Recombinant strain for in-situ synthesis of protoporphyrin, construction method and application of recombinant strain and composite nano preparation

Abstract

The invention relates to the technical field of biological medicines, and discloses a recombinant strain for in-situ synthesis of protoporphyrin, a construction method and application of the recombinant strain, and a composite nano preparation. The recombinant strain is obtained by genetic engineering modification of an original strain, and compared with the original strain, the activity of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the recombinant strain is enhanced. The composite nano preparation contains the recombinant strain or the recombinant strain constructed by the method. The recombinant strain can endow a sound-sensitive agent with tumor selectivity and improve treatment efficiency and biological safety.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a recombinant strain for in-situ synthesis of protoporphyrin, a construction method and application thereof, and a composite nano-preparation. Background Art

[0002] Malignant tumors are major diseases that seriously threaten human health worldwide today. Exploring efficient and safe new therapies is one of the core issues that need to be urgently addressed in the treatment of malignant tumors. Sonodynamic therapy (SDT) has developed rapidly and is recognized as a new tumor treatment method, which uses sonosensitizers under the action of ultrasound and has the advantages of being non-invasive and not easy to resist drugs. Commonly used sonosensitizer molecules include organic molecules such as porphyrins, porphyrin derivatives, anticancer drugs doxorubicin, methylene blue, and polyhydroxyfullerene. However, these sonosensitizers currently lack tumor selectivity and have problems such as oxygen dependence, rapid metabolism, and unsatisfactory tumor enrichment, which seriously restrict the efficiency of sonodynamic therapy and are also the root cause of side effects and clinical promotion. The current molecular improvement and nano-scale strategies are of limited help in improving the tumor selectivity of sonosensitizers. Therefore, developing a new strategy that can improve the tumor selectivity of sonosensitizers from the source is crucial to the prognosis of tumor sonodynamic therapy.

[0003] In recent years, with the development of synthetic biology technology, synthetic gene circuit engineered bacteria based on bacteria and other technologies have the ability to synthesize small molecules, proteins, etc. in vitro, and have been applied to the production of drugs including sonosensitizers. Although some anaerobic bacteria (or facultative anaerobic bacteria) can specifically tend to tumor tissues and enrich and colonize in tumors, they are potential targeted delivery carriers. However, due to the high immunogenicity and pathogenicity of engineered bacteria, they cannot be used for in vivo sonodynamic therapy. Therefore, it is urgent to design and develop engineered bacteria with tumor selectivity and in situ synthesis of sonosensitizers for metabolic synthesis regulation of tumor microenvironment and efficient and precise sonodynamic therapy.

[0004] At present, the strategy of giving sonosensitizers tumor selectivity is mainly achieved through the use of targeted delivery carriers. Drug delivery carriers based on nanomaterials can achieve specific targeted positioning and efficiently enrich drugs in tumor lesions; at the same time, by regulating the physical and chemical properties of nanoparticles such as size, morphology, surface charge and ligand modification, the high-density interstitial matrix barrier composed of collagen, mucopolysaccharides, proteoglycans, etc. inside the tumor is broken through, and the loaded drugs are delivered to the tumor, thereby enhancing the anti-tumor efficacy. In response to the bottleneck problems of traditional sonosensitizers, nano-delivery carriers have provided improvements in bioavailability and targeting to a certain extent. However, the current preparation process of nano-sonosensitizers is complicated, and standardized large-scale production is impossible. In addition, the properties are unstable and prone to aggregation and sedimentation. There are still a series of problems such as the safety of sonosensitizers, which hinder the clinical promotion of sonodynamic therapy. Summary of the invention

[0005] The purpose of the present invention is to overcome the problems of the prior art of complex preparation process, unstable properties and poor safety of nano sonosensitizers, and to provide a recombinant strain for in situ synthesis of protoporphyrin, a construction method and application thereof, and a composite nano preparation. The recombinant strain can impart tumor selectivity to the sonosensitizer, thereby improving treatment efficiency and biosafety.

[0006] In order to achieve the above-mentioned purpose, the first aspect of the present invention provides a recombinant strain for in situ synthesis of protoporphyrin, which is obtained by genetic engineering of a starting strain. Compared with the starting strain, the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the recombinant strain are enhanced.

