A molecular marker for detecting zinc content, iron content and thousand-grain weight of wheat grains and application thereof

By using the genotyping method at the AX-109500250 locus, and employing PCR primer combinations and KASP technology, the problem of simultaneously improving the zinc and iron content and thousand-grain weight traits of wheat grains was solved, achieving efficient breeding and improving wheat grain quality.

CN117660676BActive Publication Date: 2026-05-05INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211098786.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-07
Publication Date
2026-05-05
Estimated Expiration
2042-09-07

AI Technical Summary

Technical Problem

In current wheat breeding practices, it is difficult to simultaneously improve the zinc and iron content of grains and the thousand-grain weight, resulting in the inability to effectively solve the problem of micronutrient deficiency, and the breeding process is complex.

Method used

A genotyping method for the AX-109500250 locus was developed. The thousand-grain weight, zinc content, and iron content of wheat grains were identified using PCR primer combinations and KASP technology. Specific fluorescent tag sequences were used to distinguish genotypes, providing a molecular marker-assisted selection breeding method.

Benefits of technology

This method simultaneously increases the zinc and iron content and thousand-grain weight of wheat grains, simplifying the breeding process and improving breeding efficiency and effectiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003835831260000101
    Figure BDA0003835831260000101
  • Figure BDA0003835831260000111
    Figure BDA0003835831260000111
  • Figure BDA0003835831260000121
    Figure BDA0003835831260000121
Patent Text Reader

Abstract

This invention discloses a molecular marker for detecting pleiotropic loci of zinc, iron, and thousand-grain weight in wheat grains and its application, belonging to the field of biotechnology. The technical problem this invention aims to solve is: how to identify or assist in the identification of thousand-grain weight / zinc / iron content traits in wheat grains. To solve this problem, this invention provides the AX-109500250 locus and a substance for detecting the genotype of the AX-109500250 locus in the identification or assistance in the identification of thousand-grain weight / zinc / iron content traits in wheat grains. The AX-109500250 locus is a SNP site in the wheat genome, such as nucleotide 48 of SEQ ID No. 1, and its nucleotide type is C or T. The molecular marker provided by this invention has important application value for molecular breeding of high-zinc / high-iron / high-grain-weight wheat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a molecular marker for detecting zinc content, iron content, and thousand-grain weight of wheat grains, and its application. Background Technology

[0002] Micronutrient deficiency, also known as "hidden hunger," has become one of the most prevalent public health problems globally. Wheat, as one of the world's most widely cultivated crops, provides humans with approximately 20% of their calories and protein. For impoverished regions where grains are the staple food, wheat is a major source of daily zinc and iron intake. However, the vast majority of commercially available wheat varieties worldwide fail to meet target zinc and iron content requirements. This may be due to past breeding practices prioritizing yield over nutritional quality, resulting in the loss of numerous superior genes during the breeding process. Therefore, identifying zinc and iron genetic loci and key genes and introducing them into modern wheat varieties is crucial for improving wheat grain zinc and iron content and thus alleviating micronutrient deficiency. Some studies have shown a "dilution effect" between grain zinc and iron concentration and grain yield. While developing micronutrient-rich varieties is an important goal of wheat breeding programs, micronutrient concentration should not be achieved at the expense of grain yield. Therefore, considering both yield and micronutrients simultaneously in breeding is essential. Molecular marker-assisted selection (MART) can pyramidalize multiple favorable alleles to simultaneously improve multiple traits, but the process is complex. Conversely, selecting pleiotropic loci to simultaneously improve multiple traits may be easier. Therefore, developing molecular markers for pleiotropic loci of grain zinc content, iron content, and thousand-grain weight has significant application value for simultaneously improving grain zinc and iron content and grain weight. Summary of the Invention

[0003] The technical problem to be solved by this invention is: how to identify or assist in the identification of the thousand-grain weight / zinc content / iron content of wheat grains.

