double-digested with I and XhoI, respectively. The corresponding target gene fragments were recovered using a DNA recovery kit and ligated with the recombinant prokaryotic expression vectors containing the L-HN gene sequence obtained above after double digestion with the same enzyme. The ligation products were transformed into E. coli DH5α competent cells, positive clones were screened, plasmids were extracted, and sequencing was performed to obtain recombinant prokaryotic expression vectors containing the full-length toxin gene sequences of L-HN and Hc with correct sequences and insertion positions. Based on the different inserted fragments, they were named pTIG-Trx-mTeNT (mTL-HN-mTHc), pTIG-Trx-mA (mAL-HN-mAHc), pTIG-Trx-mB (mBL-HN-mBHc), pTIG-Trx-mE / A (mEL-HN-AHc), and pTIG-Trx-mE / mA (mEL-HN-mAHc). , pTIG-Trx-mA / mE(mAL-HN-mEHc) , pTIG-Trx-mA / E(mAL-HN-EHc) , pTIG-Trx-mE / mB(mEL-HN-mBHc) , pTIG-Trx-mT / mA (mTL-HN-mAHc) and pTIG-Trx-mA / mT (mAL-HN-mTHc), etc.

[0116] III. Expression of various recombinant biotoxin protein molecules in Escherichia coli and purification and identification of expression products

[0117] 1. Expression of each recombinant toxin protein molecule in Escherichia coli and SDS-PAGE detection of expression products

[0118] The recombinant prokaryotic expression vector constructed in step two was transformed into Escherichia coli BL21(DE3) competent cells (TIANGEN). Positive recombinants were screened, with recombinant bacteria transformed with the pTIG-Trx empty vector as a negative control. The positive recombinant bacteria were then inoculated at a ratio of 1:100 into 500 mL of LB liquid medium containing 100 mg / mL ampicillin and cultured in large quantities at 37°C and 250 rpm. When the culture reached the logarithmic growth phase (OD600 approximately 0.6-1.0), the chemical inducer IPTG was added to a final concentration of 0.4 mmol / L. The cells were then cultured at 30°C with shaking at 220 rpm for 4-5 hours, or at 18°C ​​with shaking at 220 rpm overnight. After culture, the bacterial cells were collected by centrifugation, resuspended in 20 mM sodium phosphate buffer (pH 8.0), and the cells were broken up by sonication. The supernatant was collected by centrifugation and analyzed by 12% SDS-PAGE. The results showed that the recombinant proteins that were induced were expressed and could exist in a soluble form. However, no band of the target protein was found in the uninduced strains and the induced empty vector control. This indicates that the expressed protein may be the target protein, i.e., each recombinant antigen.

[0119] 2. Purification and identification of the expression product

[0120] The recombinant toxin protein molecules expressed in step 1 contain six histidine residues or a streptoxin TS tag at their C-terminus. Therefore, the soluble expression products were purified using a Ni-NTA affinity chromatography column (Pharmacia) or a streptoxin affinity chromatography column (Dakow Biotech Co., Ltd.) according to the manufacturer's instructions to obtain the eluted purified protein. The purified protein was then analyzed by 12% SDS-PAGE, and the results showed that the purified target protein was obtained. The obtained target protein was stored at -20℃ or -80℃ for later use. Figure 2 The diagram shows the molecular structures of various recombinant biological toxins designed and biosynthesized in this invention. Figure 3 Figure A shows the SDS-PAGE electrophoresis identification of the purified target protein (mTeNT). Figure 4 The image shown is an SDS-PAGE electrophoresis image of the purified target proteins (mA and mB). Figure 5 This is an SDS-PAGE electrophoresis image of the non-toxic E / A type toxoid molecular vaccine proteins (mE / mA, mE / A, mA / mE, and mA / E) obtained after biosynthesis and purification. Figure 6 This is an SDS-PAGE electrophoresis image of the non-toxic T / A, A / T, and E / B type toxoid molecular vaccine proteins (mE / mB, mT / mA, mA / mT) obtained after biosynthesis and purification.

[0121] 3. Western blot analysis of the expressed products: Using equine biotoxin standards (purchased from the National Institutes for Food and Drug Control) and equine or mouse anti-biotoxin receptor binding domain or L-HN polyclonal antibodies (hyperimmune serum antibodies prepared in this experiment) as primary antibodies, and horseradish peroxidase (HRP)-labeled rabbit anti-equine IgG (Sigma) as secondary antibody, Western blot analysis was performed on the purified recombinant toxin-like proteins. The results showed that the expressed target proteins specifically bound to the antibodies in the antitoxin standards of various biotoxins, indicating that they all contained the corresponding functional domains of the various toxin molecules, which is consistent with the theoretical design. Figure 3 Images B and C show the results of Western blot identification of tetanus toxoid. The size and location of the positive bands are consistent with the electrophoretic positions, and are comparable to the theoretical size of recombinant protein molecules, such as anti-light chain TL mouse serum antibodies. Figure 3 (B) and anti-THc mouse serum antibodies ( Figure 3 The target protein molecule was detected in both C and N. These results indicate that the purified recombinant protein is indeed the target protein, containing all functional domains of the full-length toxin.