[0007] Preferably, the catalase is an Escherichia coli catalase tetramer of HPII structure, which comprises a subunit with heme as a cofactor.

[0008] Preferably, the recombinant strain contains a gene encoding 5-aminolevulinic acid synthase with an amino acid sequence as shown in SEQ ID NO: 1, a gene encoding phosphoenolpyruvate carboxylase with an amino acid sequence as shown in SEQ ID NO: 2, a gene encoding O-acetylserine efflux protein with an amino acid sequence as shown in SEQ ID NO: 3, and a gene encoding catalase with an amino acid sequence as shown in SEQ ID NO: 4.

[0009] Preferably, the nucleotide sequence of the gene encoding 5-aminolevulinic acid synthase is shown as SEQ ID NO: 5, the nucleotide sequence of the gene encoding phosphoenolpyruvate carboxylase is shown as SEQ ID NO: 6, the nucleotide sequence of the gene encoding O-acetylserine efflux protein is shown as SEQ ID NO: 7, and the nucleotide sequence of the gene encoding catalase is shown as SEQ ID NO: 8.

[0010] Preferably, the recombinant strain contains a recombinant vector I expressing 5-aminolevulinic acid synthase and phosphoenolpyruvate carboxylase, and a recombinant vector II expressing O-acetylserine efflux protein and catalase.

[0011] Preferably, the recombinant vector I further contains a vector plasmid I, and the recombinant vector II further contains an anaerobic promoter and a vector plasmid II.

[0012] Preferably, the vector plasmid I is pETDuet1 plasmid, the vector plasmid II is pACYCDuet1 plasmid, and the nucleotide sequence of the anaerobic promoter is shown in SEQ ID NO:9.

[0013] Preferably, the starting strain is a probiotic, preferably Escherichia coli MG1655.

[0014] The second aspect of the present invention provides a method for constructing a recombinant strain for in situ synthesis of protoporphyrin, the method comprising: genetically modifying a starting strain so that the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the starting strain are enhanced.

[0015] Preferably, the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the starting strain are enhanced by exogenously introducing a gene encoding 5-aminolevulinic acid synthase with an amino acid sequence as shown in SEQ ID NO: 1, a gene encoding phosphoenolpyruvate carboxylase with an amino acid sequence as shown in SEQ ID NO: 2, a gene encoding O-acetylserine efflux protein with an amino acid sequence as shown in SEQ ID NO: 3, and a gene encoding catalase with an amino acid sequence as shown in SEQ ID NO: 4.

[0016] Preferably, the nucleotide sequence of the gene encoding 5-aminolevulinic acid synthase is shown as SEQ ID NO: 5, the nucleotide sequence of the gene encoding phosphoenolpyruvate carboxylase is shown as SEQ ID NO: 6, the nucleotide sequence of the gene encoding O-acetylserine efflux protein is shown as SEQ ID NO: 7, and the nucleotide sequence of the gene encoding catalase is shown as SEQ ID NO: 8.

[0017] Preferably, the process of exogenous introduction includes: constructing a recombinant vector I expressing 5-aminolevulinic acid synthase and phosphoenolpyruvate carboxylase and a recombinant vector II expressing O-acetylserine efflux protein and catalase, and co-transforming the recombinant vector I and the recombinant vector II into the starting strain.

[0018] Preferably, the recombinant vector I further contains a vector plasmid I, and the recombinant vector II further contains an anaerobic promoter and a vector plasmid II.

[0019] Preferably, the vector plasmid I is pETDuet1 plasmid, the vector plasmid II is pACYCDuet1 plasmid, and the nucleotide sequence of the anaerobic promoter is shown in SEQ ID NO:9.

[0020] Preferably, the starting strain is a probiotic, preferably Escherichia coli MG1655.

[0021] The third aspect of the present invention provides the use of the above-mentioned recombinant strain or the above-mentioned method in synthesizing 5-aminolevulinic acid and / or preparing tumor sonodynamic therapy drugs.

[0022] Preferably, the tumor is selected from at least one of triple-negative breast cancer, pancreatic cancer, melanoma and non-small cell lung cancer.

[0023] The fourth aspect of the present invention provides a composite nano-preparation, which contains the recombinant strain as described above or the recombinant strain constructed by the method as described above.

