Rape cadmium enrichment related gene and application thereof

Abstract

The invention discloses a rape cadmium enrichment related gene and application thereof, and belongs to the technical field of gene engineering and the field of heavy metal soil pollution remediation. According to the invention, on the basis of a CRISPR / Cas9 gene editing technology, a plurality of pairs of sgRNAs are utilized to edit two homologous copies BnABCG36.C06 and BnABCG36.A07 of a BnPDR8 / BnABCG36 gene in a receptor rape, so that a mutant rape strain with the BnPDR8 / BnABCG36 gene mutation is obtained. The stem part of the mutant rape is enriched with more cadmium under cadmium stress, and the heavy metal cadmium transport coefficient of the mutant rape is obviously higher than that of a wild type, so that the rape can be used as a good soil heavy metal pollution phytoremediation material, has good phytoremediation application potential, and has good application prospects. An effective strategy is provided for improving the plant heavy metal pollution remediation efficiency and the application level.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and the field of heavy metal soil pollution remediation, and relates to rapeseed cadmium enrichment-related genes and applications thereof. Background Art

[0002] With the development of the economy and the irrational discharge of industrial waste, soil pollution has become more and more prominent. Among them, a considerable part of the polluted farmland is still used to produce food for daily consumption, causing pollutants to accumulate through the food chain, posing a serious threat to human health.

[0003] Traditional soil physicochemical remediation methods mainly reduce the harm of heavy metals by reducing the concentration of pollutants in the soil or increasing their stability. For example, passivators are used to form complexes with heavy metals in the soil to reduce the absorption rate of heavy metals by crops. However, this type of remediation is prone to secondary pollution when exposed to long-term rainwater leaching. In comparison, phytoremediation is currently the only method that can reduce the total amount of heavy metals in the soil. Phytoremediation technology uses heavy metal hyperaccumulators to absorb heavy metals from the soil and accumulate them in the aboveground part, thereby effectively removing pollutants and avoiding secondary pollution. Subsequent treatment is also relatively easy.

[0004] Traditional heavy metal hyperaccumulators usually have a long growth cycle and limited biomass, resulting in slow remediation, and it may take decades or even hundreds of years to restore contaminated soil to background levels. Therefore, further research on the genetic pathways involved in heavy metal transport and detoxification mechanisms, and enhancing the remediation capacity of plants through bioengineering technology, especially creating heavy metal hyperaccumulators that grow rapidly, have large biomass, and have extensive heavy metal enrichment capabilities, is the key to solving technical defects and promoting the practical application of phytoremediation technology.

[0005] Rapeseed is the largest oil crop in terms of planting area and is also the largest oil crop. Its biomass and growth rate significantly exceed those of other common heavy metal hyperaccumulators, such as Sedum serrata and Centipede grass. In addition, rapeseed itself has a certain ability to adsorb heavy metals and is not strict with the planting environment. Even in heavy metal polluted areas, the edible value of its seeds will not be affected. Therefore, rapeseed has significant potential in the field of heavy metal contaminated soil remediation. Through bioengineering technologies such as genetic modification or gene editing, creating cabbage-type rapeseed specifically for soil heavy metal pollution remediation will have broad application prospects.

[0006] Plants show typical physiological and morphological changes under cadmium stress, including reduced plant height, yellowing leaves, and decreased yield. Cadmium is not an essential element for plant growth and metabolism, so plants usually reduce its toxic effects by chelating cadmium ions and dispersing them into various tissues. In plants, extracellular chelated cadmium ions need to rely on essential ion transporters or ion channels to enter the cells. Members of the transporter family, such as IRT, HMA, Nramp, and YSL, play an important role in this process, responsible for absorbing cadmium ions from the roots and transporting them to various parts of the plant.