[0004] To solve the above-mentioned technical problems, in a first aspect, the present invention provides the use of a substance for detecting the genotype of the AX-109500250 locus in any of the following:

[0005] A1) Identification or auxiliary identification of wheat grain thousand-grain weight, zinc content and / or iron content;

[0006] A2) Screening or assisted screening of wheat plants, strains, varieties or lines with high thousand-grain weight, zinc content and / or iron content;

[0007] A3) Wheat-assisted breeding;

[0008] The AX-109500250 site is a SNP site in the wheat genome, such as the 48th nucleotide of SEQ ID No.1, and its nucleotide type is C or T.

[0009] In the above applications, the thousand-grain weight, zinc content, and / or iron content of the wheat sample at the AX-109500250 locus with the genotype TT are higher than or candidate higher than those of the wheat sample at the AX-109500250 locus with the genotype CC. The genotype TT indicates a homozygous wheat genome with nucleotide type T at the AX-109500250 locus. The genotype CC indicates a homozygous wheat genome with nucleotide type C at the AX-109500250 locus.

[0010] Furthermore, in the above applications, the substance used to detect the polymorphism or genotype of the AX-109500250 locus is any one of the following:

[0011] B1) The substance for detecting the genotype of the AX-109500250 locus contains a PCR primer composition for amplifying wheat genomic DNA fragments including the AX-109500250 locus.

[0012] B2) The substance used to detect the genotype at the AX-109500250 locus is a PCR reagent containing the PCR primer composition described above;

[0013] B3) A kit containing the PCR primer composition described in B1) or the PCR reagent described in B2).

[0014] Furthermore, in the above applications, the PCR primer composition comprises: single-stranded DNA with nucleotide sequence of positions 22-41 of SEQ ID No. 2, single-stranded DNA with nucleotide sequence of positions 22-41 of SEQ ID No. 3, and single-stranded DNA with nucleotide sequence of SEQ ID No. 4.

[0015] Furthermore, in the above-described application, the PCR primer composition comprises primer L1 with the nucleotide sequence shown in SEQ ID No. 2, primer L2 with the nucleotide sequence shown in SEQ ID No. 3, and primer R with the nucleotide sequence shown in SEQ ID No. 4.

[0016] Furthermore, the 5' ends of primers L1 and L2 are specific fluorescent tag sequences.

[0017] Furthermore, the specific fluorescent tag sequences at the 5' ends of primers L1 and L2 are different, allowing them to bind to fluorescent probes of different luminescent types.

[0018] In one embodiment of the present invention, the first 21 nucleotides of primer L1 are specific fluorescent tag sequences FAM, and the first 21 nucleotides of primer L2 are specific fluorescent tag sequences HEX.

[0019] The single-stranded DNA molecule shown by primer L1 and the single-stranded DNA molecule shown by primer R amplify the fragment with genotype CC at the AX-109500250 locus, carrying the FAM fluorescent adapter sequence. The PCR amplification product shows a blue color when irradiated with fluorescence.

[0020] The single-stranded DNA molecule shown by primer L2 and the single-stranded DNA molecule shown by primer R amplify the TT fragment at the AX-109500250 locus, carrying the HEX fluorescent adapter sequence. The PCR amplification product shows a red color when irradiated with fluorescence.

[0021] The single-stranded DNA molecules shown by primer L1, primer L2, and primer R amplified the fragment with genotype CT at the AX-109500250 locus. The PCR amplification products showed a green color when irradiated with fluorescence.

[0022] The genotype TT indicates a homozygous wheat genome with nucleotides of type T at the AX-109500250 locus; the genotype CC indicates a homozygous wheat genome with nucleotides of type C at the AX-109500250 locus; and the genotype CT indicates a heterozygous wheat genome with nucleotides of both C and T at the AX-109500250 locus.

[0023] To address the aforementioned technical problems, in a second aspect, the present invention provides the above-described PCR primer composition and / or a kit containing the PCR primer composition.

[0024] The above PCR primer composition is selected from any one of the following R1)-R3):

[0025] R1) The PCR primer composition amplifies the wheat genomic DNA fragment including the AX-109500250 site.

[0026] The R2) PCR primer composition comprises: a single-stranded DNA with nucleotide sequence of positions 22-41 of SEQ ID No. 2, a single-stranded DNA with nucleotide sequence of positions 22-41 of SEQ ID No. 3, and a single-stranded DNA with nucleotide sequence of SEQ ID No. 4.

