Optimized method and application of female fish fertility control

Abstract

The present invention provides a method and application for optimizing the fertility control of female fish. The method uses gene editing technology to knock out the key coding gene for the synthesis of gonadal progesterone in fish, block the synthesis of fish progesterone, and hinder the maturation and ovulation of the oocytes of the obtained homozygous female fish, so that it is unable to mate and lay eggs with wild-type male fish, thereby obtaining infertile female fish. After the obtained infertile female fish is treated with gonadotropin and corresponding preparations, it can restore the ability to mate and lay eggs naturally with wild-type male fish, and achieve a higher fertilization rate and membrane emergence rate, and the surviving offspring individuals have no obvious difference in morphology from wild-type fish of the same period. In the above manner, the method provided by the present invention can be widely used in various types of aquaculture fish to achieve effective control of the fertility of female fish in aquaculture fish, and protect ecological safety, and has broad application prospects in the field of genetic breeding and ecological safety of aquaculture fish.

Description

Technical Field

[0001] The invention relates to the fields of genetic engineering technology and molecular biology, and in particular to an optimized method for controlling the fertility of female fish and its application. Background Art

[0002] In recent years, in order to increase the growth rate of aquatic species, increase aquaculture production, enhance disease resistance, and improve the quality of aquaculture species, many scholars have used genetic manipulation technology to conduct extensive research in aquaculture-related fields. However, once genetically manipulated aquaculture materials are released or escape into natural water bodies, they may reproduce naturally with wild populations, causing genetic manipulation sites to gradually infiltrate wild populations in nature, thereby destroying the natural population genetic structure and genetic diversity, causing artificial genetic manipulation sites to "genetically pollute" wild species, and generating unpredictable and difficult to eliminate ecological safety risks, which hinders the application and promotion of new breeding technologies based on genetic manipulation and genetically manipulated aquaculture species in the aquaculture industry.

[0003] Fertility control refers to the technology of artificially intervening in the fertility of target species to achieve artificial control of fertility. By establishing and optimizing fertility control technology, the fertility of these genetically manipulated aquaculture materials can be effectively controlled to prevent the "gene pollution" caused by the drift of artificial genetic manipulation sites in wild populations. It is the key to realizing the application of new breeding technologies such as gene editing in industrial breeding for efficient improvement of production traits, and thereby ensuring the ecological safety of natural populations. At the same time, it can also effectively protect the intellectual property rights of aquatic species with genetically improved traits, ensure the driving force for the development of seed industry science and technology, and promote the green, healthy and sustainable development of the aquaculture industry.

[0004] In order to control fertility, the invention patent with application number 201310049161.5 discloses a method for controlling fish reproduction. The patent constructs homozygous zebrafish with GAL4 gene and homozygous zebrafish with UAS-antisense dnd gene, and then hybridizes the two to obtain reproductive abortion of the two-line hybrid offspring. The method found through gonad tissue sections that about 3% of the egg cells in the ovaries of the two-line hybrid female fish were in the fourth developmental stage, and the size and number of the lobular cavity in the testes of the two-line hybrid male fish were about 10% of the control. This method requires the construction of two transgenic fish, the steps are relatively cumbersome, and it involves the introduction of exogenous genes. Therefore, whether it can be applied in economic fish needs further study.

[0005] The invention patent with application number 202111369875.5 discloses the loach CDK1 gene and its application in the molecular breeding of sterile polyploid loach. The patent uses CRISPR / Cas9 technology to knock out the CDK1 gene of polyploid loach to obtain sterile polyploid loach. However, although this method can obtain sterile individuals, there is no method to rescue fertility. Therefore, it is impossible to continuously obtain sterile offspring for breeding practice. It is necessary to continuously mate heterozygous parents and screen the offspring to obtain homozygous sterile offspring. Only then can sterile offspring be used for breeding. This is for the supply of large quantities of seedlings of aquaculture fish, and the economic costs such as manpower and material resources are obviously unbearable in large-scale breeding practices. Therefore, it is difficult to promote and apply it in aquaculture animals.