[0007] ABC (ATP-binding cassette) family transporters are one of the most numerous and oldest protein families, and are involved in a variety of important physiological processes in plants. ABC transporters play a key role in maintaining metal homeostasis in plants. Pleiotropic drug resistance proteins (PDRs) in the ABCG subfamily are also part of the ABC family, and mainly play a role in protecting plants from external biotic and abiotic stresses. In addition, transporters in the PDR subfamily are also involved in the transport of heavy metals. Summary of the invention

[0008] The purpose of the present invention is to provide rapeseed cadmium enrichment-related genes and their application in cultivating transgenic rapeseed, which can enrich cadmium in soil, thereby realizing the restoration of heavy metal contaminated soil. The present invention uses emerging bioengineering technologies such as the CRISPR / Cas9 system to provide a new breeding method for preparing cabbage-type rapeseed specifically for soil heavy metal contamination.

[0009] In a first aspect, the present invention provides a rapeseed cadmium enrichment-related gene, wherein the rapeseed cadmium enrichment-related gene is BnABCG36.C06 and BnABCG36.A07, which are homologous genes to the gene BnPDR8 / BnABCG36;

[0010] The nucleotide sequence of BnABCG36.C06 is shown in SEQ ID NO.1;

[0011] The nucleotide sequence of BnABCG36.A07 is shown in SEQ ID NO.2.

[0012] Furthermore, the present invention knocks out rapeseed cadmium enrichment-related genes BnABCG36.C06 and BnABCG36.A07, thereby improving rapeseed's ability to accumulate heavy metal cadmium.

[0013] In a second aspect, the present invention provides a method for cultivating rapeseed with high enrichment of heavy metal cadmium, using the CRISPR / Cas9 system to edit BnABCG36.C06 and BnABCG36.A07 in rapeseed to obtain rapeseed with high enrichment of heavy metal cadmium.

[0014] Furthermore, the method for cultivating rapeseed with high accumulation of heavy metal cadmium according to the present invention specifically comprises the following steps:

[0015] s1. Design target sgRNA1-5 targeting BnABCG36.C06 and BnABCG36.A07, and synthesize and construct vector-related primers;

[0016] s2. Construction of CRISPR / Cas9 system;

[0017] s3. Extract plasmid and transform Agrobacterium;

[0018] s4. Transformation of rapeseed mediated by Agrobacterium;

[0019] s5. Harvesting transformed rapeseed seeds;

[0020] s6. After the seeds are screened for Hyg resistance, they are sown, the genomic DNA is extracted and the editing site sequence is verified to obtain rapeseed with high enrichment of heavy metal cadmium.

[0021] Furthermore, the nucleotide sequences of the target sgRNAs 1 to 5 described in the present invention are shown in SEQ ID NOs. 3 to 7.

[0022] Furthermore, the construction of the CRISPR / Cas9 system described in the present invention includes: based on the dicotyledon gene editing vector pHSE401, sgRNA1~5 are activated by the AtU6-26 Arabidopsis promoter, the Cas9 protein is activated by CaMV 35S, and the target sgRNA1~5 are inserted into the BsaI-BsaI restriction site of pHSE401.

[0023] Furthermore, the site of rapeseed mediated transformation by Agrobacterium in the present invention is the rapeseed hypocotyl.

[0024] Furthermore, the type of Agrobacterium described in the present invention is GV3101.

[0025] Furthermore, the rapeseed of the present invention is Brassica napus.

[0026] In a third aspect, the present invention provides an application of a rapeseed cadmium enrichment-related gene in breeding rapeseed varieties for remediation of cadmium-contaminated soil.

[0027] Furthermore, the present invention provides an application of a rapeseed cadmium enrichment-related gene in cultivating rapeseed varieties for remediating cadmium-contaminated soil, knocking out the genes BnABCG36.C06 and BnABCG36.A07, and improving the rapeseed's ability to enrich heavy metal cadmium in the soil.

