Application of OsPRMT6a gene in regulating rice heading time and grain weight

By regulating the expression of the OsPRMT6a gene, the heading date of rice was advanced and the grain weight was increased, solving the problem of regulating the heading date and grain weight of rice in existing technologies and improving rice yield and quality.

CN118185954BActive Publication Date: 2026-04-03JIANGXI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410460853.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-17
Publication Date
2026-04-03
Estimated Expiration
2044-04-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the heading period and grain weight of rice, thus affecting the yield and quality of rice.

Method used

By overexpressing or inhibiting the expression of the OsPRMT6a gene, the heading time and grain weight of rice can be regulated. Overexpression or inhibition of the gene can be achieved using recombinant vectors or recombinant bacteria.

Benefits of technology

Overexpression of the OsPRMT6a gene advances the heading stage of rice, increases grain weight, and improves rice yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118185954B_ABST
    Figure CN118185954B_ABST
Patent Text Reader

Abstract

This invention relates to the field of plant genetic engineering, and particularly to the application of the OsPRMT6a gene in regulating the heading time and grain weight of rice. The invention involves constructing a vector overexpressing the OsPRMT6a gene and introducing it into rice using Agrobacterium-mediated transformation. Positive transgenic plants are obtained through screening with hygromycin labeling, and further, positive plants with high expression levels are obtained. Under Nipponbare background conditions, the OsPRMT6a gene overexpression material exhibits earlier heading and increased grain weight compared to the wild type. Therefore, it is evident that overexpression of the OsPRMT6a gene described in this invention can advance rice heading and increase grain weight, possessing significant breeding value for increasing rice yield and efficiency, and reducing costs and increasing income.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and in particular to the application of the OsPRMT6a gene in regulating heading time and grain weight in rice. Background Technology

[0002] Rice is one of the world's major crops, and China is the world's largest rice producer, with an annual output exceeding 200 million tons, accounting for 28% of global rice production. Increasing grain production and ensuring food security are crucial for stabilizing global economic development. The heading (flowering) stage is an important agronomical trait in rice growth and development, its length directly reflecting changes in rice varieties during their growth period. An optimal growth period plays a vital role in maintaining high and stable rice yields. Research shows that the molecular regulatory network of rice heading stage is highly complex, influenced by a combination of intrinsic genetic factors and external environmental factors such as light, temperature, and others. Changes in light and temperature directly regulate chlorophyll content and photosynthetic rate in rice leaves, thereby regulating leaf area index, dry matter accumulation, and other physiological and biochemical indicators, playing a decisive role during the heading stage. Currently, most regions in my country have entered a stage of high-yield, high-quality, and high-efficiency agriculture. To further improve rice yield and quality and achieve sustainable development in rice production, it is necessary to implement strict scientific regulation of the heading stage to achieve the goals of increased yield and efficiency, cost reduction, and increased income.

[0003] Grain weight, as one of the three key factors in rice yield, plays a crucial role in improving rice production. Grain weight is determined by a combination of factors, including grain length, width, length-to-width ratio, and grain fullness, and is primarily expressed as thousand-grain weight. Grain traits also influence the appearance and milling quality of rice. With the development of molecular techniques, several grain weight-related genes have been cloned and reported, such as the TGW6 and GW2 genes. These grain weight genes have laid the foundation for understanding the mechanism of rice grain weight formation and for molecular breeding to improve yield. However, as a complex quantitative trait, discovering more rice grain weight genes is essential for breeding to improve both rice yield and quality. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the OsPRMT6a gene in regulating rice heading time and grain weight, thereby solving the problems existing in the prior art. Overexpression of the OsPRMT6a gene described in this invention can advance rice heading and increase rice grain weight.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides the application of the OsPRMT6a gene or biological materials containing the OsPRMT6a gene in regulating the heading time of rice, wherein the nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO: 3.

[0007] Preferably, the heading time of rice is advanced by overexpressing the OsPRMT6a gene; and the heading time of rice is delayed by inhibiting the expression of the OsPRMT6a gene.

[0008] Preferably, the biomaterial includes a recombinant vector or recombinant bacteria.

[0009] This invention provides a method for advancing the heading time of rice, including the step of overexpressing the OsPRMT6a gene in rice to advance the heading time of rice; the nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO: 3.

[0010] The present invention provides a method for delaying the heading time of rice, comprising the step of inhibiting the expression of the OsPRMT6a gene in rice to delay the heading time of rice; the nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO: 3.

[0011] This invention provides the application of the OsPRMT6a gene or biological materials containing the OsPRMT6a gene in regulating rice grain weight, wherein the nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO: 3.