[0006] In view of this, it is necessary to design an optimized method and application for controlling the fertility of female fish to solve the above problems. Summary of the invention

[0007] In view of the defects of the above-mentioned prior art, the purpose of the present invention is to provide an optimized method and application for controlling the fertility of female fish. The present invention uses gene editing technology to specifically cut the key coding gene for the synthesis of gonadal progesterone in fish, and efficiently obtains infertile female fish; and uses gonadotropin and preparations that promote oocyte maturation and ovulation to treat infertile female fish, which better saves the fertility of female fish and realizes the control of female fish fertility.

[0008] To achieve the above object, the present invention provides a method for optimizing the fertility control of female fish, specifically:

[0009] Gene editing technology is used to knock out the key coding gene for the synthesis of progesterone in the fish gonads, thereby blocking the synthesis of progesterone in fish and obtaining homozygous infertile female fish;

[0010] After the homozygous infertile female fish with deletion is treated with gonadotropin and a preparation promoting oocyte maturation and ovulation, the homozygous infertile female fish with deletion can recover the ability to naturally mate and lay eggs with wild male fish.

[0011] As a further improvement of the present invention, the key coding gene for gonadal progesterone synthesis is a gene encoding a regulatory protein of the progesterone synthesis pathway (steroidogenic acute regulatory protein, star), namely, the star gene.

[0012] As a further improvement of the present invention, the method for controlling the fertility of female fish specifically comprises the following steps:

[0013] S1. Use gene editing technology to knock out the star gene in fish and obtain star-deficient homozygous fish;

[0014] S2, selecting star-deficient homozygous female fish from the star-deficient homozygous fish; the star-deficient homozygous female fish has blocked oocyte maturation and ovulation disorders, and cannot reproduce naturally;

[0015] S3, treating the star-deficient homozygous female fish with gonadotropin and a preparation that promotes oocyte maturation and ovulation of the star-deficient homozygous female fish;

[0016] S4. Naturally mate the homozygous star deletion female fish obtained after the treatment in step S3 with the wild-type male fish.

[0017] As a further improvement of the present invention, in step S3, the gonadotropin is human chorionic gonadotropin, and the preparation for promoting oocyte maturation and ovulation of star-deficient homozygous female fish is 4-pregnane-17α,20β-diol-3-one.

[0018] As a further improvement of the present invention, in step S3, the processing method is:

[0019] The human chorionic gonadotropin is injected 8 hours before the natural mating of the homozygous star-deficient female fish; then, the 4-pregnane-17α,20β-diol-3-one is used for drug bath treatment 6 hours before the natural mating of the homozygous star-deficient female fish.

[0020] As a further improvement of the present invention, in step S1, obtaining the star deletion homozygous fish specifically comprises the following steps:

[0021] S11, using gene editing technology to knock out the star gene in fish and obtain the F0 generation;

[0022] S12, hybridizing the F0 generation male fish with the wild-type female fish, and performing target detection fragment amplification and sequencing on the genome of the obtained F1 generation, detecting the mutation of the F1 generation, and obtaining the F1 generation star heterozygous fish with effective mutation;

[0023] S13, self-pollinating the F1 generation star heterozygous fish, and obtaining the F2 generation star deletion homozygous fish through enzyme digestion identification and screening.

[0024] As a further improvement of the present invention, in step S11, the method of knocking out the star gene in fish by gene editing technology specifically includes the following steps:

[0025] P1. Design star gene editing target sites in fish based on TALENs technology;

[0026] P2. According to the star gene editing target site of the fish, design a targeting double arm and assemble and synthesize TALENs mRNA; the targeting double arm includes a left arm and a right arm;

[0027] P3. Use the predetermined concentration of targeted double-arm mRNA as the injection for star gene editing and perform microinjection into fish fertilized eggs.

[0028] As a further improvement of the present invention, in step P1, the star gene editing target site of the fish is located on the second exon of the star gene, with a 22bp DNA sequence on the second exon of the star gene as the intermediate sequence.

