Treatment of amyotrophic lateral sclerosis (ALS)

Abstract

The present invention relates to AAVs encoding polynucleotides targeting SOD1, which are useful in the treatment of amyotrophic lateral sclerosis (ALS) and / or canine degenerative spinal cord disease (DM).

Description

[0001] This application is a divisional application of application number 201880081098.4, filed on October 16, 2018, and the invention name is “Treatment of Amyotrophic Lateral Sclerosis (ALS)”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of Provisional Patent Application No. 62 / 572,702, filed October 16, 2017, entitled “Treatment of Amyotrophic Lateral Sclerosis (ALS),” the contents of which are incorporated herein by reference in their entirety.

[0004] Reference Sequence Listing

[0005] This application is filed with a sequence listing in electronic format. The sequence listing is provided as a file titled "20571047PCTSL.txt," which was created on October 16, 2018 and is 93,286 bytes in size. The electronic form of the sequence listing is incorporated herein by reference in its entirety. Field of the Invention

[0006] The present invention relates to compositions of polynucleotides, methods and processes for designing, preparing, manufacturing and / or formulating the polynucleotides, comprising an AAV vector, a small interfering RNA (siRNA) duplex, shRNA, microRNA or a precursor thereof, which targets the superoxide dismutase 1 (SOD1) gene or encodes a molecule targeting the superoxide dismutase 1 (SOD1) gene to interfere with SOD1 gene expression and / or SOD1 enzyme production. In some embodiments, the polynucleotide is inserted into a recombinant adeno-associated virus (AAV) vector. Also disclosed is a method for inhibiting SOD1 gene expression in a subject suffering from a neurodegenerative disease. The method optionally introduces at least one polynucleotide into a subject suffering from the neurodegenerative disease. In particular, the disease is amyotrophic lateral sclerosis (ALS). Background of the Invention

[0008] Amyotrophic lateral sclerosis (ALS), also known as Lou Gehrig's disease, is a fatal progressive neurodegenerative disease characterized by the massive loss of motor neurons (MNs) in the primary motor cortex, brainstem, and spinal cord. The loss of motor neurons disrupts basic fundamental movements, such as breathing, and typically results in death within 2 to 5 years of diagnosis. The progressive deterioration of motor function in patients severely impairs their ability to breathe, requiring some form of respiratory assistance to keep them alive. Other symptoms include weakness in the hands, arms, legs, or swallowing muscles. Some patients (e.g., FTD-ALS) may also develop frontotemporal dementia.

[0009] According to the ALS Association, approximately 5,600 people are diagnosed with ALS each year in the United States. The incidence of ALS is 2 per 100,000 people, and it is estimated that at any given time, as many as 30,000 Americans may have the disease.

[0010] Two forms of ALS have been described: sporadic ALS (sALS), which is the most common form of ALS in the United States, accounting for 90% to 95% of all diagnosed cases. The other is familial ALS (fALS), which occurs primarily in families, has dominant inheritance, and accounts for only about 5% to 10% of all cases in the United States. sALS and fALS are clinically indistinguishable.

[0011] Pathological studies have shown that certain cellular processes occur after disease onset, including increased endoplasmic reticulum stress, free radical (i.e., reactive oxygen species (ROS)) generation, mitochondrial dysfunction, protein aggregation, apoptosis, inflammation, and glutamate excitotoxicity, particularly in motor neurons (MNs).

[0012] The causes of ALS are complex and diverse. Generally, ALS is considered a complex genetic disease in which a combination of multiple genes and environmental exposures predisposes a person to susceptibility. More than a dozen genes have been found to be associated with ALS, including SOD-1 (Cu 2+ / Zn 2+ The mitochondrial apoptosis is symptomatic, with the onset of symptomatic motor neuron degeneration (MND) occurring in 142 samples of the mitochondrial apoptosis factor α (MTSA), 147 ...

[0013] Currently, there is no curative therapy for ALS. The only drug approved by the FDA is riluzole, which antagonizes glutamate reactions to reduce the pathological development of ALS. However, only about three months of life extension has been reported for ALS patients in the early stages, while no therapeutic benefit has been observed in ALS patients in the late stages, which indicates that patients lack treatment options (Bensimon G et al., J Neurol. 2002, 249, 609-615). Therefore, there is still a need for new treatment strategies that can effectively prevent the progression of the disease.

[0014] I-type Cu 2+ / Zn 2+Mutations in the superoxide dismutase (SOD1) gene are the most common cause of fALS, accounting for approximately 20% to 30% of all fALS cases. Recent reports suggest that approximately 4% of all sALS cases may also be associated with SOD1 mutations (Robberecht and Philip, Nat. Rev. Neurosci., 2013, 14, 248-264). fALS associated with SOD1 is very likely not caused by the loss of normal SOD1 activity, but rather by the acquisition of toxic functions. One hypothesis for fALS toxicity associated with mutant SOD1 suggests that abnormal SOD1 enzymes cause small molecules, such as peroxynitrite or hydrogen peroxide, to produce destructive free radicals. Other hypotheses for mutant SOD1 neurotoxicity include inhibition of proteasome activity, mitochondrial damage, disruption of RNA processing, and the formation of intracellular aggregates. Abnormal accumulation of mutant SOD1 variants and / or wild-type SOD1 in ALS forms insoluble fibrillar aggregates that are identified as pathological inclusion bodies. Aggregated SOD1 protein can induce mitochondrial stress (Vehvilainen P et al., Front Cell Neurosci., 2014, 8, 126) and other toxicities to cells, especially motor neurons.

[0015] These findings suggest that SOD1 may be a potential therapeutic target for familial and sporadic ALS. Therapies that can reduce the SOD1 protein (whether wild type or mutant) produced in the central nervous system of ALS patients may alleviate the patient's ALS symptoms, such as motor neuron degeneration, muscle weakness and atrophy. Reagents and methods designed to prevent the aggregation of wild type and / or mutant SOD1 proteins can prevent disease progression and improve ALS symptoms. RNA interference (RNAi)-mediated gene silencing has attracted the interest of researchers in recent years. The art has taught the potential of small double-stranded RNA (small interfering RNA) molecules targeting the SOD1 gene in treating ALS (see, for example, U.S. Patent No. 7,632,938 and U.S. Patent Publication No. 20060229268).

[0016] The present invention develops an RNA interference or knockdown-based approach to inhibit or prevent the expression of the SOD1 gene in ALS patients to treat the disease.

[0017] The present invention provides novel polynucleotides, including double-stranded RNA (dsRNA) constructs and / or siRNA constructs, shRNA constructs and / or microRNA constructs and methods for designing the same. Additionally, these siRNA constructs can be synthetic molecules encoded in expression vectors (one or two strands) for delivery to cells. Such vectors include, but are not limited to, adeno-associated viral vectors, such as vector genomes of any AAV serotype, or other viral delivery vectors, such as lentiviruses. Summary of the Invention

[0018] The present invention provides an AAV vector encoding a polynucleotide targeting SOD1 to interfere with SOD1 gene expression and / or SOD1 protein production and a method for using the same. The present invention also includes a method for treating motor neuron degenerative diseases such as amyotrophic lateral sclerosis.

[0019] In one embodiment, SOD1 is suppressed by 30% in subjects treated with AAV encoding a polynucleotide targeting SOD1 compared to untreated subjects. The AAV can be administered to the subject as an infusion or bolus at a predetermined dose level. As a non-limiting example, suppression is seen in the C1 to L7 ventral horn region.

[0020] The present invention relates to gene-specific interference with gene expression and protein production mediated by RNA molecules. The present invention also includes methods for treating motor neuron degenerative diseases such as amyotrophic lateral sclerosis. The siRNA included in the compositions characterized herein comprises a dsRNA having an antisense strand (antisense strand) having a region of 30 nucleotides or less, typically 19-24 nucleotides in length, that is substantially complementary to at least a portion of an mRNA transcript of the SOD1 gene.

[0021] The present invention provides short double-stranded RNA molecules, such as small interfering RNA (siRNA) duplexes, that target SOD1 mRNA to interfere with SOD1 gene expression and / or SOD1 protein production. The siRNA duplexes of the present invention can interfere with both alleles of the SOD1 gene, regardless of any specific mutation in the SOD1 gene, and can particularly interact with those found in ALS disease.

[0022] In some embodiments, such siRNA molecules or single strands of siRNA molecules are inserted into an adeno-associated viral vector for introduction into cells, particularly motor neurons and / or other peripheral cells in the central nervous system.

[0023] The siRNA duplex of the present invention comprises an antisense strand and a sense strand, which hybridize together to form a duplex structure, wherein the antisense strand is complementary to the nucleic acid sequence of the targeted SOD1 gene, and wherein the sense strand is homologous to the nucleic acid sequence of the targeted SOD1 gene. In some aspects, the 5' end of the antisense strand has a 5' phosphate group, and the 3' end of the sense strand has a 3' hydroxyl group. In other aspects, the 3' end of each strand has no overhang or has an overhang of one or two nucleotides.

[0024] According to the present invention, each strand of the siRNA duplex targeting the SOD1 gene is about 19-25 nucleotides in length, preferably about 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides in length. In some aspects, the siRNA can be an unmodified RNA molecule.

[0025] In other aspects, the siRNA can comprise at least one modified nucleotide, such as a base, sugar, or backbone modification.

[0026] In one embodiment, the siRNA or dsRNA comprises at least two sequences that are complementary to each other. The dsRNA comprises a sense strand having a first sequence and an antisense strand having a second sequence. The antisense strand comprises a nucleotide sequence that is substantially complementary to at least a portion of an mRNA encoding SOD1, and the region of complementarity is 30 nucleotides or less in length, and at least 15 nucleotides in length. Typically, the dsRNA is 19 to 24 nucleotides in length, for example, 19 to 21 nucleotides in length. In some embodiments, the dsRNA is about 15 to about 25 nucleotides in length, and in other embodiments, the dsRNA is about 25 to about 30 nucleotides in length.

[0027] The dsRNA, upon contact with or transcription within a cell expressing SOD1, inhibits or suppresses expression of the SOD1 gene by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% or more, e.g., when measured by the methods described herein.

[0028] According to the present invention, an AAV vector comprising a nucleic acid encoding a siRNA duplex targeting the SOD1 gene, one strand of the siRNA duplex, or a dsRNA is produced, and the serotype of the AAV vector can be AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV A AV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AA A AV2-3 / rh.61, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-9 / rh.52, AAV3-11 / rh.53, AAV4-8 / r11.64, AAV4-9 / rh.54, AAV4-19 / r h.55, AAV5-3 / rh.57, AAV5-22 / rh.58, AAV7.3 / hu.7, AAV16.8 / hu.10, AAV16.12 / hu.11, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV106.1 / hu.37, AAV114.3 / hu .40, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV161.10 / hu.60,AAV161.6 / hu.61、AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu.16、AAV52 / hu.19、AAV52.1 / hu.20、AAV58.2 / hu.25、AAV3.3、AAV3.4、AAVA3.5 A3.7、AAVC1、AAVC2、AAVC5、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAVH2、AAVrh.72、AAVhu.8、AAVrh.68、AAVrh.70、AAVpi.1、AAVpi.3、AAVpi.2、AAVrh.60、AAVrh. AVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVH6、AAVLK03、AAVH-1 / hu.1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVH. AVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVcy. VCy.5R4、AAVcy.6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、AAVhu.15、AAVhu.16、 AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu. .32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.4 5、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AAVhu.58, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.14 / 9, AAVhu.t19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuttle 100-1, AAV Shuttle 100-3, AAV Shuttle 100-7, AAV Shuttle 10-2, AAV Shuttle 10-6, AAV Shuttle 10-8, AAV Shuttle 100-2, AAV SM10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.AAV CKd-B4、AAV CKd-B5、AAV CKd-B6、AAV CKd-B7、AAV CKd-B8、AAV CKd-H1、AAVCKd-H2、AAV CKd-H3、AAV CKd-H4、AAV CKd-H5、AAV CKd-H6、AAV CKd-N3、AAV CKd-N4、AAVCKd-N9、AAV CLg-F1、AAV CLg-F2、AAV CLg-F3、AAV CLg-F4、AAV CLg-F5、AAV CLg-F6、AAVCLg-F7、AAV CLg-F8、AAV CLv-1、AAV CLv1-1、AAV Clv1-10、AAV CLv1-2、AAV CLv-12、AAVCLv1-3、AAV CLv-13、AAV CLv1-4、AAV Clv1-7、AAV Clv1-8、AAV Clv1-9、AAV CLv-2、AAVCLv-3、AAV CLv-4、AAV CLv-6、AAV CLv-8、AAV CLv-D1、AAV CLv-D2、AAV CLv-D3、AAV CLv-D4、AAV CLv-D5、AAV CLv-D6、AAV CLv-D7、AAV CLv-D8、AAV CLv-E1、AAV CLv-K1、AAV CLv-K3、AAV CLv-K6、AAV CLv-L4、AAV CLv-L5、AAV CLv-L6、AAV CLv-M1、AAV CLv-M11、AAV CLv-M2、AAV CLv-M5、AAV CLv-M6、AAV CLv-M7、AAV CLv-M8、AAV CLv-M9、AAV CLv-R1、AAVCLv-R2、AAV CLv-R3、AAV CLv-R4、AAV CLv-R5、AAV CLv-R6、AAV CLv-R7、AAV CLv-R8、AAVCLv-R9、AAV CSp-1、AAV CSp-10、AAV CSp-11、AAV CSp-2、AAV CSp-3、AAV CSp-4、AAV CSp-6、AAV CSp-7、AAV CSp-8、AAV CSp-8.10、AAV CSp-8.2、AAV CSp-8.4、AAV CSp-8.5、AAVCSp-8.6、AAV CSp-8.7、AAV CSp-8.8、AAV CSp-8.9、AAV CSp-9、AAV.hu.48R3、AAV.VR-355、AAV3B、AAV4、AAV5、AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF1 6 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, AAVF9 / HSC9, AAV-PHP.B, AAV-PHP.A, G2B-26, G2B-13, TH1.1-32, TH1.1-35, AAVPHP.B2, AAVPHP.B3, AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B-ATP, AAVPH P.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP, AA VPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAV PHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP .B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3, AAVG2B4, AAVG2B5 and their variants. ,

[0029] According to the present invention, the siRNA duplex or dsRNA targeting the SOD1 gene in ALS is selected from the siRNA duplexes listed in Table 4. Preferably, the siRNA duplex or dsRNA targeting the SOD1 gene in ALS is selected from the group consisting of siRNA duplexes D-4000 to D-4025.

[0030] The present invention also provides a pharmaceutical composition comprising at least one siRNA duplex targeting the SOD1 gene and a pharmaceutically acceptable carrier. In some aspects, the nucleic acid sequence encoding the siRNA duplex is inserted into an AAV vector.

[0031] In some embodiments, the present invention provides methods for inhibiting / silencing SOD1 gene expression in cells. Thus, siRNA duplexes or dsRNA can be used to substantially inhibit SOD1 gene expression in cells, particularly motor neurons. In some aspects, inhibition of SOD1 gene expression refers to inhibition by at least about 20%, preferably at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%. Thus, the protein product of the targeted gene can be inhibited by at least about 20%, preferably at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%. The SOD1 gene can be a wild-type gene or a mutant SOD1 gene having at least one mutation. Thus, the SOD1 protein is a wild-type protein or a mutant polypeptide having at least one mutation.

[0032] In some embodiments, the present invention provides a method for treating or improving amyotrophic lateral sclerosis associated with an abnormal SOD1 gene and / or SOD1 protein in a subject in need of treatment, the method comprising administering to the subject a pharmaceutically effective amount of at least one siRNA duplex targeting the SOD1 gene, delivering the siRNA duplex to target cells, inhibiting SOD1 gene expression and protein production, and improving the symptoms of ALS in the subject.

[0033] In some embodiments, an AAV vector comprising a nucleic acid sequence encoding at least one siRNA duplex targeting the SOD1 gene is administered to a subject in need of treatment and / or improvement of ALS. The AAV vector serotype can be selected from the group consisting of: AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3 , AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV 42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44 .2, AAV44.5, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV1-7 / rh.48, AAV1-8 / rh.49, AAV2-15 / rh.62, AAV2-3 / rh.6 1. AAV2-4 / rh.50, AAV2-5 / rh.51, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-9 / rh.52, AAV3-11 / rh.53, AAV4-8 / r11.64, AAV4-9 / rh.54, AAV4-19 / rh .55, AAV5-3 / rh.57, AAV5-22 / rh.58, AAV7.3 / hu.7, AAV16.8 / hu.10, AAV16.12 / hu.11, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV106.1 / hu.37, AAV 114.3 / hu.40, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55,AAV161.10 / hu.60, AAV161.6 / hu.61, AAV33.12 / hu.17, AAV33.4 / hu.15, AAV33.8 / hu.16, AAV52 / hu.19, AAV52.1 / hu.20, AAV58.2 / hu.25, AAVA3.3, AAVA3.4, AAVA3.5, AAVA3.7, AAVC1, AAVC2, AAVC5, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAVH2, AAVrh.72, AAVhu.8, AAVrh.68, AAVrh.70, AAVpi.1, AAVpi.3, A AVpi.2、AAVrh.60、AAVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVH6、AAVLK03、AAVH-1 / hu.1、AAVH-5 / hu.12 、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVcy. .5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、 AAVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu. 29R、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44、AAVhu.44R1、AAVhu.44R2 AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.14 / 9, AAVhu.t19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, AAAV, BAAV, sheep AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuttle 100-1, AAV Shuttle 100-3, AAV Shuttle 100-7, AAV Shuttle 10-2, AAV Shuttle 10-6, AAV Shuttle 10-8, AAV Shuttle 100-2, AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43, authentic AAV (ttAAV), UPENN AAV 10, Japanese AAV10 serotype, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAVCBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAVCBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAVCHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1AAV CKd-B2、AAVCKd-B3、AAV CKd-B4、AAV CKd-B5、AAV CKd-B6、AAV CKd-B7、AAV CKd-B8、AAV CKd-H1、AAVCKd-H2、AAV CKd-H3、AAV CKd-H4、AAV CKd-H5、AAV CKd-H6、AAV CKd-N3、AAV CKd-N4、AAVCKd-N9、AAV CLg-F1、AAV CLg-F2、AAV CLg-F3、AAV CLg-F4、AAV CLg-F5、AAV CLg-F6、AAVCLg-F7、AAV CLg-F8、AAV CLv-1、AAV CLv1-1、AAV Clv1-10、AAV CLv1-2、AAV CLv-12、AAVCLv1-3、AAV CLv-13、AAV CLv1-4、AAV Clv1-7、AAV Clv1-8、AAV Clv1-9、AAV CLv-2、AAVCLv-3、AAV CLv-4、AAV CLv-6、AAV CLv-8、AAV CLv-D1、AAV CLv-D2、AAV CLv-D3、AAV CLv-D4、AAV CLv-D5、AAV CLv-D6、AAV CLv-D7、AAV CLv-D8、AAV CLv-E1、AAV CLv-K1、AAV CLv-K3、AAV CLv-K6、AAV CLv-L4、AAV CLv-L5、AAV CLv-L6、AAV CLv-M1、AAV CLv-M1、AAV CLv-M2、AAV CLv-M5、AAV CLv-M6、AAV CLv-M7、AAV CLv-M8、AAV CLv-M9、AAV CLv-R1、AAVCLv-R2、AAV CLv-R3、AAV CLv-R4、AAV CLv-R5、AAV CLv-R6、AAV CLv-R7、AAV CLv-R8、AAVCLv-R9、AAV CSp-1、AAV CSp-10、AAV CSp-11、AAV CSp-2、AAV CSp-3、AAV CSp-4、AAV CSp-6、AAV CSp-7、AAV CSp-8、AAV CSp-8.10、AAV CSp-8.2、AAV CSp-8.4、AAV CSp-8.5、AAVCSp-8.6、AAV CSp-8.7、AAV CSp-8.8、AAV CSp-8.9、AAV CSp-9、AAV.hu.48R3、AAV.VR-355、AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF 15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF 6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, AAVF9 / HSC9, AAV-PHP.B, AAV-PHP.A, G2B-26, G2B-13, TH1.1-32, TH1.1-35, AAVPHP.B2, AAVPHP.B3, AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B-A TP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B- QQP, AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN ,AAVPHP.B-EGT,AAVPHP.B-DST,AAVPHP.B-DST,AAVPHP.B-STP,AAVPHP.B-PQP,AAVPHP.B-SQP,AAVP HP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3, AAVG2B4, AAVG2B5 and their variants. 、

[0034] In some aspects, ALS is familial ALS associated with SOD1 mutations. In other aspects, ALS is sporadic ALS, characterized by abnormal aggregation of SOD1 protein or disruption of SOD1 protein function or localization, although not necessarily as a result of a genetic mutation. Symptoms of ALS improved by the present method may include motor neuron degeneration, muscle weakness, muscle stiffness, slurred speech, and / or difficulty breathing.

[0035] In some embodiments, siRNA duplexes or dsRNA targeting the SOD1 gene, or AAV vectors comprising molecules encoding such siRNAs, can be introduced directly into the central nervous system of a subject, for example, by intracranial injection.

[0036] In some embodiments, the pharmaceutical compositions of the present invention are used as monotherapy. In other embodiments, the pharmaceutical compositions of the present invention are used in combination therapy. Combination therapy can be combined with one or more neuroprotective agents, such as small molecule compounds, growth factors, and hormones, that have been tested for their neuroprotective effects on motor neuron degeneration.

[0037] In some embodiments, the present invention provides a method for treating or ameliorating amyotrophic lateral sclerosis (ALS) by administering a therapeutically effective amount of a plasmid or AAV vector described herein to a subject in need thereof. ALS can be familial ALS or sporadic ALS.

[0038] In some embodiments, the present invention provides methods of treating or ameliorating canine degenerative myelopathy (DM) by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein.

[0039] In some embodiments, the present invention provides methods for treating or ameliorating amyotrophic lateral sclerosis (ALS) by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein to reduce neurofilament light chain (NF-L) levels in the subject.

[0040] In some embodiments, the present invention provides methods for treating or ameliorating canine degenerative myelopathy (DM) by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein to reduce neurofilament light chain (NF-L) levels in the subject.

[0041] In some embodiments, the present invention provides methods of reducing the level of neurofilament light chain (NF-L) in a subject by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The foregoing and other objects, features and advantages will become apparent from the following description of specific embodiments of the present invention as illustrated in the accompanying drawings, which are not necessarily drawn to scale, emphasis instead being placed upon illustrating the principles of various embodiments of the present invention.

[0044] Figure 1 The calibration curve for the Quanterix Simoa hNF-L(β) assay of NF-L is shown.

[0045] Figure 2A and Figure 2B The stability of NF-L in normal canine CSF is shown. Figure 2A The stability of NF-L in pg / ml is shown, and Figure 2BStability is shown as a percentage of the -80°C control.

[0046] Figure 3A and Figure 3B The stability of NF-L in normal canine serum is shown. Figure 3A The stability of NF-L in pg / ml is shown. Figure 3B Stability is shown as a percentage of the -80°C control.

[0047] Figure 4A and Figure 4B is a histogram showing NF-L levels in dogs with DM. Figure 4A NF-L levels in CSF are shown. Figure 4B NF-L levels in serum are shown.

[0048] Figure 5A 、 Figure 5B and Figure 5C is a histogram showing the level of pNF-H in DM dogs. Figure 5A showed that pNF-H levels were elevated in the CSF of DM dogs. Figure 5B It was shown that pNF-H levels in CSF did not correlate with disease severity. Figure 5C It was shown that pNF-H in CSF is specific for DM. Specific implementation plan

[0049] The present invention relates to polynucleotides targeting SOD1 as therapeutic agents. RNA interference-mediated gene silencing can specifically inhibit gene expression. Therefore, the present invention provides polynucleotides targeting the SOD1 gene, such as small double-stranded RNA (dsRNA) molecules (small interfering RNA, siRNA), shRNA, microRNA, and their precursors, pharmaceutical compositions comprising such polynucleotides, and methods for designing such polynucleotides. The present invention also provides uses of these polynucleotides for inhibiting SOD1 gene expression and protein production to treat neurodegenerative diseases, particularly amyotrophic lateral sclerosis (ALS).

[0050] The details of one or more embodiments of the present invention are set forth in the following description. Although any materials and methods similar or equivalent to the materials or methods described herein can be used in the implementation or testing of the present invention, preferred materials and methods are now described. Through the description, other features, objects and advantages of the present invention will be apparent. In the description, the singular also includes the plural, unless the context clearly indicates otherwise. Unless otherwise defined, as used herein, all technical and scientific terms have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. In the event of a conflict, this specification shall prevail.

[0051] Amyotrophic lateral sclerosis (ALS) and SOD1

[0052] Amyotrophic lateral sclerosis (ALS) is an adult-onset neurodegenerative disease that is progressive and fatal, characterized by the selective death of motor neurons in the motor cortex, brainstem, and spinal cord. Patients diagnosed with ALS develop a progressive muscle phenotype characterized by spasticity, hyper- or hyporeflexia, fasciculations, muscle atrophy, and paralysis. These motor impairments are caused by muscle denervation resulting from the loss of motor neurons. The main pathological features of ALS include degeneration of the corticospinal tract and massive loss of lower motor neurons (LMN) or anterior horn cells (Ghatak et al., J Neuropathol Exp Neurol., 1986, 45, 385-395), degeneration and loss of Betz cells and other pyramidal cells in the primary motor cortex (Udaka et al., ACTA Neuropathol., 1986, 70, 289-295; Maekawa et al., Brain, 2004, 127, 1237-1251) and reactive gliosis in the motor cortex and spinal cord (Kawamata et al., Am J Pathol., 1992, 140, 691-707; and Schiffer et al., J Neurol Sci., 1996, 139, 27-33). ALS is usually fatal within 3 to 5 years of diagnosis due to respiratory defects and / or inflammation (Rowland LP and Shneibder NA, N Engl. J. Med., 2001, 344, 1688-1700).

[0053] The cellular hallmark of ALS is the presence of ubiquitinated cytoplasmic inclusions of proteins in degenerating motor neurons and surrounding cells (e.g., astrocytes). Ubiquitinated inclusions (i.e., Lewy body-like inclusions or filamentous inclusions) are the most common specific type of inclusion in ALS and are found in LMNs of the spinal cord and brainstem and in upper motor neurons (UMNs) of the corticospinal cord (Matsumoto et al., J Neurol Sci., 1993, 115, 208-213; and Sasak and Maruyama, Acta Neuropathol., 1994, 87, 578-585). Several proteins have been identified as components of inclusions, including ubiquitin, Cu / Zn superoxide dismutase 1 (SOD1), peripherin, and Dorfin. Neurofilamentous inclusions are commonly found in hyaline conglomerate inclusions (HCIs) and axonal "spheres" of spinal motor neurons in ALS. Other less specific types of inclusions include Bunina bodies (cystatin C-containing inclusions) and crescent-shaped inclusions (SCIs) in the upper cortex. Other neuropathological features observed in ALS include Golgi fragmentation, mitochondrial vacuolization, and ultrastructural abnormalities of synaptic terminals (Fujita et al., Acta Neuropathol. 2002, 103, 243-247).

[0054] Furthermore, in frontotemporal dementia ALS (FTD-ALS), cortical atrophy (including both the frontal and temporal lobes) has also been observed, which may contribute to cognitive impairment in FTD-ALS patients.

[0055] ALS is a complex, multifactorial disease, and the multiple mechanisms postulated to contribute to the pathogenesis of ALS include dysfunctional protein degradation, glutamate excitotoxicity, mitochondrial dysfunction, apoptosis, oxidative stress, inflammation, protein misfolding and aggregation, aberrant RNA metabolism, and altered gene expression.

[0056] About 10% of ALS cases have a family history of the disease, and these patients are referred to as familial ALS (fALS) or hereditary, typically with a Mendelian dominant pattern of inheritance and high penetrance. The remainder (approximately 90%-95%) are classified as sporadic ALS (sALS) because they have no documented family history and are thought to be caused by other risk factors, including environmental factors, genetic polymorphisms, somatic mutations, and possibly gene-environment interactions. In most cases, familial (or hereditary) ALS is inherited as an autosomal dominant disease, but there are pedigrees with autosomal recessive and X-linked inheritance and incomplete penetrance. The sporadic and familial forms are clinically indistinguishable, suggesting a common pathogenesis. The exact cause of the selective death of motor neurons in ALS remains elusive. Advances in understanding the genetic factors in fALS may shed light on both forms of the disease.

[0057] Recently, a surge in genetic causes of ALS has revealed mutations in more than 10 different genes known to cause fALS. The most common mutations are found in the gene encoding Cu / Zn superoxide dismutase 1 (SOD1; ~20%) (Rosen DR et al., Nature, 1993, 362, 59-62), the gene fused in sarcoma / translocated in liposarcoma (FUS / TLS; 1-5%), and TDP-43 (TARDBP; 1-5%). More recently, a hexanucleotide repeat expansion (GGGGCC) in the C9orF72 gene has been identified. n It has been identified as the most common cause of fALS in Western populations (approximately 40%) (reviewed by Renton et al., Nat. Neurosci., 2014, 17, 17-23). ​​Other genes mutated in ALS include alsin (ALS2), senataxin (SETX), vesicle-associated membrane protein (VAPB), and angiopoietin (ANG). The fALS genes control different cellular mechanisms, suggesting that the pathogenesis of ALS is complex and may be related to several different processes that ultimately lead to motor neuron degeneration.

[0058] SOD1 is one of three human superoxide dismutases identified and characterized in mammals: copper-zinc superoxide dismutase (Cu / ZnSOD or SOD1), manganese superoxide dismutase (MnSOD or SOD2), and extracellular superoxide dismutase (ECSOD or SOD3). SOD1 is a 32 kDa homodimer of a 153-residue polypeptide, each subunit having one copper and one zinc binding site, encoded by the SOD1 gene on human chromosome 21 (NCBI reference sequence NM_000454.4; SEQ ID NO: 1) (see Table 10). SOD1 catalyzes the conversion of superoxide anions (O2- ) is converted into molecular oxygen (O2) and hydrogen peroxide (H2O2). The intracellular concentration of SOD1 is high (ranging from 10 to 100 μM), accounting for 1% of the total protein content of the central nervous system (CNS). This protein is located not only in the cytoplasm of eukaryotic cells, but also in the nucleus, lysosomes, peroxisomes, and mitochondrial intermembrane space (Lindenau J et al., Glia, 2000, 29, 25-34).

[0059] 15-20% of fALS patients and 1-2% of all ALS cases carry mutations in the SOD1 gene. Currently, at least 170 different mutations distributed throughout the 153 amino acid SOD1 polypeptide have been found to cause ALS, and an updated list can be found in the ALS Online Genetic Database (ALSOD) (Wroe R et al., Amyotroph Lateral Scler., 2008, 9, 249-250). Table 1 lists some examples of mutations in SOD1 in ALS. These mutations are primarily single amino acid substitutions (i.e., missense mutations), although deletions, insertions, and C-terminal truncations also occur. Different SOD1 mutations show different geographic distribution patterns. For example, approximately half of all Americans with ALS caused by mutations in the SOD1 gene have a specific mutation, Ala4Val (or A4V). The A4V mutation is generally associated with more severe signs and symptoms. To date, the I113T mutation is the most common mutation in the UK. In Europe, the most common mutation is the D90A substitution.

[0060] Table 1. Examples of SOD1 mutations in ALS

[0061]

[0062]

[0063] To study the mechanism of neuronal death associated with SOD1 gene defects, several rodent models of ALS associated with SOD1 have been developed in the field, which express the human SOD1 gene with different mutations, including missense mutations, small deletions or insertions. Some examples of ALS mouse models include SOD1 G93A 、SOD1 A4V 、SOD1 G37R 、SOD1 G85R 、SOD1 D90A 、SOD1 L84V 、SOD1 I113T 、SOD1 H36R / H48Q 、SOD1 G127X 、SOD1 L126X and SOD1 L126delTTThere are two transgenic rat models with two different human SOD1 mutations: SOD1 H46R and SOD1 G93R These rodent ALS models develop muscle weakness similar to that seen in human ALS patients, as well as other pathogenic features that mirror several hallmarks of the human disease, particularly the selective death of spinal motor neurons, accumulation of protein inclusions in motor neurons, and microglial activation. Transgenic rodents are well-known in the art as good models for human SOD1-related ALS and provide models for studying disease pathogenesis and developing treatments.