[0024] Preferably, the composite nanoformulation comprises the recombinant strain and an erythrocyte membrane coated around the recombinant strain.

[0025] Through the above technical solution, the beneficial effects of the present invention are:

[0026] The recombinant strain provided by the present invention is obtained through synthetic biology technology and genetic engineering circuit design, has high tumor targeting, can continuously, specifically, efficiently and safely synthesize the secretion sonosensitizer protoporphyrin precursor molecule 5-aminolevulinic acid, and then specifically synthesize the sonosensitizer protoporphyrin in situ at the tumor, forming a selective tumor in situ sonosensitizer "biosynthesis factory", which gives the sonosensitizer tumor selectivity from the root, so as to achieve efficient and safe new sonodynamic therapy; and specifically and efficiently express and secrete catalase, improve hypoxia in the tumor site by decomposing hydrogen peroxide metabolites in the tumor microenvironment, and achieve accurate, efficient and safe tumor sonodynamic therapy. By coating the recombinant strain with red blood cell membrane, the biocompatibility and tumor targeting can be effectively enhanced, so that it has a higher in vivo circulation time and safety.

[0027] Furthermore, the recombinant vector II expressing O-acetylserine efflux protein and catalase also contains an anaerobic promoter, which serves as an efflux switch for 5-aminolevulinic acid and a sonodynamic oxygen supply switch to enhance the sonodynamic effect and improve the in situ biosynthesis function and tumor selectivity of the recombinant strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a structural diagram of the recombinant plasmid pETDuet1-RSHemA-PPC and the recombinant plasmid pACYCDuet1-Pvhb-eamA-Catalase HPII in Example 2;

[0029] Figure 2 is a schematic diagram of the process of obtaining the recombinant strain in Example 2;

[0030] Figure 3 This is the PCR verification image of the recombinant Escherichia coli single colony in Example 2;

[0031] Figure 4 This is a WB image for verifying the hypoxic response ability of the recombinant Escherichia coli in Example 3;

[0032] Figure 5 This is a result diagram of verifying the 5-aminolevulinic acid expression ability of the recombinant Escherichia coli in Example 3;

[0033] Figure 6 This is a result diagram of verifying the protoporphyrin synthesis function of the recombinant Escherichia coli in Example 3;

[0034] Figure 7 This is a diagram of the effect of verifying the production of active oxygen after ultrasonically recombinant Escherichia coli produced protoporphyrin in Example 3;

[0035] Figure 8 This is a characterization diagram of the catalase-enhanced sonodynamic killing effect of recombinant Escherichia coli under normoxic conditions in Example 3;

[0036] Fig. 9 This is a characterization diagram of the catalase-enhanced sonodynamic killing effect of recombinant Escherichia coli under hypoxic conditions in Example 3;

[0037] Fig.10 is the in vivo tumor-specific enrichment diagram of the recombinant Escherichia coli in Example 4;

[0038] Fig.11 This is a diagram showing the therapeutic effect of the recombinant E. coli on mouse breast cancer in Application Example 1;

[0039] Fig.12 This is a diagram showing the therapeutic effect of the recombinant Escherichia coli in Application Example 2 on pancreatic cancer in mice. DETAILED DESCRIPTION

[0040] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0041] The term "enhance", "increase", "improve" or "activate" used in the present invention generally means an increase in statistically significant amounts. However, for the avoidance of doubt, the term "enhance", "increase", "improve" or "activate" means an increase of at least 10% compared to a reference level (e.g., the level in the starting strain), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including an increase of 100%, or an increase of any amount between 10% and 100% compared to a reference level; or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times, or an increase of any amount between 2 times and 10 times, or an increase of a greater amount compared to a reference level.

[0042] The first aspect of the present invention provides a recombinant strain for in situ synthesis of protoporphyrin, which is obtained by genetic engineering of a starting strain. Compared with the starting strain, the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the recombinant strain are enhanced.

