A method for rapid detection of bacterial, fungal and mycoplasma contamination in mesenchymal stem cell culture based on fluorescence quantitative PCR

Abstract

The present invention provides a method for rapidly detecting bacterial, fungal and mycoplasma contamination during the culture of mesenchymal stem cells based on fluorescent quantitative PCR, and belongs to the technical field of microbial detection. A DNA-specific fragment for detecting bacteria, fungi and mycoplasma includes a DNA fragment with a nucleotide sequence such as that shown in SEQ ID NO:1 or a DNA fragment with a length of more than 50% cut off on the basis of SEQ ID NO:1. Based on the DNA-specific fragment, the present invention designs a universal primer for detecting bacteria, fungi and mycoplasma. qPCR detection using the universal primer can rapidly and specifically detect whether there is bacterial, fungal and mycoplasma contamination in mesenchymal stem cell preparations, and the method is simple and accurate, takes less time than conventional culture methods, and the results can be qualitatively analyzed.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial detection, and particularly relates to a method for rapidly detecting bacteria, fungi and mycoplasma contamination in a mesenchymal stem cell culture process based on fluorescent quantitative PCR. Background Art

[0002] Mesenchymal stem cells and their exosomes have broad application prospects in clinical medicine. Therefore, the pollution-free culture of mesenchymal stem cells has attracted more and more attention. The culture process of mesenchymal stem cells needs to comply with strict quality control tests. Quality control tests include sterility, tumorigenicity, cell purity, and cell activity. Sterility includes the detection of mycoplasma, bacteria, fungi, and endotoxins.

[0003] Traditional mycoplasma detection methods mainly include culture method and indicator cell method, which generally require simultaneous detection. These two methods usually take a long time, such as at least 28 days for culture method. In recent years, cell therapy drugs have developed rapidly, and their market cycle is fast and the shelf life is short. Both culture method and indicator cell method cannot meet the time requirements for drug release. Real-time fluorescence quantitative PCR is a method for quantitative analysis of specific DNA sequences in the sample to be tested. Real-time fluorescence quantitative PCR is a real-time detection of the PCR process through fluorescent signals during PCR amplification. Since there is a linear relationship between the CT value of the template and the starting copy number of the template during the exponential period of PCR amplification, it becomes the basis for quantification. The single peak diagram of the PCR product melting curve indicates the singleness of the PCR amplification product. Therefore, the detection of mycoplasma based on real-time fluorescence quantitative PCR technology is expected to achieve good detection results. However, mesenchymal stem cells are also susceptible to bacterial and fungal contamination during the culture process. Although there are reports on specific fragments and universal primers for detecting bacteria and / or fungi, there are currently no universal detection primers and methods that can be used for bacterial, fungal and mycoplasma contamination in the mesenchymal stem cell culture process. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a universal primer for detecting mesenchymal stem cell contamination, which can realize the simultaneous detection of bacteria, fungi and mycoplasma, and provide a basis for simplifying the detection operation.

[0005] The present invention also aims to provide a universal primer for detecting bacteria, fungi and mycoplasma, which can detect not only several typical mycoplasmas involved in the Chinese Pharmacopoeia, but also multiple bacteria and fungi, and quickly and specifically detect whether there is cell, fungus and mycoplasma contamination in mesenchymal stem cell preparations, simplify experimental operations and reduce detection costs.

[0006] The present invention provides a DNA specific fragment for detecting bacteria, fungi and mycoplasma, comprising a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:1 or a DNA fragment with a length of more than 50% cut off based on SEQ ID NO:1.

[0007] Preferably, it comprises a DNA fragment having a nucleotide sequence as shown in SEQ ID NO:2 to SEQ ID NO:5.

[0008] The present invention provides a universal primer for detecting bacteria, fungi and mycoplasma, comprising:

[0009] At least one primer pair for amplifying the DNA specific fragment: a forward primer F1 with a nucleotide sequence as shown in SEQ ID NO: 6 and a reverse primer R1 with a nucleotide sequence as shown in SEQ ID NO: 7, a forward primer F2 with a nucleotide sequence as shown in SEQ ID NO: 8 and a reverse primer R1 with a nucleotide sequence as shown in SEQ ID NO: 7, a forward primer F3 with a nucleotide sequence as shown in SEQ ID NO: 9 and a reverse primer R1 with a nucleotide sequence as shown in SEQ ID NO: 7, and a forward primer F1 with a nucleotide sequence as shown in SEQ ID NO: 6 and a reverse primer R2 with a nucleotide sequence as shown in SEQ ID NO: 10.

[0010] The invention provides application of the universal primer in preparing a kit for simultaneously detecting bacteria, fungi and mycoplasma.