[0027] R3) The PCR primer composition includes primer L1 with the nucleotide sequence shown in SEQ ID No. 2, primer L2 with the nucleotide sequence shown in SEQ ID No. 3, and primer R with the nucleotide sequence shown in SEQ ID No. 4.

[0028] Furthermore, in this invention, the molar ratio of primer L1, primer L2 and primer R in the primer composition or the kit is 2:2:5.

[0029] To address the aforementioned technical problems, in a third aspect, this invention provides a method for identifying or assisting in the identification of wheat grain thousand-grain weight, zinc content, and / or iron content traits. The method includes detecting the genotype of the wheat at the AX-109500250 locus, and identifying or assisting in the identification of the wheat grain thousand-grain weight, zinc content, and / or iron content based on the genotype. For wheat samples with the genotype TT at the AX-109500250 locus, the thousand-grain weight, zinc content, and / or iron content are higher than or candidate to be higher than those of wheat samples with the genotype CC at the AX-109500250 locus. The genotype TT indicates a homozygous type of nucleotide T at the AX-109500250 locus in the wheat genome; the genotype CC indicates a homozygous type of nucleotide C at the AX-109500250 locus in the wheat genome.

[0030] Furthermore, in the above method, the method for detecting the genotype of the AX-109500250 locus of the wheat to be tested includes using the genomic DNA of the wheat to be tested as a template, performing KASP using the above-mentioned PCR primer composition to obtain PCR products; and determining the genotype based on the fluorescence signal of the PCR products.

[0031] Specifically, the method includes the following steps:

[0032] S1) Extract genomic DNA from the wheat to be tested;

[0033] S2) Using the genomic DNA extracted in S1) as a template, and the above-mentioned PCR primer combination as amplification primers, PCR amplification is performed to obtain PCR amplification products;

[0034] S3) Determine or assist in determining the traits of the wheat grain thousand-grain weight / zinc content / iron content based on the genotype at the AX-109500250 locus.

[0035] The wheat samples with the genotype TT at the AX-109500250 locus had a higher or candidate higher thousand-grain weight, zinc content, and iron content than the wheat samples with the genotype CC at the AX-109500250 locus.

[0036] The genotype TT indicates a homozygous wheat genome with nucleotides of type T at the AX-109500250 locus; the genotype CC indicates a homozygous wheat genome with nucleotides of type C at the AX-109500250 locus.

[0037] Furthermore, in the above method, the PCR primer composition described in S2) includes primer L1, primer L2, and primer R.

[0038] Furthermore, in the above method, step S3) determines the genotype of the AX-109500250SNP site based on the fluorescence color development of the PCR product.

[0039] Specifically, in step S2), the extracted genomic DNA of the wheat to be tested was used as a template for PCR amplification using the K_AX-109500250 primer set. The PCR reaction system is shown in Table 1. The KASP primer working solution consists of two competing primers (primer L1 and primer L2) at a concentration of 12 μM and a universal primer (primer R) at a concentration of 30 μM. That is, the molar ratio of primer L1, primer L2 and primer R in the primer working solution is 2:2:5. The 2×KASP master Mix contains two universal fluorescent probes and two universal quenching probes synthesized for the upstream primer tag sequences (FAM and HEX).

[0040] Table 1. PCR reaction system of K_AX-109500250

[0041] Reaction components Volume (μL) KASP primer working solution 0.056 2×KASP master Mix 2.5 DNA (dried at 45℃ for 1 hour) 2.0 ddH2O 2.5

[0042] PCR amplification was performed using an S1000™ Thermal Cycler 384-well PCR instrument. The amplification program is as follows:

[0043] Step 1: Denature at 95℃ for 15 minutes;

[0044] The second step is to denature at 95°C for 20 seconds, anneal / extend at 65–55°C for 1 minute, and perform 10 falling cycles, decreasing the temperature by 1°C per cycle.

[0045] The third step involves denaturation at 95°C for 20 seconds, followed by annealing / extending at 57°C for 1 minute, for a total of 32 cycles.

[0046] In step S3), the PCR amplification products were genotyped using a Pherastar Plus autofocus fluorescence multi-functional microplate reader (BMGLABTECH) and Klustercaller v3.4 software (LGC, Hoddesdon, UK).