[0122] IV. Verification of the non-toxicity of recombinant biotoxin protein molecules

[0123] Animal experiments verified the toxicity of each recombinant biotoxin protein molecule in mice. Intraperitoneal injection of 10 or 100 μg per mouse (4 mice per group, female, 6-week-old KM mice) did not cause death or significant toxic side effects, and did not produce the strong toxicity and side effects of natural biotoxins. These results indicate that the genetically engineered mutants are non-toxic, achieving the expected results and meeting the design requirements.

[0124] In summary, gene sequences of various functional domains of different types of biotoxins were cloned using genetic engineering techniques and ligated into the pTIG-Trx series of prokaryotic expression vectors to obtain recombinant expression plasmids. Through optimization of induction expression conditions, efficient soluble expression, biosynthesis, and assembly of the recombinant plasmids in *E. coli* were achieved, and the results were demonstrated using HisTrap. TM HP protein purification columns or streptokinase affinity chromatography columns purified recombinant biotoxin protein molecules with high purity and good stability, providing a basis for further investigation into the immunoprotective efficacy of different biotoxin proteins as subunit vaccines.

[0125] The molecular structures and characteristics of various recombinant toxins obtained through this embodiment are shown in Table 3.

[0126] Table 3. Molecular structure and properties of various recombinant toxins

[0127]

[0128]

[0129] Note: All recombinant toxoid molecules are composed of two functional domains: the L-HN domain and the receptor-binding region Hc. The three recombinant toxoid molecules mTeNT, mA, and mB are linked by a GS linker peptide (gene sequence GGATCC, amino acid sequence GS). The molecules mE / A, mE / mA, mA / mE, mA / E, mT / mA, mA / mT, and mE / mB are linked by a GS linker peptide. The gene sequence of this GS linker peptide is GGCGGTGGCGGTAGTGGCGGTGGCGGTAGCGGCGGTGGCGGTAGTGGATCC (SEQ ID No. 38); the amino acid sequence is GGGGSGGGGSGGGGSGS (SEQ ID No. 37). Detailed information on the various L-HN domains and the receptor-binding region Hc, as well as their mutants, is shown in Table 2.

[0130] Example 3: Detection of antibody levels and evaluation of protective efficacy in mice immunized with tetanus toxin functional epitope antigen proteins.

[0131] The recombinant proteins (TL, THN, TL-HN, THc, TL-GS-HN, and TL-2A-HN) prepared in Example 1 were used as subunit vaccine antigens to immunize mice, and their immunogenicity and protective efficacy were tested. Specifically, Balb / c mice (6-8 weeks old, female, SPF grade, purchased from the Experimental Animal Center of the Academy of Military Medical Sciences) were randomly divided into groups of 10 mice each. The immunization dose was either 1 μg or 10 μg of protein per mouse, with the combined group receiving half of each protein. The negative control group was immunized with PBS containing no recombinant protein and with aluminum adjuvant (Alhydrogel) at a final concentration of 1 mg / ml. TM 2.0% (Brenntag Biosector product) was mixed and immunized with booster immunization every 3 weeks (the dosage of antigen protein and aluminum adjuvant was the same as above). After one or two immunizations, blood was collected from mice, and then the protective effect of the antigen was evaluated by challenge with tetanus toxin (TeNT) (observed for one week and the results were statistically analyzed). The serum antibody level of mice was detected by ELISA and the neutralizing titer was determined by the classic in vivo neutralization test, as follows.

[0132] Serum antibody levels were measured using an ELISA method (enzyme-linked immunosorbent assay plate coated with each recombinant protein antigen at a concentration of 2 μg / mL, using isolated immunized mouse serum as the primary antibody, and HRP-labeled goat anti-mouse IgG (Santa Cruz Biotechnology, Inc.) as the secondary antibody). The specific method is as follows:

[0133] The antigen was diluted to 2 μg / ml and added to 100 μL / well of a 96-well ELISA plate, and incubated overnight at 4°C. The next day, 200 μL of 2% BSA blocking buffer was added to each well, and the plate was incubated at 37°C for 2 hours, followed by washing 6 times with PBST (PBS containing 0.1% Tween-20). Mouse serum samples were serially diluted 1:100 to 2-fold with 2% BSA. 100 μL of the diluted sample was added to each well and incubated at 37°C for 1.5 hours. After washing 6 times with PBST, 100 μL of 1:5000 diluted goat anti-mouse IgG / horseradish enzyme-labeled secondary antibody was added to each well, and the plate was incubated at 37°C for 0.5 hours, followed by 6 washes with PBST. The reaction was terminated with 50 μL of 2M sulfuric acid per well, and the absorbance was read at 492 nm using an ELISA reader. Mouse serum immunized with aluminum adjuvant diluted in PBS served as a negative control (N). A positive result was defined as an OD492 value (P) greater than or equal to 0.3 and a P / N ratio ≥ 2.1. Antibody levels in each group are expressed as mean ± standard deviation. This method was used to determine antibody levels for each antigen in the following assays.