[0011] The invention provides a kit for detecting microbial contamination of mesenchymal stem cells based on fluorescent quantitative PCR technology, comprising the universal primers and a premixed solution for fluorescent quantitative PCR amplification.

[0012] The present invention provides application of the universal primer in preparing a kit for detecting microbial contamination of mesenchymal stem cells.

[0013] The present invention provides a method for detecting bacterial, fungal and mycoplasma contamination in a mesenchymal stem cell culture system, comprising the following steps:

[0014] Extract DNA from the mesenchymal stem cell culture system to be tested;

[0015] Using the extracted DNA as a template, preparing a qPCR reaction system using the universal primers, and performing qPCR amplification;

[0016] Determine whether there is bacterial, fungal and mycoplasma contamination in the mesenchymal stem cell culture system to be tested based on the shape of the amplification curve and the CT value of the detection channel:

[0017] Positive: The CT value of the detection channel is <29, and the amplification curve has an obvious exponential growth trend;

[0018] Negative: The sample test result CT ≥ 30 or no CT value and no amplification curve with obvious exponential growth trend;

[0019] Suspicious: For samples with a CT value of 29≤CT value<30 and a typical amplification curve, it is recommended to repeat the test. If the repeated test results show a CT value <29 and a typical amplification curve, it is positive, otherwise it is negative.

[0020] Preferably, the qPCR reaction system, in 10 μl, includes MasterqPCR Mix-SYBR (+UDG) 5 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL and DNA 4 μL.

[0021] Preferably, the reaction system of the qPCR amplification is 50°C for 2 min; 95°C for 2 min; 95°C for 15 s, 55°C for 30 s, 72°C for 30 s, 32 cycles, and collecting fluorescence signals at 72°C.

[0022] Preferably, the bacteria include at least one of the following: Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis and Clostridium sporogenes;

[0023] The fungi include Candida albicans and / or Aspergillus niger;

[0024] The mycoplasma includes oral mycoplasma and / or pneumoniae.

[0025] The present invention provides a DNA specific fragment for detecting bacteria, fungi and mycoplasma, including a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1 or a DNA fragment with a length of more than 50% cut off on the basis of SEQ ID NO: 1. The present invention firstly performs sequence comparison on the whole genomes of 7 bacteria and fungi (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis, Clostridium sporogenes, Candida albicans and Aspergillus niger) and 2 mycoplasmas (Mycoplasma oralis and Mycoplasma pneumoniae), finds a homologous conservative sequence, then designs amplification primers according to the homologous conservative sequence, and uses the primers to perform fluorescence quantitative PCR detection and verification, thereby realizing the detection of bacteria, fungi and mycoplasma, greatly simplifying the detection operation, and providing a basis for the simultaneous detection of bacteria, fungi and mycoplasma.

[0026] The present invention provides a universal primer for detecting mesenchymal stem cell contamination based on fluorescent quantitative PCR technology, including a forward primer with a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4. The universal primer provided by the present invention can be used to quickly and specifically detect whether there is bacterial fungal and mycoplasma contamination in mesenchymal stem cell preparations. In the embodiment of the present invention, 7 kinds of bacteria and fungi (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis, Clostridium sporogenes, Candida albicans and Aspergillus niger) and 2 kinds of mycoplasmas (Oral Mycoplasma and Mycoplasma pneumoniae) recorded in the pharmacopoeia are used as representatives by real-time fluorescent quantitative PCR method, and their inactivated DNA is used as a template for real-time fluorescent quantitative PCR reaction. The results show that the universal primer can detect bacteria, fungi and mycoplasma at the same time, and has good detection specificity, and the detection sensitivity is higher than the sensitivity of the traditional culture method recorded in the Chinese Pharmacopoeia. The development of the universal primer provides great convenience for the application environment of rapid and efficient detection of bacteria, fungi and mycoplasma, and can greatly reduce the detection cost and labor input.

[0027] The present invention provides a method for detecting bacterial, fungal and mycoplasma contamination in a mesenchymal stem cell culture system, and uses the shape of the amplification curve and the CT value of the detection channel by a real-time fluorescence quantitative PCR method to determine whether there is bacterial, fungal and mycoplasma contamination in the mesenchymal stem cell culture system to be tested. The method provided by the present invention meets the requirements of rapid and efficient detection, greatly simplifies the detection steps of contaminating microorganisms in the mesenchymal stem cell culture system, and has great industrial promotion and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the conservative sequence alignment result of bacteria, fungi and mycoplasma (a total of nine species);

[0029] Figure 2 is the melting curve of Staphylococcus aureus-F1 / R1 primer;

[0030] Figure 3 is the melting curve of Bacillus subtilis-F1 / R1 primer;