[0064] Studies in animal and cell models suggest that pathogenic SOD1 variants cause ALS through gain-of-function. That is, when altered by SOD1 mutations, superoxide dismutase acquires new, but deleterious, properties. For example, some SOD1 mutant variants in ALS increase oxidative stress (e.g., increased accumulation of toxic superoxide radicals) by disrupting redox cycling. Other studies also suggest that some SOD1 mutant variants in ALS may acquire toxic properties independent of their normal physiological functions (e.g., abnormal aggregation of misfolded SOD1 variants). In the aberrant redox chemistry model, mutant SOD1 is unstable and interacts with unconventional substrates through aberrant chemistry, leading to overproduction of reactive oxygen species (ROS). In the proteotoxicity model, unstable, misfolded SOD1 aggregates in cytoplasmic inclusions, sequestering proteins critical for cellular processes. These two hypotheses are not mutually exclusive. Oxidation of selected metal-binding histidine residues in the active site has been shown to mediate SOD1 aggregation.

[0065] Aggregated mutant SOD1 proteins can also induce mitochondrial dysfunction (Vehvilainen P et al., Front Cell Neurosci., 2014, 8, 126), impaired axonal transport, abnormal RNA metabolism, glial cell pathology and glutamate excitotoxicity. In some sporadic ALS cases, misfolded wild-type SOD1 proteins were found in diseased motor neurons, which formed a "toxic conformation" similar to the SOD1 variant associated with familial ALS (Rotunno MS and Bosco DA, Front Cell Neurosci., 2013, 16, 7, 253). These evidences indicate that ALS is a protein folding disease, similar to other neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease.

[0066] Currently, there are no treatments for patients with ALS. The only FDA-approved drug, riluzole (also known as Rilutek), is an inhibitor of glutamate release that has a modest effect on ALS and only extends survival by 2-3 months when taken for 18 months. Unfortunately, patients taking riluzole do not experience any slowing of disease progression or improvement in muscle function. Therefore, riluzole does not provide a cure, or even an effective treatment. Researchers continue to search for better treatments.

[0067] One method of inhibiting abnormal SOD1 protein aggregation is to silence / inhibit the expression of the SOD1 gene in ALS. It is reported that small interfering RNA for the treatment of allele-specific gene silencing mutations has therapeutic benefits for the treatment of fALS (e.g., Ralgh GS et al., Nat. Medicine, 2005, 11 (4), 429-433; and Raoul C et al., Nat. Medicine, 2005, 11 (4), 423-428; and Maxwell MM et al., PNAS, 2004, 101 (9), 3178-3183; and Ding H et al., Chinese Medical J., 2011, 124 (1), 106-110; and Scharz DS et al., Plos Genet., 2006, 2 (9), e140; the contents of each of which are incorporated herein by reference in their entirety).

[0068] The art teaches a number of other RNA therapeutics that target the SOD1 gene in ALS and regulate SOD1 expression, such RNA-based agents include antisense oligonucleotides and double-stranded small interfering RNA. See, for example, Wang H et al., J Biol. Chem., 2008, 283(23), 15845-1585); U.S. Patent Nos. 7,498,316; 7,632,938; 7,678,895; 7,951,784; 7,977,314; 8,183,219; 8,309,533 and 8,586,554; and U.S. Patent Publication Nos. 2006 / 0229268 and 2011 / 0263680; the contents of each of which are incorporated herein by reference in their entirety.

[0069] The present invention uses viral vectors such as adeno-associated virus (AAV) vectors to efficiently deliver siRNA duplexes or polynucleotides targeting SOD1 to cells. AAV vectors containing RNAi molecules of the present invention, such as siRNA molecules, can increase the delivery of active agents to motor neurons. Polynucleotides targeting SOD1 may be able to significantly inhibit the expression of the SOD1 gene in cells (e.g., mRNA levels); thus, improving stress induced by intracellular SOD1 expression, such as protein aggregation and inclusion body formation, increased free radicals, mitochondrial dysfunction, and RNA metabolism.

[0070] Such polynucleotides targeting SOD1 can be used to treat ALS. According to the present invention, a method for treating and / or improving ALS in a patient comprises administering an effective amount of at least one polynucleotide targeting SOD1 encoding one or more siRNA duplexes to the patient's cells and allowing the gene expression of SOD1 to be inhibited / silenced.

[0071] Compositions of the present invention

[0072] carrier

[0073] In some embodiments, the siRNA molecules described herein can be inserted into a vector such as a plasmid or a viral vector or encoded by a vector such as a plasmid or a viral vector. Preferably, the siRNA molecules are inserted into a viral vector or encoded by a viral vector.

[0074] The viral vector can be a herpes virus (HSV) vector, a retroviral vector, an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, etc. In some specific embodiments, the viral vector is an AAV vector.

[0075] Retroviral vectors

[0076] In some embodiments, siRNA duplexes targeting the SOD1 gene can be encoded by a retroviral vector (see, e.g., U.S. Patent Nos. 5,399,346; 5,124,263; 4,650,764 and 4,980,289; the contents of each of which are herein incorporated by reference in their entirety).

[0077] Adenoviral vector

[0078] Adenovirus is a eukaryotic DNA virus that can be modified to effectively deliver nucleic acids to a variety of cell types in vivo and has been widely used in gene therapy protocols, including for targeting genes to neural cells. Various replication-defective adenoviruses and minimal adenovirus vectors for nucleic acid therapy have been described (see, e.g., PCT Patent Publication Nos. WO199426914, WO199502697, WO199428152, WO199412649, WO199502697, and WO199622378; the contents of each of which are incorporated herein by reference in their entirety). Such adenovirus vectors can also be used to deliver the siRNA molecules of the present invention to cells.

[0079] Adeno-associated virus (AAV) vectors

[0080] AAV is a parvovirus. Like other parvoviruses, AAV is a single-stranded, non-enveloped DNA virus with a genome length of about 5000 nucleotides, comprising two open reading frames encoding proteins (Rep) responsible for replication and structural proteins (Cap) of the capsid. The open reading frames are flanked by two inverted terminal repeat (ITR) sequences, which serve as the starting point for viral genome replication. In addition, the AAV genome contains packaging sequences that allow the viral genome to be packaged into AAV capsids. AAV vectors require a co-helper virus (e.g., adenovirus) to carry out productive infection in infected cells. In the absence of such auxiliary functions, AAV virions primarily enter host cells and integrate into the genome of the cell.

[0081] AAV vectors have been studied for siRNA delivery due to several unique characteristics of AAV vectors. These characteristics include (i) the ability to infect dividing and non-dividing cells; (ii) a broad host range of infections, including human cells; (iii) wild-type AAV has never been associated with any disease and cannot replicate in infected cells; (iv) the lack of a cell-mediated immune response against the vector and (v) the ability to integrate into the host chromosome or exist episomally, thus creating the possibility of long-term expression. In addition, infection with AAV vectors has minimal effect on altering the pattern of cellular gene expression (Stilwell and Samulski et al., Biotechniques, 2003, 34, 148).

[0082] Typically, the AAV vector used for siRNA delivery can be a recombinant viral vector that is replication-defective due to the lack of sequences encoding functional Rep and Cap proteins in the viral genome. In some cases, the defective AAV vector may lack most of all coding sequences and essentially contain only one or two AAV ITR sequences and a packaging sequence.

[0083] AAV vectors can also include self-complementary AAV vectors (scAAV). scAAV vectors contain two DNA strands that anneal together to form double-stranded DNA. By skipping second-strand synthesis, scAAV can be rapidly expressed in cells.

[0084] Methods for generating / modifying AAV vectors, such as pseudotyped AAV vectors, are disclosed in the art (PCT Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO2005005610 and WO2005072364, the contents of each of which are herein incorporated by reference in their entirety).

[0085] AAV vectors for delivering siRNA molecules to mammalian cells can be prepared or derived from a variety of AAV serotypes, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, and AAV-DJ. In some cases, AAVs of different serotypes can be mixed together or mixed with other types of viruses to produce chimeric AAV vectors.

[0086] AAV vectors for delivering siRNA can be modified to enhance delivery efficiency. Such modified AAV vectors containing siRNA expression cassettes can be efficiently packaged and can be used to successfully infect target cells with high frequency and minimal toxicity.

[0087] In some embodiments, the AAV vector used to deliver the siRNA duplex of the present invention can be a human serotype AAV vector. Such a human AAV vector can be derived from any known serotype, for example, from any of the serotypes AAV1-AAV11. As non-limiting examples, the AAV vector can be a vector comprising an AAV1-derived genome in an AAV1-derived capsid; a vector comprising an AAV2-derived genome in an AAV2-derived genome; a vector comprising an AAV4-derived genome in an AAV4-derived capsid; a vector comprising an AAV6-derived genome in an AAV6-derived capsid or a vector comprising an AAV9-derived genome in an AAV9-derived capsid.

[0088] In other embodiments, the AAV vector used to deliver the siRNA duplex of the present invention can be a pseudotyped AAV vector comprising sequences and / or components originating from at least two different AAV serotypes. A pseudotyped AAV vector can be a vector comprising an AAV genome derived from one AAV serotype and capsid proteins derived at least in part from a different AAV serotype. As non-limiting examples, such pseudotyped AAV vectors can be vectors comprising an AAV2-derived genome in an AAV1-derived capsid; or a vector comprising an AAV2-derived genome in an AAV6-derived capsid; or a vector comprising an AAV2-derived genome in an AAV4-derived capsid; or an AAV2-derived genome in an AAV9-derived capsid.

[0089] In other embodiments, AAV vectors can be used to deliver siRNA molecules to the central nervous system (eg, US Pat. No. 6,180,613; the contents of which are herein incorporated by reference in their entirety).

[0090] In some aspects, the AAV vectors used to deliver the siRNA duplexes of the present invention can further comprise a modified capsid comprising a peptide from a non-viral source. In other aspects, the AAV vectors can comprise a CNS-specific chimeric capsid to facilitate delivery of the siRNA duplexes to the brain and spinal cord. For example, an alignment of cap nucleotide sequences from AAV variants showing CNS tropism can be constructed to identify variable region (VR) sequences and structures.

[0091] viral genome

[0092] In one embodiment, as shown, the AAV particle includes a viral genome having a payload region.

[0093] Viral genome size

[0094] In one embodiment, the viral genome comprising the payload described herein can be a single-stranded or double-stranded viral genome. The size of the viral genome can be small, medium, large, or maximum size. In addition, the viral genome can include a promoter and a polyA tail.

[0095] In one embodiment, the viral genome comprising the payload described herein can be a small single-stranded viral genome. The size of the small single-stranded viral genome can be 2.7 to 3.5 kb, for example, about 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, and 3.5 kb. As a non-limiting example, the size of the small single-stranded viral genome can be 3.2 kb. In addition, the viral genome can include a promoter and a polyA tail.

[0096] In one embodiment, the viral genome comprising the payload described herein can be a small double-stranded viral genome. The size of the small double-stranded viral genome can be 1.3 to 1.7 kb, for example, about 1.3, 1.4, 1.5, 1.6, and 1.7 kb. As a non-limiting example, the size of the small double-stranded viral genome can be 1.6 kb. In addition, the viral genome can include a promoter and a polyA tail.

[0097] In one embodiment, the viral genome comprising the payload described herein can be a medium single-stranded viral genome. The size of the medium single-stranded viral genome can be 3.6 to 4.3 kb, for example, about 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, and 4.3 kb. As a non-limiting example, the size of the medium single-stranded viral genome can be 4.0 kb. In addition, the viral genome can include a promoter and a polyA tail.

[0098] In one embodiment, the viral genome comprising the payload described herein can be a medium double-stranded viral genome. The size of the medium double-stranded viral genome can be 1.8 to 2.1 kb, for example, about 1.8, 1.9, 2.0, and 2.1 kb. As a non-limiting example, the size of the medium double-stranded viral genome can be 2.0 kb. In addition, the viral genome can include a promoter and a polyA tail.

[0099] In one embodiment, the viral genome comprising a payload as described herein can be a large single-stranded viral genome. The size of the large single-stranded viral genome can be 4.4 to 6.0 kb, for example, a size of about 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 and 6.0 kb. As a non-limiting example, the size of the large single-stranded viral genome can be 4.7 kb. As another non-limiting example, the size of the large single-stranded viral genome can be 4.8 kb. As another non-limiting example, the size of the large single-stranded viral genome can be 6.0 kb. In addition, the viral genome can include a promoter and a poly A tail.

[0100] In one embodiment, the viral genome comprising the payload described herein can be a large double-stranded viral genome. The size of the large double-stranded viral genome can be 2.2 to 3.0 kb, for example, about 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 and 3.0 kb. As a non-limiting example, the size of the large double-stranded viral genome can be 2.4 kb. In addition, the viral genome can include a promoter and a polyA tail.

[0101] Viral genome components: Inverted terminal repeats (ITRs)

[0102] The AAV particles of the present invention comprise a viral genome having at least one ITR region and a payload region. In one embodiment, the viral genome comprises two ITRs. These two ITRs flank the 5' and 3' ends of the payload region. The function of the ITRs is to serve as origins of replication containing replication recognition sites. The ITRs comprise regions of sequences that can be complementary and symmetrically arranged. The ITRs introduced into the viral genome of the present invention can comprise naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.

[0103] The ITRs may be derived from the same serotype as the capsid, selected from any serotype described herein or a derivative thereof. The ITRs may have a different serotype than the capsid. In one embodiment, the AAV particle has more than one ITR. In a non-limiting example, the AAV particle has a viral genome comprising two ITRs. In one embodiment, the serotypes of the ITRs are identical to each other. In another embodiment, the ITRs have different serotypes. Non-limiting examples include zero, one, or two ITRs having the same serotype as the capsid. In one embodiment, both ITRs of the viral genome of the AAV particle are AAV2 ITRs.

[0104] Independently, the length of each ITR can be about 100 to about 150 nucleotides. The length of an ITR can be 100-105 nucleotides, 106-110 nucleotides, 111-115 nucleotides, 116-120 nucleotides, 121-125 nucleotides, 126-130 nucleotides, 131-135 nucleotides, 136-140 nucleotides, 141-145 nucleotides or 146-150 nucleotides. In one embodiment, the length of an ITR is 140-142 nucleotides. Non-limiting examples of ITR lengths are 102, 140, 141, 142, 145 nucleotides in length, and nucleotides with at least 95% identity thereto.

[0105] In one embodiment, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule, which can be located near the 5' end of the flip ITR in the expression vector. In another embodiment, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule, which can be located near the 3' end of the flip ITR in the expression vector. In yet another embodiment, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule, which can be located near the 5' end of the flop ITR in the expression vector. In yet another embodiment, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule, which can be located near the 3' end of the flop ITR in the expression vector. In one embodiment, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule, which can be located between the 5' end of the flip ITR and the 3' end of the flop ITR in the expression vector. In one embodiment, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule, which can be located between the 3' end of the flip ITR and the 5' end of the flip ITR in the expression vector (e.g., between the 5' end of the flip ITR and the 3' end of the flop ITR or in the middle between the 3' end of the flop ITR and the 5' end of the flip ITR). As a non-limiting example, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule, which can be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream of the 5' or 3' end of the ITR (e.g., Flip or Flop ITR) in the expression vector. As a non-limiting example, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule, which can be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more 30 nucleotides upstream of the 5' or 3' end of the ITR (e.g., Flip or Flop ITR) in the expression vector. As another non-limiting example, the AAV particles comprise a nucleic acid sequence encoding an siRNA molecule, which can be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30, or 25-30 nucleotides downstream of the 5' or 3' end of the ITR (e.g., Flip or Flop ITR) in the expression vector.As another non-limiting example, the AAV particles comprise a nucleic acid sequence encoding an siRNA molecule, which can be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30, or 25-30 nucleotides upstream of the 5' or 3' end of the ITR (e.g., Flip or Flop ITR) in the expression vector. As a non-limiting example, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule that is located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, or more than 25% of the nucleotides upstream of the 5' or 3' end of the ITR (e.g., Flip or Flop ITR) in the expression vector. As another non-limiting example, the AAV particle comprises a nucleic acid sequence encoding an siRNA molecule that is located within the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% of the 5' or 3' end of the ITR (e.g., Flip or Flop ITR) in the expression vector.

[0106] Viral genome components: promoters

[0107] In one embodiment, the payload region of the viral genome comprises at least one element that enhances transgene target specificity and expression (see, e.g., Powell et al., Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are incorporated herein by reference in their entirety). Non-limiting examples of elements that enhance transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers, and introns.

[0108] Those skilled in the art will recognize that expression of the polypeptides of the present invention in target cells may require specific promoters, including but not limited to species-specific, inducible, tissue-specific, or cell cycle-specific promoters (Parr et al., Nat. Med. 3:1145-9 (1997); the contents of which are incorporated herein by reference in their entirety).

[0109] In one embodiment, a promoter is considered effective when it drives expression of a polypeptide encoded in the payload region of the viral genome of an AAV particle.

[0110] In one embodiment, the promoter is one that is recognized to be effective in driving expression of a regulatory polynucleotide.

[0111] In one embodiment, the promoter is one that is considered efficient when it drives expression in the targeted cell.

[0112] In one embodiment, the promoter drives the expression of the payload in the target tissue for a period of time. The time for promoter-driven expression can be 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days , 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years. Expression can persist for 1-5 hours, 1-12 hours, 1-2 days, 1-5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years, or 5-10 years.

[0113] In one embodiment, the promoter drives expression of the payload for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65 or more years.

[0114] The promoter can be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include viral promoters, plant promoters, and mammalian promoters. In some embodiments, the promoter can be a human promoter. In some embodiments, the promoter can be truncated.

[0115] Promoters that drive or promote expression in most tissues include, but are not limited to, human elongation factor 1 alpha subunit (EF1α), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken beta-actin (CBA) and its derived CAG, beta glucuronidase (GUSB), or ubiquitin C (UBC). Tissue-specific expression elements can be used to restrict expression to certain cell types, such as, but not limited to, muscle-specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or nervous system promoters, which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.

[0116] Non-limiting examples of muscle-specific promoters include the mammalian muscle creatine kinase (MCK) promoter, the mammalian desmin (DES) promoter, the mammalian troponin I (TNNI2) promoter, and the mammalian skeletal α-actin (ASKA) promoter (see, e.g., U.S. Patent Publication No. US20110212529, the contents of which are herein incorporated by reference in their entirety).

[0117] Non-limiting examples of neuronal tissue-specific expression elements include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B chain (PDGF-β), synaptobrevin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca 2+ / Calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), light neurofilament (NFL) or heavy neurofilament (NFH), β-globin minigene nβ2, proenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2) promoters. Non-limiting examples of tissue-specific expression elements for astrocytes include glial fibrillary acidic protein (GFAP) and EAAT2 promoters. Non-limiting examples of tissue-specific expression elements for oligodendrocytes include myelin basic protein (MBP) promoters.

[0118] In one embodiment, the promoter may be less than 1 kb. The length of the promoter may be 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330,

[0119] 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more nucleotides. The promoter may be between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800, or 700-800 in length.

[0120] In one embodiment, the promoter can be a combination of two or more components of the same or different starting or parent promoters, such as, but not limited to, CMV and CBA. The length of each component can be 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 800 or more. The length of each component can be between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800, or 700-800. In one embodiment, the promoter is a combination of a 382-nucleotide CMV-enhancer sequence and a 260-nucleotide CBA-promoter sequence.

[0121] In one embodiment, the viral genome comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include CMV, CBA (including derivatives CAG, CBh, etc.), EF-1α, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3).

[0122] Yu et al. (Molecular Pain 2011, 7:63; the contents of which are incorporated herein by reference in their entirety) evaluated the expression of eGFP in rat DRG cells and primary DRG cells under the CAG, EFIα, PGK, and UBC promoters using lentiviral vectors and found that expression of UBC was weaker than that of the other three promoters, and only 10-12% of glial cells were expressed for all promoters. Soderblom et al. (E. Neuro 2015; the contents of which are incorporated herein by reference in their entirety) evaluated the expression of eGFP in AAV8 with CMV and UBC promoters and in AAV2 with CMV promoter after motor cortex injection. Intranasal administration of plasmids containing UBC or EFIα promoters showed sustained airway expression greater than expression containing the CMV promoter (see, for example, Gill et al., Gene Therapy 2001, Vol. 8, 1539-1546; the contents of which are incorporated herein by reference in their entirety). Husain et al. (Gene Therapy 2009; the contents of which are incorporated herein by reference in their entirety) evaluated HβH constructs with the hGUSB promoter, the HSV-1 LAT promoter, and the NSE promoter and found that the HβH constructs were less expressed in the mouse brain than NSE. Passini and Wolfe (J. Virol. 2001, 12382-12392, the contents of which are incorporated herein by reference in their entirety) evaluated the long-term effects of an HβH vector after intracerebroventricular injection in neonatal mice and found that there was sustained expression for at least one year. Xu et al. (Gene Therapy 2001, 8, 1323-1332; the contents of which are incorporated herein by reference in their entirety) found that expression was low in all brain regions when using the NFL and NFH promoters compared to CMV-lacZ, CMV-luc, EF, GFAP, hENK, nAChR, PPE, PPE+wpre, NSE (0.3 kb), NSE (1.8 kb), and NSE (1.8 kb+wpre). Xu et al. found that the order of promoter activity was NSE (1.8 kb), EF, NSE (0.3 kb), GFAP, CMV, hENK, PPE, NFL, and NFH. NFL is a 650-nucleotide promoter and NFH is a 920-nucleotide promoter. Both are absent in the liver, but NFH is abundant in sensory proprioceptive neurons, brain, and spinal cord, while NFH is present in the heart.Scn8a is a 470-nucleotide promoter that is expressed throughout the DRG, spinal cord, and brain, with particularly high expression in hippocampal neurons and cerebellar Purkinje cells, cortex, thalamus, and hypothalamus (see, e.g., Drews et al., Identification of evolutionarily conserved, functional noncoding elements in the promoter region of the sodium channel gene SCN8A, Mamm Genome (2007) 18:723-731; and Raymond et al., Expression of Alternatively Spliced ​​Sodium Channel α-subunit genes, Journal of Biological Chemistry (2004) 279(44)46234-46241; the contents of which are incorporated herein by reference in their entireties).

[0123] Any of the promoters taught by Yu, Soderblom, Gill, Husain, Passini, Xu, Drews, or Raymond, supra, may be used in the present invention.

[0124] In one embodiment, the promoter is not cell-specific.

[0125] In one embodiment, the promoter is the ubiquitin c (UBC) promoter. The size of the UBC promoter can be 300-350 nucleotides. As a non-limiting example, the UBC promoter is 332 nucleotides.

[0126] In one embodiment, the promoter is a β-glucuronidase (GUSB) promoter. The size of the GUSB promoter can be 350-400 nucleotides. As a non-limiting example, the GUSB promoter is 378 nucleotides.

[0127] In one embodiment, the promoter is a light neurofilament (NFL) promoter. The size of the NFL promoter can be 600-700 nucleotides. As a non-limiting example, the NFL promoter is 650 nucleotides. As a non-limiting example, the construct can be AAV-promoter-CMV / globin intron-regulatory polynucleotide-RBG, wherein the AAV can be self-complementary and the AAV can be a DJ serotype.

[0128] In one embodiment, the promoter is a neurofilament heavy (NFH) promoter. The size of the NFH promoter can be 900-950 nucleotides. As a non-limiting example, the NFH promoter is 920 nucleotides. As a non-limiting example, the construct can be AAV-promoter-CMV / globin intron-regulatory polynucleotide-RBG, wherein the AAV can be self-complementary and the AAV can be a DJ serotype.

[0129] In one embodiment, the promoter is the scn8a promoter. The size of the scn8a promoter can be 450-500 nucleotides. As a non-limiting example, the scn8a promoter is 470 nucleotides. As a non-limiting example, the construct can be AAV-promoter-CMV / globin intron-regulatory polynucleotide-RBG, wherein the AAV can be self-complementary and the AAV can be a DJ serotype.

[0130] In one embodiment, the viral genome comprises a Pol III promoter.

[0131] In one embodiment, the viral genome comprises a P1 promoter.

[0132] In one embodiment, the viral genome comprises a FXN promoter.

[0133] In one embodiment, the promoter is the phosphoglycerate kinase 1 (PGK) promoter.

[0134] In one embodiment, the promoter is the chicken beta-actin (CBA) promoter.

[0135] In one embodiment, the promoter is the CAG promoter, which is a construct comprising the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin (CBA) promoter.

[0136] In one embodiment, the promoter is a cytomegalovirus (CMV) promoter.

[0137] In one embodiment, the viral genome comprises an H1 promoter.

[0138] In one embodiment, the viral genome comprises a U6 promoter.

[0139] In one embodiment, the promoter is a liver or skeletal muscle promoter. Non-limiting examples of liver promoters include human alpha-1-antitrypsin (hAAT) and thyroxine-binding globin (TBG). Non-limiting examples of skeletal muscle promoters include desmin, MCK, or synthetic C5-12.

[0140] In one embodiment, the promoter is an RNA pol III promoter. As a non-limiting example, the RNA pol III promoter is U6. As a non-limiting example, the RNA pol III promoter is H1.

[0141] In one embodiment, the viral genome comprises two promoters. As non-limiting examples, the promoters are the EF1α promoter and the CMV promoter.

[0142] In one embodiment, the viral genome comprises an enhancer element, a promoter and / or a 5'UTR intron. The enhancer element, also referred to herein as an "enhancer," may be, but is not limited to, a CMV enhancer, the promoter may be, but is not limited to, a CMV, CBA, UBC, GUSB, NSE, synaptophysin, MeCP2, and GFAP promoter, and the 5'UTR / intron may be, but is not limited to, SV40 and CBA-MVM. As non-limiting examples, the enhancers, promoters and / or introns used in combination can be: (1) CMV enhancer, CMV promoter, SV40 5'UTR intron; (2) CMV enhancer, CBA promoter, SV40 5'UTR intron; (3) CMV enhancer, CBA promoter, CBA-MVM 5'UTR intron; (4) UBC promoter; (5) GUSB promoter; (6) NSE promoter; (7) synapsin promoter; (8) MeCP2 promoter, (9) GFAP promoter, (10) H1 promoter; and (11) U6 promoter.

[0143] In one embodiment, the viral genome comprises an engineered promoter.

[0144] In another embodiment, the viral genome comprises a promoter from a naturally expressed protein.

[0145] Viral genome components: untranslated regions (UTRs)

[0146] By definition, the wild-type untranslated region (UTR) of a gene is transcribed but not translated. Typically, the 5'UTR begins at the transcription start site and ends at the start codon, and the 3'UTR begins just after the stop codon and continues to the transcription termination signal.

[0147] Features commonly found in genes that are abundantly expressed in specific target organs can be engineered into the UTR to enhance stability and protein production. As a non-limiting example, the 5'UTR from an mRNA normally expressed in the liver (e.g., albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or factor VIII) can be used in the viral genome of the AAV particles of the present invention to enhance expression in hepatocyte cell lines or the liver.

[0148] While not wishing to be bound by theory, the wild-type 5' untranslated region (UTR) includes features that play a role in translation initiation. The Kozak sequence is commonly known to be involved in the process by which ribosomes initiate translation of many genes, and this sequence is often contained in the 5'UTR. The Kozak sequence has a consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), followed by another "G."

[0149] In one embodiment, the 5'UTR in the viral genome comprises a Kozak sequence.

[0150] In one embodiment, the 5'UTR in the viral genome does not contain a Kozak sequence.

[0151] While not wishing to be bound by theory, wild-type 3'UTRs are known to have a stretch of adenosine and uridine embedded within them. These AU-rich markers are particularly prevalent in genes with high turnover rates. Based on their sequence characteristics and functional properties, AU-rich elements (AREs) can be divided into three classes (Chen et al., 1995, the contents of which are incorporated herein by reference in their entirety): Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several dispersed copies of the AUUUA motif within a U-rich region. Class II AREs, such as, but not limited to, GM-CSF and TNF-α, have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Class III AREs are less well defined, such as, but not limited to, c-Jun and myogenin. These U-rich regions do not contain the AUUUA motif. Most proteins that bind to AREs are known to destabilize the messenger, but members of the ELAV family (most notably HuR) have been shown to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3'UTR of a nucleic acid molecule will result in HuR binding and thereby stabilization of the messenger in vivo.

[0152] The introduction, removal, or modification of 3'UTRs rich in AU elements (AREs) can be used to modulate the stability of polynucleotides. When engineering specific polynucleotides, such as the payload region of a viral genome, one or more copies of AREs can be introduced to reduce the stability of the polynucleotide, thereby reducing translation and reducing the yield of the resulting protein. Similarly, AREs can be identified and removed or mutated to increase intracellular stability and thereby increase translation and yield of the resulting protein.

[0153] In one embodiment, the 3'UTR of the viral genome may contain an oligo(dT) sequence for templated addition of a poly-A tail.

[0154] In one embodiment, the viral genome may include at least one miRNA seed, binding site, or full sequence. MicroRNA (or miRNA or miR) is a non-coding RNA of 19-25 nucleotides that binds to the site of a nucleic acid target and downregulates gene expression by reducing nucleic acid molecule stability or inhibiting translation. The microRNA sequence includes a "seed" region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which has perfect Watson-Crick complementarity with the miRNA target sequence of the nucleic acid.

[0155] In one embodiment, the viral genome can be engineered to include, alter, or remove at least one miRNA binding site, sequence, or seed region.

[0156] Any UTR from any gene known in the art can be introduced into the viral genome of the AAV particle. These UTRs or portions thereof can be placed in the same orientation as the gene from which they are selected, or their orientation or position can be changed. In one embodiment, the UTR used in the viral genome of the AAV particle can be inverted, shortened, extended, made with one or more other 5'UTRs or 3'UTRs known in the art. As used herein, the term "altered" when referring to a UTR means that the UTR has been changed in some way relative to a reference sequence. For example, a 3' or 5'UTR can be changed relative to a wild-type or native UTR by a change in orientation or position as taught above, or a 3' or 5'UTR can be changed by including additional nucleotides, deletions of nucleotides, exchanges of nucleotides, or transposition.

[0157] In one embodiment, the viral genome of the AAV particle comprises at least one artificial UTR that is not a variant of a wild-type UTR.

[0158] In one embodiment, the viral genome of the AAV particle comprises UTRs selected from a family of transcripts whose proteins share a common function, structure, characteristic, or property.

[0159] Viral genome components: polyadenylation sequence

[0160] In one embodiment, the viral genome of the AAV particle of the invention comprises at least one polyadenylation sequence.The viral genome of the AAV particle may comprise a polyadenylation sequence between the 3' end of the payload encoding sequence and the 5' end of the 3' ITR.

[0161] In one embodiment, the polyadenylation sequence or "polyA sequence" can range in length from absent to about 500 nucleotides. The length of the polyadenylation sequence can be, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 ,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142 、143、144、145、146、147、148、149、150、151、152、153、154、155、156、157、158、159、160、161、162、163、164、165、166、167、168、169、170、171、172、173、174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192、193、194、195、196、197、198、199、200、201、2 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261,262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、 322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499 and 500 nucleotides.

[0169] In one embodiment, the polyadenylation sequence is 50-100 nucleotides in length.

[0170] In one embodiment, the polyadenylation sequence is 50-150 nucleotides in length.

[0171] In one embodiment, the polyadenylation sequence is 50-160 nucleotides in length.

[0172] In one embodiment, the polyadenylation sequence is 50-200 nucleotides in length.

[0173] In one embodiment, the polyadenylation sequence is 60-100 nucleotides in length.

[0174] In one embodiment, the polyadenylation sequence is 60-150 nucleotides in length.

[0175] In one embodiment, the polyadenylation sequence is 60-160 nucleotides in length.

[0176] In one embodiment, the polyadenylation sequence is 60-200 nucleotides in length.

[0177] In one embodiment, the polyadenylation sequence is 70-100 nucleotides in length.

[0178] In one embodiment, the polyadenylation sequence is 70-150 nucleotides in length.

[0179] In one embodiment, the polyadenylation sequence is 70-160 nucleotides in length.

[0180] In one embodiment, the polyadenylation sequence is 70-200 nucleotides in length.

[0181] In one embodiment, the polyadenylation sequence is 80-100 nucleotides in length.

[0182] In one embodiment, the polyadenylation sequence is 80-150 nucleotides in length.

[0183] In one embodiment, the polyadenylation sequence is 80-160 nucleotides in length.

[0184] In one embodiment, the polyadenylation sequence is 80-200 nucleotides in length.

[0185] In one embodiment, the polyadenylation sequence is 90-100 nucleotides in length.

[0186] In one embodiment, the polyadenylation sequence is 90-150 nucleotides in length.

[0187] In one embodiment, the polyadenylation sequence is 90-160 nucleotides in length.

[0188] In one embodiment, the polyadenylation sequence is 90-200 nucleotides in length.