[0134] The in vivo neutralizing activity and titer of serum antibodies in immunized mice were determined using a classic in vivo neutralization assay. Serum antibody titers were reported as International Units per milliliter (IU / ml), with one IU defined as 10⁻⁶ neutralizing units. 4 Neutralizing antibodies against LD50 biotoxins. The following protocol was designed to determine the neutralizing titers of mouse serum against tetanus toxin or botulinum toxin (Note: This protocol should be referenced when determining botulinum toxin neutralizing antibodies, replacing tetanus toxin with botulinum toxin; other methods remain the same, refer to the 2020 edition of the Chinese Pharmacopoeia).

[0135] (1) Dilution of the toxin with the test sample. Dilute the toxin to 100 LD. 50 / ml. Then, the mouse serum was diluted to a factor equivalent to the corresponding toxin according to the expected potency, such as diluting 2 IU / ml serum 200 times to 0.1 IU / ml. At the same time, the antitoxin standard was diluted to the corresponding concentration.

[0136] (2) In vitro binding of toxins to test samples. 1 ml of diluted toxin was mixed with different volumes of diluted serum or tetanus antitoxin standards (all toxins and antitoxin standards were purchased from the China National Institutes for Food and Drug Control), with 5 gradients per group. The mixture was brought to a final volume of 2.5 ml with diluent, and the toxin and antibody were thoroughly mixed and incubated at 37°C for 15 min to allow for complete reaction.

[0137] (3) Animal administration and observation. SPF-grade female KM mice (15-18g) were randomly divided into groups of four. The incubated toxin and antitoxin conjugate sample was injected intraperitoneally into the mice at a dose of 500 μl / mouse, with four mice administered each dilution of each sample. Animal morbidity and mortality were observed daily for seven consecutive days. Serum titer was calculated by comparing the 50% mortality endpoint of the tetanus antitoxin standard group with the 50% protective endpoint of the experimental group.

[0138] In this embodiment, the TL, THN, TL-HN, THc, TL-GS-HN, and TL-2A-HN protein antigens were administered as immunizations once and twice at doses of 1 and 10 μg, respectively. (Table 4 and...) Figure 7 The results showed that each recombinant antigen elicited an antibody response against itself. Protective responses were observed in all immunization groups at different doses and number of immunizations, exhibiting a positive dose-dependent relationship. However, the protective effect against the toxin and the level of neutralizing antibodies varied. The TL-HN group showed the strongest protective effect and the highest level of neutralizing antibodies, followed by the TL and THc groups, while the THN group showed the weakest, with no significant protective effect after a single immunization. The negative control group showed no specific antibody response, nor any protective effect or neutralizing antibodies. Notably, the neutralizing antibody levels also differed among the three groups containing both TL and HN. The highest level of neutralizing antibodies was achieved when the L and HN functional domains were directly assembled into L-HN, reaching 10 and 80 IU / ml in the 1 and 10 μg dose groups, respectively, after two immunizations. However, when the L and HN functional domains were assembled via linker peptides GS or 2A, the neutralizing antibody level decreased by 5-10 times. This result suggests that the linker peptides affect the structure and conformation of the L-HN molecule, leading to a decrease in neutralizing antibody levels.

[0139] Table 4. Evaluation results of the protective efficacy of tetanus toxin functional epitope antigen proteins after immunization in mice.

[0140]

[0141]

[0142] Note: Animals were immunized once or twice with each protein antigen. Three weeks after immunization, 10 animals were in each group, using different doses (10... 2 LD 50 Or 10 3 LD 50 Protective experiments were conducted on patients with tetanus toxin attack; serum neutralizing antibodies in the two immunization groups were determined using a classic in vivo neutralization assay. * p = 0.0108 < 0.05, # p = 0.00001 < 0.001, indicating that the HN group showed a highly statistically significant difference in protection levels compared to other groups.

