Use of an RNA helicase dhx33 inhibitor in the preparation of a medicament for treating thyroid cancer

By developing an RNA helicase DHX33 inhibitor, and utilizing ferroptosis and IL-24 induction mechanisms, the shortcomings of existing thyroid cancer treatments have been addressed, achieving effective inhibition of thyroid cancer cells and chemosensitization.

CN117599046BActive Publication Date: 2026-07-10SHENZHEN KEYE HEALTH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311522757.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-15
Publication Date
2026-07-10
Estimated Expiration
2043-11-15

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_6
    Figure SMS_6
  • Figure SMS_7
    Figure SMS_7
Patent Text Reader

Abstract

The application belongs to the field of biological medicine, and discloses application of an RNA helicase DHX33 inhibitor in preparation of a drug for treating or adjuvant treating thyroid cancer. The application establishes an important role of DHX33 protein in development of thyroid cancer, and provides an inhibitor having an action of inhibiting DHX33 helicase activity, thereby causing lipid peroxidation mediated by DHX33 deletion, and inducing interleukin 24 (IL-24) expression in thyroid cancer cells. The inhibitor can rapidly induce cancer cell ferroptosis, and significantly inhibit thyroid cancer cell proliferation through up-regulation of IL-24, and therefore has important medical development value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to RNA helicase DHX33 inhibitors and their application in the preparation of drugs for the treatment of thyroid cancer. Background Technology

[0002] Thyroid cancer is a common endocrine system cancer and also the fastest growing cancer in terms of incidence.

[0003] Based on pathological type, thyroid cancer can be classified into papillary thyroid carcinoma (PTC), follicular thyroid carcinoma (FTC), poorly differentiated or undifferentiated thyroid carcinoma, and medullary thyroid carcinoma (MTC), which is related to mutations in different mutually exclusive genes. Different pathological types of thyroid cancer exhibit significant differences in physiological characteristics, treatment methods, and prognosis.

[0004] Papillary thyroid carcinoma (PTC) and follicular thyroid carcinoma (FTC) both belong to differentiated thyroid carcinoma (DTC), exhibiting high expression of vascular endothelial growth factor and its receptor, as well as gene alterations such as BRAFV600E mutation, RET rearrangement, and RAS point mutation. PTC is the most common histological type of differentiated thyroid carcinoma, with low invasiveness, accounting for over 80% of all thyroid cancers. Due to its relatively low specificity in early symptoms, often presenting as a painless mass in the thyroid region, hoarseness, and difficulty swallowing, diagnosis is relatively challenging. However, it grows slowly and has a low metastasis rate. Treatment primarily involves partial thyroidectomy and radioactive iodine therapy, or targeted multi-kinase inhibitors, which can prolong median progression-free survival and shrink tumors in some patients, all with good therapeutic effects.

[0005] Poorly differentiated thyroid carcinoma (PDTC) is a relatively rare type of thyroid cancer, accounting for 2% to 15% of all thyroid cancers. Its clinicopathological features mainly include extrathyroidal dilatation, cervical lymph node metastasis, high mitotic rate, and tumor necrosis. Mutations in key driver genes such as BRAF, RAS, and TERT have been reported to be closely related to the development of PDTC and these mutations change as the tumor progresses. Due to the rarity of the disease and the heterogeneity of inclusion criteria, treatment for PDTC is not yet standardized. Currently, surgery is the preferred treatment for PDTC, and the extent of the surgery can be determined through preoperative evaluation, appropriate imaging examinations, and intraoperative findings.

[0006] Medullary thyroid carcinoma (MTC), like papillary thyroid carcinoma (PTC), grows relatively slowly and rarely grows rapidly; most cases are asymptomatic. The main differences between MTC and PTC are based on the cells of origin and tissue structure, and the survival rate of MTC is shorter than that of PTC; late-stage surgery cannot prolong survival. Treatment generally involves total thyroidectomy and neck lymph node dissection.

[0007] In summary, surgery is the preferred treatment for thyroid cancer with varying pathological features and malignancy levels, supplemented by targeted therapy, chemotherapy, and radiotherapy. The choice of molecularly targeted therapy drugs depends on disease characteristics (gene mutation status), malignancy level, and whether the patient is inoperable or refractory to radioactive iodine. Immunotherapy is currently in the clinical trial stage, while chemotherapy is only suitable for stage IV thyroid cancer patients, but its efficacy is relatively poor. In conclusion, developing safer and more effective drugs is crucial for improving the survival rate and quality of life for thyroid cancer patients. Summary of the Invention

[0008] The purpose of this invention is to provide an RNA helicase DHX33 inhibitor and its use in the preparation of a medicament or pharmaceutical composition for the treatment or adjuvant treatment of thyroid cancer.

[0009] To achieve the objectives of this invention, in a first aspect, the present invention provides an RNA helicase DHX33 inhibitor for the treatment or adjuvant treatment of thyroid cancer. In this invention, the RNA helicase DHX33 inhibitor (i.e., a DHX33 protein inhibitor) is selected from at least one of compound A or a pharmaceutically acceptable salt or prodrug:

[0010]

[0011] This invention discloses for the first time that DHX33 protein can be used as a target for the treatment of thyroid cancer. Therefore, in a second aspect, this invention provides the application of the above-mentioned RNA helicase DHX33 as a novel therapeutic target for thyroid cancer.