[0029] As a further improvement of the present invention, in step P3, the predetermined concentration is 50-100 ng / μL, and the volume of the star gene-edited injection injected during the microinjection is 1.0-2.0 nL.

[0030] To achieve the above objectives, the present invention also provides the application of the above optimized method for controlling female fish fertility in the field of aquaculture fish genetic breeding and ecological safety.

[0031] The beneficial effects of the present invention are:

[0032] 1. The optimized method for controlling the fertility of female fish provided by the present invention can obtain effectively mutated F1 generation star heterozygous fish by using gene editing technology to specifically cut the star gene of fish, and self-pollinate, and screen out F2 generation star-deficient homozygous fish by enzyme cutting identification, thereby blocking the synthesis of fish progesterone, and all female fish in the obtained star-deficient homozygous fish have obstacles to the final maturation and ovulation of their oocytes due to the obstruction of gonadal progesterone synthesis, and cannot mate and lay eggs with wild-type male fish, thereby obtaining infertile female fish. At the same time, the infertile female fish obtained based on the above method can be treated with gonadotropins and preparations that promote the maturation and ovulation of oocytes of star-deficient homozygous female fish, so that they can complete natural ovulation and fertilization, and the surviving offspring individuals have no obvious difference in morphology from wild fish of the same period. Moreover, compared with the method of simply using a preparation that promotes the maturation and ovulation of oocytes of homozygous star-deficient female fish, the present invention further adds the use of gonadotropin, which can significantly improve the fertilization rate and membrane emergence rate of the treated female fish, and has a better rescue effect on the fertility of the female fish. Therefore, the method provided by the present invention can not only efficiently obtain infertile female fish, but also effectively rescue their fertility by using gonadotropin and corresponding preparations, thereby achieving the control of the fertility of female fish.

[0033] 2. The optimized method for controlling the fertility of female fish provided by the present invention can efficiently realize the artificial control and optimization of the breeding of genetically manipulated female fish parents, and can realize the controllable supply of their sterile offspring seedlings, effectively control the fertility of these genetically manipulated aquaculture materials, and prevent the "gene pollution" caused by the drift of artificial genetic manipulation sites in wild-type populations, fundamentally solve the ecological safety problem of genetic manipulation applications using new genetic breeding technologies, and have important significance for the sustainable development and promotion of genetic manipulation improvement and breeding research of fish. At the same time, it can also effectively protect the intellectual property rights of aquatic species with genetically improved traits, ensure the driving force for the development of seed industry science and technology, and promote the green, healthy and sustainable development of the aquaculture industry.

[0034] 3. Star is highly expressed in the ovary and is closely related to oocyte maturation and ovulation. It is widely present in fish and its function is conservative. The optimized method for controlling female fish fertility provided by the present invention can be applied to various aquaculture fish to achieve effective control of female fish fertility in aquaculture fish and protect ecological safety, and has broad application prospects in the field of aquaculture fish genetic breeding and ecological safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 A schematic flow chart of the method for optimizing female fish fertility control provided by the present invention.

[0036] Figure 2 It is a comparison diagram of the starcDNA partial sequences of a 3-month-old wild-type control zebrafish and the star deletion homozygous zebrafish provided by the present invention.

[0037] Figure 3 Schematic diagram of the treatment of star deletion homozygous female fish in Example 1 and Comparative Example 1.

[0038] Figure 4 The bar graph is a comparative analysis of the spawning effects of the star-deficient homozygous female fish treated in Example 1 and Comparative Example 1 and the star-deficient homozygous female fish not treated.

[0039] Figure 5 This is a comparison of the development of the offspring of star-deficient homozygous zebrafish after treatment in Example 1 and Comparative Example 1 and the wild-type fish of the same period. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0041] It should also be noted that, in order to avoid obscuring the present invention due to unnecessary details, only structures and / or processing steps closely related to the scheme of the present invention are shown in the drawings, while other details that are not closely related to the present invention are omitted.

[0042] In addition, it should be noted that the terms "comprises", "includes" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or apparatus.