[0043] The recombinant strain for in situ synthesis of protoporphyrin provided by the present invention realizes the release of 5-ALA in response to the tumor microenvironment by constructing a 5-aminolevulinic acid (5-ALA) synthesis gene circuit in the starting strain, and cooperates with the enhancement of O-acetylserine efflux protein and catalase expression, thereby realizing the specific in situ synthesis of sonosensitizer protoporphyrin at the tumor site, and enhancing the selective sonodynamic therapy effect of the tumor; and specifically and efficiently expresses and secretes catalase, improves hypoxia at the tumor site by decomposing hydrogen peroxide metabolites in the tumor microenvironment, and realizes accurate, efficient and safe tumor sonodynamic therapy. The recombinant strain can be used as an intelligent biosynthetic engineering probiotic that can synthesize sonosensitizers specifically in situ at the tumor site, with the help of its autonomous movement and invasion and penetration ability, the gene circuit is precisely regulated by the tumor microenvironment response promoter, and the ultrasound selection area is visualized by fluorescent molecular imaging based on the recombinant strain, thereby realizing the selective and precise killing of tumor cells by sonodynamic therapy.

[0044] According to the present invention, preferably, the catalase is an Escherichia coli catalase tetramer of HPII structure, which comprises a subunit with heme as a cofactor.

[0045] In the present invention, in order to further improve the 5-ALA production of the recombinant strain and the targeting of the tumor, preferably, the recombinant strain contains a gene encoding a 5-aminolevulinic acid synthase whose amino acid sequence is shown in SEQ ID NO: 1, a gene encoding a phosphoenolpyruvate carboxylase whose amino acid sequence is shown in SEQ ID NO: 2, a gene encoding an O-acetylserine efflux protein whose amino acid sequence is shown in SEQ ID NO: 3, and a gene encoding a catalase whose amino acid sequence is shown in SEQ ID NO: 4. Further preferably, the nucleotide sequence of the gene encoding 5-aminolevulinic acid synthase (RSHemA for short) is shown in SEQ ID NO: 5, the nucleotide sequence of the gene encoding phosphoenolpyruvate carboxylase (PPC for short) is shown in SEQ ID NO: 6, the nucleotide sequence of the gene encoding O-acetylserine efflux protein (eamA for short) is shown in SEQ ID NO: 7, and the nucleotide sequence of the gene encoding catalase (CatalaseHPII for short) is shown in SEQ ID NO: 8.

[0046] In the present invention, in order to further improve the 5-ALA production of the recombinant strain and the targeting of the tumor, preferably, the recombinant strain contains a recombinant vector I expressing 5-aminolevulinic acid synthase and phosphoenolpyruvate carboxylase and a recombinant vector II expressing O-acetylserine efflux protein and catalase. The starting strain is advantageous for enhancing the synthetic metabolic flux of the target sonosensitizer precursor molecule 5-ALA by exogenously introducing the recombinant vector I, and cooperating with phosphoenolpyruvate carboxylase and 5-aminolevulinic acid synthase; the starting strain is advantageous for enhancing the expression and activity of O-acetylserine efflux protein and catalase by exogenously introducing the recombinant vector II.

[0047] According to the present invention, preferably, the recombinant vector I also contains a vector plasmid I, and the recombinant vector II also contains an anaerobic promoter and a vector plasmid II, a hypoxic promoter, an O-acetylserine efflux protein encoding gene (eamA) and a catalase encoding gene (Catalase HPII) are connected in series, and eamA is regulated by the hypoxic promoter signal to ensure the precise excretion of the synthesized target sonosensitizer precursor molecule 5-ALA, to achieve the responsive release of 5-ALA in the tumor microenvironment and the improvement of microenvironment hypoxia, thereby enhancing the tumor selective sonodynamic therapy effect.

[0048] In the present invention, both the vector plasmid I and the vector plasmid II may contain a His-tag tag, which is beneficial for protein purification. Further preferably, the vector plasmid I is a pETDuet1 plasmid; the vector plasmid II is a pACYCDuet1 plasmid, which contains a PelB signal peptide to improve the strain's ability to secrete and express catalase; the anaerobic promoter is a hypoxic promoter Pvhb, whose nucleotide sequence is shown in SEQ ID NO: 9, to improve the tumor targeting of the recombinant strain.