[0012] Thirdly, this invention provides the application of RNA helicase DHX33 inhibitors as ferroptosis inducers in thyroid cancer cells regulated by DHX33 (DHX33 gene), meaning that DHX33 inhibitors can rapidly induce ferroptosis in thyroid cancer cells. Ferrroptosis is an iron-dependent cell death process, a novel form of cell death distinct from apoptosis and autophagy. Fatty acid metabolism is closely related to ferroptosis. Fatty acid metabolism mainly includes de novo fatty acid synthesis, fatty acid oxidation, and the desaturation and elongation of fatty acids to generate fatty acids with different degrees of saturation and carbon chain lengths. Among these, fatty acid desaturases mainly include SCD, FADS1, and FADS2, with SCD being the rate-limiting enzyme. Studies have shown that fatty acid metabolism is abnormal in cancer cells, with many cancer cells overexpressing these fatty acid desaturases. Inhibition of SCD can lead to the generation of lipid peroxides in the cell membrane, further inducing ferroptosis. This process is accompanied by the accumulation of iron ions and is iron-induced.

[0013] This invention provides the application of RNA helicase DHX33 inhibitors as inducers of interleukin-24 (IL-24) in thyroid cancer cells regulated by DHX33 (DHX33 gene). Specifically, DHX33 inhibitors can upregulate IL-24 expression in thyroid cancer cells, thereby inducing cell death. IL-24 is a novel tumor suppressor gene that can both inhibit tumor cell growth and angiogenesis and induce apoptosis, while simultaneously inducing immune cells to express cytokines. IL-24 has inhibitory effects on almost all tumor cells, promoting tumor cell apoptosis and inhibiting angiogenesis by regulating endoplasmic reticulum stress and mitochondrial function, thus inhibiting tumor cell growth without harmful effects on normal cells. Furthermore, IL-24 can enhance tumor cell chemosensitivity and synergistically enhance the anti-tumor properties of chemotherapeutic drugs by regulating ABC transporter superfamily resistance-related proteins, interfering with the expression of related signaling pathway proteins to inhibit resistance signals, and regulating tumor cell DNA damage repair.

[0014] The reference sequence number of the DHX33 gene on NCBI is: NM_020162.4.

[0015] Fourthly, the present invention provides a targeted drug for the treatment or adjuvant treatment of thyroid cancer, wherein the target of the drug is RNA helicase DHX33, and the targeted drug can inhibit the activity of DHX33 helicase, thereby affecting the ferroptosis process of cancer cells regulated by DHX33 protein, and the inhibition of cancer cells by IL-24 induced by DHX33 inhibitor. The active ingredient of the targeted drug is compound A or its pharmaceutically acceptable salt or prodrug.

[0016] In an embodiment of the present invention, thyroid cancer is caused by gene mutations, including but not limited to BRAFV600E mutations, RET rearrangements, and RAS mutations.

[0017] In embodiments of the present invention, thyroid cancer includes, but is not limited to, tumors resistant to previous chemotherapy or targeted therapies such as BRAFV600E, RET, BRAF, RAS, and TERT.

[0018] Fifthly, the present invention provides the application of the above-mentioned RNA helicase DHX33 inhibitor in the treatment or adjuvant treatment of thyroid cancer.

[0019] In a sixth aspect, the present invention provides the use of the above-mentioned RNA helicase DHX33 inhibitor in the preparation of a medicament or pharmaceutical composition for the treatment or adjuvant treatment of thyroid cancer.

[0020] In a seventh aspect, the present invention provides the application of the above-mentioned RNA helicase inhibitor in upregulating the expression level of interleukin-24 (IL-24) in thyroid cancer cells.

[0021] In embodiments of the present invention, the frequency or dosage of the RNA helicase DHX33 inhibitor intake can be determined by a physician based on individual physical condition, age, sex, weight, and other factors. In specific embodiments, the intake frequency can range from once to three times per day. In embodiments of the present invention, the intake dose of the RNA helicase DHX33 inhibitor needs to ensure an effective drug exposure of 4000-7500 ng·h / mL per day. In specific embodiments, in mice, the oral dose of the RNA helicase DHX33 inhibitor can be 25 mg-300 mg / kg once, and the intravenous dose can be 2.5 mg-25 mg / kg per injection. In a specific implementation plan, in mice, the oral dose of the RNA helicase DHX33 inhibitor can be, for example, 35 mg-290 mg / kg, 45 mg-280 mg / kg, 55 mg-270 mg / kg, 65 mg-260 mg / kg, 75 mg-250 mg / kg, 85 mg-240 mg / kg, 95 mg-230 mg / kg, 105 mg-220 mg / kg, 115 mg-210 mg / kg, 125 mg-200 mg / kg, 135 mg-190 mg / kg, 145 mg-180 mg / kg, or 155 mg-170 mg / kg per dose. When administered intravenously in mice, the single injection dose of the RNA helicase DHX33 inhibitor can be, for example, 3.0 mg-24.5 mg / kg, 3.5 mg-24 mg / kg, 4.0 mg-23.5 mg / kg, 4.5 mg-23 mg / kg, 5.0 mg-22.5 mg / kg, 5.5 mg-22 mg / kg, 6.0 mg-21.5 mg / kg, 6.5 mg-21 mg / kg, 7.0 mg-20.5 mg / kg, 7.5 mg- 20mg / kg, 8.0mg-19.5mg / kg, 8.5mg-19mg / kg, 9.0mg-18.5mg / kg, 9.5mg-18mg / kg, 10.0mg-17.5mg / kg, 10.5mg- 17.0mg / kg, 11.0mg-16.5mg / kg, 11.5mg-16mg / kg, 12.0mg-15.5mg / kg, 12.5mg-15.0mg / kg or 13.0mg-14.5mg / kg.