[0047] To solve the above-mentioned technical problems, in a fourth aspect, the present invention provides a method for wheat breeding, the method comprising selecting wheat with the genotype TT at the above-mentioned AX-109500250 locus as a parent for breeding, wherein the genotype TT indicates that the nucleotide type at the AX-109500250 locus in the wheat genome is T homozygous.

[0048] In this invention, the purpose of wheat breeding is to obtain wheat with higher thousand-grain weight, zinc content, and / or iron content.

[0049] To address the aforementioned technical problems, in a fifth aspect, the present invention provides a DNA molecule, the nucleotide sequence of which is SEQ ID No. 1.

[0050] The aforementioned DNA molecule can serve as a molecular marker for the thousand-grain weight, zinc content, and / or iron content of wheat grains. The molecular marker is the AX-109500250 site, which is a SNP site in the wheat genome, such as the 48th nucleotide of SEQ ID No. 1, and its nucleotide type is C or T.

[0051] The AX-109500250 mentioned above is located on the long arm (2DL) of wheat chromosome 2D, and the alleles that increase grain zinc content, iron content and thousand-grain weight all come from Xiaoyan 60.

[0052] In this invention, the wheat can be a pure line or an inbred line. The inbred line can be a recombinant inbred line. The recombinant inbred line can be a recombinant inbred line obtained by crossing Zhongmai 175 as the female parent and wheat rotation selection 987 as the male parent, or it can be a recombinant inbred line of Zhongmai 175 and Xiaoyan 60.

[0053] This invention utilizes the wheat 55K SNP chip to analyze the genotypes of the Zhongmai 175 / Xiaoyan 60 RIL population, constructing a high-density linkage map. Combining grain zinc content, iron content, and thousand-grain weight phenotypes, a pleiotropic locus was located on the long arm of chromosome 2D. The allele from Xiaoyan 60 can simultaneously increase grain zinc content, iron content, and thousand-grain weight. Based on this, this invention developed the KASP marker K_AX-109500250, which is closely linked to the 2D locus, providing a valuable tool for wheat breeding. Attached Figure Description

[0054] Figure 1 A 2D genetic linkage map and LOD curve of pleiotropic QTLs were constructed for SNP markers in a 55K chip.

[0055] Figure 2 The results of the K-AX-109500250 primer set for testing Zhongmai 175, Xiaoyan 60 and 250 families are presented.

[0056] Figure 3 The results of the detection of the K-AX-109500250 primer pair for Zhongmai 175, Lunxuan 987 and 146 families are presented. Detailed Implementation

[0057] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0058] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0059] The Zhongmai 175 used in the following examples was preserved in this experiment and is described in the following literature: He Zhonghu, Chen Xinmin, Wang Desen, et al. Analysis of the high-yield, high-efficiency and wide-adaptability characteristics of Zhongmai 175 and thinking on breeding methods [J]. Chinese Agricultural Science, 2015, 48(17):3394-3403. The public can obtain the above-mentioned biological materials from the applicant. The above-mentioned biological materials are only used to repeat the experiments of this invention and cannot be used for other purposes.

[0060] The Xiaoyan 60 in the following examples was donated by Zheng Qihui of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and is described in the following literature: LUO QL, ZHENG Q, HU P, LIU LQ, YANG GT, LI HW, LI B, LI Z S. Mapping QTL for agronomic traits under two levels of salt stress in a new constructed RILwheat population[J]. Theoretical and Applied Genetics, 2020, 134(1):1-19. The above-mentioned biological materials can be obtained from the applicant by the public. The above-mentioned biological materials are only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0061] The 987 selected in the following examples was preserved in this experiment and is recorded in the following literature: Chen Xinmin, Zhang Yan, Xia Xianchun, Shao Fengcheng, Wang Desen, Zhang Wenxiang, Wang Zhongwei, Zhang Yong, Zhang Yunhong, Li Simin, He Zhonghu. Application of high molecular weight glutenin subunit molecular markers in wheat variety improvement [J]. Journal of Triticeae Crops, 2012, 32(05):960-966. The public can obtain the above-mentioned biological materials from the applicant. The above-mentioned biological materials are only used for repeating the experiments of this invention and cannot be used for other purposes.