[0031] Figure 4 is the melting curve of the primers of Clostridium sporogenes-F1 / R1;

[0032] Figure 5 is the melting curve of Escherichia coli-F1 / R1 primer;

[0033] Figure 6 is the melting curve of Candida albicans -F1 / R1 primer;

[0034] Figure 7 is the melting curve of Aspergillus niger-F1 / R1 primer;

[0035] Figure 8 is the melting curve of Pseudomonas aeruginosa-F1 / R1 primer;

[0036] Fig. 9 is the melting curve of oral M. F1 / R1 primers;

[0037] Fig.10 is the melting curve of Mycoplasma pneumoniae-F1 / R1 primer;

[0038] Fig.11 is the melting curve of Staphylococcus aureus-F2 / R1 primer;

[0039] Fig.12 is the melting curve of Bacillus subtilis-F2 / R1 primer;

[0040] Fig.13 is the melting curve of the primer Clostridium sporogenes-F2 / R1;

[0041] Fig.14 is the melting curve of Escherichia coli-F2 / R1 primer;

[0042] Fig.15 is the melting curve of Candida albicans -F2 / R1 primer;

[0043] Fig.16 is the melting curve of Aspergillus niger-F2 / R1 primer;

[0044] Fig.17 is the melting curve of Pseudomonas aeruginosa-F2 / R1 primer;

[0045] Fig.18 is the melting curve of oral M. F2 / R1 primer;

[0046] Fig.19 is the melting curve of Mycoplasma pneumoniae-F2 / R1 primer;

[0047] Fig. 20 is the melting curve of Staphylococcus aureus-F3 / R1 primer;

[0048] Fig.21 is the melting curve of Bacillus subtilis-F3 / R1 primer;

[0049] Fig. 22 is the melting curve of the primer Clostridium sporogenes-F3 / R1;

[0050] Fig.23 is the melting curve of Escherichia coli-F3 / R1 primer;

[0051] Fig.24is the melting curve of Candida albicans -F3 / R1 primer;

[0052] Fig.25 is the melting curve of Aspergillus niger-F3 / R1 primer;

[0053] Fig.26 is the melting curve of Pseudomonas aeruginosa-F3 / R1 primer;

[0054] Fig. 27 is the melting curve of oral M. F3 / R1 primer;

[0055] Fig.28 is the melting curve of Mycoplasma pneumoniae-F3 / R1 primer;

[0056] Fig.29 is the melting curve of Staphylococcus aureus-F1 / R2 primer;

[0057] Fig.30 is the melting curve of Bacillus subtilis-F1 / R2 primer;

[0058] Fig.31 is the melting curve of the primers of Clostridium sporogenes-F1 / R2;

[0059] Fig.32 is the melting curve of Escherichia coli-F1 / R2 primer;

[0060] Fig.33 is the melting curve of Candida albicans -F1 / R21 primer;

[0061] Fig.34 is the melting curve of Aspergillus niger-F1 / R2 primer;

[0062] Fig.35 is the melting curve of Pseudomonas aeruginosa-F1 / R2 primer;

[0063] Fig.36 is the melting curve of oral M. F1 / R2 primers;

[0064] Fig.37 This is the melting curve of Mycoplasma pneumoniae-F1 / R2 primers. DETAILED DESCRIPTION

[0065] The invention provides a DNA specific fragment for detecting bacteria, fungi and mycoplasma, comprising a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:1 (GCCACACTGGAACTGAGACACGGTC CAGACTCCTACGGGAGGCAGCAGTGGGGAATATT) or a DNA fragment with a length of more than 50% cut off based on SEQ ID NO:1.

[0066] In the present invention, the method for obtaining the DNA specific fragment is preferably to perform sequence comparison on the whole genomes of 7 bacteria and fungi (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis, Clostridium sporogenes, Candida albicans and Aspergillus niger) and 2 mycoplasmas (Mycoplasma oralis and Mycoplasma pneumoniae) to obtain a homologous conservative sequence.

[0067] In the present invention, the DNA specific fragment is preferably a DNA fragment with a length of 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% cut off on the basis of SEQ ID NO: 1. In the present invention, the DNA fragments shown in the nucleotide sequences such as SEQ ID NO: 2 (CGGTCCAGACTCCTA CGGGAGGCAGCAGTGGGGAAT), SEQ ID NO: 3 (GACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAAT), SEQ ID NO: 4 (CACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAAT), SEQ ID NO: 5 (CGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAAT) are used as examples for illustration, and the detection of bacteria, fungi and mycoplasma can be achieved simultaneously based on the DNA specific fragment, but it cannot be understood as limiting the scope of protection of the present invention. The experimental results show that based on the DNA specific fragment, the presence of contaminating microorganisms such as bacteria, fungi and mycoplasma can be detected simultaneously, and the specific detection experimental results show that the DNA fragment only exists in bacteria, fungi and mycoplasma, is not conserved in cultured target cells and viruses, and cannot obtain positive amplification results, indicating that the DNA fragment has good specificity.