[0022] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0023] This invention establishes the crucial role of RNA helicase DHX33 in the development and progression of thyroid cancer. The provided RNA helicase DHX33 inhibitor inhibits DHX33 helicase activity, thereby inducing DHX33-regulated ferroptosis. Simultaneously, this inhibitor can upregulate the expression of interleukin-24 (IL-24), thus preventing the proliferation of thyroid cancer cells. The RNA helicase DHX33 inhibitor of this invention can significantly inhibit the growth of thyroid cancer cells, thereby achieving the goal of treating thyroid cancer and thus possessing significant pharmaceutical development value. Attached Figure Description

[0024] Figure 1 In a preferred embodiment of the present invention, the expression level of DHX33 protein in representative human thyroid cancer tissues was significantly higher than that in normal thyroid tissues.

[0025] Figure 2 In a preferred embodiment of the present invention, the expression level of DHX33 protein in representative human thyroid cancer cells TPC-1 and BCPAP was significantly higher than that in human skin fibroblasts (HSF).

[0026] Figure 3 For the analysis of the half-inhibitory concentration (IC50) of HSF cells treated with DHX33 inhibitor compound A in a preferred embodiment of the present invention, the half-inhibitory concentration (IC50) is... 50 (greater than 10μM)

[0027] Figure 4 For the analysis of the half-inhibitory concentration (IC50) of TPC-1 cells treated with DHX33 inhibitor compound A in a preferred embodiment of the present invention, the half-inhibitory concentration (IC50) is... 50 The value is 0.0456 μM.

[0028] Figure 5 For the preferred embodiment of the present invention, the half-inhibition concentration (IC50) of BCPAP cells treated with DHX33 inhibitor compound A was analyzed, and the IC50 was 0.045 μM.

[0029] Figure 6 In a preferred embodiment of the present invention, the morphological changes of TPC-1 and BCPAP cells treated with DHX33 inhibitor compound A were analyzed.

[0030] Figure 7 The results of the analysis of TPC-1 cell clone growth after treatment with DHX33 inhibitor compound A in a preferred embodiment of the present invention are shown.

[0031] Figure 8The results of the soft agar experiment on TPC-1 cells treated with DHX33 inhibitor compound A in a preferred embodiment of the present invention—independent suspension growth—are analyzed.

[0032] Figure 9 This is an analysis of the clonal growth of BCPAP cells treated with DHX33 inhibitor compound A in a preferred embodiment of the present invention.

[0033] Figure 10 The results of the soft agar experiment on BCPAP cells treated with DHX33 inhibitor compound A in a preferred embodiment of the present invention—independent suspension growth—are analyzed.

[0034] Figure 11 This invention relates to a preferred embodiment of the present invention, which analyzes the changes in the transcriptional level of lipid metabolism desaturase genes after treating thyroid cancer cells TPC-1 with different doses of DHX33 inhibitor compound A.

[0035] Figure 12 This invention relates to a preferred embodiment of the present invention, which analyzes the changes in the transcriptional level of the interleukin-24 (IL-24) gene after treating thyroid cancer cells TPC-1 with different doses of the DHX33 inhibitor compound A.

[0036] Figure 13 In a preferred embodiment of the present invention, the changes in the transcriptional level of the interleukin-24 (IL-24) gene in TPC-1 thyroid cancer cells after DHX33 knockout (shDHX33) were analyzed.

[0037] Figure 14 In a preferred embodiment of the present invention, the content of IL-24 in the cell supernatant of TPC-1 cells after treatment with DHX33 inhibitor compound A for 24 hours was analyzed.

[0038] Figure 15 This is a quantitative analysis diagram of reactive oxygen species (ROS) in TPC-1 cells after treatment with DHX33 inhibitor compound A for 16 hours or after DHX33 knockout (shDHX33) in a preferred embodiment of the present invention.

[0039] Figure 16 This is a quantitative analysis diagram of reactive oxygen species (ROS) in BCPAP cells after treatment with DHX33 inhibitor compound A for 16 hours or after DHX33 knockout (shDHX33) in a preferred embodiment of the present invention.

[0040] Figure 17 This is a quantitative analysis diagram of lipid peroxides (LPO) in TPC-1 cells after treatment with DHX33 inhibitor compound A for 16 hours or after DHX33 knockout (shDHX33) in a preferred embodiment of the present invention.

[0041] Figure 18 This is a quantitative analysis diagram of lipid peroxides (LPO) in BCPAP cells after treatment with DHX33 inhibitor compound A for 16 hours in a preferred embodiment of the present invention.

[0042] Figure 19 This is a quantitative analysis diagram of ferrous ions in TPC-1 cells after treatment with DHX33 inhibitor compound A for 16 hours or after DHX33 knockout (shDHX33) in a preferred embodiment of the present invention.