[0043] The present invention provides a method for optimizing the fertility control of female fish, which is specifically:

[0044] Gene editing technology is used to knock out the key coding gene for the synthesis of progesterone in the fish gonads, thereby blocking the synthesis of progesterone in fish and obtaining homozygous infertile female fish;

[0045] After the homozygous infertile female fish with deletion is treated with gonadotropin and a preparation promoting oocyte maturation and ovulation, the homozygous infertile female fish with deletion can recover the ability to naturally mate and lay eggs with wild male fish.

[0046] Through the above-mentioned method, the present invention can utilize gene editing technology to specifically cut the key coding gene for the synthesis of gonadal progesterone in fish, and efficiently obtain infertile female fish; and use gonadotropin and preparations that promote oocyte maturation and ovulation to treat infertile female fish, thereby better saving the fertility of female fish, so as to achieve control of the fertility of female fish.

[0047] Preferably, the key coding gene for the synthesis of gonadal progesterone is the star gene.

[0048] Preferably, the method for controlling the fertility of female fish specifically comprises the following steps:

[0049] S1. Use gene editing technology to knock out the star gene in fish and obtain star-deficient homozygous fish;

[0050] S2, selecting star-deficient homozygous female fish from the star-deficient homozygous fish; the star-deficient homozygous female fish has blocked oocyte maturation and ovulation disorders, and cannot reproduce naturally;

[0051] S3, treating the star-deficient homozygous female fish with gonadotropin and a preparation that promotes oocyte maturation and ovulation of the star-deficient homozygous female fish;

[0052] S4. Naturally mate the homozygous star deletion female fish obtained after the treatment in step S3 with the wild-type male fish.

[0053] Through the above method, gene editing technology can be used to specifically cut the star gene of fish, and star-deficient homozygous infertile female fish can be efficiently obtained; and the infertile female fish can ovulate and fertilize normally after the above treatment, and its success rate, fertilization rate, emergence rate and embryo survival rate can be tested and counted. Its fertilization rate and emergence rate are significantly improved compared with the method of using the preparation alone.

[0054] Preferably, in step S1, obtaining the star deletion homozygous fish specifically comprises the following steps:

[0055] S11, using gene editing technology to knock out the star gene in fish and obtain the F0 generation;

[0056] S12, hybridizing the F0 generation male fish with the wild type female fish, and performing target detection fragment amplification and sequencing on the genome of the obtained F1 generation, detecting the mutation of the F1 generation, and obtaining the F1 generation star heterozygous fish with effective mutation; the genotype thereof is star+ / -;

[0057] S13, self-pollinating the F1 generation star heterozygous fish, and obtaining the F2 generation star deletion homozygous fish by enzyme digestion identification and screening, and the genotype of the fish is star- / -.

[0058] Preferably, in step S11, the step of knocking out the star gene in fish using gene editing technology specifically comprises the following steps:

[0059] P1. Design star gene editing target sites in fish based on TALENs technology;

[0060] P2. According to the star gene editing target site of the fish, design a targeting double arm and assemble and synthesize TALENs mRNA; the targeting double arm includes a left arm and a right arm;

[0061] P3. Use the predetermined concentration of targeted double-arm mRNA as the injection for star gene editing and perform microinjection into fish fertilized eggs.

[0062] Preferably, in step P1, the star gene editing target site of the fish is located on the second exon of the star gene, with a 22 bp DNA sequence on the second exon of the star gene as the intermediate sequence.

[0063] Preferably, in step P3, the predetermined concentration is 50-100 ng / μL, and the volume of the star gene-edited injection injected during the microinjection is 1.0-2.0 nL.