[0012] Preferably, rice grain weight is increased by overexpressing the OsPRMT6a gene; and rice grain weight is decreased by inhibiting the expression of the OsPRMT6a gene.

[0013] Preferably, the biomaterial includes a recombinant vector or recombinant bacteria.

[0014] The present invention provides a method for increasing rice grain weight, comprising the step of overexpressing the OsPRMT6a gene in rice to induce an increase in rice grain weight; the nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO: 3.

[0015] The present invention discloses the following technical effects:

[0016] This invention discovered that overexpression of the OsPRMT6a gene in rice leads to an increase in grain width and length, ultimately resulting in an increase in rice grain weight. This leads to the conclusion that the rice histone arginine methyltransferase OsPRMT6a gene can increase rice grain weight. Furthermore, this invention introduced the constructed pCAMBIA1390ubi-OsPRMT6a expression vector into rice using Agrobacterium-mediated transformation, and screened for positive transgenic plants using hygromycin labeling, further obtaining positive plants with high expression levels. Under Nipponbare background conditions, the OsPRMT6a gene overexpression material showed earlier heading and increased grain weight compared to the wild type. Therefore, it is evident that overexpression of the OsPRMT6a gene described in this invention can advance rice heading and increase grain weight, possessing significant breeding value for increasing rice yield and efficiency, and reducing costs and increasing income. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a spatiotemporal expression diagram of the OsPRMT6a gene in different tissues of rice; where Young leaves are tender leaves, young roots are young roots, Tillering leaves are tillering leaves, Booting leaves are leaves during the booting stage, Panicles<3cm are panicles<3cm, Panicles 3-5cm are panicles 3-5cm, Panicles>5cm are panicles>5cm, 1_DAF is day 1 post-fertilization, 5_DAF is day 5 post-fertilization, 10_DAF is day 10 post-fertilization, and mature leaves are mature leaves.

[0019] Figure 2 This is a subcellular localization map of the OsPRMT6a gene; where Empty-GFP is an empty vector with a GFP tag, and OsPRMT6a-GFP is a vector with a GFP tag linked to OsPRMT6a.

[0020] Figure 3 The map of the pCAMBIA1390ubi-OsPRMT6a expression vector;

[0021] Figure 4 GUS staining diagram of the OsPRMT6a gene;

[0022] Figure 5This is a graph showing the expression level of the OsPRMT6a gene overexpression against a Nipponbare background.

[0023] Figure 6 The editing status of OsPRMT6a gene knockout under Nipponbare background; (A) the location and editing status of the target site on the gene; (B) the sequencing status of the knockout target site; WT is wild type, and OsPRMT6a-1 and OsPRMT6a-2 are transgenic plants with OsPRMT6a gene knockout.

[0024] Figure 7 Phenotypic images of rice plants overexpressing the OsPRMT6a gene under Nipponbare background at the heading stage; (A) is a schematic diagram of rice heading (sampled in the field and then planted in pots); (B) is a bar chart showing the time of the start of heading; WT is wild type, prmt6a-1 and prmt6a-2 are transgenic plants with the OsPRMT6a gene knocked out, and OE1 and OE2 are transgenic plants overexpressing the OsPRMT6a gene;

[0025] Figure 8 The image shows the grain width of seeds overexpressing the OsPRMT6a gene against a Nipponbare background. WT represents the wild type, prmt6a-1 and prmt6a-2 are transgenic plants with the OsPRMT6a gene knocked out, and OE1 and OE2 are transgenic plants overexpressing the OsPRMT6a gene.

[0026] Figure 9 The image shows the grain length of seeds overexpressing the OsPRMT6a gene against a Nipponbare background. WT represents the wild type, prmt6a-1 and prmt6a-2 are transgenic plants with the OsPRMT6a gene knocked out, and OE1 and OE2 are transgenic plants overexpressing the OsPRMT6a gene.

[0027] Figure 10 The bar chart shows the grain width of plants overexpressing the OsPRMT6a gene against the background of Nipponbare. WT represents wild type, prmt6a-1 and prmt6a-2 represent transgenic plants with the OsPRMT6a gene knocked out, and OE1 and OE2 represent transgenic plants overexpressing the OsPRMT6a gene.

[0028] Figure 11 The image shows a bar chart of grain lengths overexpressing the OsPRMT6a gene against a Nipponbare background; WT represents the wild type, prmt6a-1 and prmt6a-2 represent transgenic plants with the OsPRMT6a gene knocked out, and OE1 and OE2 represent transgenic plants overexpressing the OsPRMT6a gene.