[0043] Figure 20 This is a quantitative analysis diagram of ferrous ions in BCPAP cells after treatment with DHX33 inhibitor compound A for 16 hours in a preferred embodiment of the present invention.

[0044] Figure 21 This is a quantitative analysis diagram of glutathione (GSH) in TPC-1 cells after treatment with DHX33 inhibitor compound A for 16 hours in a preferred embodiment of the present invention.

[0045] Figure 22 In a preferred embodiment of the present invention, the expression levels of genes involved in lipid metabolism in TPC-1 and BCPAP cells were analyzed after 24 hours of treatment with DHX33 inhibitor compound A.

[0046] Figure 23 In a preferred embodiment of the present invention, the expression levels of lipid metabolism genes in thyroid cancer cells TPC-1 and BCPAP after DHX33 knockout (shDHX33) were analyzed. Detailed Implementation

[0047] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0048] 1. Cell Culture

[0049] Human thyroid cancer cell lines TPC-1 and BCPAP were purchased from Pronosei Biotechnology Co., Ltd. (Wuhan). TPC-1 and BCPAP cells were cultured in RPMI-1640 medium, a complete medium containing 10% fetal bovine serum (FBS), 2 mM L-glutamine, and supplemented with non-essential amino acids, streptomycin, and penicillin. Culture conditions were a 37°C CO2 incubator with 60-70% humidity. Human skin fibroblast HSF was purchased from Shanghai Bosen Biotechnology Co., Ltd., cultured in Dulbecco's Modified Eagle Medium (high glucose) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, non-essential amino acids, streptomycin, and penicillin.

[0050] 2. Real-time quantitative PCR

[0051] To analyze the molecular mechanism by which DHX33 protein promotes the growth of thyroid cancer cells, quantitative PCR (SYBR Green Supermix (Bio-Rad)) was used to analyze the expression changes of important genes in thyroid cancer cells. Transcriptional content was calculated using Ct values ​​after normalization with H3.3 values. Cells were seeded at appropriate densities in 6-well plates. The next day, appropriate concentrations of DHX33 inhibitor were added to RPMI-1640 medium. Cells were treated with the inhibitor for 0 hours, 4 hours, or 6 hours, and then RNA was extracted from the cells. Quantitative PCR analysis was then performed on the RNA samples. The target genes analyzed were: FADS1, FADS2, SCD, SLC3A2, SLC7A11, GPX4, IL-24, and IL-7.

[0052] Primers were designed online using the "realtime PCR tool" at IDT (http: / / sg.idtdna.com / site) and purchased from BGI (Shenzhen) Co., Ltd.

[0053] The primer sequences targeting genes involved in ferroptosis in human cells are as follows (all primers are from 5′ to 3′):

[0054] Primer name sequence H3.3-Forward TGTGGCGCTCCGTGAAATTAG H3.3-Reverse CTGCAAAGCACCGATAGCTG SCD-Forward CCTGGTTTCACTTGGAGCTGTG SCD-Reverse TGTGGTGAAGTTGATGTGCCAGC FADS1-Forward CTGTCGGTCTTCAGCACCTCAA FADS1-Reverse CTGGGTCTTTGCGGAAGCAGTT FADS2-Forward TGCAACGTGGAGCAGTCCTTCT FADS2-Reverse GGCACATAGAGACTTCACCAGC GPX4-Forward AGAGATCAAAGAGTTCGCCGC GPX4-Reverse TCTTCATCCACTTCCACAGCG SLC3A2-Forward CAACTACCGGGGTGAGAACT SLC3A2--Reverse TATGTCCCGAACCTGGAACC SLC7A11-Forward GCTGTGATATCCCTGGCATT SLC7A11--Reverse GGCGTCTTTAAAGTTCTGCG

[0055] The primer sequences targeting the interleukin gene in human cells are as follows (all primers are from 5′ to 3′):

[0056] IL-24-Forward AGCCTGTGGACTTTAGCCAG IL-24-Reverse GGTAAAACCCAGGCAAGGGA IL-7-Forward TTGCCAAGGCGTTGAGAGAT IL-7-Reverse CCTGGATGAGGACCAGAGGA

[0057] 3. Half-inhibitory concentration (IC50) 50 ) Measurement

[0058] Thyroid cancer cell lines TPC-1 and BCPAP cells were used at a rate of 1 x 10⁻⁶. 4 100 μL / well of cells were seeded onto 96-well plates and allowed to adhere completely. DHX33 inhibitor was then added to the RPMI-1640 medium at concentrations of 19 nM, 39 nM, 78 nM, 156 nM, 312 nM, 625 nM, 1.25 μM, 2.5 μM, 5 μM, and 10 μM, and mixed thoroughly using a multichannel pipette. After 72 hours of incubation with the DHX33 inhibitor and cells, CCK-8 reagent (Shanghai Yisheng Biotechnology Co., Ltd.) was added to the RPMI-1640 medium in the 96-well plates according to standard procedures. After 1 hour of incubation, the plates were read using an ELISA reader (OD). 450nm The experiment was repeated three times, and inhibition curves of the DHX33 inhibitor at different concentrations were plotted (e.g., Figure 3-5 As shown), the half-inhibitory concentration (IC50) of the DHX33 inhibitor was calculated. 50 ).