[0143] Example 4: Dose-dependent immunoprotective effects of recombinant tetanus toxin THc and TL-HN protein antigens

[0144] To further evaluate the protective efficacy of THc and TL-HN at low doses, this invention conducted protective studies after immunizing these two protein antigens once or twice with different doses. The dose-dependent immunization protective regimen of recombinant tetanus toxin protein antigen is as follows: the doses of recombinant TL-HN, THc, and TL+THN combined histone antigens were 4000, 1000, 250, 62.5, 15.6, and 3.9 ng / animal, respectively, with 1 or 2 immunizations, and other procedures were the same as in Example 3. Three weeks after immunization, the animals were challenged with different doses of tetanus toxin, observed for one week, and the survival rate was recorded. The median effective dose (ED) for each group was calculated using probability analysis (SPSS 17.0-Probit). 50 This value is used to quantitatively evaluate the efficacy of a vaccine.

[0145] The results shown in Tables 5 to 7 indicate that, three weeks after a single immunization with TL-HN antigen, the 62.5 ng group produced antibodies against 10... 2 LD 50 Complete protection against tetanus toxin attack was achieved, while the THc and TL+THN groups required immunization with 1 and 4 μg of antigen, respectively, to produce complete protection. (Regarding 1000 LD) 50 Tetanus toxin attack, median effective dose (ED) of TL-HN, THc, and TL+THN groups after a single immunization. 50 The ED values ​​were 42.249 ng, 664.433 ng, and 1116.589 ng, respectively; the median effective dose (ED) of the TL-HN, THc, and TL+THN groups after two immunizations was... 50 The levels were 10.852 ng, 31.210 ng, and 124.858 ng, respectively. These results further demonstrate that L-HN is far superior to Hc as an immunogenic antigen, especially under low-dose, fewer-time immunization conditions, where its effect is more pronounced. Combined with the neutralizing antibody levels in each group after two immunizations, the results of this invention show that TL-HN has the highest protective efficacy, stronger than the THc protein commonly used in previous studies.

[0146] Furthermore, by comparing the immunoprotective effects of the combined TL-HN and TL+THN histone antigens, both the protective efficacy and the level of neutralizing antibodies were significantly lower in the TL+THN group than in the L-HN group. These results indicate that the combined groups did not synergistically enhance immunoprotection, suggesting that the L-HN protein antigen remains the decisive factor, with more correct structures and conformations existing in the L-HN molecule or at the L and HN junction.

[0147] In summary, the results of this invention indicate that among the three functional domain molecules of tetanus toxin, TL, THN, and THc all possess different protective efficacies and exhibit varying degrees of neutralizing antibody epitopes. However, TL-HN and THc are strong neutralizing antibody epitope antigens. More importantly, the TL-HN functional domain molecule is a more dominant protective antigen, far superior to the TL, THN, THc, and TL+THN combination group.

[0148] Given that human clinical trials may require larger doses of antigen and multiple immunizations, and that the resulting immune response is weaker than in animals, TL-HN's characteristic as a more efficient subunit protein immunogen may be more advantageous for its use as a human vaccine, potentially producing a stronger antibody response and protective effect with lower doses and fewer immunizations. Furthermore, its ability to generate higher levels of neutralizing antibodies than THc antigens suggests that it could not only serve as a subunit vaccine antigen but also as an immunogen to replace toxoids in the preparation of novel antitoxins for horses.

[0149] Table 5. Protective efficacy of recombinant TL-HN protein against tetanus toxin after immunization of mice with different doses (1 or 2 times).

[0150]

[0151]

[0152] Note: For each dose immunization group, 10 [units of medication] should be administered three weeks after the first or second immunization. 2 Or 10 3 LD 50 Tetanus toxin was administered, and the patients were observed for one week. The number of survivors was then recorded. Serum neutralizing antibodies in both immunization groups were measured using a classic in vivo neutralization assay.

[0153] Table 6. Protective efficacy against tetanus toxin in mice immunized once or twice with different doses of TL+THN combined with histones.

[0154]

[0155] Note: For each dose immunization group, 10 [units of medication] should be administered three weeks after the first or second immunization. 2 Or 10 3 LD 50 Tetanus toxin was administered, and the patients were observed for one week. The number of survivors was then recorded. Serum neutralizing antibodies in both immunization groups were measured using a classic in vivo neutralization assay.

[0156] Table 7. Protective efficacy of recombinant THc protein against tetanus toxin after immunization of mice with different doses (1 or 2 times).

[0157]

[0158] Note: For each dose immunization group, 10 [units of medication] should be administered three weeks after the first or second immunization. 2 Or 10 3 LD 50 Tetanus toxin was administered, and the patients were observed for one week. The number of survivors was then recorded. Serum neutralizing antibodies in both immunization groups were measured using a classic in vivo neutralization assay.

[0159] Example 5: Evaluation of the immunoprotective efficacy of toxin-like molecular vaccines against tetanus and other biological toxins.