[0064] Preferably, in step S3, the gonadotropin is human chorionic gonadotropin, the preparation for promoting oocyte maturation and ovulation of homozygous star-deficient female fish is 4-pregnane-17α,20β-diol-3-one; and the treatment method is:

[0065] The human chorionic gonadotropin is injected 8 hours before the natural mating of the homozygous female star-deficient fish; then, 6 hours before the natural mating of the homozygous female star-deficient fish, the 4-pregnane-17α,20β-diol-3-one is used for medicated bath treatment; wherein the concentration of human chorionic gonadotropin is preferably 5IU / μL, and the injection volume is preferably 10μL; when the homozygous female star-deficient fish is treated with medicated bath treatment, the concentration of the 4-pregnane-17α,20β-diol-3-one preparation in the medicated bath is preferably 300μg / L.

[0066] The above-mentioned optimized method for controlling female fish fertility can be applied to various aquaculture fish to achieve effective control of female fish fertility in aquaculture fish and protect ecological safety, and can be applied to the field of genetic breeding and ecological safety of aquaculture fish.

[0067] The optimized method and application of female fish fertility control provided by the present invention are described below in conjunction with specific embodiments and comparative examples.

[0068] Example 1

[0069] See also Figure 1 As shown, this embodiment takes zebrafish as an example to provide an optimized method and application for controlling female fish fertility, which specifically includes the following steps:

[0070] S1. Gene editing technology was used to knock out the star gene in zebrafish to obtain star-deficient homozygous fish. The specific process is as follows:

[0071] S11. Use TALENs technology to knock out the star gene of zebrafish and obtain the F0 generation. The specific method is as follows:

[0072] 1) Based on the gene sequence information of zebrafish star in the NCBI database of the United States (NC_007119.6, NCBI), the zebrafish star gene editing target site was designed on the second exon of the star gene; a 22bp DNA sequence on the second exon of the zebrafish star gene was used as the intermediate sequence, which contained a recognition site (GAGCTC) for the commonly used restriction endonuclease SacI, and the gene sequence information was CCGAAGAAGGAGCTCCTTGCTC.

[0073] 2) The left and right arms of the zebrafish star gene editing target site use the 20 and 17 bp of their middle sequences as the binding sites for the left and right arms of TALENs, respectively, to assemble the targeted arms; the gene sequence information of the left arm is AGCACTTGGATAAACCACAT, and the gene sequence information of the right arm is ATGCAAGATCTCTTACT.

[0074] The TALENs plasmid that was correctly sequenced after assembly was linearized using restriction endonuclease SacI; TALENs targeted double-arm mRNA was transcribed from the linearized TALENs plasmid, specifically: using Invitrogen's mMESSAGEmMACHINE TM The SP6 Transcription Kit was used to synthesize mRNA in vitro. The concentration of mRNA was then determined using an ultra-micro spectrophotometer. The mRNA was then packaged and stored at -80°C for later use.

[0075] 3) A targeted double-arm mRNA at a concentration of 100 ng / μL was used as an injection for star gene editing and injected into 1- or 2-cell zebrafish embryos using a microinjector with an injection volume of 1.0 nL; the injected zebrafish eggs were cultured to sexual maturity to obtain the F0 generation, and the star gene was specifically cut to achieve star gene editing, resulting in star gene mutation.

[0076] S12. The male zebrafish F0 generation is hybridized with the wild-type female fish to obtain the F1 generation, the target detection fragment is amplified and sequenced on the F1 generation genome, the F1 generation mutation is detected, and the F1 generation star heterozygous zebrafish (star+ / -) with effective mutations are screened out; among the primers for the target detection fragment amplification and sequencing, the sequence of the forward primer and the sequence of the reverse primer for screening the star heterozygous zebrafish are TGACAGGTAAGAGCACTTTC and AGCCTGCATAAAGGAGTCTG, respectively.

[0077] S13, self-cross the F1 generation star heterozygous zebrafish with effective mutations, and screen out effective mutant lines with 1 bp deletion at the target site by enzyme digestion identification (such as Figure 2 As shown), the F2 generation of star-deficient homozygous zebrafish (genotype: star- / -) were obtained.

[0078] S2. In the F2 generation star-deficient homozygous fish, the female fish had oocyte maturation disorder and ovulation obstruction, and could not reproduce normally. The spawning success rate of natural mating with wild-type males was 0.00%.