[0059] 4. Cell morphology observation

[0060] Thyroid cancer cell lines TPC-1 and BCPAP cells were used at a rate of 1 x 10⁻⁶. 5 Seed 2 mL of cells per well in a 6-well plate and allow the cells to adhere completely. Add 40 nM of DHX33 inhibitor to the RPMI-1640 medium and gently shake to mix. Observe the cell morphology changes using a fluorescence microscope after incubation with DHX33 inhibitor for 0, 4, 6, 8, and 24 hours, respectively.

[0061] 5. Immunohistochemical analysis

[0062] Thyroid cancer tissue microarrays were purchased from Wuhan Tiande Biotechnology Co., Ltd. The microarray contained 102 samples, including 97 cancer tissue samples and 5 normal tissue samples as controls. Immunohistochemical (IHC) staining was performed according to the instructions for the thyroid cancer tissue microarray. The slides were baked at 60°C for half an hour before use. The tissues were dewaxed in dewaxing solution and rehydrated in a series of solutions with gradually decreasing ethanol concentrations. Antigens were presented in Tris buffer (pH 9.0) in an autoclave. The tissues were then incubated in an aqueous alcohol solution containing 1% H2O2 to inactivate endogenous peroxidase. After blocking with 5% FBS-PBS for 30 min at room temperature, the tissues were incubated with primary antibody overnight at 4°C. Analysis was then performed according to the manufacturer's recommendations using the DAKO kit (DAKO Biotechnology, Denmark). The primary antibody used was anti-DHX33 (purchased from Santa Cruz Biotechnology). Experimental results ( Figure 1 The dark areas stained in the middle show that DHX33 protein is highly expressed in various human thyroid cancer tissues (especially the cell nucleus).

[0063] 6. Detection of Reactive Oxygen Species (ROS)

[0064] Human thyroid cancer cell lines TPC-1 and BCPAP cells were used at a rate of 1×10⁻⁶. 5 1 cell / 2ml / well was seeded into a 6-well plate, and after the cells had fully adhered, the DHX33 inhibitor was added as a positive control. The ferroptosis inducer, negative, 40 nM, and 80 nM concentrations from the reactive oxygen species fluorescence assay kit (Elabscience) were added to the culture medium and shaken for 1 min to mix. After 16 h of incubation with the DHX33 inhibitor and cells, the mixture was... Reactive oxygen species (ROS) fluorescence detection kit (Elabscience) was used for ROS detection. Three replicates were used. The reagent DCFH-DA underwent a series of chemical reactions to become the cell membrane-insoluble fluorescent substance DCF. A bar graph of ROS levels at different concentrations of DHX33 inhibitor was plotted using a multi-mode microplate reader (PerkinElmer). The ROS levels were then analyzed by OD... 590nm Value analysis was performed on the reactive oxygen species (ROS) status of human thyroid cancer cells. For example... Figure 4 As shown, DHX33 inhibitors can increase ROS levels, thereby damaging human thyroid cancer cells and even inducing their death.

[0065] 7. Detection of ferrous ions in cells

[0066] Human thyroid cancer cells TPC-1 and BCPAP were digested with trypsin to prepare a cell suspension, and cell counting was performed. The procedure for detecting ferrous ions using the ferrous ion colorimetric assay kit (Elabscience) was followed by reading the plate using an ELISA reader (OD). 590nm ), calculate the ferrous ion content of the cell sample.

[0067] 8. Lipid peroxides (LPO)

[0068] The lipid peroxide content was detected according to the instructions of the lipid peroxide colorimetric assay kit (Elabscience). The plate was read using an ELISA reader (OD). 590nm LPO content was calculated based on protein concentration. Cells were collected by low-speed centrifugation (4℃, 1000 rpm) for 10 min, and 300-500 μL of PBS (0.01 M, pH 7.4) was added. Cells were then sonicated and centrifuged at 1500 × g for 10 min at 4℃. The supernatant was collected and placed on ice for testing, with a portion reserved for protein concentration determination. Reagents were added according to the assay kit instructions, and the plate was read using an ELISA reader (OD). 590nm The LPO content in cells was analyzed based on protein concentration.

[0069] 9. Reduced glutathione (GSH)

[0070] Before preparing the sample for testing, a portion of the sample needs to be reserved for protein concentration determination. The procedure for using the Reduced Glutathione Colorimetric Assay Kit (Elabscience) is as follows: Reduced glutathione content is detected using a microplate reader (OD). 405nm) The GSH content is calculated based on protein concentration.

[0071] 10. Clonal growth of cells (Foci)

[0072] 2.0×103 Each cell was cultured in 10.0 mL of RPMI-1640 medium (100 mm cell culture dish) with or without DHX33 inhibitor, and incubated in a 37°C CO2 incubator, with the medium being changed weekly. Cell clone growth was observed; after 2-3 weeks, when the cell clones reached a sufficient size, Geimsa staining was performed, and photographs were taken for statistical analysis.

[0073] 11. Soft agar test

[0074] 1.0×10 4 Mix each cell with 4.0 mL of RPMI 1640 medium containing 0.3% agar and 10% FBS, and add the mixture to a basal agar plate (4.0 mL of solidified RPMI 1640 medium containing 0.6% agar and 10% FBS). Incubate the plates at 37°C, checking every 3 days, and adding 2.0 mL of RPMI 1640 medium containing 0.3% agar and 10% FBS weekly. Observe colony growth and count the cells after 2-3 weeks.