[0028] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0029] The present invention is based on CRISPR / Cas9 gene editing technology, and uses multiple pairs of sgRNA to edit two homologous genes BnABCG36.C06 and BnABCG36.A07 of the BnPDR8 / BnABCG36 gene in the recipient rapeseed, and obtains a mutant rapeseed line with a mutation in the BnPDR8 / BnABCG36 gene. Compared with the gene editing recipient parent K407 (control group), the mutant rapeseed line enriched more cadmium in the aboveground part (stem) of the edited material under cadmium stress, and its heavy metal cadmium transport coefficient was significantly higher than that of the wild type (parent K407), indicating that the mutant rapeseed can be used as a good soil heavy metal pollution plant remediation material, has good plant remediation application potential, and provides an effective strategy for improving the efficiency and application level of plant heavy metal pollution remediation. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the dicot gene editing backbone vector pHSE401.

[0031] Figure 2 Schematic diagram of the process for constructing gene editing transformation vectors.

[0032] Figure 3 This is the distribution of target sequences sgRNA1 to 5 on two homologous genes of BnPDR8 / BnABCG36, BnABCG36.C06 and BnABCG36.A07.

[0033] Figure 4 Flow chart of preparing rapeseed gene-edited strains by hypocotyl genetic transformation method. Among them, a is the seed disinfection process; b is the seed germination process; c is the Agrobacterium preparation process; d is the strain pre-culture process; e is the Agrobacterium infection strain and co-cultivation process; f is the strain callus induction culture process; g is the strain stem germination process; h is the strain root germination process; i is the strain transplantation and greenhouse culture process.

[0034] Figure 5 The results of cadmium enrichment in gene-edited rapeseed are shown in Figure 1. Among them, a is the cadmium content of gene-edited rapeseed in culture medium; b is the transport coefficient of gene-edited rapeseed in culture medium; c is the cadmium enrichment of gene-edited rapeseed in culture medium; d is the cadmium content of gene-edited rapeseed in soil culture; e is the transport coefficient of gene-edited rapeseed in soil culture; f is the cadmium enrichment of gene-edited rapeseed in soil culture; WT is the wild type, and 8-26 and 8-42 are both gene-edited rapeseed. DETAILED DESCRIPTION

[0035] The technical scheme of the present invention is described below in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0036] Example 1

[0037] This example provides the editing and transformation of the related gene BnPDR8 / BnABCG36 and the construction and transformation of the vector.

[0038] 1. Design of sgRNA target sequence and synthesis of homologous recombination primers

[0039] The sequences of two homologous genes of BnPDR8 / BnABCG36, BnABCG36.C06 and BnABCG36.A07, were obtained through the rapeseed database BnIR (Brassica napus multi-omics information resource, https: / / yanglab.hzau.edu.cn / ), and the sequence registration numbers were BnaC06G0240100ZS and BnaA07G0222800ZS, respectively. The nucleotide sequence of BnaC06G0240100ZS is shown in SEQ ID NO.1, and the nucleotide sequence of BnaA07G0222800ZS is shown in SEQ ID NO.2. According to the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, universal target sgRNAs 1 to 5 that can simultaneously target BnABCG36.C06 and BnABCG36.A07 were designed with the help of the CRISPR online website (http: / / skl.scau.edu.cn / home / ). The specific sequences are shown in Table 1. The specific positions of universal target sgRNAs 1 to 5 in genes BnABCG36.C06 and BnABCG36.A07 are shown in Table 1. Figure 3 shown.

[0040] Table 1 Common target sgRNAs 1 to 5 targeting BnABCG36.C06 and BnABCG36.A07

[0041] Serial number name sequence SEQ ID NO.3 sgRNA1 CCAGCAGAAACCTCGAAGACATC SEQ ID NO.4 sgRNA2 GGTCACCTCCAAGAAAGACCAGG SEQ ID NO.5 sgRNA3 ATTGGGGTTGGAGCCTTGCTTGG SEQ ID NO.6 sgRNA4 GAGCAGCAGCTATTGTGATGAGG SEQ ID NO.7 sgRNA5 CTCATCGTCTATGCCATGGT

[0042] The designed sgRNA sequences were added with the sticky ends of the BsaI restriction site to obtain the corresponding homologous recombination primers, which were synthesized by Sangon.