[0029] Figure 12The bar chart shows the thousand-grain weight of plants overexpressing the OsPRMT6a gene under the Nipponbare background. WT represents the wild type, prmt6a-1 and prmt6a-2 are transgenic plants with the OsPRMT6a gene knocked out, and OE1 and OE2 are transgenic plants overexpressing the OsPRMT6a gene.

[0030] Figure 13 The image shows a scanning electron microscope image of glumes on the surface of young spikelets overexpressing the OsPRMT6a gene against a Nipponbare background. WT represents the wild type, prmt6a represents the transgenic plant with the OsPRMT6a gene knocked out, and OE represents the transgenic plant overexpressing the OsPRMT6a gene. The red box represents a single glume outer surface cell.

[0031] Figure 14 The bar chart shows the number of cells on the surface of young spikelets overexpressing the OsPRMT6a gene against the Nipponbare background; WT represents wild type, prmt6a represents transgenic plants with the OsPRMT6a gene knocked out, and OE represents transgenic plants overexpressing the OsPRMT6a gene.

[0032] Figure 15 The image shows a semi-thin section of the glumes on the surface of young spikelets overexpressing the OsPRMT6a gene under a clear background. The first row is a cross-section of the young spikelet glumes, and the following three rows are magnified views of parts of the cross-section. WT represents the wild type, prmt6a-cas9 represents the transgenic plant with the OsPRMT6a gene knocked out, and prmt6a-OE represents the transgenic plant overexpressing the OsPRMT6a gene. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] Example 1

[0039] Spatiotemporal expression pattern of rice histone arginine methyltransferase OsPRMT6a gene

[0040] To obtain the expression pattern of the rice histone arginine methyltransferase OsPRMT6a gene, RNA was extracted from samples taken from various parts of the rice plant at different growth stages, with each sample tested in triplicate. RNA extraction from rice tissues (roots, stems, leaves, and panicles) was performed using the SDS-TRIZOL method.

[0041] The specific steps are as follows:

[0042] 1. Reagent preparation and sample preparation

[0043] SDS-buffer (50mM TRIS (pH 8.0), 150mM LiCl, 5mM EDTA (pH 8.0), 1% SDS) was prepared using DEPC water. The containers and pipette tips used were autoclaved. The corresponding samples were taken from the -80℃ freezer and placed on ice for later use. Then, they were put into 1.5mL RNA-free centrifuge tubes placed on ice. 50-100mg of sample was taken from each period.

[0044] 2. SDS-buffer extraction

[0045] Add 400 μL of SDS-buffer to the centrifuge tubes. Prepare a steel ball sterilized by high-temperature alcohol flame and add one ball to each centrifuge tube. Immediately place the tubes into a DNA extraction sample shaker and quickly crush the sample for 1 minute. Then add 800 μL of a phenol-chloroform mixture (phenol equilibrated in TRIS (pH 8.0)) (phenol to chloroform volume ratio 1:1), shake well, place on ice for 5 minutes, and centrifuge at 10,000 × g, 4 °C for 10 minutes. Transfer 500 μL of the supernatant to a new 1.5 mL RNA-Free centrifuge tube.

[0046] 3. TRIZOL extraction

[0047] Add 1 mL of TRIZOL extract to the sample; add 200 μL of chloroform, shake well, and incubate at room temperature for 3 min; centrifuge at 10,000 × g, 4 °C for 10 min.

[0048] 4. RNA precipitation

[0049] Carefully aspirate 500 μL of supernatant into a new 1.5 mL RNA-Free centrifuge tube, add 400 μL of isopropanol, mix by inverting the tube, and place on ice for 10 min; centrifuge at 10,000 × g, 4 °C for 10 min.

[0050] 5. RNA washing and dissolution

[0051] Carefully discard the supernatant, add 500 μL of 75% (volume percentage) ethanol (prepared with DEPC water), and gently suspend the RNA precipitate at the bottom; centrifuge at 10,000×g, 4℃ for 5 min, carefully discard the supernatant, centrifuge briefly again for 15 s, use an RNA-free pipette tip to remove the remaining liquid, and then place it in a clean bench to air dry; add 40 μL of DEPC water, and gently tap to promote the dissolution of the RNA precipitate.

[0052] 6. RNA digestion (removal of gDNA contamination)

[0053] The reaction system consisted of 40 μL of template RNA, 4.5 μL of 10× Buffer, and 4 μL of DNase I (RNase-Free). The reaction mixture was treated in a metal bath at 37°C for 30 min and then at 75°C for 5 min. The mixture was then stored at -80°C.

[0054] 7. Synthesis of first-strand cDNA

[0055] The extracted RNA samples were reverse transcribed using a reverse transcription kit from Beijing TransGen Biotech Co., Ltd., which effectively synthesized first-strand cDNA and minimized the probability of contamination during the experiment.