[0062] The zinc and iron content of wheat grains in the following examples were detected by X-ray fluorescence spectroscopy. The determination of zinc and iron content in the grains was carried out at the Crop Research Institute of Sichuan Academy of Agricultural Sciences.

[0063] Example 1: Discovery of pleiotropic loci and tightly linked SNPs in wheat grains for zinc content, iron content, and thousand-grain weight.

[0064] 1. Test materials: In this invention, Zhongmai 175 was used as the female parent and Xiaoyan 60 was used as the male parent for hybridization. The SSD single-seed transfer method was used to construct a recombinant inbred line (RIL) population containing 250 families.

[0065] 2. Field Trials: For several consecutive years, the experimental fields were treated with zinc fertilizer before sowing to ensure sufficient zinc content in the soil. The aforementioned RIL population was planted in Gaoyi and Gaocheng in 2018–2019, and in Gaoyi, Gaocheng, and Beijing in 2019–2020. Field planting employed a completely randomized block design with two replicates, single-row plots, 1m row length, 0.2m row spacing, and 30 seeds evenly sown per row. After full plant maturity, 30 ears of grain were randomly harvested from each row and threshed manually.

[0066] 3. Determination of zinc and iron content in grains: (1) First, use high vacuum grease to seal a 4μm thick Poly4 sample film on the inner wall and bottom of an aluminum cup with a diameter of about 40mm; (2) Take about 15g of cleaned grains and put them into the aluminum cup with the sealed Poly4 sample film, and gently shake to distribute the grains evenly; (3) Load the sample onto the instrument and use X-Supreme 8000 (Oxford Instruments plc, Abingdon, UK) to determine the zinc and iron content. The analysis model established by Paltridge et al. (2012) was used to analyze the zinc and iron content of the grains. The total analysis time for each sample was 186s, including 60s for zinc and iron collection time and 66s for dead zone time.

[0067] 4. Thousand-grain weight determination: The thousand-grain weight is determined using an SC-G type automatic seed tester and thousand-grain weight meter. For specific operating methods, please refer to the instrument's instruction manual.

[0068] 5. Genetic mapping and QTL localization: A 55K microarray was used to perform whole-genome scanning of the genomic DNA of 250 families in the aforementioned RIL population, and the QTLs were mapped using IciMapping 4.1 software. http: / / www.isbreeding.net / Genetic linkage maps were constructed. The complete complex interval mapping (ICIM) method in IciMapping v4.1 software was used to detect the grain zinc content, iron content, and thousand-grain weight QTL of the above RIL population. The LOD threshold was set to 2.5, and the step size was set to 1 cM.

[0069] 6. Discovery of linkage marker AX-109500250: Using the above-mentioned RIL population, the QTLs for grain zinc content, iron content, and thousand-grain weight were simultaneously detected in the regions flanking markers AX-110535834 and AX-108771648 on chromosome 2DL. Figure 1 Analysis showed that this locus exhibited pleiotropic effects; the allele from Xiaoyan 60 could simultaneously increase grain zinc content, iron content, and thousand-grain weight without affecting plant height, demonstrating significant breeding value. The SNP marker AX-109500250, closely linked to this QTL, was specific on chromosome 2D; therefore, it was converted into a KASP marker for marker-assisted selection breeding.

[0070] Example 2: Design of K_AX-109500250 specific primers and establishment of detection method

[0071] I. Design of KASP-labeled specific primers

[0072] Sequence 1 is a flanking sequence of the SNP marker AX-109500250. Its 48th nucleotide is either C or T, representing one of the two polymorphic single nucleotides of this SNP marker, meaning that in actual wheat samples, this position contains either C or T. Sequence 1 was uploaded to the Polymarker website (http: / / www.polymarker.info / ) for primer design. Based on the design results, a chromosome-specific primer set was selected. The K_AX-109500250 primer set includes two competing primers (primer L1 and primer L2) and one universal primer (primer R). The 5' ends of the two competing primers were modified by adding universal fluorescent adapter sequences FAM and HEX, respectively, based on the Polymarker primer design results. The specific sequences are as follows:

[0073] AX-109500250SNP:

[0074] 5'-GTGTCTCTGT GCACATCAAT CCAATTATAA GCAGAATCAAAGCGTCG[C / T]CCACCCAGGAAG CCCAAGGCTGCGAAGGGGAAAAGGCCTCGA GCTCCATGTG GCCATTCGGA GTCTGAGGGA-3';

[0075] According to Appendix 1, Table 1 of the Standard for Nucleotide and / or Amino Acid Sequence Listings and Electronic Sequence Files (ZC 0003-2001), when the nucleotide sequence is C or T, it is represented by the symbol "y". That is, the nucleotide sequence of Sequence 1 is:

[0076] 5'-GTGTCTCTGT GCACATCAAT CCAATTATAA GCAGAATCAA AGCGTCGyCC ACCCAGGAAGCCCAAGGCTG CGAAGGGGAA AAGGCCTCGA GCTCCATGTG GCCATTCGGA GTCTGAGGGA-3' (sequence 1, y is C or T);

[0077] Primer L1: (Sequence 2, the single underlined part is the specific fluorescent tag sequence FAM, and the double underlined letters are polymorphic sites);

[0078] Primer L2: (Sequence 3, the single underlined part is the specific fluorescent tag sequence HEX, and the double underlined letters are polymorphic sites);

[0079] Primer R: 5'-GAATGGCCACATGGAGCTC'-3' (sequence 4).

[0080] The nucleotide sequences of the amplification products of primers L1 and R are as follows:

[0081] 5'-GAAGGTGACCAAGTTCATGCTAAGCAGAATCAAAGCGTCGCCCACCCAGGAAGCCCAAGGCTGCGAAGGGGAAAAGGCCTCGAGCTCCATGTGGCCATTC-3' (Sequence 5).

[0082] The nucleotide sequences of the amplification products of primers L2 and R are as follows:

[0083] 5'-GAAGGTCGGAGTCAACGGATTAAGCAGAATCAAAGCGTCGTCCACCCAGGAAGCCCAAGGCTGCGAAGGGGAAAAGGCCTCGAGCTCCATGTGGCCATTC-3' (Sequence 6).

[0084] The single-stranded DNA molecule shown by primer L1 and the single-stranded DNA molecule shown by primer R amplify the fragment with genotype CC at the AX-109500250SNP site, carrying the FAM fluorescent adapter sequence. The PCR amplification product shows blue fluorescence when irradiated.

[0085] The single-stranded DNA molecule shown by primer L2 and the single-stranded DNA molecule shown by primer R amplify the fragment with genotype TT at the AX-109500250SNP site, carrying the HEX fluorescent adapter sequence. The PCR amplification product shows red color when illuminated by fluorescence.

[0086] The single-stranded DNA molecules shown by primer L1, primer L2, and primer R amplified the fragment with genotype CT at the AX-109500250 SNP site. The PCR amplification product showed a green color when illuminated by fluorescence.

[0087] The genotype CC at the AX-109500250SNP locus indicates a homozygous genotype C at the AX-109500250SNP locus in the wheat genome.

[0088] The genotype TT at the AX-109500250SNP locus indicates a homozygous genotype T at the AX-109500250SNP locus in the wheat genome.

[0089] The genotype CT at the AX-109500250SNP locus indicates that the genotype at the AX-109500250SNP locus in the wheat genome is heterozygous for both C and T.

[0090] II. Establishment of Detection Methods

[0091] The test materials were Zhongmai 175, Xiaoyan 60, and a RIL population (containing 250 families) constructed using the SSD single-grain transfer method with Zhongmai 175 as the female parent and Xiaoyan 60 as the male parent.

[0092] 1. Genomic DNA was extracted from the above-mentioned test materials and diluted to obtain a template solution with a DNA concentration of approximately 50 ng / μL.

[0093] 2. Using the DNA obtained in step 1 as a template, PCR amplification was performed using the K_AX-109500250 primer set. The PCR reaction system is shown in Table 1. The KASP primer working solution consists of two competing primers (primer L1 and primer L2) at a concentration of 12 μM and a universal primer (primer R) at a concentration of 30 μM. That is, the molar ratio of primer L1, primer L2 and primer R in the primer working solution is 2:2:5. The 2×KASP master mix (purchased from LGC, UK, catalog number KBS-1016-002) contains two universal fluorescent probes and two universal quenching probes synthesized for the upstream primer tag sequences (FAM and HEX).