[0068] The invention provides a universal primer for detecting bacteria, fungi and mycoplasma, comprising at least one of the following primer pairs for amplifying the specific DNA fragment: a forward primer F1 having a nucleotide sequence as shown in SEQ ID NO: 6 (CGGTCCAGACTCCTACGG) and a reverse primer R1 having a nucleotide sequence as shown in SEQ ID NO: 7 (ATTCCCCACTGCTGCCTC), a forward primer F2 having a nucleotide sequence as shown in SEQ ID NO: 8 (GACACGGTCCAGACTCCT) and a reverse primer R1 having a nucleotide sequence as shown in SEQ ID NO: 7 (ATTCCCCACTGCTGCCTC), a forward primer F3 having a nucleotide sequence as shown in SEQ ID NO: 9 (CACGGTCCAGACTCCTAC) and a reverse primer R1 having a nucleotide sequence as shown in SEQ ID NO: 7 (ATTCCCCACTGCTGCCTC), a forward primer F1 having a nucleotide sequence as shown in SEQ ID NO: 6 (CGGTCCAGACTCCTACGG) and a reverse primer R2 having a nucleotide sequence as shown in SEQ ID NO: 10 (TTCCCCACTGCTGCCTCCC).

[0069] In the present invention, the four pairs of primers are designed for the specific fragment shown in SEQ ID NO: 1. The source of the universal primers is preferably commissioned to be synthesized by a gene synthesis company.

[0070] In the present invention, the sensitivity detection experiment shows that the detection sensitivity is higher than the sensitivity of the traditional culture method recorded in the Chinese Pharmacopoeia (10CFU / ml), wherein the detection sensitivity of oral mycoplasma is 5CFU / ml, and the detection sensitivity of Mycoplasma pneumoniae is 2.5CFU / ml.

[0071] In view of the fact that the universal primer can achieve specific detection of bacteria, fungi and mycoplasma at the same time, the present invention provides the use of the universal primer in preparing a kit for simultaneously detecting bacteria, fungi and mycoplasma.

[0072] In the present invention, the kit is suitable for the detection of all kinds of bacteria, fungi and mycoplasma. In the embodiment of the present invention, in order to illustrate the effect achieved by the kit in detail, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis and Clostridium sporogenes are used as bacterial representatives, Candida albicans and / or Aspergillus niger are used as fungal representatives, and Mycoplasma oralis and Mycoplasma pneumoniae are used as mycoplasma representatives. The results show that the kit can not only detect bacteria, fungi and mycoplasma at the same time, but also distinguish cultured cells and viruses, and has good detection specificity. In addition, the detection sensitivity of the kit meets the detection requirements.

[0073] The invention provides a kit for detecting microbial contamination of mesenchymal stem cells based on fluorescent quantitative PCR technology, comprising the universal primers and a premixed solution for fluorescent quantitative PCR amplification.

[0074] The present invention has no particular restrictions on the type and source of the fluorescent quantitative PCR amplification premix, and the type and source of the premix known in the art can be used. In an embodiment of the present invention, the fluorescent quantitative PCR amplification premix preferably includes Master qPCR Mix (+UDG) was purchased from Beijing Qingke Xinye Biotechnology Co., Ltd., batch number OFC19901.

[0075] In the present invention, the mesenchymal stem cell contaminating microorganisms preferably include bacteria, fungi and mycoplasma. In an embodiment of the present invention, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis and Clostridium sporogenes are bacterial representatives, Candida albicans and / or Aspergillus niger are fungal representatives, and Mycoplasma oralis and Mycoplasma pneumoniae are mycoplasma representatives. The results show that the kit can not only detect bacteria, fungi and mycoplasma at the same time, but also distinguish cultured cells and viruses, and has good detection specificity. In addition, the detection sensitivity of the kit meets the detection requirements.

[0076] The present invention provides application of the universal primer in preparing a kit for detecting microbial contamination of mesenchymal stem cells.

[0077] In the present invention, the kit is suitable for the detection of all kinds of bacteria, fungi and mycoplasma. In the embodiment of the present invention, in order to illustrate the effect achieved by the kit in detail, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis and Clostridium sporogenes are used as bacterial representatives, Candida albicans and / or Aspergillus niger are used as fungal representatives, and Mycoplasma oralis and Mycoplasma pneumoniae are used as mycoplasma representatives. The results show that the kit can not only detect bacteria, fungi and mycoplasma at the same time, but also distinguish cultured cells and viruses, and has good detection specificity. In addition, the detection sensitivity of the kit meets the detection requirements.