[0056] (1) Mix the system in Table 1 in a 0.2 mL centrifuge tube.

[0057] Table 1 System

[0058] Components Dosage RNase-freeWater 6μL Template RNA / mRNA 0.1 ng - 5 μg (2 μL) TransScriptRT / RIEnzymeMix 1μL <![CDATA[Oligo(dT) 18 ]]> 1μL 2×TSReactionMix 10μL

[0059] (2) Mix gently.

[0060] (3) Precautions:

[0061] ① If the reverse transcription product is used for PCR: place a 0.2 mL centrifuge tube at 42℃ for 30 min, and then heat at 85℃ for 5 s to inactivate the reverse transcriptase.

[0062] ② If the reverse transcription product is used for qPCR: place a 0.2 mL centrifuge tube at 42℃ for 30 min, and then heat at 85℃ for 5 s to inactivate the reverse transcriptase.

[0063] 8. Real-time quantitative PCR

[0064] The kit used was SYBR Green Real-time PCR Master Mix (Toyobo); the reaction system consisted of 10 μL of 2×SYBR Premix Ex Taq II, 2 μL of 10 μM PCR Forward Primer, 2 μL of 10 μM PCR Reverse Primer, 4 μL of cDNA template, and water to a final volume of 20 μL.

[0065] The PCR program was as follows: 95℃ for 30s, 95℃ for 5s, 60℃ for 30s, with a cycle count of 40; 95℃ for 15s, 60℃ for 1min, 95℃ for 15s.

[0066] 9. Results Analysis

[0067] The results of the real-time PCR experiment are based on 2 -△△CT The method was used for calculation and analysis, and the results showed that the OsPRMT6a gene exhibits tissue-specific expression, with the highest expression in the spike (e.g., Figure 1 (As shown).

[0068] Example 2

[0069] Recombinant primers were designed based on the sequence information of gene OsPRMT6a (accession number LOC_Os10g34740) provided by the Rice Gene Database (https: / / www.ricedata.cn / gene / ).

[0070] F:

[0071] R:

[0072] The underlined parts in italics represent the Kpn I restriction sites, while the bolded italic parts represent partial sequences on the vector.

[0073]

[0074] Using the pGWB4 vector as a template, and employing recombination primers:

[0075] F: CTTTCGCGAGCTCGGTACCATGGTGAGCAAGGGCGA, SEQ ID NO.12;

[0076] R: TGCAGGTCGACTCTAGAGGATCCCTTGTACAGCTCGTCCATGCC, SEQ ID NO. 13.

[0077] The EGFP fragment was amplified and then recombined into the pCAMBIA1300 vector, which had been linearized by double digestion with KpnI and BamHI, to obtain the recombinant vector named pCAMBIA1300-EGFP. A single KpnI digestion was then performed, and the fragment was recovered from the gel. Using the recombinant primers of SEQ ID NO.1 and SEQ ID NO.2, and with Nipponbare cDNA as a template, PCR amplification was performed. The cut and purified linearized vector was ligated to the PCR amplification product using homologous recombinase and transformed into *E. coli*. The correctly sequenced plasmid was transformed into *Agrobacterium tumefaciens* EHA105 and then injected into the lower epidermis of well-grown tobacco. The fluorescent expression sites were observed and photographed using a laser confocal microscope (Zeiss LSM 900). The specific operation steps are as follows:

[0078] 1. Amplification of the target fragment

[0079] Using the recombinant primers of SEQ ID NO.1 and SEQ ID NO.2, PCR amplification was performed with cDNA of Nipponbare rice as a template. A 50 μL system was prepared using the Taq enzyme method (HLINGENE), specifically: 20 μL Nuclease-free Water, 25 μL 2xNG PCR Master Mix, 2 μL Primer(F) (100 μM), 2 μL Primer(R) (100 μM), and 1 μL Template.

[0080] PCR program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 50℃ annealing for 45 sec, 72℃ extension for 12 sec, for a total of 30 cycles; final extension at 72℃ for 10 min, and storage at 16℃.

[0081] 2. Construction of recombinant vectors

[0082] This experiment used the homologous recombination ligase (ClonExpress II One Step Cloning Kit) from Nanjing Novizan Pharmaceutical Co., Ltd. Following the instructions, a 20 μL ligation system was constructed: 8 μL RNase-free Water, 3 μL linearized vector, 3 μL DNA fragment, 4 μL 5×CE II Buffer, and 2 μL Exnase I.