[0079] S3, 8 hours before the natural mating of the homozygous star-deficient female fish (0:00 a.m.), injecting the human chorionic gonadotropin (HCG); then, 6 hours before the natural mating of the homozygous star-deficient female fish (2:00 a.m.-8:00 a.m.), using the preparation 4-pregnane-17α,20β-diol-3-one that promotes oocyte maturation and ovulation for drug bath treatment (such as Figure 3 As shown in B in the figure), the concentration of human chorionic gonadotropin is 5 IU / μL, the injection volume is 10 μL, and the concentration of 4-pregnane-17α,20β-diol-3-one in the bath is 300 μg / L.

[0080] S4. The treated star-deficient homozygous female fish were naturally mated with wild-type male fish.

[0081] The experimental results show that the treated homozygous female fish with star deletion can ovulate and fertilize normally, and the spawning success rate of the treated homozygous female fish with star deletion is 60.00%, the fertilization rate is 50.82%, the emergence rate is 88.51%, and the three-week survival rate is 69.36%.

[0082] It should be noted that this embodiment only takes zebrafish as an example, and does not limit the application field of the method for controlling female fish fertility provided by the present invention. Those skilled in the art should understand that for various aquaculture fish containing star genes, they can all be gene-edited according to the method provided by the present invention to achieve effective control of female fish fertility, which all belong to the protection scope of the present invention. In other embodiments of the present invention, the species of fish can also be changed to various aquaculture fish such as carp, crucian carp, grass carp, perch, tilapia, etc. Based on the same principle, they can all achieve technical effects similar to those in Example 1, so they will not be repeated here. In addition, since the optimized method for controlling female fish fertility provided by the present invention can be applied to various aquaculture fish, to achieve effective control of female fish fertility in aquaculture fish, and to protect ecological safety, it has broad application prospects in the field of genetic breeding and ecological safety of aquaculture fish.

[0083] Comparative Example 1

[0084] For the convenience of comparison with Example 1, this comparative example also takes zebrafish as an example to provide an optimized method for controlling female fish fertility. Compared with Example 1, the only difference is that step S3 does not inject human chorionic gonadotropin, but only uses 4-pregnane-17α,20β-diol-3-one for drug bath treatment (such as Figure 3 ).

[0085] The test results show that the spawning success rate of the star-deficient homozygous female fish obtained by the drug bath treatment with only 4-pregnane-17α,20β-diol-3-one in the comparative example is 40.00%, the fertilization rate is 18.34%, the membrane emergence rate is 47.81%, and the three-week survival rate is 55.03%. The comparison diagram of the corresponding data in Example 1 is as follows Figure 4 As shown. Figure 4 It can be seen that compared with the method of using only a preparation that promotes the maturation and ovulation of oocytes of homozygous star-deficient female fish for medicated bath treatment in Comparative Example 1, Example 1 further adds the injection of gonadotropin before medicated bathing, which can significantly improve the fertilization rate and membrane emergence rate of the treated female fish, and has a better rescue effect on the fertility of the female fish.

[0086] Comparative Example 2

[0087] For the convenience of comparison with Example 1 and Comparative Example 1, this comparative example also takes zebrafish as an example, and selects the offspring produced by natural mating of wild-type female and male fish as Comparative Example 2 to conduct a comparative test on spawning effect.

[0088] See also Figure 5 As shown, the spawning effects of the star-deficient homozygous female fish treated in Example 1, the star-deficient homozygous female fish treated in Comparative Example 1 and the offspring produced by natural mating with wild-type male fish, and the offspring produced by natural mating of wild-type female and male fish were compared. The results show that the surviving offspring of the star-deficient homozygous female fish have no obvious developmental disorders, and there is no significant difference in morphology from the wild-type fish of the same period, proving that the star-deficient homozygous female fish treated in both Example 1 and Comparative Example 1 can restore the ability to mate and spawn naturally with wild-type male fish, and their surviving offspring individuals have no significant difference in morphology from the wild-type fish of the same period.