[0160] Given that the TL-HN and THc functional domains of tetanus toxin are both highly effective protective antigens, this invention constructs and biosynthesizes a non-toxic toxoid full-length molecular antigen protein containing these two important protective antigen functional domains (Hc and L-HN) as a highly effective novel vaccine. The goal is to improve the protective efficacy of biotoxin vaccines, enhance their clinical trial potential, reduce the number of immunizations, and improve their effectiveness and safety.

[0161] The immunogenicity and protective efficacy of the recombinant tetanus toxoid (mTeNT, gene sequence as shown in SEQ ID No. 31, amino acid sequence as shown in SEQ ID No. 32, see Tables 2 and 3 for details) vaccine molecule were studied through animal immunoprotection experiments (see above for details). Figure 8 (See Table 8), with formaldehyde-inactivated tetanus toxoid (TeNT Toxoid, TT) as a control. The results showed that mTeNT, like formaldehyde-inactivated tetanus toxoid (TT) and the TL-HN+THc combination group, produced antibody titers against the two important functional domains, TL-HN and THc. The mTeNT toxoid molecular antigen vaccine, together with the TL-HN+THc combination group including all functional domains and the traditional toxoid vaccine TT, exhibited strong immunoprotective effects, superior to THc antigen alone, producing stronger and more effective immune efficacy.

[0162] To further evaluate the protective efficacy of mTeNT at low doses, this invention conducted protective experiments on the mTeNT toxoid molecular antigen vaccine after one or two immunizations at different doses, with TT toxoid vaccine and TL-HN+THc combination group serving as control groups. The experimental results (Tables 9 to 11) show that, against 100 LD... 50 Tetanus toxin attack, the median effective dose (ED) after a single immunization in the combination group of mTeNT, TT toxoid, and TL-HN+THc was... 50 The effective doses were 42.2 ng, 480.1 ng, and 69.8 ng, respectively; the median effective dose (ED) after two immunizations was... 50 The concentrations are 13.3 ng, 221.4 ng, and 54.4 ng respectively; for 1000 LD 50Tetanus toxin attack, the median effective dose (ED) after a single immunization in the combination group of mTeNT, TT toxoid, and TL-HN+THc was... 50 The doses were 54.9 ng, 480.1 ng, and 165.5 ng, respectively; the median effective dose (ED) after two immunizations was 165.5 ng. 50 The doses were 17.1 ng, 284.9 ng, and 71.6 ng, respectively. According to the results, the recombinant tetanus toxoid mTeNT vaccine produced the strongest immune protection, followed by the TL-HN+THc combination group, while the TT toxoid vaccine showed the weakest protective efficacy. These results further demonstrate that the low-dose mTeNT toxoid molecular antigen vaccine produced strong protective efficacy, an effect comparable to or better than the TL-HN+THc combination group, which includes all functional domains, but significantly higher than the effect of the traditional inactivated toxoid vaccine (TT).

[0163] Based on the above experimental results, the mTeNT toxoid molecular antigen vaccine can produce strong and complete protection with low doses and fewer immunizations. These novel recombinant non-toxic biological toxoids, such as tetanus toxoid vaccines, can replace traditional inactivated toxoid vaccines (TT). These vaccine molecules do not require formaldehyde-inactivated biological toxins and can be directly used as recombinant protein antigen vaccines for highly effective immunization to prevent or treat tetanus toxin poisoning.

[0164] In addition, utilizing the aforementioned tetanus toxoid technology platform, this invention designs and biosynthesizes other serum-type botulinum toxoid protein molecules, including mA [gene sequence formed by linking mAL-HN (SEQ ID No. 17) and mAHc (SEQ ID No. 12) via a GS small linker peptide (gene sequence GGATCC), and amino acid sequence formed by linking mAL-HN (SEQ ID No. 28) and mAHc (SEQ ID No. 23) via a GS small linker peptide (amino acid sequence GS), see Tables 2 and 3] and mB [gene sequence formed by linking mBL-HN (SEQ ID No. 18) and mBHc (SEQ ID No. 13) via a GS small linker peptide (gene sequence GGATCC), and amino acid sequence formed by linking mBL-HN (SEQ ID No. 29) and mBHc (SEQ ID No. 24) via a GS linker peptide (amino acid sequence GS), see Tables 2 and 3]. Figure 2 and Figure 4This series of toxoids is also non-toxic and can replace traditional formaldehyde-inactivated botulinum toxoid (BoNT Toxoid, BT) as an antigen vaccine. Its immunoprotective efficacy was evaluated through the same animal studies, with immunization doses of 1 μg or 10 μg protein antigen per mouse, administered once, or twice with a booster dose at 3-week intervals. For example, mA botulinum toxoid molecules, as an antigen vaccine, produced strong protective effects, inducing high levels of neutralizing antibodies after a single immunization, and producing antibodies against the toxin at a concentration of 10... 3 LD 50 The full protective effect of a single dose of BoNT / A was demonstrated; similarly, the mB botulinum toxoid molecular antigen also produced strong protection and can be used as a recombinant full-length toxin molecular vaccine (Table 12). These results indicate that they can all produce highly effective protection against their own toxins, with protective efficacy higher than that of subunit vaccines containing single functional domains (L-HN or Hc).

