Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

766results about "Microinjection based" patented technology

Method for knocking off animal FGF5 gene by using CRISPR-Cas9 system

The invention provides a method for knocking off an animal FGF5 gene by using a CRISPR-Cas9 system. The method comprises the following steps: firstly, acquiring a DNA sequence aiming at an sgRNA recognition area of a second FGF5 exon, wherein the base sequence of the DNA sequence is as shown in SEQ ID NO.1; secondly, establishing an sgRNA expression structure of the second FGF5 exon, inserting a T7 starter before an sgRNA transcriptional start site, establishing an in-vitro transcription carrier of Cas9 protein, and regulating and controlling by using the T7 starter. Cas9 mRNA and sgRNA are obtained through the in-vitro transcription carrier of Cas9 and sgRNA, and the method can be used for knocking off the animal FGF5 gene.
Owner:CHINA AGRI UNIV

Method for knocking off animal myostatin gene by using CRISPR-Cas9 system

The invention provides a method for knocking off an animal myostatin gene by using a CRISPR-Cas9 system. The method comprises the following steps: firstly, acquiring a DNA sequence aiming at an sgRNA recognition area of a second myostatin exon, wherein the base sequence of the DNA sequence is as shown in SEQ ID NO.1; secondly, establishing an sgRNA expression structure of the second myostatin exon, inserting a T7 starter before an sgRNA transcriptional start site, establishing an in-vitro transcription carrier of Cas9 protein, and regulating and controlling by using the T7 starter. Cas9 mRNA and sgRNA are obtained through the in-vitro transcription carrier of Cas9 and sgRNA, and the method can be used for knocking off the animal myostatin gene.
Owner:CHINA AGRI UNIV

Design principle for construction of expression constructs for gene therapy

The invention concerns an expressible nucleic acid construct, which contains only the sequence information necessary for expressing a gene for RNA or protein synthesis. Expression constructs of this type can be used in gene therapy and genetic vaccination and avoid many of the risks associated with constructs today. The invention further concerns the possibility of improving the conveying of the construct into cells or tissue by covalent linkage of the construct, for example to particles or peptides.
Owner:MOLOGEN AG

Particle delivery techniques

A method is provided for in vivo or ex vivo delivery of a preparation of powdered nucleic acid molecules into vertebrate tissue for transformation of cells in the tissue using needleless injection techniques. The method can be used to deliver therapeutically relevant nucleotide sequences to cells in mammalian tissue to provide gene therapy, elicit immunity or to provide antisense or ribozyme functions. A method for providing densified processed pharmaceutical compositions is also described. The method is used to convert non-dense pharmaceutical powders or particulate formulations into densified particles optimally suited for transdermal delivery using a needleless syringe. The method is also used to optimize the density and particle size of powders and particulate formulations for subsequent transdermal delivery thereof. Densified pharmaceutical compositions formed by the present methods are also provided.
Owner:POWDERJECT RES LTD OXFORD (GB)

Electrospraying method with conductivity control

An electrospraying apparatus and / or method is used to coat particles. For example, a flow including at least one liquid suspension may be provided through at least one opening at a spray dispenser end. The flow includes at least particles and a coating material. A spray of microdroplets suspending at least the particles is established forward of the spray dispenser end by creating a nonuniform electrical field between the spray dispenser end and an electrode electrically isolated therefrom. The particles are coated with at least a portion of the coating material as the microdroplet evaporates. For example, the suspension may include biological material particles.
Owner:RGT UNIV OF MINNESOTA

Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology

The present invention mainly relates to formation of zebrafish with hepcidin gene knocked out, by the use of CRISPR / Cas9 technology, a unique PAM region is designed, so that the hepcidin gene in the zebrafish is knocked out, and other genes are not accidentally injured. The first case of hepcidin knockout transgenic animal model zebrafish has great significance, the hepcidin is a major factor in the regulation of iron, once the hepcidin is knocked out, an animal model can be successfully molded into an iron overload animal model, the human factor intervention can be excluded, the hepcidin has great significance to iron expression researches, meanwhile compared with the traditional gene knockout technology, the CRISPR / Cas9 technology has low toxicity, high accuracy, high efficiency, short success cycle and other characteristics, and the hepcidin gene can be faster knocked out.
Owner:徐又佳