[0043] 2. Construction of CRISPR / Cas9 final vector

[0044] The designed sgRNA1-5 primers were incubated at 65°C for 5 min and then diluted 10-fold for later use.

[0045] Prepare the dicot gene editing transformation vector pHSE401 (Addgene plasmid #62201, Figure 1 shown), refer to Figure 2 As shown in the flowchart, the vector pHSE401 was cut with BsaI, and the cut fragments were recovered. The cut plasmid and the diluted primer fragments were ligated overnight with T4 ligase, and the resulting vector was the CRISPR / Cas9 final vector. Specifically, sgRNA1~5 was initiated by AtU6-26 Arabidopsis promoter, Cas9 protein was initiated by CaMV 35S, and the target sequence sgRNA1~5 was inserted into the BsaI-BsaI cut site of the basic vector to obtain the CRISPR / Cas9 final vector. The heat shock method was used to transform the competent Escherichia coli, and after activation at 37℃ for 60min, it was spread on the resistant solid medium and cultured for 12h. The monoclonal colony was picked and shaken, and then the positive plasmid was verified by bacterial liquid PCR with universal primers M13-F and gRNAScfd-R and sent for sequencing.

[0046] 3. Vector Agrobacterium Transformation

[0047] Take the Escherichia coli carrying the positive plasmid in step 2, shake it overnight, extract the positive plasmid with a plasmid extraction kit, and introduce it into the Agrobacterium competent GV3101 by electroporation, and then culture it on a solid medium resistant to rifampicin and kanamycin at 28°C for 2-3 days, then pick a single clone GV3101 strain, shake it small, perform PCR on the GV3101 bacterial solution and send it for sequencing verification, add glycerol to the final positive GV3101 strain shake to a glycerol concentration of 25%, and store it at -80°C.

[0048] Example 2

[0049] This embodiment provides the creation of rapeseed gene-edited strains using hypocotyl genetic transformation.

[0050] The specific operation of preparing rapeseed gene-edited lines by hypocotyl genetic transformation is as follows: Figure 4 The gene editing recipient parent of this example is Brassica napus K407.

[0051] 1. Seed disinfection

[0052] (1) Place the selected plump seeds into a sterilized flask and soak them in deionized water for 20 minutes. In a clean bench, disinfect the soaked seeds with 75% ethanol for 30 seconds, and then disinfect the seeds with 1.5% to 2.5% sodium hypochlorite solution for 10 minutes. During the disinfection, the flask needs to be shaken continuously.

[0053] (2) After disinfection, pour off the sodium hypochlorite solution and rinse the seeds with 75 mL of sterile deionized water for 5 min, vibrating during the rinsing process to ensure that there is no residual disinfectant on the surface of the seeds;

[0054] (3) After discarding the rinse water, add 50 mL of sterile water and rinse quickly for 1 min. Repeat the operation 4 times until the disinfectant and other impurities on the seed surface are completely removed;

[0055] (4) Place the sterilized and rinsed seeds in a Petri dish containing sterilized filter paper, use aseptic operation to blow dry the moisture on the surface of the seeds, and then transfer them to another new Petri dish containing filter paper and further blow dry them on an ultra-clean workbench.

[0056] 2. Seed germination

[0057] (1) Use a flame-sterilized tweezer (make sure the surface of the tweezer is sterile) to transfer the sterilized and disinfected seeds to the seed germination medium M0. The seed germination medium M0 is 1 / 2MS + 20g / L sucrose + 10g / L agar. Place about 30 seeds in each seed germination medium M0. This step needs to be performed under sterile conditions to avoid contamination of the seeds by microorganisms. Open the lid of the seed germination medium M0 containing the seeds and place it in the culture box.

[0058] (2) Place the culture box in the dark or under light conditions and allow the seeds to germinate at a temperature range of 22 to 25°C. Allow the seeds to germinate under the above conditions for 4 days.

[0059] 3. Preparation of Agrobacterium

[0060] (1) Prepare Agrobacterium tumefaciens 2 days after seed germination. Use the GV3101 strain containing the gene editing vector, streak it onto a solid medium containing 100 μg / mL rifampicin and 50 μg / mL kanamycin, and culture it at 28°C for 2 days.