[0165] In summary, the above results further verify that the non-toxic toxoid molecular antigen vaccine prepared using genetic engineering and biosynthesis technology is a feasible and effective technical solution that can be applied to the research and development of highly effective biological toxin vaccine varieties.

[0166] Table 8. Evaluation Results of Immunoprotective Efficacy of Recombinant Non-toxic Tetanus Toxoid (mTeNT) Related Vaccine Molecules

[0167]

[0168] Note: Protective experiments were conducted 3 weeks after the last immunization, using different doses of tetanus toxin. The survival rate / total number indicates the level of protection, with 10 animals protected per group. Serum neutralizing antibodies were determined using classic in vivo neutralization assays. TT represents formaldehyde-inactivated tetanus toxoid (purchased from the National Institutes for Food and Drug Control). TL-HN+THc represents the combination of TL-HN and THc subunit vaccines. At the level of protection, mTeNT showed no difference compared to the TT and TL-HN+THc combination groups.

[0169] Table 9. Protective efficacy of recombinant nontoxic tetanus toxoid (mTeNT) vaccine molecules against tetanus toxoid after immunization with mice at different doses (1 or 2 times).

[0170]

[0171] Note: For each dose immunization group, 10 [units of medication] should be administered three weeks after the first or second immunization. 2 Or 10 3 LD 50 Tetanus toxin was administered, and the patients were observed for one week. The number of survivors was then recorded. Serum neutralizing antibodies in both immunization groups were measured using a classic in vivo neutralization assay.

[0172] Table 10. Protective efficacy of tetanus toxin against tetanus toxin in mice immunized once or twice with different doses of the TT standard tetanus toxoid vaccine.

[0173]

[0174]

[0175] Note: For each dose immunization group, 10 [units of medication] should be administered three weeks after the first or second immunization. 2 Or 10 3 LD 50 Tetanus toxin was administered, and the patients were observed for one week. The number of survivors was then recorded. Serum neutralizing antibodies in both immunization groups were measured using a classic in vivo neutralization assay.

[0176] Table 11. Protective efficacy against tetanus toxin in mice immunized once or twice with different doses of the combined TL-HN and THc subunit vaccine.

[0177]

[0178] Note: For each dose immunization group, 10 [units of medication] should be administered three weeks after the first or second immunization. 2 Or 10 3 LD 50 Tetanus toxin was administered, and the patients were observed for one week. The number of survivors was then recorded. Serum neutralizing antibodies in both immunization groups were measured using a classic in vivo neutralization assay.

[0179] Table 12. Protective efficacy of different doses of botulinum toxin molecules against biotoxins in mice after a single immunization.

[0180]

[0181] Note: For each dose group, a single immunization was administered three weeks later, followed by 10... 3 LD 50 Tetanus toxin was administered, and the patients were observed for one week. The number of survivors was then tallied. / indicates that the procedure was not implemented or is not applicable.

[0182] Example 6: Evaluation of the immunoprotective efficacy of E / A and A / E type toxoid molecular vaccines

[0183] E / A type toxoid molecular antigens, including mE / mA (gene sequence as shown in SEQ ID No. 33, amino acid sequence as shown in SEQ ID No. 34) and mE / A [gene sequence formed by linking mEL-HN (SEQ ID No. 19) and AHc (SEQ ID No. 11) via GS linker peptide (SEQ ID No. 36), amino acid sequence formed by linking mEL-HN (SEQ ID No. 30) and AHc (SEQ ID No. 22) via GS linker peptide (SEQ ID No. 35, see Tables 2 and 3 for details]; A / E type toxoid molecular antigens, including mA / E [gene sequence formed by linking mAL-HN (SEQ ID No. 17) and EHc (SEQ ID No. 14) via GS linker peptide (SEQ ID No. 36), amino acid sequence formed by linking mAL-HN (SEQ ID No. 28) and EHc (SEQ ID No. 25) via GS linker peptide (SEQ ID No. 36)]. [SEQ ID No. 35] (see Tables 2 and 3 for details) and mA / mE [gene sequence formed by linking mAL-HN (SEQ ID No. 17) and mEHc (SEQ ID No. 15) via GS linker peptide (SEQ ID No. 36), and amino acid sequence formed by linking mAL-HN (SEQ ID No. 28) and mEHc (SEQ ID No. 26) via GS linker peptide (SEQ ID No. 35), see Tables 2 and 3 for details]. These two types of molecular antigens were used as subunit vaccine immunization regimens in Example 3. The results shown in Table 13 indicate that each immunization group was immunized twice with doses of 1 and 10 μg, and each recombinant antigen produced antibody responses specifically targeting itself and its corresponding functional domain. All immunization groups produced strong complete protection against BoNT / A; however, the protective effects of the E / A and A / E toxoid molecular vaccines against BoNT / E differed. The E / A toxoid molecular vaccine produced strong complete protection against BoNT / E, while the A / E toxoid molecular vaccine could not produce strong protection against BoNT / E, with the 10μg dose group showing only 60% protection and low levels of neutralizing antibodies.