[0078] The present invention provides a method for detecting bacterial, fungal and mycoplasma contamination in a mesenchymal stem cell culture system, comprising the following steps:

[0079] Extract DNA from the mesenchymal stem cell culture system to be tested;

[0080] Using the extracted DNA as a template, preparing a qPCR reaction system using the universal primers, and performing qPCR amplification;

[0081] Determine whether there is bacterial, fungal and mycoplasma contamination in the mesenchymal stem cell culture system to be tested based on the shape of the amplification curve and the CT value of the detection channel:

[0082] Positive: The CT value of the detection channel is <29, and the amplification curve has an obvious exponential growth trend;

[0083] Negative: The sample test result CT ≥ 30 or no CT value and no amplification curve with obvious exponential growth trend;

[0084] Suspicious: For samples with a CT value of 29≤CT value<30 and a typical amplification curve, it is recommended to repeat the test. If the repeated test results show a CT value <29 and a typical amplification curve, it is positive, otherwise it is negative.

[0085] The present invention extracts DNA from a mesenchymal stem cell culture system to be tested.

[0086] The present invention has no particular limitation on the method for extracting DNA, and any method known in the art for extracting DNA, such as a kit method, can be used. After the DNA is extracted, it is preferably subjected to a quality inspection, including a concentration and integrity inspection. The qualified DNA is diluted and refrigerated for later use.

[0087] Using the extracted DNA as a template, the present invention utilizes the universal primers to prepare a qPCR reaction system and performs qPCR amplification.

[0088] In the present invention, the qPCR reaction system is based on 10 μl and preferably includes Master qPCRMix-SYBR (+UDG) 5μL, 10μM forward primer 0.5μL, 10μM reverse primer 0.5μL and DNA 4μL. The reaction system of the qPCR amplification is preferably 50℃2min; 95℃2min; 95℃15S, 55℃30S, 72℃30S, 32 cycles, and collecting fluorescence signals at 72℃. The present invention has no special restrictions on the instrument used for the qPCR amplification, and a qPCR instrument known in the art can be used.

[0089] In the present invention, the bacteria preferably include at least one of the following: Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis and Clostridium sporogenes. The fungi preferably include Candida albicans and / or Aspergillus niger. The mycoplasma preferably includes Mycoplasma oralis and Mycoplasma pneumoniae.

[0090] In an embodiment of the present invention, the CT values ​​of the primers for detecting oral mycoplasma at a concentration of 5 CFU / ml and 2.5 CFU / ml of mycoplasma pneumoniae DNA are both lower than 29, indicating that the primers can detect oral mycoplasma and mycoplasma pneumoniae. At the same time, the primers can detect DNA corresponding to 7 bacteria and fungi, indicating that the primers can detect bacteria and fungi. The present invention also carried out specific experiments, using cultured mesenchymal stem cells and human polyomavirus JCV as controls, respectively, and the test results were negative. It shows that the universal primers can only detect bacteria, fungi and mycoplasma, but cannot detect mesenchymal stem cells and conventional viruses in the culture system, and the primers have good detection specificity.

[0091] The following is a detailed description of a method for rapid detection of bacteria, fungi and mycoplasma contamination in the culture process of mesenchymal stem cells based on fluorescent quantitative PCR provided by the present invention in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0092] Example 1

[0093] Screening Method for Specific DNA Fragments of Bacteria, Fungi and Mycoplasma

[0094] According to the English names of nine bacteria, fungi and mycoplasmas, the corresponding gene sequences were searched in NCBI and GenBank, and then homologous sequence comparison analysis was performed. The comparison results are shown in Figure 1 , a conservative sequence was obtained, the nucleotide sequence of which is shown in SEQ ID NO: 1 (GCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATT).

[0095] Table 1 Summary of strain information

[0096]

[0097]

[0098] Example 2

[0099] Design and validation of universal primers for bacteria, fungi and mycoplasma

[0100] 1. Primer Design

[0101] Using the conserved sequence obtained in Example 1 as a template, universal primers were designed using Primer Premier 5 software. The results are shown in Table 2.

[0102] Table 2 Primer sequence information

[0103]

[0104] 2. Verification method

[0105] 2.1 Strain information is shown in Table 3.