[0075] 12. Western blot analysis

[0076] Cells were lysed using RIPA buffer supplemented with protease and phosphatase inhibitors (Thermo Fisher). After incubation on ice for 5 min, cell lysates were further disrupted by sonication. Whole-cell extracts were then subjected to SDS-PAGE gelation with a protein loading of 40 μg per sample. The protein was then transferred onto a polyvinylidene fluoride (PVDF) membrane. The membrane was blocked in 5% skim milk and incubated in 1×TBST buffer at room temperature for 1 h. The primary antibody was diluted in 5% FBS (with 1×TBST) and incubated with the membrane overnight at 4°C. The membrane was then washed several times with 1×TBST buffer and incubated at room temperature with HRP (horseradish peroxidase)-labeled secondary antibody in 5% FBS (with 1×TBST) for 1 h. The blot was visualized using an ECL kit (Thermo Fisher). The primary antibodies are as follows: anti-GAPDH, Absin (abs830030); anti-FADS1, ABclonal (A0178); anti-FADS2, ABclonal (A10270); anti-SCD, ABclonal (A16429); anti-DHX33, Bethy1 (A300-800A).

[0077] 13. IL 24-ELISA detection

[0078] Human thyroid cancer cell line TPC-1 cells were seeded into 6-well plates and allowed to adhere completely. DHX33 inhibitor compound A was added to RPMI 1640 medium at concentrations of 0 nM, 40 nM, and 80 nM and mixed thoroughly. After incubation of compound A and cells for 16 hours, the cell supernatant was collected. IL-24 levels were detected using the Human IL-24 ELISAKIT kit (Shanghai Jianglai Biotechnology Co., Ltd.), with two replicates. Following a series of chemical reactions involving biotinylate antibody and enzymes, IL-24 levels in cancer cells were analyzed using OD (450 nm), and bar graphs of IL-24 levels at different compound A concentrations were plotted.

[0079] 14. Data Statistical Analysis

[0080] Data are expressed as mean + SD. Statistical significance was determined using the Student's t-test. A p-value < 0.05 was indicated by *; a p-value < 0.01 was indicated by **; and a p-value < 0.001 was indicated by ***.

[0081] Example 1. High expression of DHX33 protein in various thyroid cancer tissues

[0082] This embodiment utilizes immunohistochemistry to analyze the expression of DHX33 protein in human thyroid cancer tissue.

[0083] Paraffin-embedded tissue microarrays of human thyroid cancer tissue were purchased from Wuhan Tiande Biotechnology Co., Ltd., comprising 97 cancer tissue samples and five normal tissue samples as controls. The paraffin-embedded tissue microarrays were first incubated in a 60°C oven for 30 min, then rapidly deparaffinized in xylene, and gradually hydrated in a series of ethanol solutions with progressively decreasing concentrations (100%, 95%, 70%, 50%, and 25%) (gently shaking for 5 min each time, repeating the treatment once for each ethanol concentration), and finally hydrated in distilled water for 10 min. Antigens were then presented in a steam oven with 50 mM Tris hydrochloride buffer (pH 9.0) for 40 min, followed by cooling to room temperature. The tissues were then incubated in a methanol solution containing 1% H2O2 to inactivate endogenous peroxidase. After blocking with 10% FBS for 1 h at room temperature, the tissues were incubated with primary antibody overnight at 4°C. The standard protocol was then followed according to the manufacturer's recommendations using the DAKO kit (DAKO GmbH, Denmark). The antibodies used were sourced from the following sources: anti-DHX33, Santa Cruz (purchased from Santa Cruz Biotechnology). Experimental results ( Figure 1The dark, circular areas shown in the image indicate that DHX33 protein is highly expressed in various human thyroid cancer tissues (especially the cell nucleus). Table 1 below provides data for 97 cancer tissues and 5 normal tissues. This data shows that 81 pathological tissues, approximately 79% of the total pathological samples, highly expressed DHX33 protein. Analysis of the pathological sections revealed lower DHX33 expression in non-tumor areas and surrounding non-proliferative normal tissues.

[0084] Table 1. DHX33 protein expression analysis in 97 types of thyroid cancer tissues and 5 types of normal tissues

[0085]

[0086]

[0087]

[0088]

[0089] Note: In the table, "-" indicates negative DHX33 expression; "+" indicates weak positive DHX33 expression; "++" indicates moderate positive DHX33 expression; and "+++" indicates strong positive DHX33 expression.

[0090] Example 2. High expression of DHX33 protein in thyroid cancer cells

[0091] This embodiment uses Western blotting to analyze the expression of DHX33 protein in human thyroid cancer cells.

[0092] To analyze the expression of DHX33 protein in human thyroid cancer cells, we selected two different representative thyroid cancer cell lines, TPC-1 and BCPAP, and normal human skin fibroblasts (HSF), for comparison, using the methods described above. Figure 2 As shown, using human skin fibroblasts (HSF) as a control, the expression level of DHX33 protein was significantly higher in human thyroid cancer cells TPC-1 and BCPAP, and significantly lower in normal cells. This result confirms... Figure 1 The results of DHX33 protein expression analysis in the analyzed tissues demonstrate that DHX33 is specifically expressed in cancer tissues.

[0093] Example 3. DHX33 inhibitors have specific killing effects on thyroid cancer cells, while normal cells are insensitive to these inhibitors.