Crispr/Cas9-induced scale-missing zebra fish mode and establishment method

InactiveCN104928321ANo developmentMicroinjection basedFermentationScanty hairFishery
The invention relates to a Crispr / Cas9-induced scale-missing zebra fish mode. The mode is scale-missing zebra fish containing EDA gene exon 4-locus base insertion. Meanwhile, the invention also discloses an establishment method and the application of the Crispr / Cas9-induced scale-missing zebra fish mode. The established scale-missing zebra fish mode has a great application value in functional research of related genes of appendages of the skin, screening of medicines for treating ectoderm dysplasia such as human baldness, and the like.
Owner:CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST

Method for targetedly integrating exogenous gene into target gene

The invention discloses a method for targetedly integrating an exogenous gene into a target gene of a mammal, which is implemented by targetedly integrating an exogenous gene into a target gene by utilizing a CRISPR / Cas9 system, and especially targetedly integrating a Cre gene to a first exon of a mouse Enpp1 gene. The technique has the advantages of high integration efficiency (20%) and simple operation step, only needs to construct one exogenous gene vector, and can not be influenced by the position effect.
Owner:HANGZHOU NORMAL UNIVERSITY

Preparation method of staphylococcus aureus CRISPR/Cas9 system and application of system in constructing mouse model

The invention discloses a preparation method of a staphylococcus aureus CRISPR / Cas9 system and an application of the system in constructing a genetically modified mouse model. The staphylococcus aureus CRISPR / Cas9 system is composed of two components, namely Cas9 mRNA and gRNA, wherein a preparation method of the Cas9 mRNA is achieved by adding a T7 promoter to the upstream region of original Cas9 coding DNA, and a preparation method of the gRNA is achieved by adding the T7 promoter to the upstream region of an original gRNA coding sequence. The staphylococcus aureus Cas9 mRNA and gRNA, which are injected to mouse fertilized embryos through micro-injection, can achieve gene editing and modification of various types, such as single-gene knockout, multi-gene knockout and / or gene knock-in and the like, on the mouse fertilized embryos; therefore, the CRISPR / Cas9 system has a good application prospect in the aspects of fertilized embryo gene editing and modification of such animals as mouse and the like as well as construction of animal models.
Owner:GUANGZHOU MAGIGEN BIOTECH

Cultivation method of Cyp gene knocked-out rats, and preparation method of liver microsome of the rats

The invention provides a cultivation method of Cyp gene knocked-out rats, and a preparation method of liver microsome of the rats. The Cyp gene knock-out herein includes Cyp single gene knock-out and Cyp multiple gene knock-out. In the method, firstly a Cyp gene knocked-out rat is constructed by means of a CRISPR / Cas system, which includes selection of a knocked-out target site, in-vitro synthesis and transcription of sg RNA and Cas9m RNA, preparation of a pseudopregnant female rat, in-vitro micro-injection and transplanting of a single-cell embryo, and cultivation of the rat, and finally, a homozygote Cyp gene knocked-out rat can be cultured. Furthermore, the liver of the Cyp gene knocked-out rat is extracted and is subjected to homogenization and differential centrifugation to prepare the liver microsome of the rat in Cyp gene deletion. The invention also provides an application of the Cyp gene knocked-out rats and the liver microsome thereof in study on drug metabolism.
Owner:EAST CHINA NORMAL UNIV

Method for knocking out p66shc gene in pig embryo

The invention provides a method for knocking out p66shc in a pig embryo by utilizing a CRISPR-Cas9 gene editing method. The method comprises the following concrete operation steps: (1) designing an Oligo DNA sequence; (2) connecting Oligo; (3) transforming and amplifying a constructed plasmid; (4) verifying knock-out efficiency by plasmid transfected cells; (5) constructing a CRISPR-Cas9 system of the p66shc gene; (6) producing the pig embryo with the p66shc gene knocked out; and (7) verifying a p66shc gene knock-out result. By adopting the scheme of the invention, the ROS level in an in vitro embryo culture process is effectively reduced, so that in vitro production efficiency of the pig embryo is improved by reducing damage and the like in the in vitro embryo culture process, and finally, an effective in vitro production system of the pig embryo is constructed.
Owner:HUNAN UNIV OF HUMANITIES SCI & TECH

Development and applications of heat shock induced Cas9 enzyme transgene danio rerio