[0189] In one embodiment, the AAV particles comprise a nucleic acid sequence encoding an siRNA molecule, which can be located upstream of a polyadenylation sequence in an expression vector. Additionally, the AAV particles comprise a nucleic acid sequence encoding an siRNA molecule, which can be located downstream of a promoter in an expression vector, such as, but not limited to, a CMV, U6, CAG, CBA, or CBA promoter with an SV40 intron or a human beta globin intron. As a non-limiting example, the AAV particles comprise a nucleic acid sequence encoding an siRNA molecule, which can be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides downstream of a promoter and / or upstream of a polyadenylation sequence in an expression vector. As another non-limiting example, the AAV particles comprise a nucleic acid sequence encoding an siRNA molecule, which can be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30, or 25-30 nucleotides downstream of a promoter and / or upstream of a polyadenylation sequence in an expression vector. As a non-limiting example, an AAV particle comprises a nucleic acid sequence encoding an siRNA molecule that is located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, or more than 25% of the nucleotides downstream of a promoter and / or upstream of a polyadenylation sequence in an expression vector. As another non-limiting example, an AAV particle comprises a nucleic acid sequence encoding an siRNA molecule that is located within the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% of the nucleotides downstream of a promoter and / or upstream of a polyadenylation sequence in an expression vector.

[0190] In one embodiment, the AAV particle comprises a rabbit globin polyadenylation (polyA) signal sequence.

[0191] In one embodiment, the AAV particles comprise a human growth hormone polyadenylation (polyA) signal sequence.

[0192] Viral genome components: introns

[0193] In one embodiment, the payload region includes at least one expression-enhancing element, such as one or more introns or portions thereof. Non-limiting examples of introns include MVM (67-97 bp), F.IX truncated intron 1 (300 bp), beta globin SD / immunoglobulin heavy chain splice acceptor (250 bp), adenovirus splice donor / immunoglobulin splice acceptor (500 bp), SV40 late splice donor / splice acceptor (19S / 16S) (180 bp), and hybrid adenovirus splice donor / IgG splice acceptor (230 bp).

[0194] In one embodiment, the length of the intron or intron portion can be 100-500 nucleotides. The length of the intron can be 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500. The intron may be between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400-500 in length.

[0195] In one embodiment, the AAV viral genome may comprise a promoter, such as, but not limited to, CMV or U6. As a non-limiting example, the promoter of the AAV comprising the nucleic acid sequence of the siRNA molecule of the present invention is the CMV promoter. As another non-limiting example, the promoter of the AAV comprising the nucleic acid sequence of the siRNA molecule of the present invention is the U6 promoter.

[0196] In one embodiment, the AAV viral genome may comprise a CMV promoter.

[0197] In one embodiment, the AAV viral genome may comprise a U6 promoter.

[0198] In one embodiment, the AAV viral genome may comprise CMV and U6 promoters.

[0199] In one embodiment, the AAV viral genome may comprise an H1 promoter.

[0200] In one embodiment, the AAV viral genome may comprise a CBA promoter.

[0201] In one embodiment, the siRNA molecule of coding can be located at the downstream of a promoter in the expression vector, and the promoter is for example but not limited to CMV, U6, H1, CBA, CAG or the CBA promoter with introns such as SV40 or other introns known in the art. In addition, the siRNA molecule of coding can also be located at the upstream of a polyadenylation sequence in the expression vector. As non-limiting examples, the siRNA molecule of coding can be located at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides in the downstream of a promoter and / or in the upstream of a polyadenylation sequence in the expression vector. As another non-limiting example, the encoded siRNA molecule can be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30, or 25-30 nucleotides downstream of the promoter and / or upstream of the polyadenylation sequence in the expression vector. As a non-limiting example, the encoded siRNA molecule can be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, or more than 25% of the nucleotides downstream of the promoter and / or upstream of the polyadenylation sequence in the expression vector. As another non-limiting example, the encoded siRNA molecule can be located in the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% or 20-25% of the expression vector downstream of the promoter and / or upstream of the polyadenylation sequence.

[0202] Viral genome components: filler sequences

[0203] In one embodiment, the viral genome comprises one or more stuffer sequences.

[0204] In one embodiment, the viral genome comprises one or more stuffer sequences to bring the length of the viral genome to an optimal size for packaging. As a non-limiting example, the viral genome comprises at least one stuffer sequence to bring the length of the viral genome to approximately 2.3 kb. As a non-limiting example, the viral genome comprises at least one stuffer sequence to bring the length of the viral genome to approximately 4.6 kb.

[0205] In one embodiment, the viral genome comprises one or more stuffer sequences to reduce the possibility that the hairpin structure of the vector genome (e.g., a regulatory polynucleotide as described herein) may be read as an inverted terminal repeat (ITR) during expression and / or packaging. As a non-limiting example, the viral genome comprises at least one stuffer sequence so that the length of the viral genome is about 2.3 kb. As a non-limiting example, the viral genome comprises at least one stuffer sequence so that the length of the viral genome is about 4.6 kb.

[0206] In one embodiment, the viral genome is a single-stranded (ss) viral genome and comprises one or more stuffer sequences having a length of about 0.1 kb to 3.8 kb, such as, but not limited to, 0.1 kb, 0.2 kb, 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 In some embodiments, the full-length filler sequence in the vector genome is 3.1kb. In some embodiments, the full-length filler sequence in the vector genome is 2.7kb. In some embodiments, the full-length filler sequence in the vector genome is 0.8kb. In some embodiments, the full-length filler sequence in the vector genome is 0.4kb. In some embodiments, the full-length filler sequence in the vector genome is 0.8kb. In some embodiments, the full-length filler sequence in the vector genome is 0.8kb. In some embodiments, the full-length filler sequence in the vector genome is 0.4kb. In some embodiments, the full-length filler sequence in the vector genome is 0.8kb. As a non-limiting example, each stuffer sequence in the vector genome is 0.4 kb in length.

[0207] In one embodiment, the viral genome is a self-complementary (sc) viral genome and comprises one or more filler sequences having a length of approximately 0.1 kb to 1.5 kb, such as, but not limited to, 0.1 kb, 0.2 kb, 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb or 1.5 kb. As a non-limiting example, the full-length filler sequence in the vector genome is 0.8 kb. As a non-limiting example, the full-length filler sequence in the vector genome is 0.4 kb. As a non-limiting example, the length of each filler sequence in the vector genome is 0.8 kb. As a non-limiting example, the length of each filler sequence in the vector genome is 0.4 kb.

[0208] In one embodiment, the viral genome comprises any portion of the stuffer sequence. The viral genome may comprise 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of the stuffer sequence.

[0209] In one embodiment, the viral genome is a single-stranded (ss) viral genome and comprises one or more stuffer sequences so that the length of the viral genome is about 4.6 kb. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located 3' of the 5' ITR sequence. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located 5' of the promoter sequence. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located 3' of the polyadenylation signal sequence. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located 5' of the 3' ITR sequence. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located between two intron sequences. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located within an intron sequence. As a non-limiting example, the viral genome comprises two stuffer sequences, and the first stuffer sequence is located 3' of the 5' ITR sequence, and the second stuffer sequence is located 3' of the polyadenylation signal sequence. As a non-limiting example, the viral genome comprises two stuffer sequences, and the first stuffer sequence is located 5' of the promoter sequence, and the second stuffer sequence is located 3' of the polyadenylation signal sequence. As a non-limiting example, the viral genome comprises two stuffer sequences, and the first stuffer sequence is located 3' of the 5' ITR sequence, and the second stuffer sequence is located 5' of the 5' ITR sequence.

[0210] In one embodiment, the viral genome is a self-complementary (sc) viral genome and comprises one or more stuffer sequences so that the length of the viral genome is about 2.3 kb. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located 3' of the 5' ITR sequence. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located 5' of the promoter sequence. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located 3' of the polyadenylation signal sequence. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located 5' of the 3' ITR sequence. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located between two intron sequences. As a non-limiting example, the viral genome comprises at least one stuffer sequence, and the stuffer sequence is located within an intron sequence. As a non-limiting example, the viral genome comprises two stuffer sequences, and the first stuffer sequence is located 3' of the 5' ITR sequence, and the second stuffer sequence is located 3' of the polyadenylation signal sequence. As a non-limiting example, the viral genome comprises two stuffer sequences, and the first stuffer sequence is located 5' of the promoter sequence, and the second stuffer sequence is located 3' of the polyadenylation signal sequence. As a non-limiting example, the viral genome comprises two stuffer sequences, and the first stuffer sequence is located 3' of the 5' ITR sequence, and the second stuffer sequence is located 5' of the 5' ITR sequence.

[0211] In one embodiment, the viral genome can include one or more stuffing sequences between one of the multiple regions of the viral genome. In one embodiment, the stuffing region can be located before, for example, but not limited to, a region of a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region. In one embodiment, the stuffing region can be located after, for example, but not limited to, a region of a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region. In one embodiment, the stuffing region can be located before and after, for example, but not limited to, a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region.

[0212] In one embodiment, the viral genome may include one or more stuffer sequences that fork at least one region of the viral genome. The bifurcated region of the viral genome may include 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of the region 5' of the stuffer sequence region. As a non-limiting example, the stuffer sequence may fork at least one region such that 10% of the region is located 5' of the stuffer sequence and 90% of the region is located 3' of the stuffer sequence. As a non-limiting example, the stuffer sequence may fork at least one region such that 20% of the region is located 5' of the stuffer sequence and 80% of the region is located 3' of the stuffer sequence. As a non-limiting example, the stuffing sequence may bifurcate at least one region such that 30% of the region is located 5' of the stuffing sequence and 70% of the region is located 3' of the stuffing sequence. As a non-limiting example, the stuffing sequence may bifurcate at least one region such that 40% of the region is located 5' of the stuffing sequence and 60% of the region is located 3' of the stuffing sequence. As a non-limiting example, the stuffing sequence may bifurcate at least one region such that 50% of the region is located 5' of the stuffing sequence and 50% of the region is located 3' of the stuffing sequence. As a non-limiting example, the stuffing sequence may bifurcate at least one region such that 60% of the region is located 5' of the stuffing sequence and 40% of the region is located 3' of the stuffing sequence. As a non-limiting example, the stuffing sequence may bifurcate at least one region such that 70% of the region is located 5' of the stuffing sequence and 30% of the region is located 3' of the stuffing sequence. As a non-limiting example, the stuffing sequence may bifurcate at least one region such that 80% of the region is located 5' of the stuffing sequence and 20% of the region is located 3' of the stuffing sequence. As a non-limiting example, the stuffer sequence may bifurcate at least one region such that 90% of the region is located 5' to the stuffer sequence and 10% of the region is located 3' to the stuffer sequence.

[0213] In one embodiment, the viral genome comprises a stuffer sequence after the 5' ITR.

[0214] In one embodiment, the viral genome comprises a stuffer sequence after the promoter region. In one embodiment, the viral genome comprises a stuffer sequence after the payload region. In one embodiment, the viral genome comprises a stuffer sequence after the intron region. In one embodiment, the viral genome comprises a stuffer sequence after the enhancer region. In one embodiment, the viral genome comprises a stuffer sequence after the polyadenylation signal sequence region. In one embodiment, the viral genome comprises a stuffer sequence after the exon region.

[0215] In one embodiment, the viral genome comprises a stuffer sequence before the promoter region. In one embodiment, the viral genome comprises a stuffer sequence before the payload region. In one embodiment, the viral genome comprises a stuffer sequence before the intron region. In one embodiment, the viral genome comprises a stuffer sequence before the enhancer region. In one embodiment, the viral genome comprises a stuffer sequence before the polyadenylation signal sequence region. In one embodiment, the viral genome comprises a stuffer sequence before the exon region.

[0216] In one embodiment, the viral genome comprises a stuffer sequence before the 3' ITR.

[0217] In one embodiment, the stuffer sequence can be located between two regions, such as, but not limited to, the 5'ITR and the promoter region. In one embodiment, the stuffer sequence can be located between two regions, such as, but not limited to, the 5'ITR and the payload region. In one embodiment, the stuffer sequence can be located between two regions, such as, but not limited to, the 5'ITR and the intron region. In one embodiment, the stuffer sequence can be located between two regions, such as, but not limited to, the 5'ITR and the enhancer region. In one embodiment, the stuffer sequence can be located between two regions, such as, but not limited to, the 5'ITR and the polyadenylation signal sequence region.

[0218] In one embodiment, a stuffer sequence may be located between two regions, such as but not limited to a 5' ITR and an exonic region.

[0219] In one embodiment, the stuffer sequence may be located between two regions, such as, but not limited to, a promoter region and a payload region. In one embodiment, the stuffer sequence may be located between two regions, such as, but not limited to, a promoter region and an intron region. In one embodiment, the stuffer sequence may be located between two regions, such as, but not limited to, a promoter region and an enhancer region. In one embodiment, the stuffer sequence may be located between two regions, such as, but not limited to, a promoter region and a polyadenylation signal sequence region. In one embodiment, the stuffer sequence may be located between two regions, such as, but not limited to, a promoter region and an exon region. In one embodiment, the stuffer sequence may be located between two regions, such as, but not limited to, a promoter region and a 3' ITR.

[0220] In one embodiment, a stuffer sequence can be located between two regions, such as, but not limited to, a payload region and an intron region. In one embodiment, a stuffer sequence can be located between two regions, such as, but not limited to, a payload region and an enhancer region. In one embodiment, a stuffer sequence can be located between two regions, such as, but not limited to, a payload region and a polyadenylation signal sequence region. In one embodiment, a stuffer sequence can be located between two regions, such as, but not limited to, a payload region and an exon region.

[0221] In one embodiment, a stuffer sequence may be located between two regions, such as, but not limited to, the payload region and the 3' ITR.

[0222] In one embodiment, the stuffing sequence may be located between two regions, such as, but not limited to, an intron region and an enhancer region. In one embodiment, the stuffing sequence may be located between two regions, such as, but not limited to, an intron region and a polyadenylation signal sequence region. In one embodiment, the stuffing sequence may be located between two regions, such as, but not limited to, an intron region and an exon region. In one embodiment, the stuffing sequence may be located between two regions, such as, but not limited to, an intron region and a 3' ITR. In one embodiment, the stuffing sequence may be located between two regions, such as, but not limited to, an enhancer region and a polyadenylation signal sequence region. In one embodiment, the stuffing sequence may be located between two regions, such as, but not limited to, an enhancer region and an exon region. In one embodiment, the stuffing sequence may be located between two regions, such as, but not limited to, an enhancer region and a 3' ITR.

[0223] In one embodiment, a stuffer sequence may be located between two regions, such as but not limited to the polyadenylation signal sequence region and the exon region. In one embodiment, a stuffer sequence may be located between two regions, such as but not limited to the polyadenylation signal sequence region and the 3' ITR.

[0224] In one embodiment, a stuffer sequence may be located between two regions, such as but not limited to an exon region and a 3' ITR.

[0225] Payload of the present invention

[0226] The AAV particles of the present disclosure comprise at least one payload region. As used herein, "payload" or "payload region" refers to one or more polynucleotides or polynucleotide regions encoded by or located within the viral genome, or the expression products of such polynucleotides or polynucleotide regions, such as transgenes, polynucleotides encoding polypeptides or multiple polypeptides, or regulatory nucleic acids or regulatory nucleic acids. The payload of the present invention typically encodes a regulatory polynucleotide or a fragment or variant thereof.

[0227] The payload region can be constructed in a manner that reflects a region that resembles or mirrors the natural organization of the mRNA.

[0228] The payload region may comprise a combination of coding and non-coding nucleic acid sequences.

[0229] In some embodiments, the AAV payload region can encode coding RNA or non-coding RNA.

[0230] In one embodiment, the AAV particles comprise a viral genome having a payload region comprising a nucleic acid sequence encoding an siRNA, miRNA, or other RNAi agent. In such an embodiment, the viral genome encoding more than one polypeptide can be replicated and packaged into the viral particles. Target cells transduced with the viral particles can express the encoded siRNA, miRNA, or other RNAi agent within a single cell.

[0231] Regulatory polynucleotides

[0232] In one embodiment, regulatory polynucleotides, such as RNA or DNA molecules, can be used to treat neurodegenerative diseases, particularly amyotrophic lateral sclerosis (ALS). As used herein, "regulatory polynucleotides" are any nucleic acid sequences that act to regulate (increase or decrease) the level or amount (e.g., mRNA or protein levels) of a target gene.

[0233] In one embodiment, the regulatory polynucleotide may comprise at least one nucleic acid sequence encoding at least one siRNA molecule. If there is more than one, the nucleic acid may independently encode 1, 2, 3, 4, 5, 6, 7, 8, 9 or more siRNA molecules.

[0234] In one embodiment, the molecular scaffold may be located downstream of the CMV promoter, fragment or variant thereof.

[0235] In one embodiment, the molecular scaffold may be located downstream of the CBA promoter, fragments or variants thereof.

[0236] In one embodiment, the molecular scaffold can be a natural pri-miRNA scaffold located downstream of the CMV promoter. As a non-limiting example, the natural pri-miRNA scaffold is derived from the human miR155 scaffold.

[0237] In one embodiment, the molecular scaffold can be the natural pri-miRNA scaffold located downstream of the CBA promoter.

[0238] In one embodiment, the selection of molecular scaffolds and regulatory polynucleotides is determined by comparing the method of regulatory polynucleotides in pri-miRNA (see, for example, Miniarikova et al., Design, Characterization, and Lead Selection of Therapeutic miRNAs Targeting Huntingtin for Development of Gene Therapy for Huntington's Disease. Molecular Therapy-Nucleic Acids (2016) 5, e297 and International Publication No. WO2016102664. The content of each of them is incorporated herein by reference in its entirety). In order to assess the activity of regulatory polynucleotides, the molecular scaffold that can be used is human pri-miRNA scaffold (e.g., miR155 scaffold), and the promoter can be CMV. HEK293T cells and reporter molecules (e.g., luciferase) can be used to determine activity in vitro.

[0239] In order to evaluate the best molecular scaffold for regulatory polynucleotides, regulatory polynucleotides are used in pri-miRNA scaffolds with CAG promoters. The construct is co-transfected with a reporter (e.g., a luciferase reporter) at 50 ng. Constructs that knock down more than 80% when co-transfected with 50 ng are considered effective. In one aspect, constructs with strong guide chain activity are preferred. The molecular scaffold can be processed in HEK293T cells by NGS to determine the guide-passenger ratio and processing variability.

[0240] To evaluate molecular scaffolds and regulatory polynucleotides in vivo, the molecular scaffold comprising the regulatory polynucleotide is packaged in AAV (e.g., the serotype can be AAV5 (see, e.g., the methods and constructs described in WO2015060722, the contents of which are incorporated herein by reference in their entirety)) and administered to an in vivo model, and the guide-passenger ratio, 5' and 3' end processing, guide to passenger strand ratio, and knockdown can be determined in different regions of the model (e.g., tissue regions).

[0241] In one embodiment, the selection of molecular scaffolds and regulatory polynucleotides is determined by comparing the regulatory polynucleotides in natural pri-miRNA and synthetic pri-miRNA. Regulatory polynucleotides can be, but are not limited to, targeting exons other than exon 1. In order to evaluate the activity of regulatory polynucleotides, molecular scaffolds are used together with CBA promoters. On the one hand, HEK293T cells, HeLa cells and reporter molecules (e.g., luciferase) can be used to determine activity in vitro, and the regulatory polynucleotides that knock down effective SOD1 show at least 80% SOD1 knockdown in the cells tested. In addition, it is believed that the most effective regulatory polynucleotides show as low as no significant passenger chain (p chain) activity. On the other hand, endogenous SOD1 is knocked down by in vitro transfection using HEK293T cells, HeLa cells and reporter molecules. Effective regulatory polynucleotides show that endogenous SOD1 knocks down more than 50%. In another aspect, the efficacy of endogenous SOD1 knockdown is assessed in different cell types (e.g., HEK293, HeLa, primary astrocytes, U251 astrocytes, SH-SY5Y neuronal cells, and fibroblasts from ALS patients) by infection (e.g., AAV2). Effective regulatory polynucleotides show greater than 60% knockdown of endogenous SOD1.

[0242] To evaluate molecular scaffolds and regulatory polynucleotides in vivo, molecular scaffolds containing regulatory polynucleotides are packaged in AAV and administered to an in vivo model, and the guide-passenger ratio, 5' and 3' end processing, passenger and guide strand ratio, and knockdown can be determined in different regions of the model (e.g., tissue regions). Molecular scaffolds can be processed from in vivo samples by NGS to determine the guide-passenger ratio and processing variability.

[0243] In one embodiment, regulatory polynucleotides are designed using at least one of the following properties: loop variants, seed mismatch / bulge / wobble variants, stem mismatch, loop variants and vassal stem mismatch variants, seed mismatch and basal stem mismatch variants, stem mismatch and basal stem mismatch variants, seed wobble and basal stem wobble variants, or stem sequence variants.

[0244] The present invention relates in part to RNA interference (RNAi)-induced inhibition of gene expression for the treatment of neurodegenerative diseases. siRNA duplexes or dsRNAs targeting the SOD1 gene are provided. Such siRNA duplexes or dsRNAs can silence expression of the SOD1 gene in cells (e.g., motor neurons), thereby ameliorating symptoms of ALS, such as motor neuron death and muscle atrophy. The SOD1 siRNA can be encoded in a polynucleotide in a recombinant AAV vector.

[0245] siRNA duplexes or dsRNAs targeting specific mRNAs can be designed and synthesized as part of a target polynucleotide targeting SOD1 in vitro and introduced into cells to activate the RNAi process.

[0246] siRNA molecules

[0247] The present invention relates to RNA interference (RNAi)-induced inhibition of gene expression for the treatment of neurodegenerative diseases. Provided herein are siRNA duplexes or encoded dsRNAs (collectively referred to herein as "siRNA molecules") that target a gene of interest. Such siRNA duplexes or encoded dsRNAs can reduce or silence gene expression in cells, such as, but not limited to, medium spiny neurons, cortical neurons, and / or astrocytes.

[0248] RNAi (also known as post-transcriptional gene silencing (PTGS), suppression or co-suppression) is a post-transcriptional gene silencing process in which RNA molecules inhibit gene expression in a sequence-specific manner, usually by causing the destruction of specific mRNA molecules. The active component of RNAi is a short / small double-stranded RNA (dsRNA), called small interfering RNA (siRNA), which typically contains 15-30 nucleotides (e.g., 19 to 25, 19 to 24, or 19 to 21 nucleotides) and a 2-nucleotide 3' overhang and matches the nucleic acid sequence of the target gene. These short RNA species may be naturally produced in vivo by Dicer-mediated cleavage of larger dsRNAs, and they are functional in mammalian cells.

[0249] Naturally expressed small RNA molecules, called microRNAs (miRNAs), cause gene silencing by regulating the expression of mRNAs. The RNA-induced silencing complex (RISC) containing miRNAs targets mRNAs that have perfect sequence complementarity with nucleotides 2-7 in the 5' region of the miRNA (which is called the seed region) and other base pairs in the 3' region. MiRNA-mediated downregulation of gene expression may be caused by cleavage of the target mRNA, translational inhibition of the target mRNA, or mRNA attenuation. The miRNA targeting sequence is usually located in the 3'-UTR of the target mRNA. A single miRNA can target more than 100 transcripts from multiple genes, and one mRNA can be targeted by different miRNAs.

[0250] The siRNA duplex or dsRNA targeting specific mRNA can be designed and synthesized in vitro and introduced into cells to activate RNAi processes. Elbashir et al. have demonstrated that 21 nucleotide siRNA duplexes (referred to as small interfering RNA) can achieve effective and specific gene knockdown in mammalian cells without inducing immune response (Elbashir SM et al., Nature, 2001, 411, 494-498). Since this preliminary report was published, post-transcriptional gene silencing by siRNA has rapidly become a powerful tool for genetic analysis in mammalian cells, and has the potential for producing new therapies.

[0251] In U.S. Patent Nos. 9,169,483 and 9,181,544 and International Patent Publication No. WO2015179525 (the contents of each of which are incorporated herein by reference in their entirety), RNAi molecules designed for targeting nucleic acid sequences encoding polyglutamine repeat proteins that cause polyglutamine expansion diseases such as Huntington's disease are described. U.S. Patent Nos. 9,169,483 and 9,181,544 and International Patent Publication No. WO2015179525 each provide an isolated RNA duplex comprising a first strand RNA (e.g., 15 consecutive nucleotides) and a second strand RNA (e.g., complementary to at least 12 consecutive nucleotides of the first strand), wherein the length of the RNA duplex is about 15 to 30 base pairs. The first strand RNA and the second strand RNA can be effectively connected by an RNA loop (~4 to 50 nucleotides) to form a hairpin structure, which can be inserted into an expression cassette. Non-limiting examples of loop moieties include SEQ ID NOs: 9-14 of U.S. Pat. No. 9,169,483 (the contents of which are incorporated herein by reference in their entirety). Non-limiting examples of RNA chains that can be used (whole or partial sequences) to form RNA duplexes include SEQ ID NOs: 1-8 of U.S. Pat. No. 9,169,483 and SEQ ID NOs: 1-11, 33-59, 208-210, 213-215, and 218-221 of U.S. Pat. No. 9,181,544 (the contents of each of which are incorporated herein by reference in their entirety). Non-limiting examples of RNAi molecules include SEQ ID NOs: 1-8 of U.S. Patent No. 9,169,483, SEQ ID NOs: 1-11, 33-59, 208-210, 213-215 and 218-221 of U.S. Patent No. 9,181,544, and SEQ ID NOs: 1, 6, 7 and 35-38 of International Patent Publication No. WO2015179525 (the contents of each of which are herein incorporated by reference in their entirety).

[0252] In vitro synthesized siRNA molecules can be introduced into cells to activate RNAi. Similar to endogenous dsRNA, when exogenous siRNA duplexes are introduced into cells, they can assemble to form RNA-induced silencing complex (RISC), which is a multi-unit complex that can interact with an RNA sequence (i.e., antisense strand) complementary to one of the two strands of the siRNA duplex. In this process, the sense strand (or passenger strand) of the siRNA is lost from the complex, while the antisense strand (or guide strand) of the siRNA is matched with its complementary RNA. In particular, the target of the RISC complex comprising siRNA is an mRNA with perfect sequence complementarity. Then, by cutting, releasing and degrading the target, siRNA-mediated gene silencing occurs.

[0253] Compared to the use of single-stranded (ss)-siRNA (e.g., antisense RNA or antisense oligonucleotides), siRNA duplexes consisting of a sense strand homologous to the target mRNA and an antisense strand complementary to the target mRNA have many advantages in terms of the efficiency of target RNA destruction. In many cases, higher concentrations of ss-siRNA are required to achieve effective gene silencing ability of the corresponding duplex.

[0254] Any of the foregoing molecules may be encoded by a viral genome.

[0255] Design and sequence of siRNA duplexes targeting target genes

[0256] The present invention provides small interfering RNA (siRNA) duplexes (and regulatory polynucleotides encoding them) that target mRNA to interfere with gene expression and / or protein production.

[0257] The encoded siRNA duplexes of the present invention comprise an antisense strand and a sense strand that hybridize together to form a duplex structure, wherein the antisense strand is complementary to the nucleic acid sequence of the target gene, and wherein the sense strand is homologous to the nucleic acid sequence of the target gene. In some aspects, the 5' end of the antisense strand has a 5' phosphate group, and the 3' end of the sense strand comprises a 3' hydroxyl group. In other aspects, the 3' end of each strand has no overhang, a single nucleotide overhang, or a two-nucleotide overhang.

[0258] Several guidelines for designing siRNAs have been proposed in the art. These guidelines generally recommend generating a double-stranded region of 19 nucleotides, a symmetrical 3' overhang of 2-3 nucleotides, a 5'-phosphate and a 3'-hydroxyl group, and targeting the region in the gene to be silenced. Other rules that may affect siRNA sequence preference include, but are not limited to: (i) A / U at the 5' end of the antisense strand; (ii) G / C at the 5' end of the sense strand; (iii) at least 5 A / U residues in the 5' end third of the antisense strand; and (iv) the absence of any GC stretches longer than 9 nucleotides. Based on such considerations and the specific sequence of the target gene, highly effective siRNA molecules necessary to suppress the expression of mammalian target genes can be easily designed.

[0259] According to the present invention, the siRNA molecule (for example, siRNA duplex or coded dsRNA) of target gene is designed.Such siRNA molecule can suppress gene expression and protein production specifically.In some respects, design siRNA molecule and be used for the gene variant in selectivity " knock-out " cell, i.e. the transcript of sudden change.In some respects, design siRNA molecule and be used for the gene variant in selectivity " knock-down " cell.In other respects, siRNA molecule can suppress or suppress wild type and mutant form of target gene.

[0260] In one embodiment, the siRNA molecules of the present invention comprise a sense strand and a complementary antisense strand, wherein the two strands hybridize together to form a duplex structure. The antisense strand has sufficient complementarity to the target mRNA sequence to guide target-specific RNAi, i.e., the siRNA molecule has a sequence sufficient to trigger the destruction of the target mRNA by the RNAi mechanism or process.

[0261] In one embodiment, the siRNA molecule of the present invention comprises a sense strand and a complementary antisense strand, wherein the two strands hybridize together to form a duplex structure, and wherein the start site of hybridization to the mRNA is between nucleotides 10-1000 on the target mRNA sequence. As non-limiting examples, the start site can be between nucleotides 10-20, 20-30, 30-40, 40-50, 60-70, 70-80, 80-90, 90-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 800-800, 800-900, 800-900, 800-10 ...

[0262] Between 700-70, 750-800, 800-850, 850-900, 900-950, 950-1000. As another non-limiting example, the start site can be nucleotide 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 8, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 1 43, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202 2, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261,262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、516、517、518、519、520、521、522、523、524、525、526、527、528、529、530、531、532、533、534、535、536、537、538、539、540、541、542、543、544、545、546、547、548、549、550、551、552、553、554、555、556、557、558、559、560、561、562、563、564、565、566、567、568、569、570、571、572、573、574、575、576、577、578、579、580、581、582、583、584、585、586、587、588、589、590、591、592、593、594、595、596、597、598、599、600、601、602、603、604、605、606、607、608、609、610、611、612、613、614、615、616、617、618、619、620、621、622、623、624、625、626、627、628、629、630、631、632、633、634、635、636、637、638、639、640、641、642、643、644、645、646、647、648、649、650、651、652、653、654、655、656、657、658、659、660、661、662、663、664、665、666、667、668、669、670、671、672、673、674、675、676、677、678、679、680、681、682、683、684、685、686、687、688、689、690、691、692、693、694、695、696、697、698、699、700、701、702、703、704、705、706、707、708、709、710、711、712、713、714、715、716、717、718、719、720、721、722、723、724、725、726、727、728、729、730、731、732、733、734、735、736、737、738、739、740、741、742、743、744、745、746、747、748、749、750、751、752、753、754、755、756、757、758、759、760、761、762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821 , 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 88 1, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999 and 1000.

[0295] In some embodiments, the antisense strand and the target mRNA sequence have 100% complementarity.The antisense strand can be complementary to any portion of the target mRNA sequence.

[0296] In other embodiments, the antisense strand and the target mRNA sequence comprise at least one mismatch. As non-limiting examples, the antisense strand and the target mRNA sequence have at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30-60%, 30-70%, 30-8 99%, 80-90%, 80-95%, 80-99%, 90-95%, 90-99%, or 95-99% complementarity.

[0297] In one embodiment, the siRNA or dsRNA comprises at least two sequences that are complementary to each other.

[0298] According to the present invention, the length of siRNA molecule is 10-50 or more nucleotides, that is, every chain comprises 10-50 nucleotides (or nucleotide analogs).Preferably, the length of siRNA molecule is about 15-30 nucleotides, for example every chain 15,16,17,18,19,20,21,22,23,24,25,26,27,28,29 or 30 nucleotides, wherein a chain is fully complementary to the target region.In one embodiment, the length of every chain of siRNA molecule is about 19 to 25,19 to 24 or 19 to 21 nucleotides.In one embodiment, the length of at least one chain of siRNA molecule is 19 nucleotides.In one embodiment, the length of at least one chain of siRNA molecule is 20 nucleotides.In one embodiment, the length of at least one chain of siRNA molecule is 21 nucleotides.In one embodiment, the length of at least one chain of siRNA molecule is 22 nucleotides.In one embodiment, the length of at least one chain of siRNA molecule is 23 nucleotides. In one embodiment, at least one strand of the siRNA molecule is 24 nucleotides in length. In one embodiment, at least one strand of the siRNA molecule is 25 nucleotides in length.

[0299] In some embodiments, the siRNA molecules of the present invention can be synthetic RNA duplexes comprising about 19 to about 25 nucleotides and having two overhanging nucleotides at the 3' end. In some aspects, the siRNA molecules can be unmodified RNA molecules. In other aspects, the siRNA molecules can comprise at least one modified nucleotide, such as a base, sugar, or backbone modification.