[0061] (2) The positive monoclonal GV3101 bacterial suspension was inoculated into 100 mL of YEP medium containing 100 μg / mL rifampicin and 50 μg / mL kanamycin, and cultured at 28°C and 220 rpm for 36 h. The OD value at 600 nm was measured using a spectrophotometer;

[0062] (3) Centrifuge at 5000 rpm for 10 min at room temperature, discard the supernatant, add acetosyringone (AS, 50 mg / mL) to DM medium to rinse the precipitated Agrobacterium GV3101 cells to obtain an Agrobacterium GV3101 suspension. The DM medium is MS liquid + 30 g / L sucrose.

[0063] 4. Pre-culture

[0064] Remove the hypocotyl, that is, open the culture box and take the cotyledon petiole of the seedling at 4 days old. After cutting off the buds with scissors, cut off all the petioles, clamp the petiole with tweezers and use a scalpel to cut it into 8mm to 10mm petiole.

[0065] 5. Infection and Co-cultivation of Agrobacterium

[0066] The end of the cotyledon petiole explant was placed in the Agrobacterium GV3101 suspension for 15 minutes. After the bacterial solution was removed on the sterilized filter paper, the cotyledon petiole explant was placed on the M1 medium. The number of cotyledon petiole explants on each M1 medium was about 30. Among them, the composition of the M1 medium was MS+18g / L mannitol+30g / L sucrose+8g / L Agar+1mg / L 2,4D+0.3mg / L KT. The M1 medium containing the cotyledon petiole explant was placed in the dark for 2 days at a culture temperature of 22-25°C.

[0067] 6. Callus Induction Culture

[0068] (1) Place the cotyledon petiole explants cultured for 2 days in step 5 in a sterilized Erlenmeyer flask, add 100 mL of sterile water, rinse for 5 minutes, and repeat the washing three times with new sterile water.

[0069] (2) Wash again with sterile water containing carbenicillin (500 mg / L) for 10 min, dry the surface water, and then insert the cotyledon petiole explants into callus induction medium M2. The number of cotyledon petiole explants inserted into each callus induction medium M2 is 40, and culture for 20 days. The composition of callus induction medium M2 is: M1 + 5 mg / L STS + 300 mg / L TMT + 25 mg / L Hyg (hygromycin).

[0070] 7. Stem Sprouting

[0071] Use sterile tweezers to transfer the cotyledon petiole explants after callus induction culture into stem germination medium M4 containing 5 mg / L Hyg, and culture them at 25°C for 3 to 4 weeks under light to obtain green seedlings. The composition of stem germination medium M4 is: 1 / 2MS+20g / L sucrose+0.1mg / L NAA+8g / L Agar+200mg / L TMT.

[0072] 8. Root sprouting

[0073] Use sterile tweezers to transfer the green seedlings into a root germination culture container containing M4 medium, and ensure that the base of the green seedlings is placed in the center of the M4 medium and in good contact with the M4 medium. Then, the root germination culture container is cultured at 25°C for 1 to 2 weeks under light to obtain plants.

[0074] 9. Transplanting and greenhouse cultivation

[0075] (1) Remove the plant with tweezers and rinse it with tap water to remove the agar. Use tweezers to make a small hole in the nutrient soil, place the root of the plant in it, cover it with nutrient soil and gently compact the nutrient soil around the root of the plant. Then cover the plant with a layer of plastic film to keep it moist and warm.

[0076] (2) The seeds harvested from all plants were collected, screened with Hyg resistance medium, and then sown for reproduction. Genomic DNA was extracted from leaves at the seedling stage and the editing site sequence was verified by PCR. Finally, the target gene-edited rapeseed was obtained and recorded as PDR8.

[0077] Example 3

[0078] This example provides the cadmium accumulation ability of gene-edited rapeseed.