InactiveCN106434748AAchieve knockoutEnabling gene editing researchMicroinjection basedPeptidesWild typeTransgenic zebrafish
The present invention relates to the technical field of biology, particularly to development and applications of a heat shock induced Cas9 enzyme transgene danio rerio. The present invention firstly provides a Cas9 enzyme expression vector, which utilizes a heat shock induced promoter HSP70 to drive the expression of a downstream Cas9 gene. According to the present invention, the Cas9 enzyme expression vector and Tol2 mRNA are co-injected into wild type danio rerio single cell fertilized egg, and selection is performed to obtain the heat shock induced Cas9 enzyme transgene danio rerio, such that the gene editing research of the CRISPR-Cas9 system in the danio rerio is successfully achieved, and the know-out of the MC4R gene in the transgene danio rerio is firstly achieved; and the Cas9 enzyme expression vector is further suitable for heat shock induced gene knockout, gene knock-in, gene expression modification and other applications of other fishes.
Owner:CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACADEMY OF SCI

Method for obtaining bmp2a gene knocked-out zebra fish through CRISPR/Cas9

The invention discloses a method for obtaining bmp2a gene knocked-out zebra fish through CRISPR / Cas9. A novel gRNA sequence is designed between a first exon and an intron of BMP2a, the gRNA sequence is GGAGCCCATCACTAGACTCTTGG, and enzyme digestion is HinfI. Compared with a traditional gene knockout technology, the CRISPR / Cas9 technology has the advantages of low toxicity, high accuracy, high efficiency, short success cycle and the like. Therefore, the BMP2a gene can be theoretically knocked out faster.
Owner:WUXI NO 2 PEOPLES HOSPITAL

Gene editing in the oocyte by cas9 nucleases

The present invention relates to a method of producing a non-human, mammalian oocyte carrying a modified target sequence in its genome, the method comprising the steps of introducing into a non-human, mammalian oocyte: (a) a clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated protein 9 (Cas9 protein) or a nucleic acid molecule encoding said Cas9 protein; and (b-i) a target sequence specific CRISPR RNA (crRNA) and a trans-activating crRNA (tracr RNA) or a nucleic acid molecule encoding said RNAs; or (b-ii) a chimaeric RNA sequence comprising a target sequence specific crRNA and tracrRNA or a nucleic acid molecule encoding said RNA; wherein the Cas9 protein introduced in (a) and the RNA sequence(s) introduced in (b-i) or (b-ii) form a protein / RNA complex that specifically binds to the target sequence and introduces a single or double strand break within the target sequence. The present invention further relates to the method of the invention, wherein the target sequence is modified by homologous recombination with a donor nucleic acid sequence further comprising the step: (c) introducing a nucleic acid molecule into the cell, wherein the nucleic acid molecule comprises the donor nucleic acid sequence and regions homologous to the target sequence. The present invention also relates to a method of producing a non-human mammal carrying a modified target sequence in its genome.
Owner:HELMHOLTZ ZENT MUNCHEN DEUTES FORSCHUNGSZENT FUR GESUNDHEIT & UMWELT

Method for breeding tcf25 gene deletion type zebra fish through gene knockout

InactiveCN107988268AEfficient and More Precise SilenceEasy to makeHydrolasesMicroinjection basedDiseaseGenotype Analysis
The invention relates to the technical field of gene knockout, and particularly discloses a method for breeding a tcf25 gene deletion type zebra fish through gene knockout. The method comprises the steps of through a CRISPR / Cas9 gene editing technology, designing an appropriate targeting gene locus on a tcf25 gene of the zebra fish, synthesizing in vitro to obtain specific sgRNA and Cas9-mRNA, microinjecting into a cell of the zebra fish, and after culturing an embryo for 60h, selecting the embryo for carrying out genotyping, so that the effectiveness of the selected locus is verified. The method provided by the invention is lower in off-target rate, removes the tcf25 gene through interference, is beneficial to further revealing the whole process of cardiac morphogenesis and a molecular mechanism regulating the process through researching functions through a genetics means, and is of great importance on understanding a cardiac disease pathology and researching and developing a new therapeutic schedule medically.
Owner:HUNAN NORMAL UNIVERSITY