[0083] Gently pipette and mix the reaction mixture (do not vortex), then briefly centrifuge to collect the reaction solution to the bottom of the tube. After reacting at 37°C for 30 min in PCR, cool the reaction mixture to 4°C or immediately place it on ice to cool for later use.

[0084] 3. Escherichia coli transformation

[0085] Take DH5α competent E. coli cells at -80℃, thaw them on ice, add 10 μL of recombinant product, mix gently, place on ice for 30 min, then heat shock in a 42℃ water bath for 45 s, immediately place on ice for 2-3 min, add 700 μL of antibiotic-free LB medium (each LB solution contains: 10 g peptone, 5 g yeast extract, 10 g NaCl; if using solid medium, add 15 g agar), and incubate on a shaker at 37℃ for 1 h. Centrifuge the mixture containing bacteria (5,000 g, 1 min), discard 600 μL of supernatant, resuspend the cells in the remaining solution, and spread them on the corresponding antibiotic plates using sterile rods. Then invert the plates containing bacteria in an incubator at 37℃ for 14 h. Single clones were selected and cultured in LB liquid medium containing the corresponding antibiotics at 37°C until the bacterial culture became turbid. PCR detection was then performed on the turbid single-clone culture using recombinant primers, and the samples were sequenced to verify the presence of positive recombinant bacteria.

[0086] 4. Escherichia coli plasmid extraction

[0087] Plasmids were extracted from the correctly sequenced monoclonal positive recombinant bacterial cultures (the high-purity plasmid DNA mini-extraction kit (TSP501-50) from Beijing Qingke Company was used in this experiment). The operation steps are as follows:

[0088] (1) Add 250 μL of Buffer BL to the adsorption column and centrifuge at 12,000 g for 1 min to activate it;

[0089] (2) Take 4 mL of bacterial culture, centrifuge to collect the bacterial cells, and remove the supernatant;

[0090] (3) Add 250 μL of Buffer S1 to resuspend the bacterial cells until a sterile block is formed;

[0091] (4) Add 250 μL of Buffer S2 and gently agitate the mixture 6-8 times to fully decompose the bacteria;

[0092] (5) Add 350 μL of Buffer S3, gently agitate up and down 6-8 times, and centrifuge at 12,000g for 15 min;

[0093] (6) Aspirate the supernatant into the adsorption column and centrifuge at 12,000g for 1 min; discard the waste liquid, etc.

[0094] (7) Wash twice with 700 μL of Buffer W2;

[0095] (8) Allow to air for 2 minutes, then discard the waste liquid;

[0096] (9) Dry for 2 minutes, add 35-50 μL of Eluent, let stand for 2 minutes, centrifuge at 12,000g for 2 minutes, and centrifuge twice to collect more plasmid DNA.

[0097] 5. Agrobacterium-mediated transformation

[0098] Take EHA105 Agrobacterium competent cells at -80℃, thaw them on ice, add 10 μL of the plasmid to be transformed, mix gently, place on ice for 5 min, place in liquid nitrogen for 5 min, then incubate in a 37℃ water bath for 5 min, then in an ice bath for 5 min. Add 700 μL of antibiotic-free LB culture medium to a centrifuge tube, and incubate in a 28℃ water bath for 3 h. Centrifuge the mixture containing bacteria (5,000 g, 1 min), discard 600 μL of supernatant, resuspend the cells in the remaining solution, and take 100 μL of bacterial culture to spread evenly on the surface of the corresponding antibiotic-resistant LB solid plate. Seal the plate and invert it in a 28℃ incubator for 2 days.

[0099] 6. Instantaneous transformation of tobacco leaves

[0100] (1) Tobacco cultivation: Sow a few tobacco seeds, expose to light for 12 hours, and the experiment can be carried out after 1 month;

[0101] (2) Agrobacterium culture: Agrobacterium obtained from step 6 was cultured at 28℃ for 2 days;

[0102] (3) Culture of suspended Agrobacterium: scrape off the surface Agrobacterium from the solid culture dish with an inoculation loop, inoculate it into 10 mL of LB liquid medium containing the corresponding resistance, and culture at 170 rpm for 1 h;

[0103] (4) Collection of bacterial cells: Centrifuge at 5000 rpm for 5 min and discard the supernatant;

[0104] (5) Resuspension: Resuspend the bacterial cells together with a 10 mM MgCl2 suspension (containing 120 μM acetylsalicylic acid) and adjust to OD.600 Up to 0.6;

[0105] (6) Injection: Select tobacco plants with good growth conditions, inject the lower epidermis of tobacco leaves with a 1mL syringe, and mark them;

[0106] (7) Cultivation: Observe the tobacco plants after injection by culturing them under low light for 2 days;

[0107] (8) Observation: Take tobacco leaves inoculated with Agrobacterium, make glass slides, and observe and photograph them using a laser confocal microscope.