[0094] Table 1. PCR reaction system of K_AX-109500250

[0095] Reaction components Volume (μL) KASP primer working solution 0.056 2×KASP master Mix 2.5 DNA (dried at 45℃ for 1 hour) 2.0 ddH2O 2.5

[0096] 3. PCR amplification was performed using an S1000™ Thermal Cycler 384-well PCR instrument. The amplification program is as follows:

[0097] Step 1: Denature at 95℃ for 15 minutes;

[0098] The second step is to denature at 95°C for 20 seconds, anneal / extend at 65–55°C for 1 minute, and perform 10 falling cycles, decreasing the temperature by 1°C per cycle.

[0099] The third step involves denaturation at 95°C for 20 seconds, followed by annealing / extending at 57°C for 1 minute, for a total of 32 cycles.

[0100] 4. After the PCR reaction, the PCR amplification products were scanned using a Pherastar Plus autofocus fluorescence multi-functional microplate reader (BMGLABTECH). The excitation wavelength for FAM was 485 nm, and the emission wavelength was 520 nm; the excitation wavelength for HEX was 535 nm, and the emission wavelength was 556 nm; the system reference fluorescence ROX was excited at 575 nm and emitted at 610 nm. Genotyping was performed using Klustercaller v3.4 software (LGC, Hoddesdon, UK) after scanning.

[0101] The results are as follows Figure 2As shown, blue samples represent the CC genotype (Zhongmai 175 type) linked to the FAM fluorescent tag sequence; red samples represent the TT genotype (Xiaoyan 60 type) linked to the HEX fluorescent tag sequence; green samples represent the CT heterozygous genotype; and pink samples may have an undetermined genotype due to poor genomic DNA quality. Comparing the genotyping results of the Zhongmai 175 / Xiaoyan 60RIL population with the original microarray genotyping, except for samples with undetermined genotypes, the marker detection results for other families were consistent with the microarray data, proving that K_AX-109500250 transformation was successful.

[0102] Example 3: Actual Sample Detection

[0103] The test materials were Zhongmai 175, Lunxuan 987, and a RIL population of 146 families from the F6 generation of a cross between Zhongmai 175 and Lunxuan 987 constructed using the SSD single-grain transfer method (Zhongmai 175 as the female parent and Lunxuan 987 as the male parent). Family names are shown in column 2 of Table 2. These materials were planted in Gaoyi, Shijiazhuang, Beijing, and Xinjiang in 2019–2020, yielding grains from four different environments.

[0104] I. Phenotypic identification of zinc content, iron content and thousand-grain weight in seeds

[0105] The zinc and iron content of the seeds of the above-mentioned test materials in four environments were analyzed using the method described in Example 1. The average zinc and iron content of the seeds in the four environments are listed in columns 3 and 4 of Table 2, respectively. The thousand-grain weight of the above-mentioned test materials was determined using an SC-G type automatic seed tester and thousand-grain weight meter. The average thousand-grain weight of the four environments is listed in column 5 of Table 2.

[0106] II. K_AX-109500250 Marker Detection

[0107] 1. Genomic DNA was extracted from the above-mentioned test materials and diluted to obtain a template solution with a DNA concentration of approximately 50 ng / μL.

[0108] 2. The genotypes of the above-mentioned test materials were analyzed using the K_AX-109500250 primer set according to the method described in Example 2.

[0109] 3. Results are as follows Figure 3 As shown, there were 63 families with the CC genotype (i.e., Zhongmai 175 type), 74 families with the TT genotype (i.e., Xiaoyan 60 or Lunxuan 987 type), and 9 heterozygous and unknown genotypes (NN). The genotyping results of the tested materials are listed in column 6 of Table 2.

[0110] Table 2. Mean values ​​of zinc content, iron content, and thousand-grain weight phenotypes and K_AX-109500250 marker detection results of 146 Zhongmai 175 / Lunxuan 987RIL populations

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117] Note: NN indicates unknown genotype.