[0300] In one embodiment, the siRNA molecules of the present invention may comprise an antisense sequence and a sense sequence, or fragments or variants thereof. As non-limiting examples, the antisense sequence and the sense sequence have at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80% or more. , 30-90%, 30-95%, 30-99%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-99%, 60-70%, 60-80%, 60-90%, 60-95%, 60-99%, 70-80%, 70-90%, 70-95%, 70-99%, 80-90%, 80-95%, 80-99%, 90-95%, 90-99% or 95-99% complementarity.

[0301] In other embodiments, the siRNA molecules of the invention can be encoded in a plasmid vector, AAV particle, viral genome, or other nucleic acid expression vector for delivery to cells.

[0302] DNA expression plasmids can be used to stably express siRNA duplexes or dsRNA of the present invention in cells and achieve long-term inhibition of target gene expression. In one aspect, the sense and antisense strands of the siRNA duplexes are typically connected by a short spacer sequence, resulting in the expression of a stem-loop structure known as short hairpin RNA (shRNA). The hairpin is recognized and cut by Dicer, thereby generating a mature siRNA molecule.

[0303] According to the present invention, AAV particles comprising nucleic acids encoding siRNA molecules targeting mRNA are produced, and the AAV serotype can be any of the serotypes listed herein. Non-limiting examples of AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A, AAV-PHP.B, AAVPHP.B2, AAVPHP.B3, AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B -SGS, AAVPHP.B-AQP, AAVPHP.B-QQP, AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3, AAVG2B4, AAVG2B5 and variants thereof.

[0304] In some embodiments, the siRNA duplexes or encoded dsRNAs of the present invention suppress (or degrade) target mRNA. Thus, the siRNA duplexes or encoded dsRNAs can be used to substantially inhibit gene expression in cells, such as neurons. In some aspects, inhibition of gene expression refers to inhibition by at least about 20%, preferably at least about 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 99% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-100%, 20-150%, 20-200%, 20-300%, 20-400%, 20-500%, 20-600%, 20-700%, 20-800%, 20-900%, 20-1500%, 20-1500%, 20-2000%, 20-300%, 20-400%, 20-500%, 20-600%, 20-700%, 20-800%, 20-9 ... 0-95%, 20-100%, 30-40%, 30-45%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 35-45%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 45-50%, 45-55%, 50-60%, 50-70 %, 50-80%, 50-90%, 50-95%, 50-100%, 55-65%, 57-68%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 85-99%, 90-95%, 90-100% or 95-100%.Thus, the protein product of the target gene may be inhibited by at least about 20%, preferably at least about 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125 3%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 99% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 2 0-95%, 20-100%, 30-40%, 30-45%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 35-45%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 45-50%, 45-55%, 50-60%, 50-70

[0015] In some embodiments, the inhibition may be 30-40%. In some embodiments, the inhibition may be 30-45%. In some embodiments, the inhibition may be 35-45%. In some embodiments, the inhibition may be greater than 50%. In some embodiments, the inhibition may be 50-60%. In some embodiments, the inhibition may be greater than 60%. In some embodiments, the inhibition may be greater than 60%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. In some embodiments, the inhibition may be greater than 100%. As a non-limiting example, the inhibition may be 55-65%. As a non-limiting example, the inhibition may be 57-68%. As a non-limiting example, the inhibition may be 70-80%. As a non-limiting example, the inhibition may be 85-99%. As a non-limiting example, the inhibition may be 35%. As a non-limiting example, the inhibition may be 36%. As a non-limiting example, the inhibition may be 40%. As a non-limiting example, the inhibition may be 41%. As a non-limiting example, the inhibition may be 43%. As a non-limiting example, the inhibition may be 45%. As a non-limiting example, the inhibition may be 49%. As a non-limiting example, the inhibition may be 62%.As a non-limiting example, the inhibition may be 64%. As a non-limiting example, the inhibition may be 74%. As a non-limiting example, the inhibition may be 77%. As a non-limiting example, the inhibition may be 84%. As a non-limiting example, the inhibition may be 87%. As a non-limiting example, the inhibition may be 95%. As a non-limiting example, the inhibition may be 99%. As a non-limiting example, the inhibition may be 100%.

[0305] In one embodiment, the siRNA duplexes or encoded dsRNAs of the invention suppress (or degrade) target mRNA in spinal motor neurons. In some aspects, inhibition of gene expression refers to inhibition of at least about 20%, preferably at least about 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 99% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-100%, 20-150%, 20-200%, 20-300%, 20-400%, 20-500%, 20-600%, 20-700%, 20-800%, 20-900%, 20-1500%, 20-1500%, 20-2000%, 20-300%, 20-400%, 20-500%, 20-600%, 20-700%, 20-800%, 20-9 ... 0-95%, 20-100%, 30-40%, 30-45%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 35-45%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 45-50%, 45-55%, 50-60%, 50-70 %, 50-80%, 50-90%, 50-95%, 50-100%, 55-65%, 57-68%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 85-99%, 90-95%, 90-100% or 95-100%.Thus, the protein product of the target gene may be inhibited by at least about 20%, preferably at least about 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125 3%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 99% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 2 0-95%, 20-100%, 30-40%, 30-45%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 35-45%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 45-50%, 45-55%, 50-60%, 50-70

[0015] In some embodiments, the inhibition may be 30-45%. In some embodiments, the inhibition may be 35-45%. In some embodiments, the inhibition may be greater than 50%. In some embodiments, the inhibition may be greater than 60%. In some embodiments, the inhibition may be 50-60%. In some embodiments, the inhibition may be 55-65%. In some embodiments, the inhibition may be 55-65%. In some embodiments, the inhibition may be 50-60%. In some embodiments, the inhibition may be 55-65%. As a non-limiting example, the inhibition may be 57-68%. As a non-limiting example, the inhibition may be 70-80%. As a non-limiting example, the inhibition may be 85-99%. As a non-limiting example, the inhibition may be 35%. As a non-limiting example, the inhibition may be 36%. As a non-limiting example, the inhibition may be 40%. As a non-limiting example, the inhibition may be 41%. As a non-limiting example, the inhibition may be 43%. As a non-limiting example, the inhibition may be 45%. As a non-limiting example, the inhibition may be 49%. As a non-limiting example, the inhibition may be 62%. As a non-limiting example, the inhibition may be 64%.As a non-limiting example, the inhibition may be 74%. As a non-limiting example, the inhibition may be 77%. As a non-limiting example, the inhibition may be 84%. As a non-limiting example, the inhibition may be 87%. As a non-limiting example, the inhibition may be 95%. As a non-limiting example, the inhibition may be 99%. As a non-limiting example, the inhibition may be 100%.

[0306] In one embodiment, the siRNA duplexes or encoded dsRNAs of the invention suppress (or degrade) target mRNA in spinal cord motor neurons by 78%.

[0307] In one embodiment, the siRNA duplexes or encoded dsRNAs of the invention suppress (or degrade) target mRNA in spinal motor neurons by 45-55%.

[0308] In one embodiment, the siRNA duplexes or encoded dsRNAs of the invention suppress (or degrade) target mRNA in vg+ cells of motor neuron morphology. In some aspects, inhibition of gene expression refers to inhibition of at least about 20%, preferably at least about 30%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40% , 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 45-50%, 45-55%, 50-60%, 50-70%, 50-80 %, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.Thus, the protein product of the target gene may be inhibited by at least about 20%, preferably at least about 30%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125 4%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 45-50%, 45-55%, 50-60%, 50-70%, 50-80 %, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.

[0309] In one embodiment, the siRNA duplexes or encoded dsRNAs of the invention suppress (or degrade) target mRNA by 53% in vg+ cells with motor neuron morphology.

[0310] In one embodiment, the siRNA molecule comprises a miRNA seed that matches a target located in the guide strand. In another embodiment, the siRNA molecule comprises a miRNA seed that matches a target located in the passenger strand. In yet another embodiment, the siRNA duplex or encoded dsRNA targeting a gene of interest does not comprise a seed that matches a target located in either the guide strand or the passenger strand.

[0311] In one embodiment, the siRNA duplex or encoded dsRNA targeting a gene of interest can have almost no significant full-length off-target effects on the guide strand. In another embodiment, the siRNA duplex or encoded dsRNA targeting a gene of interest can have almost no significant full-length off-target effects on the passenger strand. The siRNA duplex or encoded dsRNA targeting a gene of interest can have less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 1-5%, 2-6%, 3-7%, 4-8%, 5-9%, 5-10% off-target effects on the passenger strand. In another embodiment, the siRNA duplex or encoded dsRNA targeting the gene of interest can have almost no significant full-length off-target effects for the guide strand or the passenger strand. The siRNA duplex or encoded dsRNA targeting the gene of interest can have less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 1-5%, 2-6%, 3-7%, 4-8%, 5-9%, 5-10% or less of the guide or passenger strand. %, 6-10%, 5-15%, 5-20%, 5-25%, 5-30%, 10-20%, 10-30%, 10-40%, 10-50%, 15-30%, 15-40%, 15-45%, 20-40%, 20-50%, 25-50%, 30-40%, 30-50%, 35-50%, 40-50%, 45-50% full-length off-target effects.

[0312] In one embodiment, the siRNA duplex or encoded dsRNA targeting the gene of interest can have high activity in vitro. In another embodiment, the siRNA molecule can have low activity in vitro. In yet another embodiment, the siRNA duplex or dsRNA targeting the gene of interest can have high guide strand activity and low passenger strand activity in vitro.

[0313] In one embodiment, the siRNA molecule has high guide strand activity and low passenger strand activity in vitro. The target knockdown (KD) of the guide strand can be at least 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5% or 100%. The target knockdown of the guide strand can be 40-50%, 45-50%, 50-55%, 50-60%, 60-65%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 60-99%, 60-99.5%, 60-100%, 65-70%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 65-99%, 65-99.5%,

[0314] 65-100%, 70-75%, 70-80%, 70-85%, 70-90%, 70-95%, 70-99%, 70-99.5%, 70-100%, 75-80%, 75-85%, 75-90%, 75-95%, 75-99%, 75-99.5%, 75-100%, 80-85%, 80-90%, 80-95%, 80 In some embodiments, the target of the guide strand is knocked down to a value greater than 70%. In some embodiments, the target of the guide strand is knocked down to a value greater than 60%.

[0315] In one embodiment, the siRNA duplexes are designed such that there are no miRNA seeds that match sense or antisense sequences other than the gene sequence of interest.

[0316] In one embodiment, the IC for the guide strand closest to the off-target 50 Greater than 100 times the IC of the guide strand against the target gene 50 As a non-limiting example, if the IC for the guide strand closest to the off-target 50 Greater than 100 times the IC of the guide strand against the target 50 , then the siRNA molecule is considered to have high guide strand selectivity and is used to inhibit the target gene in vitro.

[0317] In one embodiment, the 5' processing of the guide strand has the correct starting point (n) at the 5' end at least 75%, 80%, 85%, 90%, 95%, 99% or 100% of the time in vitro or in vivo. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct starting point (n) at the 5' end at least 99% of the time in vitro. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct starting point (n) at the 5' end at least 99% of the time in vivo. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct starting point (n) at the 5' end at least 90% of the time in vitro. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct starting point (n) at the 5' end at least 90% of the time in vivo. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct starting point (n) at the 5' end at least 85% of the time in vitro. As a non-limiting example, 5' processing of the guide strand is precise and has the correct start (n) at the 5' end at least 85% of the time in vivo.

[0318] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands in vitro or in vivo is 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:10, 2:9, 2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:3 :5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10 , 7:9, 7:8, 7:7, 7:6, 7:5, 7:4, 7:3, 7:2, 7:1, 8:10, 8:9, 8:8, 8:7, 8:6, 8:5, 8:4, 8:3, 8:2, 8:1, 9:10, 9:9, 9:8, 9:7, 9:6, 9:5, 9:4, 9:3, 9:2, 9:1, 10:10, 10:9, 10:8, 10:7, 10:6, 1 0:5, 10:4, 10:3, 10:2, 10:1, 1:99, 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5 or 99:1. The guide to passenger ratio refers to the ratio of the guide strand to the passenger strand after intracellular processing of the pri-miRNA. For example, a guide to passenger ratio of 80:20 means that there will be 8 guide strands for every 2 passenger strands processed from the precursor. As a non-limiting example, the guide to passenger strand ratio is 8:2 in vitro. As a non-limiting example, the guide to passenger strand ratio in vivo is 8:2. As a non-limiting example, the guide to passenger strand ratio in vitro is 9:1. As a non-limiting example, the guide to passenger strand ratio in vivo is 9:1.

[0325] In one embodiment, the guide to passenger (G:P) strand ratio ranges from 1-99, 1.3-99, 5-99, 10-99, 15-99, 20-99, 25-99, 30-99, 35-99, 40-99, 45-99, 50-99, 55-99, 60-99, 65-99, 70-99, 75-99, 80-99, 85-99, 90-99, 95-99, 1-10, 1-15, 1-20, 1-25, 1-30, 1-35, 1-40, 1-45, 1-50, 1-55, 1-60, 1-65, 1-70, 1-75, 1-80, 1-85, 1-90, 1-95, 5-10, 5-15, 1-15 5, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 10-15, 10-20, 10-25, 10-30, 10-35, 10-40, 10-45, 10-50, 10-55, 10-60, 10-65, 10-70, 10-75, 10-80, 10-85, 10-90, 10-95, 15-20, 15-25, 15-30, 15-35, 15-40, 15-45, 15-50, 15-55, 15-60, 15-65, 15-70 , 15-75, 15-80, 15-85, 15-90, 15-95, 20-25, 20-30, 20-35, 20-40, 20-45, 20-50, 20-55, 20-60, 20-65, 20-70, 20-75, 20-80, 20-85, 20-90, 20-95, 25- 30, 25-35, 25-40, 25-45, 25-50, 25-55, 25-60, 25-65, 25-70, 25-75, 25-80, 25-85, 25-90, 25-95, 30-35, 30-40, 30-45, 30-50, 30-55, 30-60, 30-65, 30 -70, 30-75, 30-80, 30-85, 30-90, 30-95, 35-40, 35-45, 35-50, 35-55, 35-60, 35-65, 35-70, 35-75, 35-80, 35-85, 35-90, 35-95, 40-45, 40-50, 40-55, 4 0-60, 40-65, 40-70, 40-75, 40-80, 40-85, 40-90, 40-95, 45-50, 45-55, 45-60, 45-65, 45-70, 45-75, 45-80, 45-85, 45-90, 45-95, 50-55, 50-60, 50-65,50-70, 50-75, 50-80, 50-85, 50-90, 50-95, 55-60, 55-65, 55-70, 55-75, 55-80, 55-85, 55-90, 55-95, 60-65, 60-70, 60-75, 60-80, 60-85, 60-90, 60-95, 95, 85-90, 85-95, 90-95, 65-70, 65-75, 65-80, 65-85, 65-90, 65-95, 70-75, 70-80, 70-85, 70-90, 70-95, 75-80, 75-85, 75-90, 75-95, 80-85, 80-90, 80-95, 85-90, 85-95, or 90-95. As a non-limiting example, the range of the guide to passenger ratio is 1.3 to 99. As a non-limiting example, the range of the guide to passenger ratio is 10 to 99.

[0326] In one embodiment, the guide to passenger (G:P) strand ratio is 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30. 0, 30.5, 31, 31.5, 32, 32.5, 33, 33.5, 34, 34.5, 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, 40, 40.5, 41, 41.5, 42, 42.5, 43, 43.5, 44, 44.5, 45, 45.5, 46, 46.5, 47, 47.5, 48, 48.5, 49, 49.5, 50, 50.5, 51, 51.5, 52, 52.5, 53 , 53.5, 54, 54.5, 55, 55.5, 56, 56.5, 57, 57.5, 58, 58.5, 59, 59.5, 60, 60.5, 61, 61.5, 62, 62.5, 63, 63.5, 64, 64.5, 65, 65.5, 66, 66.5, 67, 67.5, 68, 68.5, 69, 69.5, 70, 70.5, 71, 71.5, 72, 72.5, 73, 73.5, 74, 74.5, 75, 75.5, 76 , 76.5, 77, 77.5, 78, 78.5, 79, 79.5, 80, 80.5, 81, 81.5, 82, 82.5, 83, 83.5, 84, 84.5, 85, 85.5, 86, 86.5, 87, 87.5, 88, 88.5, 89, 89.5, 90, 90.5, 91, 91.5, 92, 92.5, 93, 93.5, 94, 94.5, 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, or 99. As a non-limiting example, the guide to passenger (G:P) strand ratio is 11.5. As a non-limiting example, the guide to passenger (G:P) strand ratio is 99.

[0327] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is greater than one.

[0328] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is greater than 2.

[0329] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is greater than 5.

[0330] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is greater than 10.

[0331] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is greater than 20.

[0332] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is greater than 50.

[0333] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is greater than 300.

[0334] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is 3:14.

[0335] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is greater than 400.

[0336] In one embodiment, the ratio of the expressed guide to passenger (G:P) (also known as antisense to sense) strands is 434.

[0337] In one embodiment, the ratio of guide to passenger (G:P) (also known as antisense to sense) strands expressed is at least 3:1.

[0338] In one embodiment, the ratio of guide to passenger (G:P) (also known as antisense to sense) strands expressed is at least 5:1.

[0339] In one embodiment, the ratio of guide to passenger (G:P) (also known as antisense to sense) strands expressed is at least 10:1.

[0340] In one embodiment, the ratio of guide to passenger (G:P) (also known as antisense to sense) strands expressed is at least 20:1.

[0341] In one embodiment, the ratio of guide to passenger (G:P) (also known as antisense to sense) strands expressed is at least 50:1.

[0342] In one embodiment, the ratio of passenger to guide (P:G) (also known as sense to antisense) strands expressed in vitro or in vivo is 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:10, 2:9, 2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:3 :5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10 , 7:9, 7:8, 7:7, 7:6, 7:5, 7:4, 7:3, 7:2, 7:1, 8:10, 8:9, 8:8, 8:7, 8:6, 8:5, 8:4, 8:3, 8:2, 8:1, 9:10, 9:9, 9:8, 9:7, 9:6, 9:5, 9:4, 9:3, 9:2, 9:1, 10:10, 10:9, 10:8, 10:7, 10:6, 1 0:5, 10:4, 10:3, 10:2, 10:1, 1:99, 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5 or 99:1. The passenger to guide ratio refers to the ratio of passenger strand to guide strand after intracellular processing of the pri-microRNA. For example, a passenger to guide ratio of 80:20 means that there will be 8 passenger strands for every 2 guide strands processed from the precursor. As a non-limiting example, the passenger to guide strand ratio is 80:20 in vitro. As a non-limiting example, the passenger to guide strand ratio in vivo is 80:20. As a non-limiting example, the passenger to guide strand ratio in vitro is 8:2. As a non-limiting example, the passenger to guide strand ratio in vivo is 8:2. As a non-limiting example, the passenger to guide strand ratio in vitro is 9:1. As a non-limiting example, the passenger to guide strand ratio in vivo is 9:1.

[0349] In one embodiment, the passenger to guide (P:G) strand ratio ranges from 1-99, 1.3-99, 5-99, 10-99, 15-99, 20-99, 25-99, 30-99, 35-99, 40-99, 45-99, 50-99, 55-99, 60-99, 65-99, 70-99, 75-99, 80-99, 85-99, 90-99, 95-99, 1-10, 1-15, 1-20, 1-25, 1-30, 1-35, 1-40, 1-45, 1-50, 1-55, 1-60, 1-65, 1-70, 1-75, 1-80, 1-85, 1-90, 1-95, 5-10, 5-15, 1-15 5, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 10-15, 10-20, 10-25, 10-30, 10-35, 10-40, 10-45, 10-50, 10-55, 10-60, 10-65, 10-70, 10-75, 10-80, 10-85, 10-90, 10-95, 15-20, 15-25, 15-30, 15-35, 15-40, 15-45, 15-50, 15-55, 15-60, 15-65, 15-70 , 15-75, 15-80, 15-85, 15-90, 15-95, 20-25, 20-30, 20-35, 20-40, 20-45, 20-50, 20-55, 20-60, 20-65, 20-70, 20-75, 20-80, 20-85, 20-90, 20-95, 25- 30, 25-35, 25-40, 25-45, 25-50, 25-55, 25-60, 25-65, 25-70, 25-75, 25-80, 25-85, 25-90, 25-95, 30-35, 30-40, 30-45, 30-50, 30-55, 30-60, 30-65, 30 -70, 30-75, 30-80, 30-85, 30-90, 30-95, 35-40, 35-45, 35-50, 35-55, 35-60, 35-65, 35-70, 35-75, 35-80, 35-85, 35-90, 35-95, 40-45, 40-50, 40-55, 4 0-60, 40-65, 40-70, 40-75, 40-80, 40-85, 40-90, 40-95, 45-50, 45-55, 45-60, 45-65, 45-70, 45-75, 45-80, 45-85, 45-90, 45-95, 50-55, 50-60, 50-65,50-70, 50-75, 50-80, 50-85, 50-90, 50-95, 55-60, 55-65, 55-70, 55-75, 55-80, 55-85, 55-90, 55-95, 60-65, 60-70, 60-75, 60-80, 60-85, 60-90, 60-95, 65-70, 65-75, 65-80, 65-85, 65-90, 65-95, 70-75, 70-80, 70-85, 70-90, 70-95, 75-80, 75-85, 75-90, 75-95, 80-85, 80-90, 80-95, 85-90, 85-95 or 90-95.

[0350] In one embodiment, the passenger to guide (P:G) strand ratio is 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30. 0, 30.5, 31, 31.5, 32, 32.5, 33, 33.5, 34, 34.5, 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, 40, 40.5, 41, 41.5, 42, 42.5, 43, 43.5, 44, 44.5, 45, 45.5, 46, 46.5, 47, 47.5, 48, 48.5, 49, 49.5, 50, 50.5, 51, 51.5, 52, 52.5, 53 , 53.5, 54, 54.5, 55, 55.5, 56, 56.5, 57, 57.5, 58, 58.5, 59, 59.5, 60, 60.5, 61, 61.5, 62, 62.5, 63, 63.5, 64, 64.5, 65, 65.5, 66, 66.5, 67, 67.5, 68, 68.5, 69, 69.5, 70, 70.5, 71, 71.5, 72, 72.5, 73, 73.5, 74, 74.5, 75, 75.5, 76 , 76.5, 77, 77.5, 78, 78.5, 79, 79.5, 80, 80.5, 81, 81.5, 82, 82.5, 83, 83.5, 84, 84.5, 85, 85.5, 86, 86.5, 87, 87.5, 88, 88.5, 89, 89.5, 90, 90.5, 91, 91.5, 92, 92.5, 93, 93.5, 94, 94.5, 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, or 99.

[0351] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is greater than one.

[0352] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is greater than 2.

[0353] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is greater than 5.

[0354] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is greater than 10.

[0355] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is greater than 20.

[0356] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is greater than 50.

[0357] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is at least 3:1.

[0358] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is at least 5:1.

[0359] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is at least 10:1.

[0360] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is at least 20:1.

[0361] In one embodiment, the ratio of expressed passenger to guide (P:G) (also known as sense to antisense) strands is at least 50:1.

[0362] In one embodiment, a passenger-guide strand duplex is considered efficient when the pri-microRNA or pre-microRNA exhibits a guide to passenger strand ratio greater than 2-fold when calculatedly processed as demonstrated by methods known in the art and described herein. As non-limiting examples, when measuring processing, the pri-microRNA or pre-microRNA demonstrates a guide to passenger ratio of greater than 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, or 2-5-fold, 2-10-fold, 2-15-fold, 3-5-fold, 3-10-fold, 3-15-fold, 4-5-fold, 4-10-fold, 4-15-fold, 5-10-fold, 5-15-fold, 6-10-fold, 6-15-fold, 7-10-fold, 7-15-fold, 8-10-fold, 8-15-fold, 9-10-fold, 9-15-fold, 10-15-fold, 11-15-fold, 12-15-fold, 13-15-fold, or 14-15-fold.

[0363] In one embodiment, the vector genome encoding the dsRNA comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or greater than 99% of the full length of the construct. As a non-limiting example, the vector genome comprises a sequence that is at least 80% of the full length sequence of the construct.

[0364] In one embodiment, siRNA molecules can be used to silence wild-type or mutant forms of a target gene by targeting at least one exon on the target gene sequence. Exons can be exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, exon 22, exon 23, exon 24, exon 25, exon 26, exon 27, exon 28, exon 29, exon 30, exon 31, exon 32, exon 33, exon 34 , exon 35, exon 36, exon 37, exon 38, exon 39, exon 40, exon 41, exon 42, exon 43, exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54, exon 55, exon 56, exon 57, exon 58, exon 59, exon 60, exon 61, exon 62, exon 63, exon 64, exon 65, exon 66 and / or exon 67.

[0365] Design and sequence of siRNA duplexes targeting the SOD1 gene

[0366] The present invention provides small interfering RNA (siRNA) duplexes (and regulatory polynucleotides encoding them) that target SOD1 mRNA to interfere with SOD1 gene expression and / or SOD1 protein production.

[0367] The encoded siRNA duplexes of the present invention comprise an antisense strand and a sense strand that hybridize together to form a duplex structure, wherein the antisense strand is complementary to the nucleic acid sequence of the target SOD1 gene, and wherein the sense strand is homologous to the nucleic acid sequence of the target SOD1 gene. In some aspects, the 5' end of the antisense strand comprises a 5' phosphate group, and the 3' end of the sense strand comprises a 3' hydroxyl group. In other aspects, the 3' end of each strand has no overhang, one overhang, or two overhangs.

[0368] Several guidelines for designing siRNAs have been proposed in the art. These guidelines generally recommend creating a 19-nucleotide double-stranded region, a symmetrical 2-3 nucleotide 3' overhang, a 5'-phosphate, and a 3'-hydroxyl group, targeting the region within the gene to be silenced. Other rules that may influence siRNA sequence preference include, but are not limited to: (i) A / U at the 5' end of the antisense strand; (ii) G / C at the 5' end of the sense strand; (iii) at least 5 A / U residues in the 5'-terminal third of the antisense strand; and (iv) the absence of any GC stretches longer than 9 nucleotides. Based on these considerations and the specific sequence of the target gene, highly effective siRNA molecules necessary to suppress SOD1 gene expression can be easily designed.

[0369] According to the present invention, siRNA molecules (e.g., siRNA duplexes or encoded dsRNA) are designed to target the SOD1 gene. Such siRNA molecules can specifically suppress SOD1 gene expression and protein production. In some aspects, siRNA molecules are designed and used to selectively "knock out" SOD1 gene variants in cells, i.e., mutant SOD1 transcripts identified in patients with ALS disease. In some aspects, siRNA molecules are designed and used to selectively "knock down" SOD1 gene variants in cells. In other aspects, siRNA molecules can inhibit or suppress wild-type and mutant SOD1 genes.

[0370] In one embodiment, the siRNA molecule of the present invention comprises a sense strand and a complementary antisense strand, wherein the two strands hybridize together to form a duplex structure. The antisense strand has sufficient complementarity to the SOD1 mRNA sequence to direct target-specific RNAi, i.e., the siRNA molecule has a sequence sufficient to trigger the destruction of the target mRNA through the RNAi mechanism or process.

[0371] In one embodiment, the siRNA molecule of the present invention comprises a sense strand and a complementary antisense strand, wherein the two strands hybridize together to form a duplex structure, and wherein the start site of hybridization to SOD1 mRNA is between nucleotides 15-1000 on the SOD1 mRNA sequence. As non-limiting examples, the start site can be between nucleotides 15-25, 15-50, 15-75, 15-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-70, 750-800, 80 ...

[0372] 800-850, 850-900, 900-950 and 950-1000. As another non-limiting example, the start site can be nucleotides 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 74, 76, 77, 78, 149, 153, 157, 160, 177, 192, 193, 195, 196, 197, 198, 199, 206, 209, 210, 239, 241, 261, 263, 264, 268, 269, 276, 278, 281, 284, 290, 291, 295, 296, 316, 317, 329, 330, 337, 350, 351, 352, 354, 357, 358, 364, 375, 378, 383, 384, 390, 392, 395, 404, 406, 417, 418, 469, 470, 475, 476, 480, 487, 494, 496, 497, 501, 504, 515, 518, 522, 523, 524, 552, 554, 555, 562, 576, 577, 578, 579, 581, 583, 584, 585, 587, 588, 589, 593, 594, 595, 596, 597, 598, 599, 602, 607, 608, 609, 610, 611, 612, 613, 616, 621, 633, 635, 636, 639, 640, 641, 642, 643, 644, 645, 654, 660, 661, 666, 667, 668, 669, 673, 677, 692, 698, 699, 700, 701, 706, 749, 770, 772, 775, 781, 800, 804, 819, 829, 832, 833, 851, 854, 855, 857, 858, 859, 861, 869, 891, 892, 906, 907, 912, 913, 934, 944 and 947.

[0375] In some embodiments, the antisense strand and the target SOD1 mRNA sequence have 100% complementarity.The antisense strand can be complementary to any portion of the target SOD1 mRNA sequence.

[0376] In other embodiments, the antisense strand and the target SOD1 mRNA sequence comprise at least one mismatch. As non-limiting examples, the antisense strand and the target SOD1 mRNA sequence have at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, %, 30-95%, 30-99%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-99%, 60-70%, 60-80%, 60-90%, 60-95%, 60-99%, 70-80%, 70-90%, 70-95%, 70-99%, 80-90%, 80-95%, 80-99%, 90-95%, 90-99% or 95-99% complementarity.

[0377] In one embodiment, the siRNA or dsRNA targeting SOD1 comprises at least two sequences that are complementary to each other.

[0378] According to the present invention, the length of the siRNA molecule targeting SOD1 is about 10-50 or more nucleotides, that is, each strand comprises 10-50 nucleotides (or nucleotide analogs). Preferably, the siRNA molecule is about 15-30 nucleotides in length, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides per strand, wherein one strand is substantially complementary to the target region. In one embodiment, each strand of the siRNA molecule is about 19 to 25, 19 to 24, or 19 to 21 nucleotides in length. In one embodiment, at least one strand of the siRNA molecule is 19 nucleotides in length. In one embodiment, at least one strand of the siRNA molecule is 20 nucleotides in length. In one embodiment, at least one strand of the siRNA molecule is 21 nucleotides in length. In one embodiment, at least one strand of the siRNA molecule is 22 nucleotides in length. In one embodiment, at least one strand of the siRNA molecule is 23 nucleotides in length. In one embodiment, at least one strand of the siRNA molecule is 24 nucleotides in length. In one embodiment, at least one strand of the siRNA molecule is 25 nucleotides in length.

[0379] In some embodiments, the siRNA molecules targeting SOD1 of the present invention can be synthetic RNA duplexes comprising about 19 to about 25 nucleotides and two overhanging nucleotides at the 3' end. In some aspects, the siRNA molecules can be unmodified RNA molecules. In other aspects, the siRNA molecules can comprise at least one modified nucleotide, such as a base, sugar, or backbone modification.

[0380] In one embodiment, the siRNA molecules targeting SOD1 of the present invention may comprise a nucleotide sequence such as, but not limited to, the antisense (guide) sequences in Table 2 or fragments or variants thereof. As non-limiting examples, the antisense sequence of the siRNA molecules used in the present invention is at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30-60%, 30- -70%, 30-80%, 30-90%, 30-95%, 30-99%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-99%, 60-70%, 60-80%, 60-90%, 60-95%, 60-99%, 70-80%, 70-90%, 70-95%, 70-99%, 80-90%, 80-95%, 80-99%, 90-95%, 90-99% or 95-99%. As another non-limiting example, the antisense sequence for use in the siRNA molecules of the present invention comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or more consecutive nucleotides of the nucleotide sequence in Table 2.As yet another non-limiting example, the antisense sequence used in the siRNA molecules of the present invention comprises nucleotides 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 2 to 22, 2 to 21, 2 to 20, 2 to 19, 2 to 18, 2 to 17, 2 to 16, 2 to 15, 2 to 14, 2 to 13, 2 to 12, 2 to 11, 2 to 10, 2 to 9, 2 to 8, 3 to 22, 3 to 21, 3 to 20, 3 to 19, 3 to 18, 3 to 17, 3 to 16, 3 to 15, 3 to 14, 14, 3 to 13, 3 to 12, 3 to 11, 3 to 10, 3 to 9, 3 to 8, 4 to 22, 4 to 21, 4 to 20, 4 to 19, 4 to 18, 4 to 17, 4 to 16, 4 to 15, 4 to 14, 4 to 13, 4 to 12, 4 to 11, 4 to 10, 4 to 9, 4 to 8, 5 to 22, 5 to 21, 5 to 20, 5 to 19, 5 to 18, 5 to 17, 5 to 16, 5 to 15, 5 to 14, 5 to 13, 5 to 12, 5 to 11, 5 to 10, 5 to 9, 5 to 8, 6 to 22, 6 to 21, 6 to 20, 6 to 19, 6 to 18, 6 to 17, 6 to 16, 6 to 15, 6 to 14, 6 to 13, 6 to 1 2, 6 to 11, 6 to 10, 7 to 22, 7 to 21, 7 to 20, 7 to 19, 7 to 18, 7 to 17, 7 to 16, 7 to 15, 7 to 14, 7 to 13, 7 to 12, 8 to 22, 8 to 21, 8 to 20, 8 to 19, 8 to 18, 8 to 17, 8 to 16, 8 to 15, 8 to 14, 8 to 13, 8 to 12, 9 to 22, 9 to 21, 9 to 20, 9 to 19, 9 to 18, 9 to 17, 9 to 16, 9 to 15, 9 to 14, 10 to 22, 10 to 21, 10 to 20, 10 to 19, 10 to 18, 10 to 17, 10 to 16, 10 to 15, 10 to 14, 11 to 22, 11 to 17, 18 to 22, 18 to 21, 19 to 20, 19 to 21, 18 to 20, 19 to 22, 18 to 21, 19 to 20, 19 to 22, 18 to 21, 19 to 20, 19 to 22, 18 to 21, 19 to 22, 18 to 21, 19 to 22, 18 to 21, 19 to 22, 18 to 22, or 18 to 22.