[0049] According to the present invention, the starting strain can be any probiotic, preferably, the starting strain is Escherichia coli, more preferably Escherichia coli MG1655. Escherichia coli MG1655 is a facultative anaerobic, non-pathogenic Gram-negative strain that does not express known virulence factors such as α-hemolysin and P-fimbriae adhesin; as a chassis bacterium, its own facultative anaerobic characteristics and the unique characteristics of the tumor microenvironment, including the hypoxic environment inside the tumor, the immunosuppressive environment and the nutrients released by a large number of necrotic cells, can achieve efficient colonization at the tumor site after injection.

[0050] The second aspect of the present invention provides a method for constructing a recombinant strain for in situ synthesis of protoporphyrin, the method comprising: genetically modifying a starting strain so that the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the starting strain are enhanced.

[0051] In the present invention, the method for enhancing the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the starting strain is to exogenously introduce the coding gene RSHemA of 5-aminolevulinic acid synthase, the coding gene PPC of phosphoenolpyruvate carboxylase, the coding gene eamA of O-acetylserine efflux protein and the coding gene Catalase HPII of catalase. Preferably, the method for enhancing the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the starting strain is to exogenously introduce the gene encoding the 5-aminolevulinic acid synthase with the amino acid sequence as shown in SEQ ID NO: 1, the gene encoding the phosphoenolpyruvate carboxylase with the amino acid sequence as shown in SEQ ID NO: 2, the gene encoding the O-acetylserine efflux protein with the amino acid sequence as shown in SEQ ID NO: 3 and the gene encoding the catalase with the amino acid sequence as shown in SEQ ID NO: 4.

[0052] Further preferably, the nucleotide sequence of the gene encoding 5-aminolevulinic acid synthase is shown as SEQ ID NO: 5, the nucleotide sequence of the gene encoding phosphoenolpyruvate carboxylase is shown as SEQ ID NO: 6, the nucleotide sequence of the gene encoding O-acetylserine efflux protein is shown as SEQ ID NO: 7, and the nucleotide sequence of the gene encoding catalase is shown as SEQ ID NO: 8.

[0053] According to the present invention, in the present invention, RSHemA, PPC, eamA and Catalase HPII can be simultaneously introduced into the starting strain by an expression cassette, and can also be respectively introduced into the starting strain by multiple expression cassettes.RSHemA, PPC, eamA and Catalase HPII can be introduced into the starting strain by homologous knock-in, and homologous knock-in, i.e., gene knock-in, refers to utilizing gene homologous recombination, exogenous functional gene (the genome of target cell does not exist or inactivated gene originally), after transfer into cell, homologous recombination is carried out with the homologous sequence in the cell genome, inserted into the genome, and the technology of obtaining expression in the cell.Preferably, the process of the exogenous introduction comprises: constructing the recombinant vector I expressing 5-aminolevulinic acid synthase and phosphoenolpyruvate carboxylase and the recombinant vector II expressing O-acetylserine efflux protein and catalase, and recombinant vector I and recombinant vector II are transferred to the starting strain together.

[0054] According to the present invention, preferably, the recombinant vector I further contains a vector plasmid I, and the recombinant vector II further contains an anaerobic promoter and a vector plasmid II.

[0055] According to the present invention, preferably, the vector plasmid I is pETDuet1 plasmid, the vector plasmid II is pACYCDuet1 plasmid, and the nucleotide sequence of the anaerobic promoter is shown in SEQ ID NO:9.

[0056] Various methods for constructing recombinant vectors I and II are known in the art to be used to connect the target gene fragment to the expression vector to prepare the recombinant vector as a recombinant vector, such as but not limited to the classic "enzyme cutting-ligation" method, the Gateway cloning system developed by Invitrogen, the Creator cloning system developed by Clontech, the Univector cloning system developed by Stephen Elledge's laboratory, the λ-Red homologous recombination system developed with the participation of the Helmholtz Institute of Biotechnology of Shandong University, and the Golden Gate cloning method based on type IIs restriction endonuclease (such as, using the GeneArt Type IIs Assembly Kits provided by ThermoFisher).

[0057] For example, the recombinant vector of the present invention can be constructed by a recombinase method: based on the genome of the starting strain, the upstream and downstream homologous arm sequences of the targeted insertion site are amplified by the PCR method; the gene sequence to be inserted, the upstream and downstream homologous arm sequences and the resistance gene expression cassette are connected in series to obtain a recombinant vector, but the present invention is not limited to this.