[0118] 4. The PROC TTEST model in the internationally used SAS 9.2 statistical software was used to conduct t-tests on the zinc content, iron content, and thousand-grain weight of the grains of 146 tested materials with different genotypes. The results are shown in Table 3. The results showed that the zinc content and thousand-grain weight of the TT genotype samples were statistically significantly higher than those of the CC genotype samples. Although the difference in iron content between the two genotype samples was not statistically significant, the iron content of the TT genotype samples was higher than that of the CC genotype samples.

[0119] Table 3. Zinc content, iron content, and thousand-grain weight of grains from 146 Zhongmai 175 / Lunxuan 987RIL populations (t-test)

[0120]

[0121] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. AX-109500250 SNP sites and detection AX-109500250 Application of substances with SNP loci genotypes in any of the following: A1) Identify or assist in the identification of wheat grain thousand-grain weight, zinc content and / or iron content; A2) Screening or assisted screening of wheat plants, strains, varieties or lines with high thousand-grain weight, zinc content and / or iron content; A3) Assisted breeding based on wheat grain thousand-grain weight, zinc content, and / or iron content; The AX-109500250 The SNP site is a SNP site in the wheat genome, which is the 48th nucleotide of SEQ ID No. 1, and its nucleotide type is C or T.

2. The application according to claim 1, characterized in that: The detection AX-109500250 The polymorphism or genotype of the SNP site is any one of the following: B1) The detection AX-109500250 The material for amplifying the genotype of the SNP locus includes the aforementioned AX-109500250 PCR primer composition for wheat genomic DNA fragments including SNP sites; B2) The detection AX-109500250 The substance for the SNP locus genotype is a PCR reagent containing the PCR primer composition described in B1); B3) A kit containing the PCR primer composition described in B1) or the PCR reagent described in B2).

3. The application according to claim 2, characterized in that: The PCR primer composition comprises: single-stranded DNA with nucleotide sequence of positions 22-41 of SEQ ID No. 2, single-stranded DNA with nucleotide sequence of positions 22-41 of SEQ ID No. 3, and single-stranded DNA with nucleotide sequence of SEQ ID No.

4.

4. The application according to claim 2 or 3, characterized in that: The PCR primer composition comprises: primer L1 with the nucleotide sequence shown in SEQ ID No. 2, primer L2 with the nucleotide sequence shown in SEQ ID No. 3, and primer R with the nucleotide sequence shown in SEQ ID No.

4.

5. A method for identifying or assisting in the identification of wheat grain thousand-grain weight, zinc content, and / or iron content traits, said method comprising detecting the traits described in claim 1 of the wheat to be tested. AX-109500250 The genotype of the SNP locus is used to identify or assist in the identification of wheat grain thousand-grain weight, zinc content, and / or iron content. AX-109500250 The wheat samples with the TT genotype at the SNP locus had a thousand-grain weight, zinc content, and / or iron content higher than or higher than the specified values. AX-109500250 The wheat sample to be tested has a genotype of CC at the SNP locus, where TT indicates that the genotype is present in the wheat genome. AX-109500250 The nucleotide type of the SNP site is homozygous for T; the genotype CC indicates that the nucleotide type of the wheat genome is homozygous for T. AX-109500250 The nucleotide type at the SNP site is homozygous for C.

6. The method according to claim 5, characterized in that: The detection of wheat as described in claim 1 AX- 109500250 The method for genotyping SNP sites includes using wheat genomic DNA to be identified as a template, performing KASP using the PCR primer composition described in claim 4, and obtaining PCR products. The genotype was determined based on the fluorescence signal of the PCR product.

7. A method for breeding wheat grains based on traits such as thousand-grain weight, zinc content, and / or iron content, characterized in that: The method includes selecting the method described in claim 1. AX-109500250 Wheat with the genotype TT at the SNP locus was used as a parent for breeding. The genotype TT indicates that the wheat genome contains the TT genotype. AX-109500250 The nucleotide type at the site is homozygous for T.

Citation Information

Patent Citations

  • dCAPS marker for assisting detection of soybean huandred-grain weight and application thereof

    CN107988414A

  • Method for assisting in identifying wheat grain weight characteristic and special primer group thereof

    CN108977441A