[0381] Table 2. Antisense sequences

[0382] Antisense ID sequence Serial number A-4000 UCACCACAAGCCAAACGACUU 5 A-4001 UGAUUAAAGUGAGGACCUGUU 6 A-4002 UAUUAAAGUGAGGACCUGCUU 7 A-4003 UACACCACAAGCCAAACGAUU 8 A-4004 GAUUAAAGUGAGGACCUGCUU 9 A-4005 UCACCACAAGCCAAACGACUUU 10 A-4006 UGCCAGCAGUCACAUUGCCUU 11 A-4007 UAACAGAUGAGUUAAGGGGUU 12 A-4008 UAUUAAAGUGAGGACCUGCdTdT 13 A-4009 UACACCACAAGCCAAACGAdTdT 14 A-4010 UUGUUUAUUGGGCGAUCCCdTdT 15 A-4011 UGUUUAUUGGGCGAUCCCAdTdT 16 A-4012 UCACCACAAGCCAAACGACdTdT 17 A-4013 UGAUUAAAGUGAGGACCUGdTdT 18 A-4014 UUUUAUUGGGCGAUCCCAAdTdT 19 A-4015 UGUCAGCAGUCACAUUGCCdTdT 20 A-4016 UGCGAUCCCAAUUACACCAdTdT 21

[0383] In one embodiment, the siRNA molecules targeting SOD1 of the present invention may comprise a nucleotide sequence such as, but not limited to, a sense (passenger) sequence or a fragment or variant thereof in Table 3. As non-limiting examples, the sense sequence of the siRNA molecules used in the present invention is at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30-60%, 30- -70%, 30-80%, 30-90%, 30-95%, 30-99%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-99%, 60-70%, 60-80%, 60-90%, 60-95%, 60-99%, 70-80%, 70-90%, 70-95%, 70-99%, 80-90%, 80-95%, 80-99%, 90-95%, 90-99% or 95-99%. As another non-limiting example, the sense sequence of the siRNA molecules used in the present invention comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or more consecutive nucleotides of the nucleotide sequence in Table 3.As yet another non-limiting example, the sense sequence used in the siRNA molecules of the present invention comprises nucleotides 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 2 to 22, 2 to 21, 2 to 20, 2 to 19, 2 to 18, 2 to 17, 2 to 16, 2 to 15, 2 to 14, 2 to 13, 2 to 12, 2 to 11, 2 to 10, 2 to 9, 2 to 8, 3 to 22, 3 to 21, 3 to 20, 3 to 19, 3 to 18, 3 to 17, 3 to 16, 3 to 15, 3 to 14, 14, 3 to 13, 3 to 12, 3 to 11, 3 to 10, 3 to 9, 3 to 8, 4 to 22, 4 to 21, 4 to 20, 4 to 19, 4 to 18, 4 to 17, 4 to 16, 4 to 15, 4 to 14, 4 to 13, 4 to 12, 4 to 11, 4 to 10, 4 to 9, 4 to 8, 5 to 22, 5 to 21, 5 to 20, 5 to 19, 5 to 18, 5 to 17, 5 to 16, 5 to 15, 5 to 14, 5 to 13, 5 to 12, 5 to 11, 5 to 10, 5 to 9, 5 to 8, 6 to 22, 6 to 21, 6 to 20, 6 to 19, 6 to 18, 6 to 17, 6 to 16, 6 to 15, 6 to 14, 6 to 13, 6 to 1 2, 6 to 11, 6 to 10, 7 to 22, 7 to 21, 7 to 20, 7 to 19, 7 to 18, 7 to 17, 7 to 16, 7 to 15, 7 to 14, 7 to 13, 7 to 12, 8 to 22, 8 to 21, 8 to 20, 8 to 19, 8 to 18, 8 to 17, 8 to 16, 8 to 15, 8 to 14, 8 to 13, 8 to 12, 9 to 22, 9 to 21, 9 to 20, 9 to 19, 9 to 18, 9 to 17, 9 to 16, 9 to 15, 9 to 14, 10 to 22, 10 to 21, 10 to 20, 10 to 19, 10 to 18, 10 to 17, 10 to 16, 10 to 15, 10 to 14, 11 to 22, 11 to 17, 18 to 22, 18 to 21, 19 to 20, 19 to 21, 18 to 20, 19 to 22, 18 to 21, 19 to 20, 19 to 22, 18 to 21, 19 to 20, 19 to 22, 18 to 21, 19 to 22, 18 to 21, 19 to 22, 18 to 21, 19 to 22, 18 to 22, or 18 to 22.

[0384] Table 3. Sense sequences

[0385]

[0386]

[0387] In one embodiment, the siRNA molecule targeting SOD1 of the present invention may comprise an antisense sequence from Table 2 and a sense sequence from Table 3, or a fragment or variant thereof. As non-limiting examples, the antisense sequence and the sense sequence have at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80% or more. , 30-90%, 30-95%, 30-99%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-99%, 60-70%, 60-80%, 60-90%, 60-95%, 60-99%, 70-80%, 70-90%, 70-95%, 70-99%, 80-90%, 80-95%, 80-99%, 90-95%, 90-99% or 95-99% complementarity.

[0388] In one embodiment, the siRNA molecules targeting SOD1 of the present invention may comprise the sense and antisense siRNA duplexes described in Table 4. As non-limiting examples, these siRNA duplexes can be tested for their in vitro inhibitory activity on endogenous SOD1 gene expression.

[0389] Table 4. Sense and antisense strand sequences of SOD1 dsRNA

[0390]

[0391]

[0392]

[0393]

[0394] In other embodiments, the siRNA molecules targeting SOD1 of the present invention can be encoded in plasmid vectors, AAV particles, viral genomes or other nucleic acid expression vectors for delivery to cells.

[0395] DNA expression plasmids can be used to stably express the SOD1-targeting siRNA duplexes or dsRNAs of the present invention in cells, achieving long-term inhibition of target gene expression. In one aspect, the sense and antisense strands of the siRNA duplex are typically connected by a short spacer sequence, resulting in the expression of a stem-loop structure known as a short hairpin RNA (shRNA). The hairpin is recognized and cleaved by Dicer, generating a mature siRNA molecule.

[0396] According to the present invention, AAV particles containing nucleic acids encoding siRNA molecules targeting SOD1 mRNA are produced, and the AAV serotype can be any of the serotypes listed herein. Non-limiting examples of AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A and / or AAV-PHP.B, AAVPHP.B2, AAVPHP.B3, AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B- B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP, AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3, AAVG2B4, AAVG2B5 and variants thereof.

[0397] In some embodiments, the siRNA duplexes or encoded dsRNAs of the present invention suppress (or degrade) SOD1 mRNA. Thus, the siRNA duplexes or encoded dsRNAs can be used to substantially inhibit the expression of the SOD1 gene in a cell. In some aspects, inhibition of SOD1 gene expression refers to inhibition of at least about 20%, preferably at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40 -50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%. Thus, the protein product of the target gene may be inhibited by at least about 20%, preferably at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%. %, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.

[0398] According to the present invention, siRNA molecules are designed and tested for their ability to reduce SOD1 mRNA levels in cultured cells. Such siRNA molecules can form duplexes, such as, but not limited to, those listed in Table 4. As non-limiting examples, the siRNA duplexes can be siRNA duplex IDs: D-4000 to D-4025.

[0399] In one embodiment, the siRNA molecule comprises a miRNA seed that matches SOD1 in the guide strand. In another embodiment, the siRNA molecule comprises a miRNA seed that matches SOD1 in the passenger strand. In yet another embodiment, the siRNA duplex or encoded dsRNA targeting the SOD1 gene does not comprise a seed that matches SOD1 in either the guide strand or the passenger strand.

[0400] In one embodiment, the siRNA duplex or encoded dsRNA targeting the SOD1 gene may have almost no significant full-length off-target effects on the guide strand. In another embodiment, the siRNA duplex or encoded dsRNA targeting the SOD1 gene may have almost no significant full-length off-target effects on the passenger strand. The siRNA duplex or encoded dsRNA targeting the SOD1 gene may have less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 1-5%, 2-6%, 3-7%, 4-8%, 5-9%, 5-10%, 6-7%, 7-8%, 8-9%, 9- ...8-9%, 9-10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 1-5%, 2-6%, 3-7%, 4-8%, 5-9%, 5-10%, 6-7%, In another embodiment, the siRNA duplex or encoded dsRNA targeting the SOD1 gene can have almost no significant full-length off-target effects for the guide strand or the passenger strand. The siRNA duplexes or encoded dsRNAs targeting the SOD1 gene may have less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 1-5%, 2-6%, 3-7%, 4-8%, 5-9%, 5-10%, 5-11%, 5-12%, 5-13%, 5-14%, 5-15%, 5-16%, 5-17%, 5-18%, 5-20%, 5-25%, 5-26%, 5-27%, 5-28%, 5-30%, 5-31%, 5-32%, 5-33%, 5-34%, 5-35%, 5-36%, 5-37%, 5-38%, 5-40%, 5-5 0%, 6-10%, 5-15%, 5-20%, 5-25%, 5-30%, 10-20%, 10-30%, 10-40%, 10-50%, 15-30%, 15-40%, 15-45%, 20-40%, 20-50%, 25-50%, 30-40%, 30-50%, 35-50%, 40-50%, 45-50% full-length off-target effects.

[0401] In one embodiment, the siRNA duplex or encoded dsRNA targeting the SOD1 gene can have high activity in vitro. In another embodiment, the siRNA molecule can have low activity in vitro. In yet another embodiment, the siRNA duplex or dsRNA targeting the SOD1 gene can have high guide strand activity and low passenger strand activity in vitro.

[0402] In one embodiment, the siRNA molecule targeting SOD1 has high guide strand activity and low passenger strand activity in vitro. The target knockdown (KD) of the guide strand can be at least 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5% or 100%. The target knockdown of the guide strand can be 40-50%, 45-50%, 50-55%, 50-60%, 60-65%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 60-99%, 60-99.5%, 60-100%, 65-70%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 65-99%, 65-99.5%, 65-100%, 70-75%, 70-80%, 70-85%, 70-90%, 70-95%, 70-99%, 70-99.5%. %, 70-100%, 75-80%, 75-85%, 75-90%, 75-95%, 75-99%, 75-99.5%, 75-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-99.5%, 80-100%, 85-90%, 85-95%, 85-99%, 85-99.5%, 85-100%, 90-95%, 90-99%, 90-99.5%, 90-100%, 95-99%, 95-99.5%, 95-100%, 99-99.5%, 99-100% or 99.5-100%. As a non-limiting example, the guide strand has a target knockdown (KD) greater than 70%.As a non-limiting example, the guide strand has a target knockdown (KD) greater than 60%.

[0403] In one embodiment, siRNA duplexes targeting SOD1 are designed such that there are no miRNA seeds that match sense or antisense sequences that are not SOD1 sequences.

[0404] In one embodiment, the IC of the guide strand in the SOD1-targeting siRNA duplex closest to the off-target 50 Greater than 100 times the IC of the guide strand against the target gene SOD1 50 As a non-limiting example, if the IC for the guide strand closest to the off-target 50 Greater than 100 times the IC of the guide strand against the target 50 , it is believed that the siRNA molecule has high guide strand selectivity for inhibiting SOD1 in vitro.

[0405] In one embodiment, the 5' processing of the guide strand of the siRNA duplex targeting SOD1 has the correct start point (n) at the 5' end at least 75%, 80%, 85%, 90%, 95%, 99% or 100% of the time in vitro or in vivo. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct start point (n) at the 5' end at least 99% of the time in vitro. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct start point (n) at the 5' end at least 99% of the time in vivo. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct start point (n) at the 5' end at least 90% of the time in vitro. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct start point (n) at the 5' end at least 90% of the time in vivo. As a non-limiting example, the 5' processing of the guide strand is accurate and has the correct start point (n) at the 5' end at least 85% of the time in vitro. As a non-limiting example, 5' processing of the guide strand is precise and has the correct start (n) at the 5' end at least 85% of the time in vivo.

[0406] In one embodiment, 5' processing of the guide strand of a siRNA duplex targeting SOD1 has a correct start (n) in the range of 75-95%, 75-90%, 75-85%, 75-80%, 80-95%, 80-90%, 80-85%, 85-95%, 85-90% or 90-95% at the 5' end. As a non-limiting example, 5' processing of the guide strand of a siRNA duplex targeting SOD1 has a correct start (n) in the range of 75-95% at the 5' end.

[0407] In one embodiment, 5' processing of the guide strand of a siRNA duplex targeting SOD1 is 75%, 75.1%, 75.2%, 75.3%, 75.4%, 75.5%, 75.6%, 75.7%, 75.8%, 75.9%, 76%, 76.1%, 76.2%, 76.3%, 76.4%, 76.5%, 76.6%, 76.7%, 76.8%, 76.9%, 77%, 77.1%, 77.2%, 77.3%, 77.4%, 77.5%, 77.6%, 77.7%, 77.8%, 77.9%, 78%, 78.1%, 78.2%, 78.3%, 78.4%, 78.5%, 78.6%, 78.7%, 78.8%, 78.9%, .6%, 78.7%, 78.8%, 78.9%, 79%, 79.1%, 79.2%, 79.3%, 79.4%, 79.5%, 79.6%, 79.7%, 79.8%, 79.9%, 80%, 80.1%, 80.2%, 80.3%, 80.4%, 80.5%, 80.6%, 80.7% , 80.8%, 80.9%, 81%, 81.1%, 81.2%, 81.3%, 81.4%, 81.5%, 81.6%, 81.7%, 81.8%, 81.9%, 82%, 82.1%, 82.2%, 82.3%, 82.4%, 82.5%, 82.6%, 82.7%, 82.8%, 82 .9%, 83%, 83.1%, 83.2%, 83.3%, 83.4%, 83.5%, 83.6%, 83.7%, 83.8%, 83.9%, 84%, 84.1%, 84.2%, 84.3%, 84.4%, 84.5%, 84.6%, 84.7%, 84.8%, 84.9%, 85%, 85.1%, 85.2%, 85.3%, 85.4%, 85.5%, 85.6%, 85.7%, 85.8%, 85.9%, 86%, 86.1%, 86.2%, 86.3%, 86.4%, 86.5%, 86.6%, 86.7%, 86.8%, 86.9%, 87%, 87.1%, 87. 2%, 87.3%, 87.4%, 87.5%, 87.6%, 87.7%, 87.8%, 87.9%, 88%, 88.1%, 88.2%, 88.3%, 88.4%, 88.5%, 88.6%, 88.7%, 88.8%, 88.9%, 89%, 89.1%, 89.2%, 89.3%, 89.4%, 89.5%, 89.6%, 89.7%, 89.8%, 89.9%, 90%, 90.1%, 90.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9%, 91%, 91.1%, 91.2%, 91.3%, 91.4%, 91.94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9% or 95% of the expressed constructs had the correct start point (n). As a non-limiting example, 5' processing of the guide strand of a siRNA duplex targeting SOD1 had a correct start (n) at the 5' end for 81% of the expressed constructs. As a non-limiting example, 5' processing of the guide strand of a siRNA duplex targeting SOD1 had a correct start (n) at the 5' end for 90% of the expressed constructs.

[0429] In one embodiment, a passenger-guide strand duplex against SOD1 is considered effective when the pri-microRNA or pre-microRNA demonstrates a guide strand to passenger strand ratio of greater than 2-fold when processed as measured by methods known in the art and described herein. As non-limiting examples, when measuring processing, the pri-microRNA or pre-microRNA demonstrates a guide to passenger strand ratio of greater than 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, or 2-5-fold, 2-10-fold, 2-15-fold, 3-5-fold, 3-10-fold, 3-15-fold, 4-5-fold, 4-10-fold, 4-15-fold, 5-10-fold, 5-15-fold, 6-10-fold, 6-15-fold, 7-10-fold, 7-15-fold, 8-10-fold, 8-15-fold, 9-10-fold, 9-15-fold, 10-15-fold, 11-15-fold, 12-15-fold, 13-15-fold, or 14-15-fold.

[0430] In one embodiment, siRNA molecules can be used to silence wild-type or mutant SOD1 by targeting at least one exon on the SOD1 sequence. Exons can be exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, exon 22, exon 23, exon 24, exon 25, exon 26, exon 27, exon 28, exon 29, exon 30, exon 31, exon 32, exon 33, exon 34, , exon 35, exon 36, exon 37, exon 38, exon 39, exon 40, exon 41, exon 42, exon 43, exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54, exon 55, exon 56, exon 57, exon 58, exon 59, exon 60, exon 61, exon 62, exon 63, exon 64, exon 65, exon 66 and / or exon 67.

[0431] In one embodiment, the guide strand accounts for 0.001-0.6%, 0.005-0.6%, 0.01-0.6%, 0.015-0.6%, 0.02-0.6%, 0.025-0.6%, 0.03-0.6%, 0.035-0.6%, 0.04-0.6%, 0.045-0.6%, 0.05-0.6%, 0.055-0.6%, 0.06-0.6%, 0.065-0.6%, 0.07-0.6%, 0.075-0.6%, 0.08-0.6%, 0.085-0.6%, 0.09-0.6%, 0.095-0.6%, 0.1-0.6%, 0.1 5-0.6%, 0.2-0.6%, 0.25-0.6%, 0.3-0.6%, 0.35-0.6%, 0.4-0.6%, 0.45-0.6%, 0.5-0.6%, 0.55-0.6%, 0.001-0.5%, 0.005-0.5%, 0.01-0.5%, 0.015-0.5% , 0.02-0.5%, 0.025-0.5%, 0.03-0.5%, 0.035-0.5%, 0.04-0.5%, 0.045-0.5%, 0.05-0.5%, 0.055-0.5%, 0.06-0.5%, 0.065-0.5%, 0.07-0.5%, 0.075-0.5 %, 0.08-0.5%, 0.085-0.5%, 0.09-0.5%, 0.095-0.5%, 0.1-0.5%, 0.15-0.5%, 0.2-0.5%, 0.25-0.5%, 0.3-0.5%, 0.35-0.5%, 0.4-0.5%, 0.45-0.5%, 0.001 -0.4%, 0.005-0.4%, 0.01-0.4%, 0.015-0.4%, 0.02-0.4%, 0.025-0.4%, 0.03-0.4%, 0.035-0.4%, 0.04-0.4%, 0.045-0.4%, 0.05-0.4%, 0.055-0.4%, 0.0 6-0.4%, 0.065-0.4%, 0.07-0.4%, 0.075-0.4%, 0.08-0.4%, 0.085-0.4%, 0.09-0.4%, 0.095-0.4%, 0.1-0.4%, 0.15-0.4%, 0.2-0.4%, 0.25-0.4%, 0.3-0. 4%, 0.35-0.4%, 0.001-0.3%, 0.005-0.3%, 0.01-0.3%, 0.015-0.3%, 0.02-0.3%, 0.025-0.3%, 0.03-0.3%, 0.035-0.3%, 0.04-0.3%, 0.045-0.3%, 0.05-0.3%, 0.055-0.3%, 0.06-0.3%, 0.065-0.3%, 0.07-0.3%, 0.075-0.3%, 0.08-0.3%, 0.085-0.3%, 0.09-0.3%, 0.095-0.3%, 0.1-0.3%, 0.15-0.3%, 0.2-0.3%, 0.25-0.3%, 0.001-0. 2%, 0.005-0.2%, 0.01-0.2%, 0.015-0.2%, 0.02-0.2%, 0.025-0.2%, 0.03-0.2%, 0.035-0.2%, 0.04-0.2%, 0.045-0.2%, 0.05-0.2%, 0.055-0.2%, 0.06-0.2%, 0.065-0.2%, 0.07 -0.2%, 0.075-0.2%, 0.08-0.2%, 0.085-0.2%, 0.09-0.2%, 0.095-0.2%, 0.1-0.2%, 0.15-0.2%, 0.001-0.1%, 0.005-0.1%, 0.01-0.1%, 0.015-0.1%, 0.02-0.1%, 0.025-0.1%, 0. 0.03-0.1%, 0.035-0.1%, 0.04-0.1%, 0.045-0.1%, 0.05-0.1%, 0.055-0.1%, 0.06-0.1%, 0.065-0.1%, 0.07-0.1%, 0.075-0.1%, 0.08-0.1%, 0.085-0.1%, 0.09-0.1% or 0.095-0.1%. As a non-limiting example, the range is 0.06-0.6%. As a non-limiting example, the range is 0.4-0.5%.

[0435] In one embodiment, the guide strand accounts for 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5% or 0.6% of the total endogenous library of miRNA. As a non-limiting example, the percentage is 0.06%. As a non-limiting example, the percentage is 0.4%. As a non-limiting example, the percentage is 0.5%.

[0436] siRNA modification

[0437] In some embodiments, the siRNA molecules of the present invention, when not delivered as precursors or DNA, can be chemically modified to regulate certain features of the RNA molecule, such as, but not limited to, increasing the in vivo stability of the siRNA. Chemically modified siRNA molecules can be used in human therapeutic applications, and are improved without compromising the RNAi activity of the siRNA molecules. As non-limiting examples, siRNA molecules are modified at both 3' and 5' ends of the sense and antisense strands.

[0438] In some aspects, the siRNA duplexes of the present invention may comprise one or more modified nucleotides, such as, but not limited to, sugar-modified nucleotides, core base modifications and / or backbone modifications. In some aspects, the siRNA molecule may comprise a combination of modifications, such as a combination of core base and backbone modifications.

[0439] In one embodiment, the modified nucleotide can be a sugar-modified nucleotide.Sugar-modified nucleotides include but are not limited to 2'-fluoro, 2'-amino and 2'-thio-modified ribonucleotides, such as 2'-fluoro-modified ribonucleotides.The modified nucleotide can be modified on the sugar moiety and the nucleotide with a sugar that is not a ribosyl group or its analog.For example, the sugar moiety can be or based on mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose and other sugars, heterocycles or carbocycles.

[0440] In one embodiment, the modified nucleotides may be nucleobase modified nucleotides.

[0441] In one embodiment, the modified nucleotides can be backbone-modified nucleotides. In some embodiments, the siRNA duplex of the present invention may further include other modifications on the backbone. As used herein, normal "backbone" refers to a sugar-phosphate sequence that repeats and alternates in a DNA or RNA molecule. Deoxyribose / ribose sugars are connected to the phosphate group in the ester bond at both the 3'-hydroxyl and 5'-hydroxyl groups, also referred to as "phosphodiester" bonds / joints (PO bonds). The PO backbone can be modified to a "phosphorothioate" backbone (PS bond). In some cases, the natural phosphodiester bond can be replaced by an amide bond, but the four atoms between the two sugar units remain. Such amide modifications can promote the solid phase synthesis of oligonucleotides and increase the thermodynamic stability of the duplex formed with the siRNA complement. See, for example, Mesmaeker et al., Pure & Appl. Chem., 1997, 3, 437-440; the contents of which are incorporated herein by reference in their entirety.

[0442] Modified bases refer to nucleotide bases that have been modified by substitution or addition of one or more atoms or groups, for example, adenine, guanine, cytosine, thymine, uracil, xanthine, inosine and quercetin. Some examples of modifications of the nucleobase moiety include, but are not limited to, alkylated, halogenated, thiolated, aminated, amidated or acetylated bases, alone or in combination. More specific examples include, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides modified at the 5-position, 5-(2-amino)propyluridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deazaadenosine, 6-azouridine, 6-azocytidine, 6- thymidine (6-azothymidine), 5-methyl-2-thiouridine, other thiobases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, quercetin, archaeosine, naphthyl and substituted naphthyl, any O-alkylated and N-alkylated purine and pyrimidine such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxoacetic acid, pyridin-4-one, pyridin-2-one, phenyl and modified phenyl such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosine that acts as a G-clamp nucleotide, 8-substituted adenine and guanine, 5-substituted uracil and thymine, azapyrimidine, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides and alkylcarbonylalkylated nucleotides.

[0443] In one embodiment, the modified nucleotides may be only on the sense strand.

[0444] In another embodiment, the modified nucleotides may be only on the antisense strand.

[0445] In some embodiments, modified nucleotides can be on both the sense and antisense strands.

[0446] In some embodiments, the chemically modified nucleotides do not affect the ability of the antisense strand to pair with the target mRNA sequence.

[0447] In one embodiment, an AAV particle comprising a nucleic acid sequence encoding an siRNA molecule of the invention can encode the siRNA molecule as a polycistronic molecule.The siRNA molecule can additionally comprise one or more linkers between regions of the siRNA molecule.

[0448] Molecular scaffold

[0449] In one embodiment, the siRNA molecule may be encoded in a regulatory polynucleotide that also comprises a molecular scaffold.As used herein, a "molecular scaffold" is a framework or starting molecule that forms the sequence or structural basis upon which subsequent molecules are designed or prepared.

[0450] In one embodiment, the molecular scaffold comprises at least one 5' flanking region. As a non-limiting example, the 5' flanking region may comprise a 5' flanking sequence, which may be of any length and may be derived in whole or in part from a wild-type microRNA sequence or be a completely artificial sequence.

[0451] In one embodiment, the molecular scaffold comprises at least one 3' flanking region. As a non-limiting example, the 3' flanking region may comprise a 3' flanking sequence, which may be of any length and may be derived in whole or in part from a wild-type microRNA sequence or be a completely artificial sequence.

[0452] In one embodiment, the molecular scaffold comprises at least one loop motif region.As a non-limiting example, the loop motif region may comprise a sequence of any length.

[0453] In one embodiment, the molecular scaffold comprises a 5' flanking region, a loop motif region and / or a 3' flanking region.

[0454] In one embodiment, at least one siRNA, miRNA or other RNAi agent described herein can be encoded by a regulatory polynucleotide that can also include at least one molecular scaffold. The molecular scaffold can include a 5' flanking sequence that can be any length and can be derived in whole or in part from a wild-type microRNA sequence or be completely artificial. The 3' flanking sequence can mirror the 5' flanking sequence and / or the 3' flanking sequence in size and origin. The flanking sequence can be absent. The 3' flanking sequence can optionally include one or more CNNC motifs, wherein "N" represents any nucleotide.

[0455] The stem that forms the stem-loop structure is the minimum requirement for the regulatory polynucleotide encoding at least one siRNA, miRNA or other RNAi agent described herein. In some embodiments, the siRNA, miRNA or other RNAi agent described herein comprises at least one nucleic acid sequence that is partially complementary to or will hybridize with the target sequence. In some embodiments, the payload is a siRNA molecule or a fragment of a siRNA molecule.

[0456] In some embodiments, the 5' arm of the stem-loop structure of the regulatory polynucleotide comprises a nucleic acid sequence encoding a sense sequence. Non-limiting examples of sense sequences, or fragments or variants thereof, that can be encoded by regulatory polynucleotides are described in Table 3.

[0457] In some embodiments, the 3' arm of the stem-loop of the regulatory polynucleotide comprises a nucleic acid sequence encoding an antisense sequence. In some cases, the antisense sequence comprises a "G" nucleotide at the 5' end. Non-limiting examples of antisense sequences or fragments or variants thereof that can be encoded by regulatory polynucleotides are described in Table 2.

[0458] In other embodiments, the sense sequence may be located on the 3' arm of the stem of the stem-loop structure of the regulatory polynucleotide, while the antisense sequence is located on the 5' arm.Tables 2 and 3 describe non-limiting examples of sense and antisense sequences that may be encoded by regulatory polynucleotides.

[0459] In one embodiment, the sense and antisense sequences can be fully complementary over a substantial portion of their lengths. In other embodiments, the sense and antisense sequences can independently be at least 70%, 80%, 90%, 95%, or 99% complementary over at least 50, 60, 70, 80, 85, 90, 95%, or 99% of the strand length.

[0460] Neither identity of the sense sequence nor homology of the antisense sequence requires 100% complementarity to the target sequence.

[0461] In one embodiment, the sense and antisense sequences of the stem-loop structure of the regulatory polynucleotide are separated by a loop sequence (also referred to as a loop motif, a joint or a joint motif). The loop sequence can have any length, between 4-30 nucleotides, between 4-20 nucleotides, between 4-15 nucleotides, between 5-15 nucleotides, between 6-12 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, between 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides and / or 15 nucleotides.

[0462] In some embodiments, the loop sequence comprises a nucleic acid sequence encoding at least one UGUG motif. In some embodiments, the nucleic acid sequence encoding the UGUG motif is located 5' to the loop sequence.

[0463] In one embodiment, a spacer may be present in the regulatory polynucleotide to separate one or more modules (eg, 5' flanking region, loop motif region, 3' flanking region, sense sequence, antisense sequence) from each other. One or more such spacers may be present.

[0464] In one embodiment, there may be a spacer of between 8-20, i.e., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides between the sense sequence and the flanking region sequence.

[0465] In one embodiment, the spacer is 13 nucleotides in length and is located between the 5' end of the sense sequence and the 3' end of the flanking sequence.In one embodiment, the spacer is of sufficient length to form approximately one helical turn of the sequence.

[0466] In one embodiment, there may be a spacer of between 8-20, i.e. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides between the antisense sequence and the flanking sequence.

[0467] In one embodiment, the spacer sequence is between 10-13 nucleotides, i.e., 10, 11, 12 or 13 nucleotides, and is located between the 3' end of the antisense sequence and the 5' end of the flanking sequence. In one embodiment, the spacer region has sufficient length to form approximately one helical turn of the sequence.

[0468] In one embodiment, the molecular scaffold of the regulatory polynucleotide comprises, in the 5' to 3' direction, a 5' flanking sequence, a 5' arm, a loop motif, a 3' arm, and a 3' flanking sequence. As a non-limiting example, the 5' arm may comprise a nucleic acid sequence encoding a sense sequence, and the 3' arm comprises a nucleic acid sequence encoding an antisense sequence. In another non-limiting example, the 5' arm comprises a nucleic acid sequence encoding an antisense sequence, and the 3' arm comprises a nucleic acid sequence encoding a sense sequence.

[0469] In one embodiment, the 5' arm, sense and / or antisense sequence, loop motif, and / or 3' arm sequence can be altered (e.g., by replacing one or more nucleotides, adding nucleotides, and / or deleting nucleotides). The alterations can result in beneficial changes in construct function (e.g., increasing knockdown of the target sequence, reducing degradation of the construct, reducing off-target effects, increasing the efficiency of the payload, and reducing degradation of the payload).

[0470] In one embodiment, the molecular scaffolds of the regulatory polynucleotides are aligned so that the excision rate of the guide strand (also referred to herein as the antisense strand) is greater than that of the passenger strand (also referred to herein as the sense strand). The excision rate of the guide or passenger strand can be 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more than 99%. As a non-limiting example, the excision rate of the guide strand is at least 80%. As another non-limiting example, the excision rate of the guide strand is at least 90%.

[0471] In one embodiment, the resection rate of the guide strand is greater than the resection rate of the passenger strand. In one aspect, the resection rate of the guide strand can be at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more than 99% greater than that of the passenger strand.

[0472] In one embodiment, the efficiency of excision of the guide strand is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or greater than 99%. As a non-limiting example, the efficiency of excision of the guide strand is greater than 80%.

[0473] In one embodiment, the efficiency of cleavage of the guide strand from the molecular scaffold is greater than the efficiency of cleavage of the passenger strand from the molecular scaffold. The efficiency of cleavage of the guide strand from the molecular scaffold can be 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times greater than the efficiency of cleavage of the passenger strand from the molecular scaffold.