Inkjet gene printing

Provided herein are methods and apparatuses for transfecting a cell with a compound of interest by stressing the cell, e.g. with shear stress. The compound of interest may be nucleic acids, proteins, molecules, nanoparticles, drugs, etc., or any combination thereof. Methods of printing cells with an inkjet printing device are also provided, wherein at least a portion of viable cells (preferably at least 1%) are transfected with a compound of interest. Preferably, at least 25% of the cells are viable after printing. In addition, methods of forming an array of viable cells are provided wherein at least a portion of the viable printed cells (preferably at least 1%) are transfected with at least one compound of interest.
Owner:WAKE FOREST UNIV HEALTH SCI INC

Method for establishing ferret model capable of applying to study human disease and application thereof

The invention relates to a method for establishing a ferret model capable of applying to study human disease and an application thereof, which belong to the biology field and specifically relates to a ferret ovulation induction technology and a ferret external fertilization technology. With the method for establishing the ferret model based on the technology of utilizing CRISPR / Cas9 on the above aspects, the method can be applied to study human diseases.
Owner:INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES

Microprojectile delivery system and particulate product

InactiveUS6929950B2Number can be determinedExquisite controlBioreactor/fermenter combinationsPowder deliveryParticulatesMicroparticle
The invention relates to a particulate product comprising at least one microprojectile; characterized in that the or at least one of the microprojectiles comprises silicon. The invention also relates to devices and components used in the microprojectile implantation of the particulate product to a target of cells or target tissue.
Owner:PSIMEDICA

Nanoparticles for protein/peptide delivery and delivery means thereof

The invention discloses the biodegradable nanoparticle for use in nanoparticle projectile bombardment as a carrier for administering nucleic acid, DNA, RNA or siRNAs transdermally to an animal subject. The nanoparticles are composed of positively charged chitosan substrate and the nucleic acid encapsulated within the nanoparticles or electrostatically loaded on the exterior surface of the nanoparticles.
Owner:NANOMEGA MEDICAL CORP

Fish breeding method for improving CRISPR-Cas9 gene editing and passage efficiency through fish roe preserving fluid

ActiveCN106191124AHigh target shooting efficiencyImproving gene editing passaging efficiencyMicroinjection basedAnimal husbandryFisheryMicroinjection
The invention belongs to the field of fish molecular breeding, and particularly relates to a fish breeding method for improving CRISPR-Cas9 gene editing and passage efficiency through fish roe preserving fluid. According to the method, the fish roe preserving fluid technology, the microinjection technology an the CRISPR-Cas9 gene editing technology are ingeniously combined, the targeting efficiency of the CRISPR-Cas9 gene editing technology and gene editing passage efficiency are greatly improved, the screening time needed by a gene editing method for fish breeding is obviously saved, and the method is of great significance in promoting rapid development of gene editing fish breeding.
Owner:CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACADEMY OF SCI

Bombyx mori silk fibroin heavy chain gene mutant obtained by utilizing CRISPR/Cas technology and mutation method and application

The invention discloses a bombyx mori silk fibroin heavy chain gene mutant obtained by utilizing CRISPR / Cas technology and a mutation method and application. The mutation method includes: mixing cas9mRNA with sgRNA, micro-injecting a mixture into a bombyx mori egg, identifying genotype through PCR (polymerase chain reaction), screening out heterozygotes, and mutually mating the heterozygotes to obtain F1 generation in which pure heterozygotes appear; performing genotype detection on bombyx mori with phenotype, mating the bombyx mori with same genotype, screening out homozygotes which can be stably inherited to next generation, and then screening out the bombyx mori silk fibroin heavy chain gene mutant, wherein a core sequence of sgRNA is designed aiming at 1213-1236, 1274-1297 or 1349-1372 loci of bombyx mori silk fibroin heavy chain gene. By the method, an experiment material having economic value and scientific value is obtained quickly and efficiently, and a new material is provided for large-scale production of bombyx mori sericine cocoon and enabling the bombyx mori to serve as a bioreactor to express foreign protein.
Owner:云南纳博生物科技有限公司