[0106] Table 3 Strains used in the experiment

[0107] Bacteria source Bacillus subtilis Wenzhou Microdome Microbiology Technology Co., Ltd. Clostridium sporogenes Wenzhou Microdome Microbiology Technology Co., Ltd. Escherichia coli Wenzhou Microdome Microbial Technology Co., Ltd. Staphylococcus aureus Wenzhou Microdome Microbiology Technology Co., Ltd. Candida albicans Wenzhou Microdome Microbial Technology Co., Ltd. Aspergillus niger Wenzhou Microdome Microbiology Technology Co., Ltd. Pseudomonas aeruginosa Wenzhou Microdome Microbial Technology Co., Ltd. Oral Mycoplasma Inactivated Bacterial Liquid Huzhou Shenke Biotechnology Co., Ltd. Mycoplasma pneumoniae inactivated liquid Huzhou Shenke Biotechnology Co., Ltd.

[0108] 3. Extraction of strain / bacterial liquid DNA

[0109] The genomic DNA of the above nine standard strains / bacterial solutions were extracted according to the instructions of the Tiangen Genomic DNA Extraction Kit. The specific method is as follows:

[0110] 1. Add 200 μl buffer GA and vortex until thoroughly mixed.

[0111] 2. Add 20 μl Proteinase K solution and mix well.

[0112] 3. Add 200 μl of buffer GB, mix thoroughly by inversion, and place at 70°C for 10 min. The solution should become clear. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0113] 4. Add 200 μl of anhydrous ethanol and shake thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0114] 5. Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, centrifuge at 12000rpm for 30 seconds, pour out the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0115] 6. Add 500 μl of buffer GD to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0116] 7. Add 600 μl of rinse solution PW to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0117] 8. Repeat step 7.

[0118] 9. Place the adsorption column CB3 back into the collection tube, centrifuge at 12000rpm for 2min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0119] 10. Transfer the adsorption column CB3 into a clean centrifuge tube, add 50 μl of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 5 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the solution into the centrifuge tube.

[0120] Table 4 Bacterial DNA concentration

[0121] Sample name DNA concentration (ng / μl) Clostridium sporogenes 4.407 Escherichia coli 4.727 Candida albicans 4.342 Aspergillus niger 4.393 Bacillus subtilis 4.044 Staphylococcus aureus 3.873 Pseudomonas aeruginosa 4.479 Mycoplasma oralis 10.462 Mycoplasma pneumoniae 23.119

[0122] 4. Fluorescence quantitative PCR reaction system and procedure

[0123] The total reaction system was 10 μl, including the following reagents: 2×TSINGKE Master qPCR Mix-SYBR (+UDG) 5 μl, upstream primer (10 μM) 0.5 μl, downstream primer (10 μM) 0.5 μl, sample DNA 4 μl. The final concentration of upstream and downstream primers was 0.4 μM each. The same template was used for duplicate well reactions, and all reactions were performed on a LightCycler480 fluorescence quantitative PCR instrument. The reaction program of real-time fluorescence quantitative PCR was: 50°C pre-denaturation for 2 min; 95°C pre-denaturation for 2 min; 95°C denaturation for 15 s, 55°C annealing for 30 s, 72°C extension for 30 s, 32 cycles, and fluorescence signal collection at 72°C (LightCycler480, SYBR Green I channel).

[0124] Result judgment (qualitative analysis):

[0125] According to the CT values ​​of the sample group, the positive control and the negative control (BET water), it is judged whether the sample to be tested contains mycoplasma.

[0126] Positive: The CT value of the detection channel is <29, and the amplification curve has an obvious exponential growth trend;

[0127] Negative: The sample test result CT ≥ 30 or no CT value and no amplification curve with obvious exponential growth trend;

[0128] Suspicious: For samples with a CT value of 29≤CT value<30 and a typical amplification curve, it is recommended to repeat the test. If the repeated test results show a CT value <29 and a typical amplification curve, it is positive, otherwise it is negative.

[0129] 5. The experimental results are shown in Tables 5 to 8 and Figure 2 to Figure 37 From the test results, it can be seen that the CT values ​​of the universal primers for bacteria, fungi and mycoplasma are all lower than 30, and the amplification curves all show obvious exponential growth, indicating that the test results are positive.

[0130] Table 5 CT values ​​detected by F1 / R1 universal primers

[0131] Melting curve Bacteria CT value Single Peak Staphylococcus aureus 23.55 Single Peak Bacillus subtilis 23.97 Single Peak Clostridium sporogenes 22.78 Single Peak Escherichia coli 23.66 Single Peak Candida albicans 25.08 Single Peak Aspergillus niger 22.74 Single Peak Pseudomonas aeruginosa 21.83 Single Peak Mycoplasma oralis 24.87 Single Peak Mycoplasma pneumoniae 28.35

[0132] Table 6 CT values ​​detected by F2 / R1 universal primers

[0133]

[0134]