[0474] In one embodiment, the molecular scaffold comprises a bifunctional targeting regulatory polynucleotide. As used herein, a "bifunctional targeting" regulatory polynucleotide is a polynucleotide in which both the guide strand and the passenger strand knock down the same target, or both the guide strand and the passenger strand knock down different targets.

[0475] In one embodiment, the molecular scaffold of the regulatory polynucleotide described herein may comprise a 5' flanking region, a loop motif region, and a 3' flanking region. Non-limiting examples of sequences of the 5' flanking region, the loop motif region (also referred to as the linker region), and the 3' flanking region, or fragments thereof, that can be used in the regulatory polynucleotide described herein are shown in Tables 5-7.

[0476] Table 5. 5' flanking regions of molecular scaffolds

[0477]

[0478] Table 6. Loop motif regions of molecular scaffolds

[0479]

[0480] Table 7. 3' flanking regions of molecular scaffolds

[0481]

[0482] In one embodiment, the molecular scaffold may comprise at least one 5' flanking region, fragment or variant thereof listed in Table 5. As non-limiting examples, the 5' flanking region may be 5F1, 5F2 or 5F3.

[0483] In one embodiment, the molecular scaffold may comprise at least one 5F1 flanking region.

[0484] In one embodiment, the molecular scaffold may comprise at least one 5F2 flanking region.

[0485] In one embodiment, the molecular scaffold may comprise at least one 5F3 flanking region.

[0486] In one embodiment, the molecular scaffold may comprise at least one loop motif region, fragment or variant thereof listed in Table 6. As non-limiting examples, the loop motif region may be L1, L2, L3 or L4.

[0487] In one embodiment, the molecular scaffold may comprise at least one L1 loop motif region.

[0488] In one embodiment, the molecular scaffold may comprise at least one L2 loop motif region.

[0489] In one embodiment, the molecular scaffold may comprise at least one L3 loop motif region.

[0490] In one embodiment, the molecular scaffold may comprise at least one L4 loop motif region.

[0491] In one embodiment, the molecular scaffold may comprise at least one 3' flanking region, fragment or variant thereof listed in Table 7. As non-limiting examples, the 3' flanking region may be 3F1, 3F2, 3F3, 3F4 or 3F5.

[0492] In one embodiment, the molecular scaffold may comprise at least one 3F1 flanking region.

[0493] In one embodiment, the molecular scaffold may comprise at least one 3F2 flanking region.

[0494] In one embodiment, the molecular scaffold may comprise at least one 3F3 flanking region.

[0495] In one embodiment, the molecular scaffold may comprise at least one 3F4 flanking region.

[0496] In one embodiment, the molecular scaffold may comprise at least one 3F5 flanking region.

[0497] In one embodiment, the molecular scaffold may comprise at least one 5' flanking region, fragment or variant thereof, and at least one loop motif region, fragment or variant thereof as described in Tables 5 and 6. As limiting examples, the 5' flanking region and loop motif region may be 5F1 and L1, 5F1 and L2, 5F1 and L3, 5F1 and L4, 5F2 and L1, 5F2 and L2, 5F2 and L3, 5F2 and L4, 5F3 and L1, 5F3 and L2, 5F3 and L3, and 5F3 and L4.

[0498] In one embodiment, the molecular scaffold may comprise at least one 3' flanking region, fragment or variant thereof, and at least one loop motif region, fragment or variant thereof as described in Tables 6 and 7. As non-limiting examples, the 3' flanking region and loop motif region may be 3F1 and L1, 3F1 and L2, 3F1 and L3, 3F1 and L4, 3F2 and L1, 3F2 and L2, 3F2 and L3, 3F2 and L4, 3F3 and L1, 3F3 and L2, 3F3 and L3, 3F3 and L4, 3F4 and L1, 3F4 and L2, 3F4 and L3, 3F4 and L4, 3F5 and L1, 3F5 and L2, 3F5 and L3, and 3F5 and L4.

[0499] In one embodiment, the molecular scaffold may comprise at least one 5' flanking region, fragment or variant thereof, and at least one 3' flanking region, fragment or variant thereof as described in Tables 5 and 7. As non-limiting examples, the flanking regions may be 5F1 and 3F1, 5F1 and 3F2, 5F1 and 3F3, 5F1 and 3F4, 5F1 and 3F5, 5F2 and 3F1, 5F2 and 3F2, 5F2 and 3F3, 5F2 and 3F4, 5F2 and 3F5, 5F3 and 3F1, 5F3 and 3F2, 5F3 and 3F3, 5F3 and 3F4, 5F3 and 3F5.

[0500] In one embodiment, the molecular scaffold may comprise at least one 5' flanking region, a fragment or variant thereof, at least one loop motif region, a fragment or variant thereof, and at least one 3' flanking region as described in Tables 5-7. As non-limiting examples, the flanking and loop motif regions may be 5F1, L1, and 3F1; 5F1, L1, and 3F2; 5F1, L1, and 3F3; 5F1, L1, and 3F4; 5F2, L1, and 3F1; 5F2, L1, and 3F2; 5F2, L1, and 3F3; 5F2, L1, and 3F4; 5F2, L1, and 3F5; 5F3, L1, and 3F1; 5F3, L1, and 3F2; 5F3, L1, and 3F3; 5F3, L1, and 3F4; 5F3, L1, and 3F5. 1 and 3F5; 5F1, L2 and 3F1; 5F1, L2 and 3F2; 5F1, L2 and 3F3; 5F1, L2 and 3F4; 5F1, L2 and 3F5; 5F2, L2 and 3F1; 5F2, L2 and 3F2; 5F2, L2 and 3F3; 5F2, L2 and 3F4; 5F2, L2 and 3F5; 5F3, L2 and 3F1; 5F3, L2 and 3F2; 5F3, L2 and 3F3; 5F3, L2 and 3F4; 5F3, L2 and 3 F5; 5F3; 5F1, L3 and 3F1; 5F1, L3 and 3F2; 5F1, L3 and 3F3; 5F1, L3 and 3F4; 5F1, L3 and 3F5; 5F2, L3 and 3F1; 5F2, L3 and 3F2; 5F2, L3 and 3F3; 5F2, L3 and 3F4; 5F2, L3 and 3F5; 5F3, L3 and 3F1; 5F3, L3 and 3F2; 5F3, L3 and 3F3; 5F3, L3 and 3F4; 5F3, L3 and 3F5; 5F1, L4 and 3F1; 5F1, L4 and 3F2; 5F1, L4 and 3F3; 5F1, L4 and 3F4; 5F1, L4 and 3F5; 5F2, L4 and 3F1; 5F2, L4 and 3F2; 5F2, L4 and 3F3; 5F2, L4 and 3F4; 5F2, L4 and 3F5; 5F3, L4 and 3F1; 5F3, L4 and 3F2; 5F3, L4 and 3F3; 5F3, L4 and 3F4; 5F3, L4 and 3F5.

[0501] In one embodiment, the molecular scaffold may be a natural pri-miRNA scaffold. As a non-limiting example, the molecular scaffold may be a scaffold derived from the human miR155 scaffold.

[0502] In one embodiment, the molecular scaffold may comprise one or more linkers known in the art. A linker may separate a region or one molecular scaffold from another. As a non-limiting example, the molecular scaffold may be a polycistronic.

[0503] A regulatory polynucleotide comprising a molecular scaffold and a siRNA molecule targeting SOD1.

[0504] In one embodiment, the regulatory polynucleotide may comprise 5' and 3' flanking regions, a loop motif region, and nucleic acid sequences encoding sense and antisense sequences as described in Table 8. In Table 8, the DNA sequence identifiers for the passenger and guide strands, as well as the 5' and 3' flanking regions and the loop region (also referred to as the linker region) are described. In Table 8, the "miR" portion of the sequence name does not necessarily correspond to the sequence number of the miRNA gene (e.g., VOYSOD1 miR-102 is a sequence name, which does not necessarily mean that miR-102 is part of the sequence).

[0505] Table 8. SOD1 regulatory polynucleotide sequence region (5' to 3')

[0506]

[0507]

[0508] AAV particles containing regulatory polynucleotides

[0509] In one embodiment, the AAV particles comprise a viral genome having a payload region comprising a regulatory polynucleotide sequence. In such an embodiment, the viral genome encoding more than one polypeptide can be replicated and packaged into viral particles. Target cells transduced with viral particles comprising regulatory polynucleotides can express the encoded sense and / or antisense sequences in individual cells.

[0510] In some embodiments, AAV particles are used in medicine to treat, prevent, alleviate, or ameliorate neurological diseases and / or disorders.

[0511] In one embodiment, AAV particles comprising a regulatory polynucleotide sequence comprising a nucleic acid sequence encoding at least one siRNA molecule can be introduced into mammalian cells.

[0512] When the AAV particle payload region comprises a regulatory polynucleotide, the regulatory polynucleotide may comprise sense and / or antisense sequences to knock down the target gene. The AAV viral genome encoding the regulatory polynucleotides described herein can be used in the fields of human disease, viruses, infections, veterinary applications, and various in vivo and in vitro environments.

[0513] In one embodiment, the AAV particle viral genome may comprise at least one inverted terminal repeat (ITR) region. The one or more ITR regions may independently have, for example, but not limited to, the following lengths: 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175 and 176 nucleotides. The length of the ITR region of the viral genome can be 75-80, 75-85, 75-100, 80-85, 80-90, 80-105, 85-90, 85-95, 85-110, 90-95, 90-100, 90-115, 95-100, 95-105, 95-120, 100-105, 100-110, 100-125, 105-110, 105-115, 105-130, 110-115, 110-120, 110-135, 115-120, 115-125, 115-140, 120-125, 1 170, 165-170, 165-175, and 170-175 nucleotides. As a non-limiting example, the viral genome comprises an ITR of about 105 nucleotides in length. As a non-limiting example, the viral genome comprises an ITR of about 141 nucleotides in length.As a non-limiting example, the viral genome comprises an ITR of about 130 nucleotides in length.

[0514] In one embodiment, the AAV particle viral genome may comprise two inverted terminal repeat (ITR) regions. The length of each ITR region can independently have, for example, but not limited to, the following lengths: 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125 5, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174 and 175 nucleotides. The length of the ITR region of the viral genome can be 75-80, 75-85, 75-100, 80-85, 80-90, 80-105, 85-90, 85-95, 85-110, 90-95, 90-100, 90-115, 95-100, 95-105, 95-120, 100-105, 100-110, 100-125, 105-110, 105-115, 105-130, 110-115, 110-120, 110-135, 115-120, 115-125, 115-140, 120-125, 1 170, 165-170, 165-175, and 170-175 nucleotides. As a non-limiting example, the viral genome comprises an ITR of about 105 nucleotides in length and about 141 nucleotides in length. As a non-limiting example, the viral genome comprises an ITR of approximately 105 nucleotides in length and approximately 130 nucleotides in length.As a non-limiting example, the viral genome comprises an ITR of approximately 130 nucleotides in length and 141 nucleotides in length.

[0520] In one embodiment, the AAV particle viral genome comprises two ITR sequence regions.

[0521] 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 240, 241, 242, 243, 244, 245 5、116、117、118、119、120、121、122、123、124、125、126、127、128、129、130、131、132、133、134、135、136、137、138、139、140、141、142、143、144、145、146、147、148、149、150、151、152、153、154、155、156、157、158、159、160、161、162、163、164、165、166、167、168、169、170、171、172、173、174、175、 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236 6、237、238、239、240、241、242、243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、516、517、518、519、520、521、522、523、524、525、526、527、528、529、530、531、532、533、534、535、536、537、538、539、540、541、542、543、544、545、546、547、548、549、550、551、552、553、554、555、556、557、558、559、560、561、562、563、564、565、566、567、568、569、570、571、572、573、574、575、576、577、578、579、580、581、582、583、584、585、586、587、588、589、590、591、592、593、594、595、596、597、598、599、600、601、602、603、604、605、606、607、608、609、610、611、612、613、614、615、616、617、618、619、620、621、622、623、624、625、626、627、628、629、630、631、632、633、634、635、636、637、638、639、640、641、642、643、644、645、646、647、648、649、650、651、652、653、654、655、656、657、658、659、660、661、662、663、664、665、666、667、668、669、670、671、672、673、674、675、676、677、678、679、680、681、682、683、684、685、686、687、688、689、690、691、692、693、694、695、696、697、698、699、700、701、702、703、704、705、706、707、708、709、710、711、712、713、714、715、716、717、718、719、720、721、722、723、724、725、726、727、728、729、730、731、732、733、734、735、736、737、738、739、740、741、742、743、744、745、746、747、748、749、750、751、752、753、754、755、756、757、758、759、760、761、762、763、764、765、766、767、768、769、770、771、772、773、774、775、776、777、778、779、780、781、782、783、784、785、786、787、788、789、790、791、792、793、794、795、796、797、798、799、800、801、802、803、804、805、806、807、808、809、810、811、812、813、814、815、816、817、818、819、820、821、822、823、824、825、826、827、828、829、830、831、832、833、834、835、836、837、838、839、840、841、842、843、844、845、846、847、848、849、850、851、852、853、854、855、856、857、858、859、860、861、862、863、864、865、866、867、868、869、870、871、872、873、874、875、876、877、878、879、880、881、882、883、884、885、886、887、888、889、890、891、892、893、894、895、896、897、898、899、900、901、902、903、904、905、906、907、908、909、910、911、912、913、914、915、916、917、918、919、920、921、922、923、924、925、926、927、928、929、930、931、932、933、934、935、936、937、938、939、940、941、942、943、944、945、946、947、948、949、950、951、952、953、954、955、956、957、958、959、960、961、962、963、964、965、966、967、968、969、970、971、972、973、974、975、976、977、978、979、980、981、982、983、984、985、986、987、988、989、990、991、992、993、994、995、996、997、998、999、1000、1001、1002、1003、1004、1005、1006、1007、1008、1009、1010、1011、1012、1013、1014、1015、1016、1017、1018、1019、1020、1021、1022、1023、1024、1025、1026、1027、1028、1029、1030、1031、1032、1033、1034、1035、1036、1037、1038、1039、1040、1041、1042、1043、1044、1045、1046、1047、1048、1049、1050、1051、1052、1053、1054、1055、1056、1057、1058、1059、1060、1061、1062、1063、1064、1065、1066、1067、1068、1069、1070、1071、1072、1073、1074、1075、1076、1077、1078、1079、1080、1081、1082、1083、1084、1085、1086、1087、1088、1089、1090、1091、1092、1093、1094、1095、1096、1097、1098、1099、1100、1101、1102、1103、1104、1105、1106、1107、1108、1109、1110、1111、1112、1113、1114、1115、1116、1117、1118、1119、1120、1121、1122、1123、1124、1125、1126、1127、1128、1129、1130、1131、1132、1133、1134、1135、1136、1137、1138、1139、1140、1141、1142、1143、1144、1145、1146、1147、1148、1149、1150、1151、1152、1153、1154、1155、1156、1157、1158、1159、1160、1161、1162、1163、1164、1165、1166、1167、1168、1169、1170、1171、1172、1173、1174、1175、1176、1177、1178、1179、1180、1181、1182、1183、1184、1185、1186、1187、1188、1189、1190、1191、1192、1193、1194、1195、1196、1197、1198、1199、1200、1201、1202、1203、1204、1205、1206、1207、1208、1209、1210、1211、1212、1213、1214、1215、1216、1217、1218、1219、1220、1221、1222、1223、1224、1225、1226、1227、1228、1229、1230、1231、1232、1233、1234、1235、1236、1237、1238、1239、1240、1241、1242、1243、1244、1245、1246、1247、1248、1249、1250、1251、1252、1253、1254、1255、1256、1257、1258、1259、1260、1261、1262、1263、1264、1265、1266、1267、1268、1269、1270、1271、1272、1273、1274、1275、1276、1277、1278、1279、1280、1281、1282、1283、1284、1285、1286、1287、1288、1289、1290、1291、1292、1293、1294、1295、1296、1297、1298、1299、1300、1301、1302、1303、1304、1305、1306、1307、1308、1309、1310、1311、1312、1313、1314、1315、1316、1317、1318、1319、1320、1321、1322、1323、1324、1325、1326、1327、1328、1329、1330、1331、1332、1333、1334、1335、1336、1337、1338、1339、1340、1341、1342、1343、1344、1345、1346、1347、1348、1349、1350、1351、1352、1353、1354、1355、1356、1357、1358、1359、1360、1361、1362、1363、1364、1365、1366、1367、1368、1369、1370、1371、1372、1373、1374、1375、1376、1377、1378、1379、1380、1381、1382、1383、1384、1385、1386、1387、1388、1389、1390、1391、1392、1393、1394、1395、1396、1397、1398、1399、1400、1401、1402、1403、1404、1405、1406、1407、1408、1409、1410、1411、1412、1413、1414、1415、1416、1417、1418、1419、1420、1421、1422、1423、1424、1425、1426、1427、1428、1429、1430、1431、1432、1433、1434、1435、1436、1437、1438、1439、1440、1441、1442、1443、1444、1445、1446、1447、1448、1449、1450、1451、1452、1453、1454、1455、1456、1457、1458、1459、1460、1461、1462、1463、1464、1465、1466、1467、1468、1469、1470、1471、1472、1473、1474、1475、1476、1477、1478、1479、1480、1481、1482、1483、1484、1485、1486、1487、1488、1489、1490、1491、1492、1493、1494、1495、1496、1497、1498、1499、1500、1501、1502、1503、1504、1505、1506、1507、1508、1509、1510、1511、1512、1513、1514、1515、1516、1517、1518、1519、1520、1521、1522、1523、1524、1525、1526、1527、1528、1529、1530、1531、1532、1533、1534、1535、1536、1537、1538、1539、1540、1541、1542、1543、1544、1545、1546、1547、1548、1549、1550、1551、1552、1553、1554、1555、1556、1557、1558、1559、1560、1561、1562、1563、1564、1565、1566、1567、1568、1569、1570、1571、1572、1573、1574、1575、1576、1577、1578、1579、1580、1581、1582、1583、1584、1585、1586、1587、1588、1589、1590、1591、1592、1593、1594、1595、1596、1597、1598、1599、1600、1601、1602、1603、1604、1605、1606、1607、1608、1609、1610、1611、1612、1613、1614、1615、1616、1617、1618、1619、1620、1621、1622、1623、1624、1625、1626、1627、1628、1629、1630、1631、1632、1633、1634、1635、1636、1637、1638、1639、1640、1641、1642、1643、1644、1645、1646、1647、1648、1649、1650、1651、1652、1653、1654、1655、1656、1657、1658、1659、1660、1661、1662、1663、1664、1665、1666、1667、1668、1669、1670、1671、1672、1673、1674、1675、1676、1677、1678、1679、1680、1681、1682、1683、1684、1685、1686、1687、1688、1689、1690、1691、1692、1693、1694、1695、1696、1697、1698、1699、1700、1701、1702、1703、1704、1705、1706、1707、1708、1709、1710、1711、1712、1713、1714、1715、1716、1717、1718、1719、1720、1721、1722、1723、1724、1725、1726、1727、1728、1729、1730、1731、1732、1733、1734、1735、1736、1737、1738、1739、1740、1741、1742、1743、1744、1745、1746、1747、1748、1749、1750、1751、1752、1753、1754、1755、1756、1757、1758、1759、1760、1761、1762、1763、1764、1765、1766、1767、1768、1769、1770、1771、1772、1773、1774、1775、1776、1777、1778、1779、1780、1781、1782、1783、1784、1785、1786、1787、1788、1789、1790、1791、1792、1793、1794、1795、1796、1797、1798、1799、1800、1801、1802、1803、1804、1805、1806、1807、1808、1809、1810、1811、1812、1813、1814、1815、1816、1817、1818、1819、1820、1821、1822、1823、1824、1825、1826、1827、1828、1829、1830、1831、1832、1833、1834、1835、1836、1837、1838、1839、1840、1841、1842、1843、1844、1845、1846、1847、1848、1849、1850、1851、1852、1853、1854、1855、1856、1857、1858、1859、1860、1861、1862、1863、1864、1865、1866、1867、1868、1869、1870、1871、1872、1873、1874、1875、1876、1877、1878、1879、1880、1881、1882、1883、1884、1885、1886、1887、1888、1889、1890、1891、1892、1893、1894、1895、1896、1897、1898、1899、1900、1901、1902、1903、1904、1905、1906、1907、1908、1909、1910、1911、1912、1913、1914、1915、1916、1917、1918、1919、1920、1921、1922、1923、1924、1925、1926、1927、1928、1929、1930、1931、1932、1933、1934、1935、1936、1937、1938、1939、1940、1941、1942、1943、1944、1945、1946、1947、1948、1949、1950、1951、1952、1953、1954、1955、1956、1957、1958、1959、1960、1961、1962、1963、1964、1965、1966、1967、1968、1969、1970、1971、1972、1973、1974、1975、1976、1977、1978、1979、1980、1981、1982、1983、1984、1985、1986、1987、1988、1989、1990、1991、1992、1993、1994、1995、1996、1997、1998、1999、2000、2001、2002、2003、2004、2005、2006、2007、2008、2009、2010、2011、2012、2013、2014、2015、2016、2017、2018、2019、2020、2021、2022、2023、2024、2025、2026、2027、2028、2029、2030、2031、2032、2033、2034、2035、2036、2037、2038、2039、2040、2041、2042、2043、2044、2045、2046、2047、2048、2049、2050、2051、2052、2053、2054、2055、2056、2057、2058、2059、2060、2061、2062、2063、2064、2065、2066、2067、2068、2069、2070、2071、2072、2073、2074、2075、2076、2077、2078、2079、2080、2081、2082、2083、2084、2085、2086、2087、2088、2089、2090、2091、2092、2093、2094、2095、2096、2097、2098、2099、2100、2101、2102、2103、2104、2105、2106、2107、2108、2109、2110、2111、2112、2113、2114、2115、2116、2117、2118、2119、2120、2121、2122、2123、2124、2125、2126、2127、2128、2129、2130、2131、2132、2133、2134、2135、2136、2137、2138、2139、2140、2141、2142、2143、2144、2145、2146、2147、2148、2149、2150、2151、2152、2153、2154、2155、2156、2157、2158、2159、2160、2161、2162、2163、2164、2165、2166、2167、2168、2169、2170、2171、2172、2173、2174、2175、2176、2177、2178、2179、2180、2181、2182、2183、2184、2185、2186、2187、2188、2189、2190、2191、2192、2193、2194、2195、2196、2197、2198、2199、2200、2201、2202、2203、2204、2205、2206、2207、2208、2209、2210、2211、2212、2213、2214、2215、2216、2217、2218、2219、2220、2221、2222、2223、2224、2225、2226、2227、2228、2229、2230、2231、2232、2233、2234、2235、2236、2237、2238、2239、2240、2241、2242、2243、2244、2245、2246、2247、2248、2249、2250、2251、2252、2253、2254、2255、2256、2257、2258、2259、2260、2261、2262、2263、2264、2265、2266、2267、2268、2269、2270、2271、2272、2273、2274、2275、2276、2277、2278、2279、2280、2281、2282、2283、2284、2285、2286、2287、2288、2289、2290、2291、2292、2293、2294、2295、2296、2297、2298、2299、2300、2301、2302、2303、2304、2305、2306、2307、2308、2309、2310、2311、2312、2313、2314、2315、2316、2317、2318、2319、2320、2321、2322、2323、2324、2325、2326、2327、2328、2329、2330、2331、2332、2333、2334、2335、2336、2337、2338、2339、2340、2341、2342、2343、2344、2345、2346、2347、2348、2349、2350、2351、2352、2353、2354、2355、2356、2357、2358、2359、2360、2361、2362、2363、2364、2365、2366、2367、2368、2369、2370、2371、2372、2373、2374、2375、2376、2377、2378、2379、2380、2381、2382、2383、2384、2385、2386、2387、2388、2389、2390、2391、2392、2393、2394、2395、2396、2397、2398、2399、2400、2401、2402、2403、2404、2405、2406、2407、2408、2409、2410、2411、2412、2413、2414、2415、2416、2417、2418、2419、2420、2421、2422、2423、2424、2425、2426、2427、2428、2429、2430、2431、2432、2433、2434、2435、2436、2437、2438、2439、2440、2441、2442、2443、2444、2445、2446、2447、2448、2449、2450、2451、2452、2453、2454、2455、2456、2457、2458、2459、2460、2461、2462、2463、2464、2465、2466、2467、2468、2469、2470、2471、2472、2473、2474、2475、2476、2477、2478、2479、2480、2481、2482、2483、2484、2485、2486、2487、2488、2489、2490、2491、2492、2493、2494、2495、2496、2497、2498、2499、2500、2501、2502、2503、2504、2505、2506、2507、2508、2509、2510、2511、2512、2513、2514、2515、2516、2517、2518、2519、2520、2521、2522、2523、2524、2525、2526、2527、2528、2529、2530、2531、2532、2533、2534、2535、2536、2537、2538、2539、2540、2541、2542、2543、2544、2545、2546、2547、2548、2549、2550、2551、2552、2553、2554、2555、2556、2557、2558、2559、2560、2561、2562、2563、2564、2565、2566、2567、2568、2569、2570、2571、2572、2573、2574、2575、2576、2577、2578、2579、2580、2581、2582、2583、2584、2585、2586、2587、2588、2589、2590、2591、2592、2593、2594、2595、2596、2597、2598、2599、2600、2601、2602、2603、2604、2605、2606、2607、2608、2609、2610、2611、2612、2613、2614、2615、2616、2617、2618、2619、2620、2621、2622、2623、2624、2625、2626、2627、2628、2629、2630、2631、2632、2633、2634、2635、2636、2637、2638、2639、2640、2641、2642、2643、2644、2645、2646、2647、2648、2649、2650、2651、2652、2653、2654、2655、2656、2657、2658、2659、2660、2661、2662、2663、2664、2665、2666、2667、2668、2669、2670、2671、2672、2673、2674、2675、2676、2677、2678、2679、2680、2681、2682、2683、2684、2685、2686、2687、2688、2689、2690、2691、2692、2693、2694、2695、2696、2697、2698、2699、2700、2701、2702、2703、2704、2705、2706、2707、2708、2709、2710、2711、2712、2713、2714、2715、2716、2717、2718、2719、2720、2721、2722、2723、2724、2725、2726、2727、2728、2729、2730、2731、2732、2733、2734、2735、2736、2737、2738、2739、2740、2741、2742、2743、2744、2745、2746、2747、2748、2749、2750、2751、2752、2753、2754、2755、2756、2757、2758、2759、2760、2761、2762、2763、2764、2765、2766、2767、2768、2769、2770、2771、2772、2773、2774、2775、2776、2777、2778、2779、2780、2781、2782、2783、2784、2785、2786、2787、2788、2789、2790、2791、2792、2793、2794、2795、2796、2797、2798、2799、2800、2801、2802、2803、2804、2805、2806、2807、2808、2809、2810、2811、2812、2813、2814、2815、2816、2817、2818、2819、2820、2821、2822、2823、2824、2825、2826、2827、2828、2829、2830、2831、2832、2833、2834、2835、2836、2837、2838、2839、2840、2841、2842、2843、2844、2845、2846、2847、2848、2849、2850、2851、2852、2853、2854、2855、2856、2857、2858、2859、2860、2861、2862、2863、2864、2865、2866、2867、2868、2869、2870、2871、2872、2873、2874、2875、2876、2877、2878、2879、2880、2881、2882、2883、2884、2885、2886、2887、2888、2889、2890、2891、2892、2893、2894、2895、2896、2897、2898、2899、2900、2901、2902、2903、2904、2905、2906、2907、2908、2909、2910、2911、2912、2913、2914、2915、2916、2917、2918、2919、2920、2921、2922、2923、2924、2925、2926、2927、2928、2929、2930、2931、2932、2933、2934、2935、2936、2937、2938、2939、2940、2941、2942、2943、2944、2945、2946、2947、2948、2949、2950、2951、2952、2953、2954、2955、2956、2957、2958、2959、2960、2961、2962、2963、2964、2965、2966、2967、2968、2969、2970、2971、2972、2973、2974、2975、2976、2977、2978、2979、2980、2981、2982、2983、2984、2985、2986、2987、2988、2989、2990、2991、2992、2993、2994、2995、2996、2997、2998、2999、3000、3001、3002、3003、3004、3005、3006、3007、3008、3009、3010、3011、3012、3013、3014、3015、3016、3017、3018、3019、3020、3021、3022、3023、3024、3025、3026、3027、3028、3029、3030、3031、3032、3033、3034、3035、3036、3037、3038、3039、3040、3041、3042、3043、3044、3045、3046、3047、3048、3049、3050、3051、3052、3053、3054、3055、3056、3057、3058、3059、3060、3061、3062、3063、3064、3065、3066、3067、3068、3069、3070、3071、3072、3073、3074、3075、3076、3077、3078、3079、3080、3081、3082、3083、3084、3085、3086、3087、3088、3089、3090、3091、3092、3093、3094、3095、3096、3097、3098、3099、3100、3101、3102、3103、3104、3105、3106、3107、3108、3109、3110、3111、3112、3113、3114、3115、3116、3117、3118、3119、3120、3121、3122、3123、3124、3125、3126、3127、3128、3129、3130、3131、3132、3133、3134、3135、3136、3137、3138、3139、3140、3141、3142、3143、3144、3145、3146、3147、3148、3149、3150、3151、3152、3153、3154、3155、3156、3157、3158、3159、3160、3161、3162、3163、3164、3165、3166、3167、3168、3169、3170、3171、3172、3173、3174、3175、3176、3177、3178、3179、3180、3181、3182、3183、3184、3185、3186、3187、3188、3189、3190、3191、3192、3193、3194、3195、3196、3197、3198、3199、3200、3201、3202、3203、3204、3205、3206、3207、3208、3209、3210、3211、3212、3213、3214、3215、3216、3217、3218、3219、3220、3221、3222、3223、3224、3225、3226、3227、3228、3229、3230、3231、3232、3233、3234、3235、3236、3237, 3238, 3239, 3240, 3241, 3242, 3243, 3244, 3245, 3246, 3247, 3248, 3249, and 3250 nucleotides. The length of any stuffing region of the viral genome can be 50-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900. 00, 900-950, 950-1000, 1000-1050, 1050-1100, 1100-1150, 1150-1200, 1200-1250, 1250-1300, 1300-1350, 1350-1400, 1400-1450, 1450-1500, 1500-1550, 1550-1600, 1600-1650, 1650-1700、1700-1750、1750-1800、1800-1850、1850-1900、1900-1950、1950-2000、2000-2050、2050-2100、2100-2150、2150-2200、2200-2250、2250-2300、2300-2350、2350-2400、 2400-2450, 2450-2500, 2500-2550, 2550-2600, 2600-2650, 2650-2700, 2700-2750, 2750-2800, 2800-2850, 2850-2900, 2900-2950, ​​2950-3000, 3000-3050, 3050-3100, 3100-3150,3150-3200 and 3200-3250 nucleotides. As a non-limiting example, the viral genome comprises a stuffing region of about 55 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 56 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 97 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 103 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 105 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 357 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 363 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 712 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 714 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 1203 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 1209 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 1512 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 1519 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 2395 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 2403 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 2405 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 3013 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 3021 nucleotides in length.