[0184] By comparing the AL-HN+EHc combination group, this invention found that in the A / E type toxoid molecular vaccine, the AL-HN antigen functional molecule exerted its immune effect, inducing the body to produce strong protective effects and neutralizing antibodies against BoNT / A. However, the EHc antigen did not exert its immune effect, thus suggesting that it has no vaccine effect in this combination and is an antigen functional molecule that should be avoided in future toxoid vaccine design. Similarly, by comparing the EL-HN+AHc combination group, we found that in the E / A type toxoid molecular vaccine, both EL-HN and AHc antigens exerted their immune effects, and their combination also enhanced the vaccine effect, producing stronger neutralizing antibody levels, making it an effective candidate vaccine.

[0185] Previous studies have shown that EHc is a weaker protective antigen compared to EL-HN, while AL-HN and AHc are both strong protective antigens. When AL-HN and EHc are assembled into a toxoid molecule, the immune effect of AL-HN is exerted, while the immune effect of EHc is weakened, failing to demonstrate its protective effect, particularly with a decrease in both neutralizing antibodies and protective efficacy. When EL-HN and AHc are combined into a toxoid molecule, there is no weakening effect between them; rather, there is a synergistic effect, further enhancing the immune response of the vaccine against EL-HN and AHc antigens, producing stronger neutralizing antibodies and protective efficacy. In particular, the E / A type toxoid molecule vaccine, even with two immunizations at a low dose (1 μg), produced strong antibody levels, significantly higher than the results of combined immunization with the EL-HN+AHc antigen group. Figure 9 This result is consistent with the level of neutralizing antibodies.

[0186] Furthermore, given the strong cross-protective effect between AHc and HHc, this E / A chimeric toxoid molecular vaccine can also protect against 1000 LD. 50 H-type botulinum toxin. Therefore, the non-toxic EL-HN-AHc chimeric molecular antigen vaccine prepared using this technology can produce protective efficacy against three different toxins (A, E, and H) and can serve as a broad-spectrum multivalent vaccine for biological defense against toxins. In summary, this E / A type toxin molecule is a multivalent vaccine candidate.

[0187] Table 13. Evaluation Results of Immunoprotective Efficacy of E / A and A / E Type Toxoid Molecular Vaccines

[0188]

[0189]

[0190] Note: The Hc+L-HN group was immunized with two antigen groups in combination; each immunization group was immunized twice at 3-week intervals. After the final immunization, serum was collected to measure neutralizing antibodies and a protective test was performed. Various types of botulinum toxin were used for challenge, with a toxin dose of 10... 3 LD 50 / animal, statistical protective effect; serum neutralizing antibodies were determined using classic in vivo neutralization assays. Each group consisted of 5 animals. Regarding protective levels, the low-dose groups of mA / E and mA / mE vaccines showed highly statistically significant differences in BoNT / E protection levels compared to the E / A class vaccine and the two combined groups. # p = 0.00001 < 0.001.

[0191] Example 7: Evaluation of the immunoprotective efficacy of T / A, A / T, and E / B type toxoid molecular vaccines.

[0192] Based on the above technical solutions, this invention further verifies the feasibility of biosynthesizing toxoid molecules assembled from functional domains. According to the research results of the preceding embodiments, the selection should be differentiated based on the strength of the protective antigens of different serum toxin types, prioritizing the selection of more potent protective antigens and avoiding significantly weaker protective antigens to prevent affecting their combination and compatibility. For example, in tetanus toxin and botulinum toxin type A, both L-HN and Hc are strong protective antigens. Therefore, mTL-HN / mAHc [mT / mA, the gene sequence is formed by linking mTL-HN (SEQ ID No. 10) and mAHc (SEQ ID No. 12) through a GS linker peptide (SEQ ID No. 36), and the amino acid sequence is formed by linking mTL-HN (SEQ ID No. 21) and mAHc (SEQ ID No. 23) through a GS linker peptide (SEQ ID No. 35), see Tables 2 and 3 for details] or mAL-HN / mTHc (mA / mT, the gene sequence is formed by linking mAL-HN (SEQ ID No. 17) and mTHc (SEQ ID No. 9) through a GS linker peptide (SEQ ID No. 36), and the amino acid sequence is formed by linking mAL-HN (SEQ ID No. 28) and mTHc (SEQ ID No. 20) through a GS linker peptide (SEQ ID No. 35). The assembly of mEL-HN / mBHc [mE / mB] can be performed by linking mEL-HN (SEQ ID No. 19) and mBHc (SEQ ID No. 13) through a GS linker peptide (SEQ ID No. 36), and the assembly of mEL-HN (SEQ ID No. 30) and mBHc (SEQ ID No. 24) through a GS linker peptide (SEQ ID No. 35), as detailed in Tables 2 and 3. Figure 2 and Figure 6 The immunoprotective efficacy of the above-described biosynthesized bivalent vaccines T / A, A / T, and E / B was evaluated through animal experiments similar to those in Example 3. The results showed that they all produced highly effective protection against the two biotoxins.