[0135] Table 7 CT values ​​detected by F3 / R1 universal primers

[0136] Melting curve Bacteria CT value Single Peak Staphylococcus aureus 26.35 Single Peak Bacillus subtilis 25.74 Single Peak Clostridium sporogenes 24.46 Single Peak Escherichia coli 24.36 Single Peak Candida albicans 25.52 Single Peak Aspergillus niger 25.52 Single Peak Pseudomonas aeruginosa 21.55 Single Peak Mycoplasma oralis 25.29 Single Peak Mycoplasma pneumoniae 27.30

[0137] Table 8 CT values ​​detected by F1 / R2 universal primers

[0138] Melting curve Bacteria CT value Single Peak Staphylococcus aureus 25.06 Single Peak Bacillus subtilis 24.24 Single Peak Clostridium sporogenes 24.33 Single Peak Escherichia coli 24.14 Single Peak Candida albicans 23.99 Single Peak Aspergillus niger 24.43 Single Peak Pseudomonas aeruginosa 24.89 Single Peak Mycoplasma oralis 25.48 Single Peak Mycoplasma pneumoniae 27.18

[0139] Example 3

[0140] The CT values ​​of DNA of seven bacteria and fungi (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis, Clostridium sporogenes, Candida albicans and Aspergillus niger) were tested by using universal primers.

[0141] 1. Strain information: 7 bacteria and fungi (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis, Clostridium sporogenes, Candida albicans and Aspergillus niger) are standard strains recommended by the Chinese Pharmacopoeia for routine sterility testing and are representative.

[0142] The genomic DNA of standard strains of seven bacteria and fungi (Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis, Clostridium sporogenes, Candida albicans and Aspergillus niger, 100 CFU / ml) were extracted according to the instructions of the Tiangen Genomic DNA Extraction Kit.

[0143] 2. Fluorescence quantitative PCR reaction system and procedure

[0144] The total reaction system was 10 μl, 2×TSINGKE MasterqPCRMix-SYBR (+UDG) 5 μl, upstream primer (10 μM) 0.5 μl, downstream primer (10 μM) 0.5 μl, and sample DNA 4 μl. The final concentration of upstream and downstream primers was 0.5 μM each. The same template was used for duplicate well reactions, and all reactions were performed on a LightCycler480 fluorescence quantitative PCR instrument. The reaction procedure for real-time fluorescence quantitative PCR was: 50°C pre-denaturation for 2 min; 95°C pre-denaturation for 2 min; 95°C denaturation for 15 s, 55°C annealing for 30 s, 72°C extension for 30 s, 32 cycles, and fluorescence signal collection at 72°C.

[0145] 4. The experimental results are shown in Table 9.

[0146] Table 9 CT values ​​obtained by universal primers for detecting DNA of 7 bacteria and fungi

[0147]

[0148] Conclusion: The above universal primers can detect DNA corresponding to 7 kinds of bacteria and fungi, and the sensitivity reaches the sensitivity of the traditional culture method recorded in the Chinese Pharmacopoeia (100 CFU / ml). It can be seen that the sensitivity of the detection method provided by the present invention is superior to that of the traditional method, and it takes less time, and the results can be obtained in 3 hours, while the traditional method takes 14 days to culture.

[0149] Example 4

[0150] Universal primers for testing the CT value of oral mycoplasma and mycoplasma pneumoniae DNA

[0151] 1. Strain information: Mycoplasma oralis and Mycoplasma pneumoniae are standard strains recommended by the Chinese Pharmacopoeia for routine mycoplasma testing and are representative.

[0152] The genomic DNA of the two mycoplasma inactivated bacterial liquids was extracted according to the instructions of the Tiangen genomic DNA extraction kit.

[0153] 2. Dilute the DNA of two mycoplasmas

[0154] The DNA extracted from the two mycoplasma inactivated bacterial solutions was diluted with sterile water. After dilution, the concentration of the original bacterial solution corresponding to oral mycoplasma DNA was 5 CFU / ml, and the concentration of the original bacterial solution corresponding to Mycoplasma pneumoniae was 2.5 CFU / ml. Take 2 μl of the diluted DNA for qPCR detection.

[0155] 3. Fluorescence quantitative PCR reaction system and procedure

[0156] The total reaction system was 10 μl: 2×TSINGKE MasterqPCRMix-SYBR (+UDG) 5 μl, upstream primer (10 μM) 0.5 μl, downstream primer (10 μM) 0.5 μl, and sample DNA 4 μl. The final concentration of the upstream and downstream primers was 0.5 μM each. The same template was used for duplicate well reactions, and all reactions were performed on a LightCycler480 fluorescence quantitative PCR instrument. The reaction procedure for real-time fluorescence quantitative PCR was: 50°C pre-denaturation for 2 min; 95°C pre-denaturation for 2 min; 95°C denaturation for 15 s, 55°C annealing for 30 s, 72°C extension for 30 s, 32 cycles, and fluorescence signal collection at 72°C.