[0550] 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 240, 241, 242, 243, 244, 245 5、116、117、118、119、120、121、122、123、124、125、126、127、128、129、130、131、132、133、134、135、136、137、138、139、140、141、142、143、144、145、146、147、148、149、150、151、152、153、154、155、156、157、158、159、160、161、162、163、164、165、166、167、168、169、170、171、172、173、174、175、 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236 6、237、238、239、240、241、242、243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、516、517、518、519、520、521、522、523、524、525、526、527、528、529、530、531、532、533、534、535、536、537、538、539、540、541、542、543、544、545、546、547、548、549、550、551、552、553、554、555、556、557、558、559、560、561、562、563、564、565、566、567、568、569、570、571、572、573、574、575、576、577、578、579、580、581、582、583、584、585、586、587、588、589、590、591、592、593、594、595、596、597、598、599、600、601、602、603、604、605、606、607、608、609、610、611、612、613、614、615、616、617、618、619、620、621、622、623、624、625、626、627、628、629、630、631、632、633、634、635、636、637、638、639、640、641、642、643、644、645、646、647、648、649、650、651、652、653、654、655、656、657、658、659、660、661、662、663、664、665、666、667、668、669、670、671、672、673、674、675、676、677、678、679、680、681、682、683、684、685、686、687、688、689、690、691、692、693、694、695、696、697、698、699、700、701、702、703、704、705、706、707、708、709、710、711、712、713、714、715、716、717、718、719、720、721、722、723、724、725、726、727、728、729、730、731、732、733、734、735、736、737、738、739、740、741、742、743、744、745、746、747、748、749、750、751、752、753、754、755、756、757、758、759、760、761、762、763、764、765、766、767、768、769、770、771、772、773、774、775、776、777、778、779、780、781、782、783、784、785、786、787、788、789、790、791、792、793、794、795、796、797、798、799、800、801、802、803、804、805、806、807、808、809、810、811、812、813、814、815、816、817、818、819、820、821、822、823、824、825、826、827、828、829、830、831、832、833、834、835、836、837、838、839、840、841、842、843、844、845、846、847、848、849、850、851、852、853、854、855、856、857、858、859、860、861、862、863、864、865、866、867、868、869、870、871、872、873、874、875、876、877、878、879、880、881、882、883、884、885、886、887、888、889、890、891、892、893、894、895、896、897、898、899、900、901、902、903、904、905、906、907、908、909、910、911、912、913、914、915、916、917、918、919、920、921、922、923、924、925、926、927、928、929、930、931、932、933、934、935、936、937、938、939、940、941、942、943、944、945、946、947、948、949、950、951、952、953、954、955、956、957、958、959、960、961、962、963、964、965、966、967、968、969、970、971、972、973、974、975、976、977、978、979、980、981、982、983、984、985、986、987、988、989、990、991、992、993、994、995、996、997、998、999、1000、1001、1002、1003、1004、1005、1006、1007、1008、1009、1010、1011、1012、1013、1014、1015、1016、1017、1018、1019、1020、1021、1022、1023、1024、1025、1026、1027、1028、1029、1030、1031、1032、1033、1034、1035、1036、1037、1038、1039、1040、1041、1042、1043、1044、1045、1046、1047、1048、1049、1050、1051、1052、1053、1054、1055、1056、1057、1058、1059、1060、1061、1062、1063、1064、1065、1066、1067、1068、1069、1070、1071、1072、1073、1074、1075、1076、1077、1078、1079、1080、1081、1082、1083、1084、1085、1086、1087、1088、1089、1090、1091、1092、1093、1094、1095、1096、1097、1098、1099、1100、1101、1102、1103、1104、1105、1106、1107、1108、1109、1110、1111、1112、1113、1114、1115、1116、1117、1118、1119、1120、1121、1122、1123、1124、1125、1126、1127、1128、1129、1130、1131、1132、1133、1134、1135、1136、1137、1138、1139、1140、1141、1142、1143、1144、1145、1146、1147、1148、1149、1150、1151、1152、1153、1154、1155、1156、1157、1158、1159、1160、1161、1162、1163、1164、1165、1166、1167、1168、1169、1170、1171、1172、1173、1174、1175、1176、1177、1178、1179、1180、1181、1182、1183、1184、1185、1186、1187、1188、1189、1190、1191、1192、1193、1194、1195、1196、1197、1198、1199、1200、1201、1202、1203、1204、1205、1206、1207、1208、1209、1210、1211、1212、1213、1214、1215、1216、1217、1218、1219、1220、1221、1222、1223、1224、1225、1226、1227、1228、1229、1230、1231、1232、1233、1234、1235、1236、1237、1238、1239、1240、1241、1242、1243、1244、1245、1246、1247、1248、1249、1250、1251、1252、1253、1254、1255、1256、1257、1258、1259、1260、1261、1262、1263、1264、1265、1266、1267、1268、1269、1270、1271、1272、1273、1274、1275、1276、1277、1278、1279、1280、1281、1282、1283、1284、1285、1286、1287、1288、1289、1290、1291、1292、1293、1294、1295、1296、1297、1298、1299、1300、1301、1302、1303、1304、1305、1306、1307、1308、1309、1310、1311、1312、1313、1314、1315、1316、1317、1318、1319、1320、1321、1322、1323、1324、1325、1326、1327、1328、1329、1330、1331、1332、1333、1334、1335、1336、1337、1338、1339、1340、1341、1342、1343、1344、1345、1346、1347、1348、1349、1350、1351、1352、1353、1354、1355、1356、1357、1358、1359、1360、1361、1362、1363、1364、1365、1366、1367、1368、1369、1370、1371、1372、1373、1374、1375、1376、1377、1378、1379、1380、1381、1382、1383、1384、1385、1386、1387、1388、1389、1390、1391、1392、1393、1394、1395、1396、1397、1398、1399、1400、1401、1402、1403、1404、1405、1406、1407、1408、1409、1410、1411、1412、1413、1414、1415、1416、1417、1418、1419、1420、1421、1422、1423、1424、1425、1426、1427、1428、1429、1430、1431、1432、1433、1434、1435、1436、1437、1438、1439、1440、1441、1442、1443、1444、1445、1446、1447、1448、1449、1450、1451、1452、1453、1454、1455、1456、1457、1458、1459、1460、1461、1462、1463、1464、1465、1466、1467、1468、1469、1470、1471、1472、1473、1474、1475、1476、1477、1478、1479、1480、1481、1482、1483、1484、1485、1486、1487、1488、1489、1490、1491、1492、1493、1494、1495、1496、1497、1498、1499、1500、1501、1502、1503、1504、1505、1506、1507、1508、1509、1510、1511、1512、1513、1514、1515、1516、1517、1518、1519、1520、1521、1522、1523、1524、1525、1526、1527、1528、1529、1530、1531、1532、1533、1534、1535、1536、1537、1538、1539、1540、1541、1542、1543、1544、1545、1546、1547、1548、1549、1550、1551、1552、1553、1554、1555、1556、1557、1558、1559、1560、1561、1562、1563、1564、1565、1566、1567、1568、1569、1570、1571、1572、1573、1574、1575、1576、1577、1578、1579、1580、1581、1582、1583、1584、1585、1586、1587、1588、1589、1590、1591、1592、1593、1594、1595、1596、1597、1598、1599、1600、1601、1602、1603、1604、1605、1606、1607、1608、1609、1610、1611、1612、1613、1614、1615、1616、1617、1618、1619、1620、1621、1622、1623、1624、1625、1626、1627、1628、1629、1630、1631、1632、1633、1634、1635、1636、1637、1638、1639、1640、1641、1642、1643、1644、1645、1646、1647、1648、1649、1650、1651、1652、1653、1654、1655、1656、1657、1658、1659、1660、1661、1662、1663、1664、1665、1666、1667、1668、1669、1670、1671、1672、1673、1674、1675、1676、1677、1678、1679、1680、1681、1682、1683、1684、1685、1686、1687、1688、1689、1690、1691、1692、1693、1694、1695、1696、1697、1698、1699、1700、1701、1702、1703、1704、1705、1706、1707、1708、1709、1710、1711、1712、1713、1714、1715、1716、1717、1718、1719、1720、1721、1722、1723、1724、1725、1726、1727、1728、1729、1730、1731、1732、1733、1734、1735、1736、1737、1738、1739、1740、1741、1742、1743、1744、1745、1746、1747、1748、1749、1750、1751、1752、1753、1754、1755、1756、1757、1758、1759、1760、1761、1762、1763、1764、1765、1766、1767、1768、1769、1770、1771、1772、1773、1774、1775、1776、1777、1778、1779、1780、1781、1782、1783、1784、1785、1786、1787、1788、1789、1790、1791、1792、1793、1794、1795、1796、1797、1798、1799、1800、1801、1802、1803、1804、1805、1806、1807、1808、1809、1810、1811、1812、1813、1814、1815、1816、1817、1818、1819、1820、1821、1822、1823、1824、1825、1826、1827、1828、1829、1830、1831、1832、1833、1834、1835、1836、1837、1838、1839、1840、1841、1842、1843、1844、1845、1846、1847、1848、1849、1850、1851、1852、1853、1854、1855、1856、1857、1858、1859、1860、1861、1862、1863、1864、1865、1866、1867、1868、1869、1870、1871、1872、1873、1874、1875、1876、1877、1878、1879、1880、1881、1882、1883、1884、1885、1886、1887、1888、1889、1890、1891、1892、1893、1894、1895、1896、1897、1898、1899、1900、1901、1902、1903、1904、1905、1906、1907、1908、1909、1910、1911、1912、1913、1914、1915、1916、1917、1918、1919、1920、1921、1922、1923、1924、1925、1926、1927、1928、1929、1930、1931、1932、1933、1934、1935、1936、1937、1938、1939、1940、1941、1942、1943、1944、1945、1946、1947、1948、1949、1950、1951、1952、1953、1954、1955、1956、1957、1958、1959、1960、1961、1962、1963、1964、1965、1966、1967、1968、1969、1970、1971、1972、1973、1974、1975、1976、1977、1978、1979、1980、1981、1982、1983、1984、1985、1986、1987、1988、1989、1990、1991、1992、1993、1994、1995、1996、1997、1998、1999、2000、2001、2002、2003、2004、2005、2006、2007、2008、2009、2010、2011、2012、2013、2014、2015、2016、2017、2018、2019、2020、2021、2022、2023、2024、2025、2026、2027、2028、2029、2030、2031、2032、2033、2034、2035、2036、2037、2038、2039、2040、2041、2042、2043、2044、2045、2046、2047、2048、2049、2050、2051、2052、2053、2054、2055、2056、2057、2058、2059、2060、2061、2062、2063、2064、2065、2066、2067、2068、2069、2070、2071、2072、2073、2074、2075、2076、2077、2078、2079、2080、2081、2082、2083、2084、2085、2086、2087、2088、2089、2090、2091、2092、2093、2094、2095、2096、2097、2098、2099、2100、2101、2102、2103、2104、2105、2106、2107、2108、2109、2110、2111、2112、2113、2114、2115、2116、2117、2118、2119、2120、2121、2122、2123、2124、2125、2126、2127、2128、2129、2130、2131、2132、2133、2134、2135、2136、2137、2138、2139、2140、2141、2142、2143、2144、2145、2146、2147、2148、2149、2150、2151、2152、2153、2154、2155、2156、2157、2158、2159、2160、2161、2162、2163、2164、2165、2166、2167、2168、2169、2170、2171、2172、2173、2174、2175、2176、2177、2178、2179、2180、2181、2182、2183、2184、2185、2186、2187、2188、2189、2190、2191、2192、2193、2194、2195、2196、2197、2198、2199、2200、2201、2202、2203、2204、2205、2206、2207、2208、2209、2210、2211、2212、2213、2214、2215、2216、2217、2218、2219、2220、2221、2222、2223、2224、2225、2226、2227、2228、2229、2230、2231、2232、2233、2234、2235、2236、2237、2238、2239、2240、2241、2242、2243、2244、2245、2246、2247、2248、2249、2250、2251、2252、2253、2254、2255、2256、2257、2258、2259、2260、2261、2262、2263、2264、2265、2266、2267、2268、2269、2270、2271、2272、2273、2274、2275、2276、2277、2278、2279、2280、2281、2282、2283、2284、2285、2286、2287、2288、2289、2290、2291、2292、2293、2294、2295、2296、2297、2298、2299、2300、2301、2302、2303、2304、2305、2306、2307、2308、2309、2310、2311、2312、2313、2314、2315、2316、2317、2318、2319、2320、2321、2322、2323、2324、2325、2326、2327、2328、2329、2330、2331、2332、2333、2334、2335、2336、2337、2338、2339、2340、2341、2342、2343、2344、2345、2346、2347、2348、2349、2350、2351、2352、2353、2354、2355、2356、2357、2358、2359、2360、2361、2362、2363、2364、2365、2366、2367、2368、2369、2370、2371、2372、2373、2374、2375、2376、2377、2378、2379、2380、2381、2382、2383、2384、2385、2386、2387、2388、2389、2390、2391、2392、2393、2394、2395、2396、2397、2398、2399、2400、2401、2402、2403、2404、2405、2406、2407、2408、2409、2410、2411、2412、2413、2414、2415、2416、2417、2418、2419、2420、2421、2422、2423、2424、2425、2426、2427、2428、2429、2430、2431、2432、2433、2434、2435、2436、2437、2438、2439、2440、2441、2442、2443、2444、2445、2446、2447、2448、2449、2450、2451、2452、2453、2454、2455、2456、2457、2458、2459、2460、2461、2462、2463、2464、2465、2466、2467、2468、2469、2470、2471、2472、2473、2474、2475、2476、2477、2478、2479、2480、2481、2482、2483、2484、2485、2486、2487、2488、2489、2490、2491、2492、2493、2494、2495、2496、2497、2498、2499、2500、2501、2502、2503、2504、2505、2506、2507、2508、2509、2510、2511、2512、2513、2514、2515、2516、2517、2518、2519、2520、2521、2522、2523、2524、2525、2526、2527、2528、2529、2530、2531、2532、2533、2534、2535、2536、2537、2538、2539、2540、2541、2542、2543、2544、2545、2546、2547、2548、2549、2550、2551、2552、2553、2554、2555、2556、2557、2558、2559、2560、2561、2562、2563、2564、2565、2566、2567、2568、2569、2570、2571、2572、2573、2574、2575、2576、2577、2578、2579、2580、2581、2582、2583、2584、2585、2586、2587、2588、2589、2590、2591、2592、2593、2594、2595、2596、2597、2598、2599、2600、2601、2602、2603、2604、2605、2606、2607、2608、2609、2610、2611、2612、2613、2614、2615、2616、2617、2618、2619、2620、2621、2622、2623、2624、2625、2626、2627、2628、2629、2630、2631、2632、2633、2634、2635、2636、2637、2638、2639、2640、2641、2642、2643、2644、2645、2646、2647、2648、2649、2650、2651、2652、2653、2654、2655、2656、2657、2658、2659、2660、2661、2662、2663、2664、2665、2666、2667、2668、2669、2670、2671、2672、2673、2674、2675、2676、2677、2678、2679、2680、2681、2682、2683、2684、2685、2686、2687、2688、2689、2690、2691、2692、2693、2694、2695、2696、2697、2698、2699、2700、2701、2702、2703、2704、2705、2706、2707、2708、2709、2710、2711、2712、2713、2714、2715、2716、2717、2718、2719、2720、2721、2722、2723、2724、2725、2726、2727、2728、2729、2730、2731、2732、2733、2734、2735、2736、2737、2738、2739、2740、2741、2742、2743、2744、2745、2746、2747、2748、2749、2750、2751、2752、2753、2754、2755、2756、2757、2758、2759、2760、2761、2762、2763、2764、2765、2766、2767、2768、2769、2770、2771、2772、2773、2774、2775、2776、2777、2778、2779、2780、2781、2782、2783、2784、2785、2786、2787、2788、2789、2790、2791、2792、2793、2794、2795、2796、2797、2798、2799、2800、2801、2802、2803、2804、2805、2806、2807、2808、2809、2810、2811、2812、2813、2814、2815、2816、2817、2818、2819、2820、2821、2822、2823、2824、2825、2826、2827、2828、2829、2830、2831、2832、2833、2834、2835、2836、2837、2838、2839、2840、2841、2842、2843、2844、2845、2846、2847、2848、2849、2850、2851、2852、2853、2854、2855、2856、2857、2858、2859、2860、2861、2862、2863、2864、2865、2866、2867、2868、2869、2870、2871、2872、2873、2874、2875、2876、2877、2878、2879、2880、2881、2882、2883、2884、2885、2886、2887、2888、2889、2890、2891、2892、2893、2894、2895、2896、2897、2898、2899、2900、2901、2902、2903、2904、2905、2906、2907、2908、2909、2910、2911、2912、2913、2914、2915、2916、2917、2918、2919、2920、2921、2922、2923、2924、2925、2926、2927、2928、2929、2930、2931、2932、2933、2934、2935、2936、2937、2938、2939、2940、2941、2942、2943、2944、2945、2946、2947、2948、2949、2950、2951、2952、2953、2954、2955、2956、2957、2958、2959、2960、2961、2962、2963、2964、2965、2966、2967、2968、2969、2970、2971、2972、2973、2974、2975、2976、2977、2978、2979、2980、2981、2982、2983、2984、2985、2986、2987、2988、2989、2990、2991、2992、2993、2994、2995、2996、2997、2998、2999、3000、3001、3002、3003、3004、3005、3006、3007、3008、3009、3010、3011、3012、3013、3014、3015、3016、3017、3018、3019、3020、3021、3022、3023、3024、3025、3026、3027、3028、3029、3030、3031、3032、3033、3034、3035、3036、3037、3038、3039、3040、3041、3042、3043、3044、3045、3046、3047、3048、3049、3050、3051、3052、3053、3054、3055、3056、3057、3058、3059、3060、3061、3062、3063、3064、3065、3066、3067、3068、3069、3070、3071、3072、3073、3074、3075、3076、3077、3078、3079、3080、3081、3082、3083、3084、3085、3086、3087、3088、3089、3090、3091、3092、3093、3094、3095、3096、3097、3098、3099、3100、3101、3102、3103、3104、3105、3106、3107、3108、3109、3110、3111、3112、3113、3114、3115、3116、3117、3118、3119、3120、3121、3122、3123、3124、3125、3126、3127、3128、3129、3130、3131、3132、3133、3134、3135、3136、3137、3138、3139、3140、3141、3142、3143、3144、3145、3146、3147、3148、3149、3150、3151、3152、3153、3154、3155、3156、3157、3158、3159、3160、3161、3162、3163、3164、3165、3166、3167、3168、3169、3170、3171、3172、3173、3174、3175、3176、3177、3178、3179、3180、3181、3182、3183、3184、3185、3186、3187、3188、3189、3190、3191、3192、3193、3194、3195、3196、3197、3198、3199、3200、3201、3202、3203、3204、3205、3206、3207、3208、3209、3210、3211、3212、3213、3214、3215、3216、3217、3218、3219、3220、3221、3222、3223、3224、3225、3226、3227、3228、3229、3230、3231、3232、3233、3234、3235、3236、3237, 3238, 3239, 3240, 3241, 3242, 3243, 3244, 3245, 3246, 3247, 3248, 3249, and 3250 nucleotides. The length of any stuffing region of the viral genome can be 50-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900. 00, 900-950, 950-1000, 1000-1050, 1050-1100, 1100-1150, 1150-1200, 1200-1250, 1250-1300, 1300-1350, 1350-1400, 1400-1450, 1450-1500, 1500-1550, 1550-1600, 1600-1650, 1650-1700、1700-1750、1750-1800、1800-1850、1850-1900、1900-1950、1950-2000、2000-2050、2050-2100、2100-2150、2150-2200、2200-2250、2250-2300、2300-2350、2350-2400、 2400-2450, 2450-2500, 2500-2550, 2550-2600, 2600-2650, 2650-2700, 2700-2750, 2750-2800, 2800-2850, 2850-2900, 2900-2950, ​​2950-3000, 3000-3050, 3050-3100, 3100-3150,3150-3200 and 3200-3250 nucleotides. As a non-limiting example, the viral genome comprises a stuffing region of about 55 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 56 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 97 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 103 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 105 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 357 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 363 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 712 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 714 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 1203 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 1209 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 1512 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 1519 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 2395 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 2403 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 2405 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 3013 nucleotides in length. As a non-limiting example, the viral genome comprises a stuffing region of about 3021 nucleotides in length.

[0573] In one embodiment, the AAV particle viral genome may comprise at least one enhancer sequence region. The one or more enhancer sequence regions may independently have, for example, but not limited to, the following lengths: 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399 and 400 nucleotides. The length of the enhancer region of the viral genome can be 300-310, 300-325, 305-315, 310-320, 315-325, 320-330, 325-335, 325-350, 330-340, 335-345, 340-350, 345-355, 350-360, 350-375, 355-365, 360-370, 365-375, 370-380, 375-385, 375-400, 380-390, 385-395 and 390-400 nucleotides. As a non-limiting example, the viral genome comprises an enhancer region of about 303 nucleotides in length. As a non-limiting example, the viral genome comprises an enhancer region of about 382 nucleotides in length.

[0574] In one embodiment, the AAV particle viral genome may include at least one promoter sequence region. The one or more promoter sequence regions can independently have, for example, but not limited to, the following lengths: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 ,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,1 42, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202 2, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262,263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557 7, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599 and 600 nucleotides. The length of the promoter region of the viral genome can be 4-10, 10-20, 10-50, 20-30, 30-40, 40-50, 50-60, 50-100, 60-70, 70-80, 80-90, 90-100, 100-110, 100-150, 110-120, 120-130, 130-140, 140-150, 150-160, 150-200, 160-170, 170-180, 180-190, 190-200, 200-210, 200-250, 210-220, 220-230, 230-240, 240-250, 250-260, 250-300, 260-270, 270-280, 280-290, 290 -300, 300-310, 300-350, 310-320, 320-330, 330-340, 340-350, 350-360, 350-400, 360-370, 370-380, 380-390, 390-400, 400-410, 400-450, 410-420, 420-430, 430-4 40, 440-450, 450-460, 450-500, 460-470, 470-480, 480-490, 490-500, 500-510, 500-550, 510-520, 520-530, 530-540, 540-550, 550-560, 550-600, 560-570, 570-580,580-590 and 590-600 nucleotides. As a non-limiting example, the viral genome comprises a promoter region of about 4 nucleotides in length. As a non-limiting example, the viral genome comprises a promoter region of about 17 nucleotides in length. As a non-limiting example, the viral genome comprises a promoter region of about 204 nucleotides in length. As a non-limiting example, the viral genome comprises a promoter region of about 219 nucleotides in length. As a non-limiting example, the viral genome comprises a promoter region of about 260 nucleotides in length. As a non-limiting example, the viral genome comprises a promoter region of about 303 nucleotides in length. As a non-limiting example, the viral genome comprises a promoter region of about 382 nucleotides in length. As a non-limiting example, the viral genome comprises a promoter region of about 588 nucleotides in length.

[0607] In one embodiment, the AAV particle viral genome may comprise at least one exon sequence region. The one or more exon regions may independently have, for example, but not limited to, the following lengths: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 8, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 1 19, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 and 150 nucleotides.The length of the exon region of the viral genome can be 2-10, 5-10, 5-15, 10-20, 10-30, 10-40, 15-20, 15-25, 20-30, 20-40, 20-50, 25-30, 25-35, 30-40, 30-50, 30-60, 35-40, 35-45, 40-50, 40-60, 40-70, 45-50, 45-55, 50-60, 50-70, 50-80, 55-60, 55-65, 60-70, 60-80, 60-90, 65-70, 65-75, 70-80, 70-90, 70-100, 75-80, 75-85. 5, 80-90, 80-100, 80-110, 85-90, 85-95, 90-100, 90-110, 90-120, 95-100, 95-105, 100-110, 100-120, 100-130, 105-110, 105-115, 110-120, 110-130, 110-140, 115-120, 115-125, 120-130, 120-140, 120-150, 125-130, 125-135, 130-140, 130-150, 135-140, 135-145, 140-150, and 145-150 nucleotides. As a non-limiting example, the viral genome comprises an exon region of about 53 nucleotides in length.As a non-limiting example, the viral genome comprises an exon region of about 134 nucleotides in length.

[0612] 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135 5, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217 7, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277,278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349 and 350 nucleotides. The length of the intron region of the viral genome can be 25-35, 25-50, 35-45, 45-55, 50-75, 55-65, 65-75, 75-85, 75-100, 85-95, 95-105, 100-125, 105-115, 115-125, 125-135, 125-150, 135-145, 145-155, 150-175, 155-165, 165-175, 175-185, 175-200, 185-195, 195-205, 200-225, 205-215, 215-225, 225-235, 225-250, 235-245, 245-255, 250-275, 255-265, 265-275, 275-285, 275-300, 285-295, 295-305, 300-325, 305-315, 315-325, 325-335, 325-350, and 335-345 nucleotides. As a non-limiting example, the viral genome comprises an intronic region of about 32 nucleotides in length. As a non-limiting example, the viral genome comprises an intronic region of about 172 nucleotides in length. As a non-limiting example, the viral genome comprises an intron region of approximately 201 nucleotides in length. As a non-limiting example, the viral genome comprises an intron region of approximately 347 nucleotides in length.

[0625] In one embodiment, the AAV particle viral genome may comprise at least one polyadenylation signal sequence region. The one or more polyadenylation signal sequence regions can independently have, for example, but not limited to, the following lengths: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 4, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140 、141、142、143、144、145、146、147、148、149、150、151、152、153、154、155、156、157、158、159、160、161、162、163、164、165、166、167、168、169、170、171、172、173、174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192、193、194、195、196、197、198、199、200 、201、202、203、204、205、206、207、208、209、210、211、212、213、214、215、216、217、218、219、220、221、222、223、224、225、226、227、228、229、230、231、232、233、234、235、236、237、238、239、240、241、242、243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556 6, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599 and 600 nucleotides. The length of the polyadenylation signal sequence region of the viral genome can be 4-10, 10-20, 10-50, 20-30, 30-40, 40-50, 50-60, 50-100, 60-70, 70-80, 80-90, 90-100, 100-110, 100-150, 110-120, 120-130, 130-140, 140- 150, 150-160, 150-200, 160-170, 170-180, 180-190, 190-200, 200-210, 200-250, 210-220, 220-230, 230-240, 240-250, 250-260, 250-300, 260-270, 270-280, 280-290, 290-300, 300-310, 300-350, 310-320, 320-330, 330-340, 340-350, 350-360, 350-400, 360-370, 370-380, 380-390, 390-400, 400-410, 400-450, 410-420, 420-430, 430- 440, 440-450, 450-460, 450-500, 460-470, 470-480, 480-490, 490-500, 500-510, 500-550, 510-520, 520-530, 530-540, 540-550, 550-560, 550-600, 560-570, 570-580,580-590 and 590-600 nucleotides. As a non-limiting example, the viral genome comprises a polyadenylation signal sequence region of about 127 nucleotides in length. As a non-limiting example, the viral genome comprises a polyadenylation signal sequence region of about 225 nucleotides in length. As a non-limiting example, the viral genome comprises a polyadenylation signal sequence region of about 476 nucleotides in length. As a non-limiting example, the viral genome comprises a polyadenylation signal sequence region of about 477 nucleotides in length.

[0665] In one embodiment, the AAV particle viral genome comprises more than one polyA signal sequence region.

[0666] Non-limiting examples of ITR to ITR sequences (ITR to ITR) of AAV particles comprising a viral genome with a payload region comprising a regulatory polynucleotide sequence are described in Table 9.

[0667] Table 9. ITR to ITR sequences of AAV particles containing regulatory polynucleotides

[0668]

[0669]

[0670] In one embodiment, the AAV particle comprises a viral genome comprising a sequence having a percent identity to any one of SEQ ID NOs: 122- 146. The viral genome may be 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to any one of SEQ ID NOs: 122-146. The viral genome can be 1-10%, 10-20%, 30-40%, 50-60%, 50-70%, 50-80%, 50-90%, 50-99%, 50-100%, 60-70%, 60-80%, 60-90%, 60-99%, 60-100%, 70-80%, 70-90%, 70-99%, 70-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-100%, 90-95%, 90-99% or 90-100% identical to any one of SEQ ID NOs: 122-146. As a non-limiting example, the viral genome comprises a sequence that is 80% identical to any one of SEQ ID NOs: 122-146. As another non-limiting example, the viral genome comprises a sequence that is 85% identical to any one of SEQ ID NOs: 122-146. As another non-limiting example, the viral genome comprises a sequence that is 90% identical to any one of SEQ ID NOs: 122-146. As another non-limiting example, the viral genome comprises a sequence that is 95% identical to any one of SEQ ID NOs: 122-146. As another non-limiting example, the viral genome comprises a sequence that is 99% identical to any one of SEQ ID NOs: 122-146.

[0671] AAV particles can be modified to enhance delivery efficiency. Such modified AAV particles comprising nucleic acid sequences encoding the siRNA molecules of the present invention can be efficiently packaged and can be used to successfully infect target cells with high frequency and minimal toxicity.

[0672] In some embodiments, the AAV particles comprising the nucleic acid sequence encoding the siRNA molecules of the present invention can be human serotype AAV particles. Such human AAV particles can be derived from any known serotype, for example, from any of the serotypes AAV1-AAV11. As non-limiting examples, the AAV particles can be vectors comprising an AAV1-derived genome in an AAV1-derived capsid; vectors comprising an AAV2-derived genome in an AAV2-derived capsid; vectors comprising an AAV4-derived genome in an AAV4-derived capsid; vectors comprising an AAV6-derived genome in an AAV6-derived capsid or vectors comprising an AAV9-derived genome in an AAV9-derived capsid.

[0673] In other embodiments, the AAV particles comprising the nucleic acid sequence encoding the siRNA molecules of the present invention may be pseudotyped hybrid or chimeric AAV particles comprising sequences and / or components originating from at least two different AAV serotypes. Pseudotyped AAV particles may be vectors comprising an AAV genome derived from one AAV serotype and capsid proteins derived at least in part from a different AAV serotype. As non-limiting examples, such pseudotyped AAV particles may be vectors comprising an AAV2-derived genome in an AAV1-derived capsid; or a vector comprising an AAV2-derived genome in an AAV6-derived capsid; or a vector comprising an AAV2-derived genome in an AAV4-derived capsid; or a vector comprising an AAV2-derived genome in an AAV9-derived capsid. In a similar manner, the present invention encompasses any hybrid or chimeric AAV particles.

[0674] In other embodiments, AAV particles comprising nucleic acid sequences encoding siRNA molecules of the invention can be used to deliver siRNA molecules to the central nervous system (eg, US Pat. No. 6,180,613; the contents of which are herein incorporated by reference in their entirety).

[0675] In some aspects, the AAV particles comprising nucleic acid sequences encoding the siRNA molecules of the present invention can further comprise modified capsids comprising peptides from non-viral sources. In other aspects, the AAV particles can comprise CNS-specific chimeric capsids to facilitate delivery of the encoded siRNA duplexes to the brain and spinal cord. For example, alignments of cap nucleotide sequences from AAV variants exhibiting CNS tropism can be constructed to identify variable region (VR) sequences and structures.

[0676] In other embodiments, the siRNA molecules of the invention can be encoded in a plasmid vector, a viral vector (eg, an AAV vector), a genome, or other nucleic acid expression vector for delivery to cells.

[0677] The DNA expression plasmid can be used to stably express the siRNA duplex or dsRNA of the present invention in cells and achieve long-term inhibition of the target gene.

[0678] In one aspect, the sense and antisense strands of the siRNA duplex encoded by a polynucleotide targeting SOD1 are typically linked by a short spacer sequence, resulting in the expression of a stem-loop structure called a short hairpin RNA (shRNA). The hairpin is recognized and cleaved by Dicer, thereby generating a mature siRNA molecule.

[0679] According to the present invention, an AAV vector containing a nucleic acid of a siRNA molecule targeting SOD1 mRNA is prepared, and the AAV vector can be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9 (hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8 and AAV-DJ and variants thereof.

[0680] In some embodiments, when expressed, the siRNA duplexes or dsRNAs of the present invention suppress (or degrade) the target mRNA (i.e., SOD1). Thus, siRNA duplexes or dsRNAs encoded by polynucleotides targeting SOD1 can be used to substantially inhibit the expression of the SOD1 gene in cells, such as motor neurons. In some aspects, inhibition of SOD1 gene expression refers to inhibition by at least about 20%, preferably at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%. Thus, the protein product of the target gene can be inhibited by at least about 20%, preferably at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%. The SOD1 gene can be a wild-type gene or a mutant SOD1 gene having at least one mutation. Thus, the protein is a wild-type protein or a mutant polypeptide having at least one mutation.

[0681] Virus production

[0682] The present disclosure provides a method for producing parvoviral particles, such as AAV particles, by viral genome replication in a viral replicating cell, comprising contacting the viral replicating cell with an AAV polynucleotide or an AAV genome.

[0683] The present disclosure provides a method for producing AAV particles with enhanced (increased, improved) transduction efficiency, which comprises the steps of: 1) co-transfecting competent bacterial cells with a bacmid vector and a viral construct vector and / or an AAV payload construct vector, 2) isolating the resulting viral construct expression vector and the AAV payload construct expression vector and transfecting virus-replicating cells separately, 3) isolating and purifying the resulting payload and the viral construct particles comprising the viral construct expression vector or the AAV payload construct expression vector, 4) co-infecting virus-replicating cells with the AAV payload and the viral construct particles comprising the viral construct expression vector or the AAV payload construct expression vector, and 5) harvesting and purifying the virus particles comprising the parvovirus genome.

[0684] In one embodiment, the present invention provides a method for producing AAV particles, comprising the steps of: 1) co-transfecting mammalian cells (such as, but not limited to, HEK293 cells) with a payload region, a construct expressing rep and cap genes, and a helper construct, and 2) harvesting and purifying the AAV particles containing the viral genome.

[0685] cell

[0686] The present disclosure provides cells comprising AAV polynucleotides and / or AAV genomes.

[0687] The viral production disclosed herein describes processes and methods for producing AAV particles that are contacted with target cells to deliver a payload construct, such as a recombinant viral construct, comprising a polynucleotide sequence encoding a payload molecule.

[0688] In one embodiment, AAV particles can be produced in virus-replicating cells including insect cells.