[0094] To analyze the inhibitory effect of DHX33 inhibitors on thyroid cancer cells, we used DHX33 inhibitor compound A to determine its half-maximal inhibitory concentration (WMC). Two different representative thyroid cancer cell lines, TPC-1 and BCPAP, were selected to conduct cell inhibition assays using compound A, with HSF cells (normal cells with low DHX33 protein expression) used as a control. Figure 3 , 4 As shown in Figure 5, the DHX33 inhibitor exhibited nanomolar-level cytotoxicity against both types of thyroid cancer cells, with inhibition curves showing a decrease exceeding 50%. However, in normal HSF cells, compound A showed little to no significant inhibition at a half-maximal concentration (WMC) above 10 μM. This indicates that the DHX33 inhibitor has specific killing activity against cancer cells, but no significant inhibitory effect on normal cells with low DHX33 content.

[0095] Example 4. DHX33 inhibitors effectively inhibited the clonal growth and suspension-independent proliferation of thyroid cancer cells.

[0096] In addition to the half-maximal inhibitory concentration (WMC) of cells, we also analyzed the changes in cell morphology after treatment with DHX33 inhibitor compound A for different time periods of 0, 4, 6, 8, and 24 hours. For example... Figure 6 As shown, at a concentration of 40 nM, we found that the morphology of TPC-1 cells changed after treatment with the DHX33 inhibitor compound A for 4 h. Another cell line, BCPAP, also showed morphological changes after treatment with compound A for 6 h. Figure 6 We also conducted clonal growth assays, using the methods described above. We selected two thyroid cancer cell lines, TPC-1 and BCPAP, for our experiments. At a concentration of 40 nM, we found that the DHX33 inhibitor compound A significantly inhibited the growth of both thyroid cancer cell lines. Figure 7 and 9 In addition to the analysis of these two-dimensional cell culture systems, we also analyzed the inhibitory effect of DHX33 inhibitor compound A on thyroid cancer cells in a three-dimensional cell culture system. This experiment was conducted in a soft agar system, as previously described. Suspension-independent growth is a key characteristic of cancer cells. Under treatment with DHX33 inhibitor compound A (40 nM), we found that thyroid cancer cells almost completely lost their ability to grow independently in suspension on soft agar, and could not form aggregates or clones. Figure 8 and 10 The results of the above experiments indicate that DHX33 inhibitor compound A has a significant inhibitory effect on thyroid cancer cells.

[0097] Example 5. DHX33 inhibitors can regulate the expression of fatty acid desaturase, a fatty acid metabolism enzyme, in thyroid cancer cells.

[0098] Cell growth is inseparable from cell membrane synthesis, especially in cancer cells where membrane formation efficiency is significantly enhanced. Studies have shown that fatty acid metabolism is crucial for cancer cell proliferation. In various cancer cells, fatty acid synthesis is abnormally active, particularly the high expression of important fatty acid regulatory enzymes such as fatty acid desaturases, including SCD1, FADS1, and FADS2. To analyze whether DHX33 inhibitors can regulate the expression of these important genes, we performed real-time quantitative PCR analysis on cells treated with DHX33 inhibitors. TPC-1 cells were treated with different doses of DHX33 inhibitor (compound A) for 4 hours. Total RNA was extracted from the cells and converted into complementary DNA molecules using reverse transcriptase. We used real-time quantitative PCR technology, employing these DNA molecules as templates, to analyze the transcriptomic levels of the aforementioned fatty acid desaturase genes. The primer sequences are as described above. Figure 11 As shown, in TPC-1 cells where DHX33 was inhibited, the gene expression of several enzymes involved in fatty acid metabolism, particularly the rate-limiting enzymes SCD, FADS1, and FADS2 in fatty acid synthesis, was downregulated. With increasing compound A dosage, the transcription of fatty acid desaturases was significantly downregulated. This signaling pathway has not been reported in current technology. To confirm that the DHX33 inhibitor compound A can indeed inhibit the protein expression of fatty acid desaturases, we selected three representative proteins, FADS1, FADS2, and SCD, for analysis. Western blotting was used to analyze the changes in FADS1, FADS2, and SCD1 protein levels after 24 hours of treatment with different doses of compound A and after knocking out intracellular DHX33 (shDHX33). We found that all three proteins showed a dose-dependent downregulation with increasing compound A dosage, especially FADS2 and SCD1, which showed the most significant changes, with significant downregulation observed even at lower compound A treatment levels. Figure 22 , 23 ).

[0099] Example 5. DHX33 inhibitors can induce ferroptosis in thyroid cancer cells.