[0157] 4. The experimental results are shown in Table 10.

[0158] Table 10 CT values ​​obtained by universal primers for detecting two mycoplasmas

[0159] Primers 5CFU / ml CT value of oral mycoplasma 2.5CFU / ml Mycoplasma pneumoniae CT value F1 / R1 24.87 28.35 F2 / R1 25.28 28.36 F3 / R1 25.29 27.30 F1 / R2 25.48 27.18

[0160] Conclusion: The above universal primers can detect the DNA corresponding to oral mycoplasma and mycoplasma pneumoniae. It can be regarded that the detection sensitivity of this method for oral mycoplasma is 5CFU / ml, and the detection sensitivity for mycoplasma pneumoniae is 2.5CFU / ml, which is higher than the sensitivity of the traditional culture method recorded in the Chinese Pharmacopoeia of 10CFU / ml. It can be seen that the sensitivity of this method is superior to the traditional method, and it takes less time, and the results can be obtained in 3 hours, while the traditional method takes 28 days to culture.

[0161] Example 5

[0162] Verification of the specificity of universal primers

[0163] The method of Example 2 was used to perform qPCR detection on human amniotic mesenchymal stem cell DNA and human polyomavirus JCV DNA using universal primers, and the results were all negative (see Table 11), indicating that the two pairs of universal primers are specific and can detect whether there is bacterial, fungal and mycoplasma (9 verified microorganisms, see Examples 3 and 4) contamination in the sample.

[0164] Table 11 Universal primers for detecting DNA of human amniotic mesenchymal stem cells and human polyomavirus JCV

[0165] Primer number Human amniotic mesenchymal stem cell DNA Human polyomavirus JCV DNA F1 / R1 Negative Negative F2 / R1 Negative Negative F3 / R1 Negative Negative F1 / R2 Negative Negative

[0166] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of universal primers for detecting bacteria, fungi and mycoplasma in preparing a kit for simultaneously detecting bacteria, fungi and mycoplasma, characterized in that: The universal primer is any one of the following groups: a forward primer F1 having a nucleotide sequence as shown in SEQ ID NO: 6 and a reverse primer R1 having a nucleotide sequence as shown in SEQ ID NO: 7; a forward primer F2 having a nucleotide sequence as shown in SEQ ID NO: 8 and a reverse primer R1 having a nucleotide sequence as shown in SEQ ID NO: 7; a forward primer F3 having a nucleotide sequence as shown in SEQ ID NO: 9 and a reverse primer R1 having a nucleotide sequence as shown in SEQ ID NO: 7, or a forward primer F1 having a nucleotide sequence as shown in SEQ ID NO: 6 and a reverse primer R2 having a nucleotide sequence as shown in SEQ ID NO:

10.

2. Use of the universal primers described in claim 1 in preparing a kit for detecting microbial contamination of mesenchymal stem cells.

3. A method for detecting bacterial, fungal and mycoplasma contamination in a mesenchymal stem cell culture system, characterized in that: The following steps are involved: Extract DNA from the mesenchymal stem cell culture system to be tested; Using the extracted DNA as a template, preparing a qPCR reaction system using the universal primers described in claim 1, and performing qPCR amplification; Determine whether there is bacterial, fungal and mycoplasma contamination in the mesenchymal stem cell culture system to be tested based on the shape of the amplification curve and the CT value of the detection channel: Positive: The CT value of the detection channel is <29, and the amplification curve has an obvious exponential growth trend; Negative: The sample test result CT ≥ 30 or no CT value and no amplification curve with obvious exponential growth trend; Suspicious: For samples with a CT value of 29≤CT value<30 and a typical amplification curve, it is recommended to repeat the test. If the repeated test results show a CT value <29 and a typical amplification curve, it is positive, otherwise it is negative.

4. The method according to claim 3, characterized in that: The qPCR reaction system is based on 10 μl, including 2×TSINGKE ® Master qPCR Mix-SYBR(+UDG) 5 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL and DNA 4 μL.

5. The method according to claim 3, characterized in that: The reaction system of the qPCR amplification was 50°C for 2 min; 95°C for 2 min; 95°C for 15 s, 55°C for 30 s, 72°C for 30 s, 32 cycles, and fluorescence signal was collected at 72°C.

6. The method according to any one of claims 3 to 5, characterized in that: The bacteria include at least one of: Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis and Clostridium sporogenes; The fungi include Candida albicans and / or Aspergillus niger; The mycoplasma includes oral mycoplasma and / or pneumoniae.

Images