[0193] As shown in Table 14, in all immunization groups using mT / mA or mA / mT type toxoid molecular antigens as subunit vaccines, two immunizations were administered at doses of 1 and 10 μg. All recombinant antigens produced antibody responses specifically against themselves and their corresponding functional domains. All immunization groups produced antibodies against the toxoid at doses of 10 μg. 3 LD 50The complete protective effect of single doses of BoNT / A and TeNT was comparable to that of the combined groups of two strong protective antigens (TL-HN+AHc or AL-HN+THc), and all combinations thereof were effective; while the mE / mB toxoid molecular antigens, when used as subunit vaccines, also produced toxins of 10 in each immunization group. 3 LD 50 The complete protective effect of single doses of BoNT / E and BoNT / B was comparable to that of the combination of two strong protective antigens (EL-HN and BHc). This result demonstrates the effectiveness of this potent combination, showcasing the immune effects of protective antigens across various functional domains through this toxoid molecular structure. These results further validate that the non-toxic chimeric toxoid molecular antigen vaccine prepared using genetic engineering and biosynthesis techniques is a feasible and effective technical solution that can be applied to the development of highly effective multivalent biological toxin vaccines.

[0194] Table 14. Protective efficacy of chimeric botulinum toxin molecules against biotoxins after a single immunization of mice at different doses.

[0195]

[0196]

[0197] Note: For each dose group, a single immunization was administered three weeks later, followed by 10... 3 LD 50 Animals were attacked with tetanus toxin and observed for one week. The number of survivors was counted. Each group consisted of 5 animals, indicating that the experiment was not conducted or was not applicable.

[0198] In summary, the technical solution of this invention can combine different serotype chimeric biological toxin antigens according to needs, and use them for the assembly and compatibility of various protective antigens of biological toxins to biosynthesize various non-toxic chimeric toxin molecules. This genetically engineered chimeric toxin molecule vaccine can protect against multiple different biological toxin pathogens at the same time, and can provide candidate vaccine varieties that protect against multiple different biological toxins.

[0199] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A non-toxic genetically engineered toxoid molecular antigen vaccine, the active ingredient of which is a fusion protein formed by fusing the mL-HN antigen of botulinum toxin type E and the mHc antigen of botulinum toxin type A in the order from the amino terminus to the carboxyl terminus via a GS linker peptide, the fusion protein being named mE / mA; the amino acid sequence of said mE / mA is shown in SEQ ID No.

34.

2. A method for preparing the non-toxic genetically engineered toxoid molecular antigen vaccine of claim 1, comprising the following steps: introducing a nucleic acid molecule encoding the fusion protein of claim 1 into Escherichia coli recipient cells to obtain recombinant Escherichia coli; culturing the recombinant Escherichia coli to obtain the fusion protein as the active ingredient.

3. The method according to claim 2, characterized in that: The sequence of the nucleic acid molecule encoding the mE / mA is shown in SEQ ID No.

33.

4. A protein, specifically the fusion protein that is the active ingredient as described in claim 1.

5. A nucleic acid molecule, as described in claim 2 or 3.

6. A recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria containing the nucleic acid molecule of claim 5.

7. A medicament for the prevention and / or treatment of symptoms of poisoning caused by botulinum toxin, comprising the protein of claim 4, the nucleic acid molecule of claim 5, or the recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria of claim 6.

8. The use of the protein of claim 4, the nucleic acid molecule of claim 5, or the recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria of claim 6 in the preparation of a medicament for the prevention and / or treatment of botulinum toxin poisoning.

Citation Information

Patent Citations

  • A-type kreotoxin receptor combination region Hc, coding protein and application thereof

    CN101054582A

  • Preparation method and application of recombinant L-HN antigen of type E botulinum toxin

    CN110938150B

  • Tetravalent vaccine for A, B, E and F types of botulinum toxin and preparation method thereof

    CN108619500A

  • Method of preparing A, B, E and F type tetravalent botulinum antitoxins

    CN108822211A