[0079] 1. Cadmium accumulation in gene-edited rapeseed under culture medium

[0080] The T1 generation seeds of gene-edited rapeseed were disinfected with 75% alcohol solution for 30s and 2% sodium hypochlorite solution for 10min, then sown in 1 / 2MS screening medium containing 25mg / L Hyg. After culturing in a dark environment for 2d, the gene-edited rapeseed was transferred to the culture room for 5d. Among them, the culture room environment was set at 25℃, and the light time and dark time were 2:1, that is, 16h of light + 8h of darkness. Gene-edited rapeseed with similar growth conditions was selected as the experimental group, and the gene-edited receptor parent Brassica napus K407 was selected as the control group. The rapeseed in the experimental group and the control group were cultured in a square dish containing 200μm / L cadmium. After 7 days of growth, the roots and stems of the gene-edited rapeseed were collected, and the cadmium enrichment of the gene-edited rapeseed was measured and analyzed using a flame atomic absorption spectrophotometer.

[0081] 2. Cadmium accumulation in gene-edited rapeseed under soil culture

[0082] The T1 generation seeds of gene-edited rapeseed were disinfected with 75% alcohol solution for 30s and 2% sodium hypochlorite solution for 10min, then sown in 1 / 2MS screening medium containing 25mg / L Hyg. After culturing in a dark environment for 2d, the gene-edited rapeseed was transferred to the culture room for 5d. Among them, the culture room environment was set at 25℃, and the light time and dark time were 2:1, that is, 16h of light + 8h of darkness. Then the gene-edited rapeseed was transferred to the nutrient soil for 20d. The gene-edited rapeseed with similar growth conditions was selected as the experimental group, and the gene-edited receptor parent Brassica napus K407 was selected as the control group. The rapeseed in the experimental group and the control group were irrigated with 200μm / L cadmium solution. After 14d of cultivation, the roots and stems of the gene-edited rapeseed were collected, and the cadmium enrichment of the gene-edited rapeseed was measured and analyzed using a flame atomic absorption spectrophotometer.

[0083] 3. Determination of cadmium content in rapeseed tissue by flame atomic absorption spectrophotometer

[0084] (1) Pretreatment of test equipment

[0085] Soak volumetric flasks, small funnels, pipettes and other containers in an aqueous solution containing 10% dilute nitric acid for more than 48 hours, then wash them with deionized water 2 to 3 times, and dry them for use.

[0086] (2) Sample digestion

[0087] The roots and stems of the collected gene-edited rapeseed were completely dried, weighed (0.25 g) and numbered, and then placed in the corresponding digestion tube according to the number, and 5 mL of concentrated nitric acid was added and left to stand overnight. The digestion tube was first digested at 60 ° C for 1 hour, and then digested at 120 ° C for 3 hours. After the digestion was completed, 1 mL of hydrogen peroxide solution was added to the digestion tube after it was cooled to room temperature, and digested at 120 ° C for 1 hour, and repeated twice. The digestion tube was acid-dried at 150 ° C to 180 ° C, and the liquid content in the digestion tube was observed after 15 minutes. The acid-dried tube was stopped when the liquid content in the digestion tube was about 500 μL. The remaining solution was diluted to a 500 mL centrifuge tube and filtered with qualitative filter paper to obtain the test solution.

[0088] (3) Determination of cadmium content

[0089] Separately transfer the standard solution and the solution to be tested into 50 mL centrifuge tubes, determine the corresponding absorbance values ​​on a flame atomic absorption spectrophotometer, and substitute the obtained absorbance values ​​into the standard curve to obtain the cadmium content of the solution to be tested.