[0108] 7. Results show

[0109] Experimental results showed that Empty-GFP signal permeated the entire cell, while the Marker gene, as shown by RFP signal, overlapped with the OsPRMT6a-GFP signal in the merge field of view, indicating that the OsPRMT6a protein is subcellularly localized in the cell nucleus (e.g., ...). Figure 2 (As shown).

[0110] Example 3

[0111] Obtaining OsPRMT6a gene overexpression materials

[0112] To obtain OsPRMT6a gene overexpression material, Agrobacterium-mediated genetic transformation was used. The specific steps are as follows:

[0113] Design recombinant primers based on the sequence information of SEQ ID NO.3:

[0114] OsPRMT6a-OE-F: GTGTTACTTCTGCACTAGGTACCATGTTCGCCGGCGGC, SEQ ID NO.4;

[0115] OsPRMT6a-OE-R: TTAGAATTCCCGGGGATCCTTTCATCACCGATTCTTTAACATA CCATTGATCT, SEQ ID NO.5.

[0116] Using the aforementioned recombinant primers, PCR amplification was performed using cDNA from *Nipponbare* rice as a template. The resulting 1227 bp PCR product was ligated into the cut and purified linearized vector pCAMBIA1390ubi (with KpnI and BamHI restriction sites). This ligation was then performed on competent DH5α *E. coli* cells, plated on LB solid medium containing 50 μg / mL kanamycin, and incubated at 37°C for 14 h. Single colonies were picked and cultured in LB liquid medium containing kanamycin until the culture became turbid. PCR detection was then performed on the mixed single colonies using the recombinant primers. Positive recombinant bacteria were sent for sequencing verification. The correct vector was named pCAMBIA1390ubi-OsPRMT6a, which is the overexpression vector of the OsPRMT6a gene. Figure 3 pCAMBIA1390ubi-OsPRMT6a was transformed into competent Agrobacterium tumefaciens EHA105 cells. Then, the mixed monoclonal bacteria were tested by PCR again using recombinant primers to obtain positive strains. The strains were mailed at low temperature to a transgenic company for transgenic experiments. The recipient material was Nipponbare. The T0 generation transgenic line was obtained, which is the transgenic line overexpressing the OsPRMT6a gene.

[0117] Example 4

[0118] Identification of expression levels in transgenic lines overexpressing the OsPRMT6a gene

[0119] To further identify the overexpression transgenic lines (T0 generation transgenic lines) obtained above, the transgenic seedlings were cultured in a room temperature and light incubator for about one week, and then the positive seedlings were identified. The specific steps are as follows:

[0120] (1) Hygromycin resistance test method

[0121] Fresh green leaves, approximately 1-2 cm in length, were cut. Leaves from wild-type Nipponbare rice were used as a negative control. The leaves were placed upright in 2 mL centrifuge tubes containing approximately 1.8 mL of the test solution, prepared from 50 mg / L hygromycin aqueous solution and 0.5 mg / L 6-benzylaminopurine. The centrifuge tubes were placed horizontally on a fixed plate to ensure full contact between the test solution and the leaves. The incubator was turned on, and the light was set to 12 h light / 12 h dark, and the temperature was set to 28°C. The prepared samples were then placed in the incubator, and the color change of the leaves in the centrifuge tubes was observed periodically to determine the resistance level. Browning of non-GMO and non-resistant GMO rice leaves began on the second day at the cut site. The longer the browning occurred, the deeper and wider the browning area would extend along the veins. Therefore, large areas of brown lesions could be observed in about 4-5 days, forming a stark contrast with the fresh green of the resistant GMO rice leaves.

[0122] (2) DNA molecular level detection method

[0123] RNA was extracted from the overexpressing transgenic lines and reverse transcribed into cDNA for later use. Further qRT-PCR was performed (steps (7) and (8) of Example 1 were followed). The primers used were qRT-PRMT6aF and qRT-PRMT6aR, with the rice constitutive expression gene OsActin as an internal control. The primer sequences are as follows:

[0124] Actin-F: CCAATCGTGAGAAGATGACCCA, SEQ ID NO.6;

[0125] Actin-R: CCATCAGGAAGCTCGTAGCTCT, SEQ ID NO.7;

[0126] qRT-PRMT6aF: AGTGCGCCAGAGATCCAAGAAG, SEQ ID NO.8;

[0127] qRT-PRMT6aR:GATCTCTAGTAAAATATTTC, SEQ ID NO.9.