[0100] Ferroprelation, first proposed by Scott JDixon in 2012, is a novel iron-dependent programmed cell death pattern distinct from apoptosis, necrosis, and autophagy. Reports of cell death characterized by ferroptosis date back to the 1950s. Sensitivity to ferroptosis is closely related to many biological processes, such as polyunsaturated fatty acid metabolism. Recent data indicate that phospholipid / lipid peroxidation is a major contributing factor to ferroptosis. Therefore, polyunsaturated fatty acid metabolism is closely related to the specific ferroptosis sensitivity of cancer cells. Previous studies have also found that the expression of genes such as SCD1 and FADS can protect cancer cells from ferroptosis. We have found that DHX33 promotes the high expression of several important fatty acid desaturases in thyroid cancer cells. Treatment with DHX33 inhibitors reduced the expression of SCD1, FADS1, and FADS2 in cancer cells, suggesting that downregulation of these genes may induce ferroptosis in cancer cells. To analyze whether DHX33 inhibitors induce ferroptosis-related pathways in thyroid cancer cells, we conducted several representative analytical tests. First, in the ferroptosis pathway, a significant increase in reactive oxygen species (ROS) was observed. We treated TPC-1 cells with different doses of the DHX33 inhibitor compound A for 16 hours or knocked out intracellular DHX33, comparing with positive or SCR controls. We found that, calculated for an equivalent number of cancer cells, DHX33 inhibition significantly induced ROS generation. Figure 15 We also treated another thyroid cancer cell line, BCPAP (or knocked out intracellular DHX33), with compound A and analyzed its reactive oxygen species (ROS) content. The results showed that treatment with compound A for only 16 hours or knocking out intracellular DHX33 significantly induced ROS generation compared to positive or SCR controls, based on an equivalent number of cancer cells. Figure 16 The main factor in ferroptosis is the generation and accumulation of lipid peroxides (LPOs). Therefore, we further analyzed the LPO levels in the cell membrane after 16 hours of DHX33 inhibitor treatment and after DHX33 knockout. In this experiment, we used an LPO detection kit (Elabscience), such as... Figure 17 As shown, treatment of TPC-1 cells with compound A for 16 h or knockout of intracellular DHX33 significantly increased LPO levels compared to the control group (SCR). This analysis was performed at the level of equivalent total cellular protein. We further analyzed the content of lipid peroxides (LPO) in the plasma membrane of BCPAP cells after 16 h of compound A treatment, and the results are as follows. Figure 18 As shown, LPO levels were significantly increased. We further analyzed ferrous ion content in TPC-1 and BCPAP cells treated with compound A for 16 h, and the results are as follows... Figure 19 , 20 As shown, after 16 h of treatment with compound A, an increase in the accumulation and concentration of iron ions was observed in both cell types. Furthermore, after DHX33 knockout, iron accumulation was also observed in TPC-1 cells compared to the control group (SCR). Glutathione peroxidase 4 (GPX4) can utilize glutathione (GSH) to reduce peroxidized lipids to non-toxic lipid alcohols, thereby protecting cells from ferroptosis. Finally, we analyzed the glutathione content in TPC-1 cells after 16 h of compound A treatment and found that the GSH content in TPC-1 cells gradually decreased with increasing compound A concentration (e.g., ...). Figure 21 Therefore, we conclude that DHX33 inhibitor compound A can induce the production of lipid peroxides in thyroid cancer cells, leading to ferroptosis, a process involving the accumulation and dependence of iron ions.

[0101] Example 6. DHX33 inhibitors can regulate the level of interleukin-24 (IL-24) in thyroid cancer cells.

[0102] Reports indicate that interleukin-24 (IL-24) protein attacks various cancers, such as liver cancer, lung cancer, and stomach cancer, in multiple ways. A new study found that delivering the IL-24-encoding gene to solid tumors using T cells can inhibit tumor growth in various cancers and suppress cancer spread to other tissues. To analyze whether DHX33 inhibitors can regulate the expression of the interleukin-24 (IL-24) gene, we performed real-time quantitative PCR analysis on cells treated with DHX33 inhibitors. TPC-1 cells were treated with different doses of DHX33 inhibitor compound A for 4 hours. Total RNA was extracted from the cells and converted into complementary DNA molecules using reverse transcriptase. We used real-time quantitative PCR to analyze the transcript levels of the aforementioned interleukin genes (IL-24 and IL-7) using these DNA molecules as templates. The primer sequences are as described above. Figure 12 As shown, in TPC-1 cells where DHX33 was suppressed, we found that the expression of the interleukin-24 (IL-24) gene was upregulated. With increasing dosage of compound A, the transcription of interleukin-24 (IL-24) was significantly upregulated. Furthermore, after DHX33 knockout, the level of IL-24 in TPC-1 cells was also upregulated compared to the control group (SCR). Figure 13 In addition, we analyzed the IL-24 content using the Human IL-24 ELISAKIT (Shanghai Jianglai Biotechnology Co., Ltd.) detection kit. The results are as follows... Figure 14As shown, after treating TPC-1 cells with compound A for 24 h, the IL-24 content in the TPC-1 cell supernatant was significantly upregulated with increasing drug concentration. The results of this example indicate that the DHX33 inhibitor compound A can upregulate the level of interleukin 24 (IL-24) in thyroid cancer cells, thereby inhibiting thyroid cell growth and angiogenesis and inducing apoptosis.

Claims

1. The use of an RNA helicase DHX33 inhibitor in the preparation of a medicament or pharmaceutical composition for the treatment or adjuvant treatment of papillary thyroid carcinoma, characterized in that, The papillary thyroid carcinoma is positive for DHX33 protein expression, and the inhibitor is selected from compound A or a pharmaceutically acceptable salt: Compound A.

Citation Information

Patent Citations

  • Application of RNA helicase DHX33 inhibitor in preparation of medicine for treating gastric cancer

    CN115969980A

  • Hydrochloride crystal form of amide compound, pharmaceutical composition and application

    CN116003394A