[0090] 4. Analysis of cadmium accumulation in gene-edited rapeseed

[0091] Figure 5Figure a shows the cadmium content in the aboveground stems of gene-edited rapeseed cultured in culture medium. The cadmium content in the aboveground stems of PDR8-42 was 1.56 times that of the wild type, and PDR8-26 was also significantly higher than that of the wild type. Figure 5 b analyzed the transport coefficient of gene-edited rapeseed (cadmium content in aboveground stems / cadmium content in underground roots). The transport coefficient of gene-edited rapeseed PDR8-26 and PDR8-42 was significantly higher than that of wild materials, among which the transport coefficient of PDR8-42 was about 2.3 times that of the wild type, and the transport coefficient of PDR8-26 was about 1.6 times that of the wild type. Figure 5 In c, through the analysis of single plant enrichment, the single plant enrichment of PDR8-26 was about 1.37 times that of the wild material, and PDR8-42 was also significantly higher than the wild material. The above data show that gene-edited rapeseed showed stronger cadmium enrichment ability under culture medium.

[0092] Figure 5 In the figure, the cadmium content in the aboveground stems of gene-edited rapeseed PDR8-26 under soil culture conditions was 1.4 times that of the wild type, which was 1.32 times better than that of PDR8-42, and its transport coefficient was also significantly higher than that of the wild type by 1.9 times ( Figure 5 e), which is 1.69 times better than that of PDR8-42; the enrichment of individual plants was more obvious in PDR8-42 than in the wild type ( Figure 5 f), which is 1.56 times that of the wild type. In summary, the gene-edited rapeseed under soil culture conditions showed a stronger cadmium enrichment ability, and the results were consistent with those of the gene-edited rapeseed under culture medium conditions.

[0093] The embodiments described above are part of the embodiments of the present invention, but not all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but only represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. A gene related to cadmium accumulation in rapeseed, characterized in that: The rapeseed cadmium enrichment-related genes are BnABCG36.C06 and BnABCG36.A07, which are homologous genes to the gene BnPDR8 / BnABCG36; The nucleotide sequence of BnABCG36.C06 is shown in SEQ ID NO.1; The nucleotide sequence of BnABCG36.A07 is shown in SEQ ID NO.

2.

2. The rapeseed cadmium accumulation-related gene according to claim 1, characterized in that: Knocking out rapeseed cadmium-accumulation-related genes BnABCG36.C06 and BnABCG36.A07 improved rapeseed's ability to accumulate heavy metal cadmium.

3. A method for cultivating rapeseed with high accumulation of heavy metal cadmium, characterized in that: The CRISPR / Cas9 system was used to edit BnABCG36.C06 and BnABCG36.A07 in rapeseed to obtain rapeseed with high accumulation of heavy metal cadmium.

4. The method according to claim 3, characterized in that: The method specifically comprises the following steps: s1. Design target sgRNA1-5 targeting BnABCG36.C06 and BnABCG36.A07, and synthesize and construct vector-related primers; s2. Construction of CRISPR / Cas9 system; s3. Extract plasmid and transform Agrobacterium; s4. Transformation of rapeseed mediated by Agrobacterium; s5. Harvesting transformed rapeseed seeds; s6. After the seeds are screened for Hyg resistance, they are sown, the genomic DNA is extracted and the editing site sequence is verified to obtain rapeseed with high enrichment of heavy metal cadmium.

5. The method according to claim 4, characterized in that The nucleotide sequences of the target sgRNAs 1 to 5 are shown in SEQ ID NOs. 3 to 7; The construction of the CRISPR / Cas9 system includes: based on the dicotyledon gene editing vector pHSE401, sgRNA1-5 are activated by the AtU6-26 Arabidopsis promoter, Cas9 protein is activated by CaMV 35S, and the target sgRNA1-5 are inserted into the BsaI-BsaI restriction site of pHSE401.

6. The method according to claim 4, characterized in that The site of the rapeseed mediated by Agrobacterium is the rapeseed hypocotyl.

7. The method according to claim 4, characterized in that The type of Agrobacterium is GV3101.

8. The method according to claim 4, characterized in that The rapeseed is Brassica napus.

9. Application of a rapeseed cadmium enrichment-related gene in breeding rapeseed varieties for remediation of cadmium-contaminated soil.

10. The use according to claim 9, characterized in that: Knocking out rapeseed cadmium enrichment-related genes BnABCG36.C06 and BnABCG36.A07 improved rapeseed's ability to accumulate heavy metal cadmium in the soil.

Images