[0128] The results of the real-time PCR experiment are based on 2 -△△CT The expression levels of the OsPRMT6a gene were calculated and analyzed using the method. The results showed that the expression levels of the OsPRMT6a gene in the T0 generation transgenic lines numbered 3, 6, and 4 (3 and 6 were later designated OE-1 and OE-2) under the Nipponbare background were significantly higher than those in the wild type (e.g., ...). Figure 5 (As shown).

[0129] Example 5

[0130] OsPRMT6a gene expression abundance in various parts of Nipponbare.

[0131] 1. Obtaining GUS materials

[0132] pCAMBIA1305.1 was linearized by single digestion with the restriction endonuclease SpeI. The promoter of the target gene OsPRMT6a (approximately 2 kb upstream of the CDS start site) was amplified by PCR and homologously recombinated into the pCAMBIA1305.1 vector. The vector was then transformed into E. coli DH5α, plated, single clones were picked, sequenced, and finally, OsPRMT6a gene knockout transgenic material was obtained by Agrobacterium-mediated transformation. The recipient material was Nipponbare.

[0133] 2. GUS staining

[0134] This experiment used the SL7160GUS staining kit (1 mg / mL) from Beijing Coollab Technology Co., Ltd., and the following procedures were performed according to the kit's instructions:

[0135] (1) The rice tissue to be tested was soaked in GUS staining solution, wrapped in aluminum foil, and vacuumed for 1 hour. Then it was incubated in an oven at 37°C for 1 hour or overnight. As the incubation time increased, blue spots gradually appeared on the rice tissue, and the intensity of the blue color was proportional to the gene expression level.

[0136] (2) After dyeing, use 70% (volume percentage) alcohol to decolorize, changing the alcohol 2-3 times to remove impurities such as chlorophyll;

[0137] (3) Preserve the sample in alcohol and observe and photograph it using a stereomicroscope.

[0138] Staining results as follows Figure 4 As shown. By Figure 4 It was found that GUS activity was detected in leaves, spikes, and leaf sheaths, but its activity was lower in flag leaves and highest in leaf sheaths and young spikes. This result is consistent with... Figure 1 The spatiotemporal representation results are consistent.

[0139] Example 6

[0140] Construction of transgenic plants with the OsPRMT6a gene knocked out:

[0141] Design of knockout targets for the OsPRMT6a gene using the online website CRISPRdirect (http: / / crispr.dbcls.jp / ). Figure 6 Target 1: 5'-aggaatggggtctcctcctctgg-3', SEQ ID NO.10; Target 2: 5'-ctcctcgtggacgccgatgtggg-3', SEQ ID NO.11), and was sent to Changsha Qingke Biotechnology for primer synthesis. 5 μL of each of the synthesized primers was added to a 200 μL LEP tube, heated at 95℃ for 3 min in a PCR instrument, and then cooled to 25℃ at a rate of 0.2℃ / s to prepare the target primer dimers. The CRISPR / Cas vector was linearized using a cutting enzyme. Finally, the target primer dimers and the linearized CRISPR / Cas vector were reacted at 20℃ for 1 h, then transformed into E. coli, plated, and single clones were picked for sequencing. Strains with correct sequencing were then sent at low temperature to a transgenic company for the construction of knockout materials.

[0142] Example 7

[0143] Effects of OsPRMT6a gene overexpression transgenic lines on agronomic traits related to heading and yield in rice

[0144] Seeds from T0 generation transgenic lines numbered 3 and 6 were harvested and sown in the field to obtain transgenic lines overexpressing the OsPRMT6a gene. Simultaneously, transgenic plants with the OsPRMT6a gene knocked out and wild-type plants (NIP, WT) were sown, and conventional day length and water / fertilizer management were implemented. At the heading stage, transgenic lines overexpressing the OsPRMT6a gene, transgenic lines with the OsPRMT6a gene knocked out, and their wild-type plants were selected, and the onset of heading time was recorded. At maturity, lines with significantly increased OsPRMT6a gene expression and their corresponding wild-type plants were selected, and yield traits, grain length, grain width, and thousand-grain weight were recorded. Results showed that under the Nippon Sunshine (Japan's dry season) conditions, lines overexpressing the OsPRMT6a gene had a heading time approximately 7 days earlier than the wild type. Among yield-related agronomical traits, grain length, grain width, and thousand-grain weight were all increased compared to the wild type, with the increase in grain width being particularly significant (e.g., ...). Figures 7-12 ).