Animal model for obese rats and establishing method

The invention relates to an animal model for obese rats and an establishing method, and belongs to the field of animal genetic engineering and genetic modification. The animal model for obese rats and the establishing method are characterized in that rats with LEP and LEPR genes knocked out are obtained through the CRISPR / Cas9 technology. The rats with LEP and LEPR genes knocked out have a typical obesity characteristic, the reliable animal model can be provided for studying the obesity disease of people, and the rats with LEP and LEPR genes knocked out are expected to become a standard experiment animal of obese rats.
Owner:SUZHOU RUIQI BIO PHARMA CO LTD

Method for obtaining sheep with different hair colors on basis of CRISPR/Cas9 and sgRNA of targeted ASIP gene

The invention discloses a method for obtaining sheep with different hair colors on the basis of CRISPR / Cas9 and sgRNA of a targeted ASIP gene. The invention provides sgRNA (ASIP-sgRNA) capable of achieving specific and targeted modification of a sheep ASIP gene, and the sgRNA (ASIP-sgRNA) is RNA as shown from the third nucleotide to the 22<nd> nucleotide of 5' tail end of a sequence 4 of a sequence list or RNA with the nucleotides from the third nucleotide to the 22<nd> nucleotide of the 5' tail end of the sequence 4 of the sequence list. The ASIP-sgRNA particularly can be the RNA as shown in the sequence 4 of the sequence list. The invention further provides a method for obtaining sheep with changed hair colors. The method comprises the following steps that co-transfection of sgRNA capable of achieving specific and targeted modification of the sheep ASIP gene and Cas9mRNA on sheep cells is conducted, and therefore the sheep ASIP gene is deleted, and the sheep with the changed hair colors are obtained. According to the method for obtaining the sheep with different hair colors on the basis of CRISPR / Cas9 and sgRNA of the targeted ASIP gene, a CRISPR / Cas9 genome-editing technology is combined with a microinjection technology, and an effective technological means is provided for artificially changing the hair colors of the sheep.
Owner:新疆畜牧科学院生物技术研究所

CRISPR-mediated rapid and effective crop site-specific gene fragment or allele replacement method and system

The invention discloses a CRISPR-mediated rapid and effective crop site-specific gene fragment or allele replacement method and system. The system provided by the invention comprises a recombinant vector and a free donor fragment; the recombinant vector comprises a coding sequence of sgRNA1, an expression cassette of a Cas9 gene, a donor fragment and a coding sequence of sgRNA2; the donor fragmentcomprises a target of sgRNA1, a mutant segment and a target of sgRNA2; homologous recombination occurs between the mutant segment and a target segment; and the differences between the mutant segmentand the target segment are as follows: (1) a target nucleotide or fragment is replaced with a mutated nucleotide or fragment, (2) NGG in the target of sgRNA1 is mutated into non-NGG, and (3) the NGG in the target of sgRNA2 is mutated into non-NGG. The invention provides a feasible and effective method for replacing and integrating site-specific gene fragments or alleles for crop breeding improvement, and the method has a great application potential and a wide prospect.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI

Method for remarkably improving fish genome editing efficiency

The invention discloses a method for remarkably improving fish genome editing efficiency. The method for remarkably improving fish genome editing efficiency comprises the following steps: designing a genome editing tool for specifically identifying and cutting a specified site sequence of the fish genome, designing a homologous donor corresponding to the specified site sequence and containing a knock-in exogenous gene fragment, introducing the genome editing tool, the homologous donor and mRNA for specifically and stably expressing fluorescent protein in primordial germ cells into fish animal embryos by using a codominant microinjection method, and selecting the embryos by detecting fluorescent protein expressed by the fluorescent protein mRNA and obtaining stable inheritable characters. The efficiency of the method for knocking the exogenous gene fragment into the specified site of the fish genome so as to obtain a first filial generation of fish with the knock-in exogenous gene fragment is remarkably higher than that of the prior art.
Owner:NANJING UNIV

Methods and compositions for the introduction of molecules into cells

The present invention is directed to the introduction of molecules, including nucleic acids, carbohydrates, plant growth regulators and peptides into cells and tissues. The present invention is also directed to media and methods for enhancing embryogenic callus production of elite lines of soybean.
Owner:STINE BIOTECH

Adjuvanted genetic vaccines

Reagents useful in nucleic acid immunization techniques are described. More particularly, adjuvanted genetic vaccine compositions are described, as are methods of using those compositions for inducing an enhanced immune response against a selected antigen.
Owner:POWDER JECT VACCINES INC
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More