[0089] In summary, the present invention provides an optimized method and application for controlling the fertility of female fish. The method uses gene editing technology to knock out the key coding gene for the synthesis of gonadal progesterone in fish, blocks the synthesis of fish progesterone, and blocks the maturation and ovulation of the oocytes of the obtained homozygous female fish, making it impossible to mate and lay eggs with wild-type male fish, thereby obtaining infertile female fish. After the infertile female fish is treated with gonadotropin and corresponding preparations, it can restore the ability to mate and lay eggs naturally with wild-type male fish, and achieve a higher fertilization rate and membrane rate, and the surviving offspring individuals have no significant difference in morphology from wild-type fish of the same period. In the above manner, the method provided by the present invention can be widely used in various types of aquaculture fish to achieve effective control of the fertility of female fish in aquaculture fish, and protect ecological safety, and has broad application prospects in the field of genetic breeding and ecological safety of aquaculture fish.

[0090] The above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A method for optimizing female fish fertility control, characterized in that: The specific steps include: S1. Use gene editing technology to knock out the star gene in fish and obtain star-deficient homozygous fish; S2, selecting star-deficient homozygous female fish from the star-deficient homozygous fish; the star-deficient homozygous female fish has blocked oocyte maturation and ovulation disorders, and cannot reproduce naturally; S3, treating the star-deficient homozygous female fish with gonadotropin and a preparation that promotes oocyte maturation and ovulation of the star-deficient homozygous female fish, so that the homozygous infertile female fish can recover the ability to mate and lay eggs naturally with wild-type male fish; the gonadotropin is human chorionic gonadotropin, and the preparation that promotes oocyte maturation and ovulation of the star-deficient homozygous female fish is 4-pregnane-17α,20β-diol-3-one; The processing method is: 8 hours before the natural mating of the homozygous star-deficient female fish, the human chorionic gonadotropin is injected, the concentration of the human chorionic gonadotropin is 5 IU / μL, and the injection volume is 10 μL; then, 6 hours before the natural mating of the homozygous star-deficient female fish, the 4-pregnane-17α,20β-diol-3-one is used for drug bath treatment, and the concentration of the 4-pregnane-17α,20β-diol-3-one preparation in the drug bath is 300 μg / L; S4. Naturally mate the homozygous star deletion female fish obtained after the treatment in step S3 with the wild-type male fish.

2. The method for optimizing female fish fertility control according to claim 1, characterized in that: In step S1, obtaining the star deletion homozygous fish specifically comprises the following steps: S11, using gene editing technology to knock out the star gene in fish and obtain the F0 generation; S12, hybridizing the F0 generation male fish with the wild-type female fish, and performing target detection fragment amplification and sequencing on the genome of the obtained F1 generation, detecting the mutation of the F1 generation, and obtaining the F1 generation star heterozygous fish with effective mutation; S13, self-pollinating the F1 generation star heterozygous fish, and obtaining the F2 generation star deletion homozygous fish through enzyme digestion identification and screening.

3. The method for optimizing female fish fertility control according to claim 2, characterized in that: In step S11, the method of knocking out the star gene in fish by gene editing technology specifically includes the following steps: P1. Design star gene editing target sites in fish based on TALENs technology; P2. According to the star gene editing target site of the fish, design a targeting double arm and assemble and synthesize TALENs mRNA; the targeting double arm includes a left arm and a right arm; P3. Use the predetermined concentration of targeted double-arm mRNA as the injection for star gene editing and perform microinjection into fish fertilized eggs.

4. The method for optimizing female fish fertility control according to claim 3, characterized in that: In step P1, the star gene editing target site of the fish is located on the second exon of the star gene, with a 22 bp DNA sequence on the second exon of the star gene as the intermediate sequence.

5. The method for optimizing female fish fertility control according to claim 3, characterized in that: In step P3, the predetermined concentration is 50-100 ng / μL, and the volume of the star gene-edited injection injected during the microinjection is 1.0-2.0 nL.

6. Use of the method for optimizing female fish fertility control as claimed in any one of claims 1 to 5 in genetic breeding of aquaculture fish.

Images