[0145] Example 8

[0146] 1. Scanning electron microscope sample preparation steps

[0147] (1) Take fresh rice samples and fix them with 2.5% glutaraldehyde (GA). After fixing at room temperature for 2 hours, store them at 4°C for an extended period. Place them on coverslips for cell culture, and discard the culture medium after the culture is complete. After gently rinsing with PBS, add PBS + electron microscopy fixative and fix at room temperature for 2 hours, then transfer to 4°C for storage. Take care to protect the scanning surface to avoid cell detachment due to vigorous shaking;

[0148] (2) Wash the fixed sample three times with 0.1M phosphate buffer (pH 7.4), 15 min each time. Then, prepare 1% osmium tetroxide and fix at room temperature in the dark for 1-2 h. Finally, wash three more times with 0.1M phosphate buffer (pH 7.4), 15 min each time.

[0149] (3) Dehydration was carried out with progressively stronger alcohol (30%-50%-70%-80%-90%-95%-100%-100%) and isoamyl acetate, each step lasting 15 min;

[0150] (4) Dry the sample in a critical point dryer;

[0151] (5) After attaching the conductive carbon film double-sided tape to the sample, place it on the sample stage of the ion sputtering instrument and perform gold sputtering for about 30 seconds to make it conductive.

[0152] (6) Observe the sample and take pictures under a scanning electron microscope.

[0153] 2. Staining steps for semi-thin sections

[0154] (1) Take 1 mm of the fresh tissue to be stained. 3 Large samples were fixed using a pre-prepared electron microscopy fixative and then evacuated using a vacuum pump until the sample settled to the bottom.

[0155] (2) The fixed sample was rinsed 2-3 times with 0.1M phosphate buffer (pH=7.4), each time for 15 minutes;

[0156] (3) Use gradually increasing alcohol concentrations (30%-50%-70%-80%-95%-100%-100%) to dehydrate at room temperature, with each step lasting 1 hour;

[0157] (4) Insert the sample into the embedding plate in an oven at 37°C for a long time;

[0158] (5) Place the embedding plate in a 60℃ oven for polymerization for 48 hours;

[0159] (6) Use a semi-thin slicer to slice the sample, each slice being approximately 1.5 μm thick, and attach it to the surface of a glass slide;

[0160] (7) Place the film in preheated toluidine blue staining solution for 2 minutes, then wash, differentiate, control the color, dry and seal.

[0161] The results are as follows Figures 13-15 As shown, scanning electron microscopy results indicate that the cells on the surface of OsPRMT6a-OE are relatively large ( Figure 13 Furthermore, at a field size of 10.3 mm × 100 LM, OsPRMT6a-OE had only 35 cells, significantly lower than wild-type and knockout mutants. Figure 14 Results from cross-sections of young spikelets showed ( Figure 15 Cells near the surface of the hull are widened in OsPRMT6a-OE, which is consistent with the results of scanning electron microscopy. Therefore, the inventors believe that overexpression of the OsPRMT6a gene will lead to the enlargement of cells on the surface of the grain hull, resulting in a larger grain width.

[0162] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the OsPRMT6a gene or biological materials containing the OsPRMT6a gene in regulating the heading time of rice, characterized in that, The nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO:

3.

2. The application according to claim 1, characterized in that, Overexpression of the OsPRMT6a gene advances the heading time of rice; inhibition of the OsPRMT6a gene delays the heading time of rice.

3. The application according to claim 1, characterized in that, The biomaterials include recombinant vectors or recombinant bacteria.

4. A method for advancing the heading time of rice, characterized in that, The method includes the step of overexpressing the OsPRMT6a gene in rice to advance the heading time of the rice; the nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO:

3.

5. A method for delaying the heading time of rice, characterized in that, The method includes the step of inhibiting the expression of the OsPRMT6a gene in rice to delay the heading time of rice; the nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO:

3.

6. The application of the OsPRMT6a gene or biological materials containing the OsPRMT6a gene in regulating rice grain weight, characterized in that, The nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO:

3.

7. The application according to claim 6, characterized in that, Overexpression of the OsPRMT6a gene increases rice grain weight; inhibition of the OsPRMT6a gene decreases rice grain weight.

8. The application according to claim 6, characterized in that, The biomaterials include recombinant vectors or recombinant bacteria.

9. A method for increasing rice grain weight, characterized in that, The method includes the step of overexpressing the OsPRMT6a gene in rice to increase the grain weight of the rice; the nucleotide sequence of the OsPRMT6a gene is shown in SEQ ID NO: 3.

Citation Information

Patent Citations

  • Proteins and biological materials related to rice (oryza sativa l.) yield, and use thereof in rice yield increase

    CA3198389A1

  • Protein arginine methyltransferase of Arabidopsis thalianum and its coding gene and application

    CN1888058A