[0689] Growth conditions for insect cells in culture and the production of heterologous products by insect cells in culture are well known in the art, see US Pat. No. 6,204,059, the contents of which are incorporated herein by reference in their entirety.

[0690] According to the present invention, any insect cell that allows parvovirus replication and can be maintained in culture can be used. Cell lines derived from Spodoptera frugiperda, including but not limited to Sf9 or Sf21 cell lines, Drosophila cell lines, or mosquito cell lines, such as cell lines derived from Aedes albopictus, can be used. The use of insect cells for expressing heterologous proteins is well documented, as are methods for introducing nucleic acids, such as vectors, such as insect cell-compatible vectors, into such cells and methods for maintaining such cells in culture. See, e.g., Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir. 63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88:4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir. 219:37-44 (1996); Zhao et al., Vir. 272:382-93 (2000); and Samulski et al., U.S. Pat. No. 6,204,059, the contents of each of which are incorporated herein by reference in their entirety.

[0691] The virus replication cell can be selected from any organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including insect cells, yeast cells, and mammalian cells. The virus replication cell can comprise mammalian cells, such as A549, WEH1, 3T3, 10T1 / 2, BHK, MDCK, COS1, COS 7, BSC 1, BSC 40, BMT 10, VERO, W138, HeLa, HEK293, Saos, C2C12, L cells, HT1080, HepG2, and primary fibroblasts, hepatocytes, and myoblasts derived from mammals. The virus replication cell comprises a cell derived from a mammalian species, including but not limited to people, monkeys, mice, rats, rabbits, and hamsters, or a cell type, including but not limited to fibroblasts, hepatocytes, tumor cells, cell line transformed cells, etc.

[0692] Mammalian cell (small-scale) production

[0693] The viral production disclosed herein describes processes and methods for producing AAV particles that contact target cells to deliver a payload, such as a recombinant viral construct comprising a polynucleotide sequence encoding the payload.

[0694] In one embodiment, AAV particles can be produced in viral replicating cells, including mammalian cells.

[0695] Virus replicating cells commonly used for the production of recombinant AAV particles include, but are not limited to, 293 cells, COS cells, HeLa cells, KB cells, and other mammalian cell lines described in U.S. Patent Nos. 6,156,303, 5,387,484, 5,741,683, 5,691,176, and 5,688,676; U.S. Patent Application 2002 / 0081721, and International Patent Applications WO 00 / 47757, WO 00 / 24916, and WO 96 / 17947, the contents of each of which are incorporated herein by reference in their entirety.

[0696] In one embodiment, AAV particles are produced in mammalian cells in which all three VP proteins are expressed in a stoichiometry close to 1:1:10 (VP1:VP2:VP3). Regulatory mechanisms that allow this controlled expression level include the production of two mRNAs, one for VP1 and the other for VP2 and VP3, through differential splicing.

[0697] In another embodiment, AAV particles are produced in mammalian cells using a triple transfection method in which the payload construct, the parvoviral Rep and parvoviral Cap, and the helper construct are contained in three different constructs. The three-component triple transfection method for AAV particle production can be used to produce small amounts of virus for analysis including transduction efficiency, target tissue (tropism) assessment, and stability.

[0698] Baculovirus

[0699] The particle production disclosed herein describes processes and methods for producing AAV particles that are contacted with target cells to deliver a payload construct that includes a polynucleotide sequence encoding the payload.

[0700] Briefly, the viral construct vector and the AAV payload construct vector are each introduced into a bacmid (also known as a bacmid) via a transposon donor / acceptor system using standard molecular biology techniques known and performed by those skilled in the art. Transfection of a separate viral replication cell population produces two baculoviruses, one containing the viral construct expression vector and the other containing the AAV payload construct expression vector. The two baculoviruses can be used to infect a single viral replication cell population for the production of AAV particles.

[0701] Baculovirus expression vectors for producing viral particles in insect cells, including but not limited to fall armyworm (Sf9) cells, provide high titer viral particle products. Recombinant baculovirus encoding viral construct expression vectors and AAV payload construct expression vectors triggers productive infection of viral replicating cells. Infectious baculovirus particles released from the primary infection infect other cells in the culture again and infect the entire cell culture population exponentially in multiple infection cycles (which is a function of the initial multiplicity of infection), see Urabe, M. et al., J Virol. 2006 Feb; 80(4): 1874-85, the contents of which are incorporated herein by reference in their entirety.

[0702] The production of AAV particles using baculovirus in an insect cell system can address the known genetic and physical instability of baculovirus. In one embodiment, the production system addresses the instability of baculovirus over multiple passages by utilizing a titer-free infected cell storage and amplification system. Small-scale seed cultures of virus producer cells are transfected with viral expression constructs encoding structural and nonstructural components of the virus particles. The virus producer cells infected with baculovirus are harvested into aliquots that can be frozen and stored in liquid nitrogen; the aliquots retain viability and infectivity for infecting large-scale virus production cell cultures, Wasilko DJ et al., Protein Expr Purif. 2009 Jun;65(2):122-32, the contents of which are incorporated herein by reference in their entirety.

[0703] Genetically stable baculovirus can be used to generate a source of one or more components for producing AAV particles in invertebrate cells. In one embodiment, a defective baculovirus expression vector can be maintained episomally in insect cells. In such an embodiment, the bacmid vector is engineered with replication control elements, including but not limited to promoters, enhancers, and / or cell cycle-regulated replication elements.

[0704] In one embodiment, baculoviruses can be engineered with a (non-)selectable marker for recombination into the chitinase / cathepsin locus. The chia / v-cath locus is not essential for propagation of baculoviruses in tissue culture, and v-cath (EC 3.4.22.50) is a cysteine ​​endoprotease that is most active against substrates containing an Arg-Arg dipeptide. The Arg-Arg dipeptide is present in densovirus and parvovirus capsid structural proteins but is rarely found in Dependinovirus VP1.

[0705] In one embodiment, stable viral replicating cells permissive for baculovirus infection are engineered with at least one stably integrated copy of any elements necessary for AAV replication and viral particle production, including but not limited to the entire AAV genome, the Rep and Cap genes, the Rep gene, the Cap gene, each Rep protein as a separate transcription cassette, each VP protein as a separate transcription cassette, AAP (assembly activator protein), or at least one baculovirus helper gene with a native or non-native promoter.

[0706] The AAV particles described herein can be produced by triple transfection or baculovirus-mediated viral production, or any other method known in the art. Any suitable permissive or packaging cell known in the art can be used to produce the vector. Mammalian cells are generally preferred. Also preferred are transcomplementing packaging cell lines that provide functions deleted from the replication-defective helper virus, such as 293 cells or other E1a transcomplementing cells.

[0707] The gene cassette may comprise some or all of the cap and rep genes of a parvovirus (e.g., AAV). However, preferably, some or all of the cap and rep functions are provided in trans by introducing a packaging vector encoding the capsid and / or Rep proteins into the cell. Most preferably, the gene cassette does not encode the capsid or Rep proteins. Alternatively, a packaging cell line stably transformed to express the cap and / or rep genes is used.

[0708] In some cases, recombinant AAV viral particles are produced and purified from the culture supernatant according to the procedures described in US20160032254, the contents of which are incorporated herein by reference. Production can also involve methods known in the art, including those using 293T cells, sf9 insect cells, triple transfection methods, or any suitable production method.

[0709] In some cases, 293T cells (adherent / suspension) are transfected with polyethyleneimine (PEI) with the plasmids required for AAV production, namely AAV2 rep, an adenoviral helper construct, and a transgene cassette flanked by ITRs. The AAV2 rep plasmid also contains the cap sequence of the specific virus being studied. Twenty-four hours after transfection (for suspension cultures, no medium change), which occurs in DMEM / F17 with or without serum, the medium is replaced with fresh medium with or without serum. Three (3) days after transfection, the culture medium of the 293 adherent cells is sampled. The cells are then scraped off, or the suspension cells are pelleted and then transferred to a container. For adherent cells, after centrifugation to remove the cell pellet, a second sample is taken from the supernatant after scraping. Next, the cells are lysed by three consecutive freeze-thaw cycles (-80°C to 37°C) or by adding the detergent triton. Cell debris is removed by centrifugation or depth filtration, and a sample 3 is taken from the culture medium. AAV particles in the sample are quantified by DNA qPCR by DNase-resistant genome titration. The total yield of this transfection was equal to the particle concentration from sample 3.

[0710] AAV particle titers were measured based on genome copy number (genomic particles per ml). Genomic particle concentration was based on DNA qPCR of vector DNA as previously reported (Clark et al. (1999) Hum. Gene Ther., 10:1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278).

[0711] Large-scale production

[0712] In some embodiments, AAV particle production can be modified to increase the scale of production. Large-scale virus production methods according to the present disclosure may include U.S. Patent Nos. 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508 or any method taught in International Publication Nos. WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 and WO2001023597, the contents of each of which are incorporated herein by reference in their entirety. Methods for increasing the scale of viral particle production generally include increasing the number of viral replicating cells. In some embodiments, the viral replicating cells comprise adherent cells. In order to increase the scale of viral particle production of adherent viral replicating cells, a larger cell culture surface is required. In some cases, large-scale production methods include using roller bottles to increase the cell culture surface. Other cell culture substrates with increased surface area are known in the art. Examples of other adherent cell culture products with increased surface area include, but are not limited to (Corning Corp., Corning, NY) and NUNC TM CELL FACTORY TM (Thermo Scientific, Waltham, MA.). In some cases, a large adherent cell surface can contain approximately 1,000 cm 2 to approximately 100,000cm 2 In some cases, large-scale adherent cell cultures may contain approximately 10 7 to about 10 9 cells, about 10 8 to about 10 10 cells, about 10 9 to about 10 12 cells or at least 10 12 In some cases, large-scale adherent cultures can produce approximately 10 9 to about 10 12 , about 10 10 to about 10 13 , about 10 11 to about 10 14 , about 10 12 to about 10 15 or at least 1015 Virus particles.

[0713] In some embodiments, the large-scale virus production methods of the present disclosure may include the use of suspension cell cultures. Suspension cell cultures allow for a significant increase in the number of cells. Typically, the virus can be grown in a suspension culture at approximately 10-50 cm 2 The number of adherent cells grown on a surface area of ​​approximately 1 cm 3 volume of suspension.

[0714] The transfection of the replicating cells of large-scale culture forms can be carried out according to any method known in the art. For large-scale adherent cell culture, transfection methods may include but are not limited to the use of inorganic compounds (such as calcium phosphate), organic compounds [such as polyethyleneimine (PEI)] or the use of non-chemical methods (such as electroporation). For cells grown in suspension, transfection methods may include but are not limited to the use of calcium phosphate and the use of PEI. In some cases, the transfection of large-scale suspension cultures can be carried out according to the part entitled "transfection procedure" described in Feng, L. et al., 2008.Biotechnol Appl.Biochem.50:121-32, the contents of which are incorporated herein by reference as a whole. According to such an embodiment, a PEI-DNA complex can be formed to introduce a plasmid to be transfected. In some cases, cells transfected with the PEI-DNA complex can be "shocked" before transfection. This includes reducing the cell culture temperature to 4°C for approximately 1 hour. In some cases, the cell culture can be shocked for approximately 10 minutes to approximately 5 hours. In some cases, the cell culture can be shocked at a temperature of approximately 0°C to approximately 20°C.

[0715] In some cases, transfection can include one or more vectors for expressing RNA effector molecules to reduce nucleic acid expression from one or more AAV payload constructs. Such methods can enhance the production of viral particles by reducing cellular resources wasted on expressing payload constructs. In some cases, such methods can be implemented according to the methods taught in U.S. Publication No. US2014 / 0099666, the contents of which are incorporated herein by reference in their entirety.

[0716] bioreactor

[0717] In some embodiments, cell culture bioreactor can be used for large-scale virus production.In some cases, bioreactor comprises stirred tank reactor.Such reactor generally comprises the generally cylindrical container with agitator (for example, impeller).In some embodiments, such bioreactor container can be placed in water jacket to control vessel temperature and / or minimize the influence that ambient temperature changes produce.The size range of bioreactor vessel volume can be about 500ml to about 2L, about 1L to about 5L, about 2.5L to about 20L, about 10L to about 50L, about 25L to about 100L, about 75L to about 500L, about 250L to about 2,000L, about 1,000L to about 10,000L, about 5,000L to about 50,000L or at least 50,000L.The container bottom can be circular or flat.In some cases, animal cell culture can be kept in the bioreactor with circular container bottom.

[0718] In some cases, the bioreactor container can be heated by using a thermal cycler. The thermal cycler delivers heated water to around the water jacket. In some cases, the heated water can be pumped through the pipeline (e.g., coil) present in the bioreactor container. In some cases, hot air can circulate around the bioreactor, including but not limited to the air space just above the culture medium. In addition, pH and CO2 levels can be maintained to optimize cell viability.

[0719] In some cases, the bioreactor may include a hollow fiber reactor. Hollow fiber bioreactors can support the cultivation of both anchorage-dependent and anchorage-independent cells. Further bioreactors may include, but are not limited to, packed bed or fixed bed bioreactors. Such bioreactors may include containers with glass beads for adherent cell attachment. Additional packed bed reactors may include ceramic beads.

[0720] In some cases, viral particles are produced using a disposable bioreactor. In some embodiments, such a bioreactor may include a WAVE TM Single-use bioreactors.

[0721] In some embodiments, AAV particle production in animal cell bioreactor culture can be performed according to the methods taught in U.S. Patent Nos. 5,064764, 6,194,191, 6,566,118, 8,137,948, or U.S. Patent Application No. US2011 / 0229971, the contents of each of which are incorporated herein by reference in their entirety.

[0722] Cell lysis

[0723] The cells of the present invention, including but not limited to virus-producing cells, can be lysed according to any method known in the art. Cell lysis can be performed to obtain one or more substances (e.g., virus particles) present in any cell of the present invention. In some embodiments, the invention can be carried out according to U.S. Patent Nos. 7,326,555, 7,579,181, 7,048,920, 6,410,300, 6,436,394, 7,732,129, 7,510,875, 7,445,930, 6,726,907, 6,194,191, 7,125,706, 6,995,006, 6,676,935, 7,968,333, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475 Cell lysis can be performed by methods listed in WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 and WO2001023597, the contents of each of which are incorporated herein by reference in their entirety. Cell lysis methods can be chemical or mechanical. Chemical cell lysis generally involves contacting one or more cells with one or more lytic agents. Mechanical lysis generally involves subjecting one or more cells to one or more lysis conditions and / or one or more lysis forces.

[0724] In some embodiments, chemical lysis can be used for lysing cells. As used herein, the term "lysing agent" refers to any reagent that can help destroy cells. In some cases, a lysing agent is introduced into a solution, referred to as a lysing solution or a lysis buffer. As used herein, the term "lysing solution" refers to a solution (typically an aqueous solution) comprising one or more lysing agents. In addition to the lysing agent, the lysing solution may include one or more buffers, solubilizing agents, surfactants, preservatives, cryoprotectants, enzymes, enzyme inhibitors and / or chelating agents. Lysing buffer is a lysing solution comprising one or more buffers. The other components of the lysing solution may include one or more solubilizing agents. As used herein, the term "solubilizing agent" refers to a compound that enhances the solubility of one or more components of a solution and / or applies the solubility of one or more entities of a solution thereto. In some cases, a solubilizing agent increases the solubility of a protein. In some cases, a solubilizing agent is selected based on the ability of the solubilizing agent to enhance protein solubility while maintaining protein conformation and / or activity.

[0725] Exemplary lysing agents may include any of the lysing agents described in U.S. Patent Nos. 8,685,734, 7,901,921, 7,732,129, 7,223,585, 7,125,706, 8,236,495, 8,110,351, 7,419,956, 7,300,797, 6,699,706, and 6,143,567, the contents of each of which are incorporated herein by reference in their entirety. In some cases, the lysing agent may be selected from lysing salts, amphoteric agents, cationic agents, ionic detergents, and non-ionic detergents. Lysing salts may include, but are not limited to, sodium chloride (NaCl) and potassium chloride (KCl). Other lysis salts can include any lysis salt described in U.S. Patent Nos. 8,614,101, 7,326,555, 7,579,181, 7,048,920, 6,410,300, 6,436,394, 7,732,129, 7,510,875, 7,445,930, 6,726,907, 6,194,191, 7,125,706, 6,995,006, 6,676,935, and 7,968,333, the contents of each of which are incorporated herein by reference in their entirety. The concentration of the salt can be increased or decreased to obtain an effective concentration for rupturing the cell membrane. As indicated herein, an amphoteric agent is a compound that can react as an acid or base. Amphoteric agents may include, but are not limited to, lysophosphatidylcholine, 3-((3-cholamidopropyl)dimethylammonium)-1-propanesulfonic acid (CHAPS), etc. Cationic agents may include, but are not limited to, cetyltrimethylammonium bromide (C(16)TAB) and benzalkonium chloride. Lysing agents comprising detergents may include ionic detergents or non-ionic detergents. Detergents may act to destroy or dissolve cell structures, including but not limited to cell membranes, cell walls, lipids, carbohydrates, lipoproteins, and glycoproteins. Exemplary ionic detergents include any ionic detergent taught in U.S. Patent Nos. 7,625,570 and 6,593,123 or U.S. Publication No. US2014 / 0087361, the contents of each of which are incorporated herein by reference in their entirety. Some ionic detergents may include, but are not limited to, sodium dodecyl sulfate (SDS), cholate, and deoxycholate. In some cases, an ionic detergent may be included in the lysis solution as a solubilizing agent. Non-ionic detergents may include, but are not limited to, octyl glucoside, digitonin, lubricant, C12E8, Triton X-100 and Noniodet P-40. Non-ionic detergents are generally weak lysing agents but may be included as solubilizing agents to solubilize cellular and / or viral proteins. Other lysing agents may include enzymes and urea. In some cases, one or more lysing agents may be combined in the lysis solution to enhance one or more of cell lysis and protein solubility. In some cases, enzyme inhibitors may be included in the lysis solution to prevent proteolysis that may result from disrupting cell membranes.

[0726] In some embodiments, mechanical cell lysis is performed. Mechanical cell lysis methods may include the use of one or more lysis conditions and / or one or more lysis forces. As used herein, the term "lysis conditions" refers to a state or environment that promotes cell destruction. Lysis conditions may include certain temperatures, pressures, osmotic purity, salinity, etc. In some cases, lysis conditions include increasing or decreasing the temperature. According to some embodiments, lysis conditions include temperature changes to promote cell destruction. Cell lysis performed according to such embodiments may include freeze-thaw lysis. As used herein, the term "freeze-thaw lysis" refers to cell lysis in which a cell solution undergoes one or more freeze-thaw cycles. According to the freeze-thaw lysis method, cells in the solution are frozen to induce mechanical destruction of the cell membrane caused by ice crystal formation and expansion. The cell solution used according to the freeze-thaw lysis method may further include one or more lysis agents, solubilizing agents, buffers, cryoprotectants, surfactants, preservatives, enzymes, enzyme inhibitors and / or chelating agents. Once the frozen cell solution is thawed, these components can increase the recovery rate of the desired cell product. In some cases, one or more cryoprotectants are included in the cell solution undergoing freeze-thaw lysis. As used herein, the term "cryoprotectant" refers to a reagent for protecting one or more substances from being damaged by freezing. Cryoprotectants can include any of those taught in U.S. Publication No. US2013 / 0323302 or U.S. Patent Nos. 6,503,888, 6,180,613, 7,888,096, 7,091,030, the contents of each of which are incorporated herein by reference as a whole. In some cases, cryoprotectants can include but are not limited to dimethyl sulfoxide, 1,2-propylene glycol, 2,3-butylene glycol, formamide, glycerol, ethylene glycol, 1,3-propylene glycol and n-dimethylformamide, polyvinyl pyrrolidone, hydroxyethyl starch, agarose, dextran, inositol, glucose, hydroxyethyl starch, lactose, sorbitol, methyl glucose, sucrose and urea. In some embodiments, freeze-thaw lysis can be performed according to any method described in U.S. Patent No. 7,704,721, the contents of which are incorporated herein by reference as a whole.

[0727] As used herein, the term "lysing force" refers to the physical activity used to destroy cells. Lysing force may include, but is not limited to, mechanical force, acoustic force, gravity, optical force, electric field force, etc. The cell lysis performed by mechanical force is referred to as "mechanical lysis" in this article. The mechanical force that can be used according to mechanical lysis can include high shear fluid force. According to this type of mechanical lysis method, a microfluidizer can be used. The microfluidizer generally includes an inlet container to which a cell solution can be applied. The cell solution can then be pumped into the interaction chamber at high speed and / or high pressure by a pump (such as a high-pressure pump) to generate shear fluid force. The lysate obtained can then be collected in one or more output containers. The pump speed and / or pressure can be adjusted to regulate cell lysis and enhance the recovery of the product (such as viral particles). Other mechanical lysis methods can include physically destroying the cell by scraping.

[0728] The cell lysis method can be selected based on the cell culture format of the cells to be lysed. For example, for adherent cell cultures, some chemical and mechanical lysis methods can be used. Such mechanical lysis methods can include freeze-thaw lysis or scraping. In another example, chemical lysis of adherent cell cultures can be performed by incubating with a lysis solution containing a surfactant such as Triton-X-100. In some cases, the cell lysate produced from the adherent cell culture can be treated with one or more nucleases to reduce the viscosity of the lysate caused by the released DNA.

[0729] In one embodiment, a method for collecting AAV particles without lysis can be used for efficient and scalable AAV particle production. In a non-limiting example, AAV particles can be produced by culturing AAV particles lacking heparin binding sites so that the AAV particles enter the supernatant in a cell culture, collecting the supernatant from the culture, and isolating the AAV particles from the supernatant, as described in U.S. Patent Application 20090275107, the contents of which are incorporated herein by reference in their entirety.

[0730] clarify

[0731] Cell lysates containing viral particles can be clarified. Clarification refers to the initial step taken when purifying viral particles from a cell lysate. The purpose of clarification is to prepare the lysate for further purification by removing larger insoluble debris. Clarification steps may include, but are not limited to, centrifugation and filtration. During clarification, centrifugation can be performed at a low speed to remove only larger fragments. Similarly, filtration can be performed using a filter with a larger pore size to remove only larger fragments. In some cases, tangential flow filtration can be used during the clarification process. Goals of viral clarification include high-throughput processing of cell lysates and optimizing final virus recovery. Advantages of including a clarification step include scalability for processing larger volumes of lysate. In some embodiments, clarification can be performed according to any of the methods set forth in U.S. Patent Nos. 8,524,446, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,5...

Claims

1. An adeno-associated virus (AAV) vector comprising a nucleic acid sequence positioned between two inverted terminal repeats (ITRs), wherein the nucleic acid sequence inhibits or suppresses SOD1 expression in a cell when expressed, wherein the nucleic acid sequence comprises a sense strand sequence and an antisense strand sequence, wherein the sense strand sequence comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of the sequence listed in Table 3 by no more than 3 nucleotides, and the antisense strand sequence comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of the sequence listed in Table 2 by no more than 3 nucleotides, and wherein the sense strand sequence and the antisense strand sequence share a complementary region of at least 4 nucleotides in length.

2. The AAV vector of claim 1, wherein the nucleic acid sequence comprises a sense strand sequence and an antisense strand sequence of a siRNA duplex.

3. The AAV vector according to claim 2, wherein the siRNA duplex is selected from the group consisting of siRNA duplex ID No. D-4000 to D-4025.

4. The AAV vector of claim 1, wherein the region of complementarity is at least 17 nucleotides in length.

5. The AAV vector of claim 4, wherein the length of the region of complementarity is between 19 and 21 nucleotides.

6. The AAV vector of claim 5, wherein the region of complementarity is 19 nucleotides in length.

7. The AAV vector of claim 1, wherein the sense strand sequence and the antisense strand sequence are independently 30 nucleotides or less.

8. The AAV vector of claim 1, wherein at least one of the sense strand sequence and the antisense strand sequence comprises a 3' overhang of at least 1 nucleotide.

9. The AAV vector of claim 8, wherein at least one of the sense strand sequence and the antisense strand sequence comprises a 3' overhang of at least 2 nucleotides.

10. The AAV vector according to claim 1, wherein the AAV vector contains the following group of serum: AAVrh.10、AAV1、AAV2、AAV2G9、AAV3、AAV3a、AAV3b、AAV3-3、AAV4、AAV4-4、AAV5、AAV6、AAV6.1、 AAV6.2、AAV6.1.2、AAV7、AAV7.2、AAV8、AAV9、AAV9.11、AAV9.13、AAV9.16、AAV9.24、AAV9.45、AAV9.47、AAV9.61、AAV9.68、AAV9.84、AAV9.9、AAV10 AV11、AAV12、AAV16.3、AAV24.1、AAV27.3、AAV42.12、AAV42-1b、AAV42-2、AAV42-3a、AAV42-3b、AAV42-4、AAV42-5a、AAV42-5b、AAV42-6b、AAV42-8、AA V42-10、AAV42-11、AAV42-12、AAV42-13、AAV42-15、AAV42-aa、AAV43-1、AAV43-12、AAV43-20、AAV43-21、AAV43-23、AAV43-25、AAV43-5、AAV44.1、AAV44. 4.2、AAV44.5、AAV223.1、AAV223.2、AAV223.4、AAV223.5、AAV223.6、AAV223.7、AAV1-7 / rh.48、AAV1-8 / rh.49、AAV2-15 / rh.62、AAV2-3 / rh.61 4 / rh.50、AAV2-5 / rh.51、AAV3.1 / hu.6、AAV3.1 / hu.9、AAV3-9 / rh.52、AAV3-11 / rh.53、AAV4-8 / r11.64、AAV4-9 / rh.54、AAV4-19 / rh.55、AAV5-3 / rh.55 7、AAV5-22 / rh.58、AAV7.3 / hu.7、AAV16.8 / hu.10、AAV16.12 / hu.11、AAV29.3 / bb.1、AAV29.5 / bb.2、AAV106.1 / hu.37、AAV114.3 / hu.40、AAV127.2 / hu. .41、AAV127.5 / hu.42、AAV128.3 / hu.44、AAV130.4 / hu.48、AAV145.1 / hu.53、AAV145.5 / hu.54、AAV145.6 / hu.55、AAV161.10 / hu.60、AAV161.6 / hu.61AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu.16、AAV52 / hu.19、AAV52.1 / hu.20、AAV58.2 / hu.25、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAVC1、AAV C2、AAVC5、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAVH2、AAVrh.72、AAVhu.8、AAVrh.68、AAVrh.70、AAVpi.1、AAVpi.3、AAVpi.2、AAVrh.60、AAVrh.44、AAVrh. .65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVH6、AAVLK03、AAVH-1 / hu.1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVc y.6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、AAVhu.15、AAVhu.16、AAVhu.17、AA Vhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu.32、AAVhu. 34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.4 6、AAVhu.47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AAVhu.58、AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.14 / 9, AAVhu.t19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, AAAV, BAAV, ovine AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8,AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuttle 100-1, AAV Shuttle 100-3, AAV Shuttle 100-7, AAV Shuttle 10-2, AAV Shuttle 10-6, AAV Shuttle 10-8, AAV Shuttle 100-2, AAV SM10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43, authentic AAV (ttAAV), UPENN AAV 10, Japanese AAV 10 serotype, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAVCBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAVCHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAVCKd-B3, AAV CKd-B4, AAV CKd-B5,AAV CKd-B6、AAV CKd-B7、AAV CKd-B8、AAV CKd-H1、AAVCKd-H2、AAV CKd-H3、AAV CKd-H4、AAV CKd-H5、AAV CKd-H6、AAV CKd-N3、AAV CKd-N4、AAVCKd-N9、AAV CLg-F1、AAV CLg-F2、AAV CLg-F3、AAV CLg-F4、AAV CLg-F5、AAV CLg-F6、AAVCLg-F7、AAV CLg-F8、AAV CLv-1、AAV CLv1-1、AAV Clv1-10、AAV CLv1-2、AAV CLv-12、AAVCLv1-3、AAV CLv-13、AAV CLv1-4、AAV Clv1-7、AAV Clv1-8、AAV Clv1-9、AAV CLv-2、AAVCLv-3、AAV CLv-4、AAV CLv-6、AAV CLv-8、AAV CLv-D1、AAV CLv-D2、AAV CLv-D3、AAV CLv-D4、AAV CLv-D5、AAV CLv-D6、AAV CLv-D7、AAV CLv-D8、AAV CLv-E1、AAV CLv-K1、AAV CLv-K3、AAV CLv-K6、AAV CLv-L4、AAV CLv-L5、AAV CLv-L6、AAV CLv-M1、AAV CLv-M11、AAVCLv-M2、AAV CLv-M5、AAV CLv-M6、AAV CLv-M7、AAV CLv-M8、AAV CLv-M9、AAV CLv-R1、AAVCLv-R2、AAV CLv-R3、AAV CLv-R4、AAV CLv-R5、AAV CLv-R6、AAV CLv-R7、AAV CLv-R8、AAVCLv-R9、AAV CSp-1、AAV CSp-10、AAV CSp-11、AAV CSp-2、AAV CSp-3、AAV CSp-4、AAV CSp-6、AAV CSp-7、AAV CSp-8、AAV CSp-8.10、AAV CSp-8.2、AAV CSp-8.4、AAV CSp-8.5、AAVCSp-8.6、AAV CSp-8.7、AAV CSp-8.8、AAV CSp-8.9、AAV CSp-9、AAV.hu.48R3、AAV.VR-355、AAV3B、AAV4、AAV5、AAVF1 / HSC1、AAVF11 / HSC11、AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, AAVF9 / HSC9, AAV-PHP.B, AAV-PHP.A, G2B-26, G2B-13, TH1.1-32, TH1.1-35, AAVPHP.B2, AAVPHP.B3, AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP, AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3, AAVG2B4, AAVG2B5 and their variants.

11. The AAV vector of claim 1, wherein the promoter is selected from the group consisting of CMV, CBA and H1.

12. The AAV vector according to claim 11, wherein The promoter is CMV.

13. The AAV vector of claim 11, wherein the promoter is CBA.

14. The AAV vector of claim 11, wherein the promoter is H1.

15. A method for inhibiting SOD1 gene expression in a cell, comprising administering to the cell a composition comprising the AAV vector of any one of claims 1-14.

16. A method for treating and / or ameliorating amyotrophic lateral sclerosis (ALS) in a subject in need of treatment, the method comprising administering to the subject a therapeutically effective amount of a composition comprising the AAV vector of any one of claims 1-14.

17. The method of claim 16, wherein the expression of SOD1 is inhibited or suppressed.

18. The method of claim 17, wherein the SOD1 is wild-type SOD1, mutant SOD1 having at least one mutation, or both wild-type SOD1 and mutant SOD1 having at least one mutation.

19. The method of claim 17, wherein the expression of SOD1 is inhibited or suppressed by about 20% to about 100%.

20. A method for inhibiting expression of a SOD1 gene in a cell, wherein the SOD1 gene comprises a mutation that causes a gain of function in the cell, the method comprising administering to the cell a composition comprising the AAV vector of any one of claims 1-14.

21. A method for treating and / or ameliorating canine degenerative myelopathy (DM) in a subject in need of treatment, the method comprising administering to the subject a therapeutically effective amount of a composition comprising the AAV vector of any one of claims 1-14.

22. The method of claim 21, wherein the expression of SOD1 is inhibited or suppressed.

23. The method of claim 22, wherein the SOD1 is wild-type SOD1, mutant SOD1 having at least one mutation, or both wild-type SOD1 and mutant SOD1 having at least one mutation.

24. The method of claim 21, wherein the expression of SOD1 is inhibited or suppressed by about 20% to about 100%.

25. A method for reducing the level of phosphorylated neurofilament heavy chain (PNF-H) in a subject, comprising administering to the subject a composition comprising an adeno-associated virus (AAV) vector for inhibiting or suppressing SOD1 expression in a cell, the AAV vector comprising a nucleic acid sequence located between two inverted terminal repeats (ITRs), wherein the nucleic acid sequence comprises a sense strand sequence and an antisense strand sequence, wherein the sense strand sequence comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of the sequence listed in Table 3, and the antisense strand sequence comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of the sequence listed in Table 2, and wherein the sense strand sequence and the antisense strand sequence share a complementary region having a length of at least 4 nucleotides.

26. The method of claim 25, wherein the nucleic acid sequence comprises a sense strand sequence and an antisense strand sequence of a siRNA duplex.

27. The method of claim 26, wherein the siRNA duplex is selected from the group consisting of siRNA duplex ID Nos. D-4000 to D-4025.

28. The method of any one of claims 25 to 27, wherein reduction of pNF-H in a subject treats and / or improves amyotrophic lateral sclerosis (ALS) in the subject in need of treatment.

Images