[0058] Subsequently, the recombinant vector can be introduced into the starting strain by conventional methods in the art, such as but not limited to microinjection, gene gun, transformation (such as electroporation), infection or transfection. The above-mentioned microinjection, gene gun, transformation, infection or transfection are all routine operations in the art. For example, transformation refers to treating cells by some known methods in molecular biology and genetic engineering, so that the treated cells are in a competent state, and thereby contact with exogenous DNA, so that the exogenous DNA enters the cells in the competent state. Commonly used transformation methods include protoplast transformation, chemical transformation and electroporation transformation. Transfection refers to the use of CaCl 2 , electroporation and other methods to transform the cells into competent cells, and then allow the competent cells to accept the recombinant DNA.

[0059] After the recombinant vector is introduced into the starting strain, positive clones can be screened out by screening markers (such as resistance genes) and verified by genomic PCR or by sequencing genomic DNA, thereby obtaining the recombinant strain for in situ synthesis of protoporphyrin.

[0060] According to the present invention, preferably, the starting strain is a probiotic, preferably Escherichia coli MG1655.

[0061] Based on the targeting effect of deep invasion and penetration of the recombinant strain provided by the present invention and the in situ synthesis driven by tumor hypoxia, 5-ALA is synthesized in situ in the tumor tissue and then converted into sonosensitizer protoporphyrin in the tumor cells, and a new type of efficient and safe sonodynamic therapy based on protoporphyrin is achieved under the hypoxia improvement effect mediated by catalase. The third aspect of the present invention provides the use of the recombinant strain as described above or the method as described above in synthesizing 5-aminolevulinic acid and / or preparing tumor sonodynamic therapy drugs.

[0062] The present invention provides a tool for efficient and long-lasting 5-ALA biosynthesis. By combining 5-ALA-mediated sonodynamic therapy with a simple platform that can be continuously and locally delivered to the tumor site, live bacteria are used as both a synthesis factory and a delivery carrier, and the bacteria's autonomous hypoxia tropism and invasion, penetration and colonization capabilities of tumors are further utilized to achieve efficient enrichment of sonosensitizers in tumors. By regulating the gene circuits of live bacteria and the control of exogenous substrates, 5-ALA can be precisely synthesized and secreted in situ at the tumor site in time and space, thereby achieving efficient sonodynamic therapy efficiency.

[0063] According to the present invention, the tumors include but are not limited to triple-negative breast cancer, pancreatic cancer, melanoma, non-small cell lung cancer and other tumors. These applications demonstrate the wide applicability and potential clinical application value of the recombinant strain provided by the present invention in the treatment of different types of tumors.

[0064] In the present invention, the bacterial cells of the recombinant strain can be proliferated in large quantities through fermentation culture. Preferably, the recombinant strain is first prepared into a seed liquid, and then the seed liquid is inoculated into a fermentation medium for fermentation to obtain a fermentation liquid. The fermentation liquid can be prepared into a corresponding liquid bacterial agent, or the bacterial cells obtained by solid-liquid separation of the fermentation liquid can be prepared into a corresponding solid bacterial agent or liquid bacterial agent for application in the synthesis of 5-aminolevulinic acid and / or the preparation of tumor sonodynamic therapy drugs.

[0065] In the present invention, preferably, the method for preparing the seed solution comprises: picking a single colony of the recombinant strain and inoculating it into a seed culture medium for seed culture to obtain the seed solution.

[0066] In the present invention, there is no particular limitation on the seed culture medium, and the seed culture medium may be a seed culture medium conventionally used in the art for preparing Escherichia coli seed solution. Preferably, the seed culture medium is LB liquid culture medium.

[0067] Preferably, the seed culture conditions include: a rotation speed of 100-180 rpm, a temperature of 37-40° C., and a time of 10-20 h.

[0068] Preferably, the single colony of the recombinant strain can be selected from the freshly prepared recombinant strain or the recombinant strain frozen at low temperature (for example, frozen in a glycerol cryovial in a -80°C refrigerator).

[0069] In the present invention, there is no particular limitation on the fermentation method, which may be a conventional fermentation method in the art, as long as the recombinant strain can grow and proliferate in large quantities. For example, seed liquid is inoculated into a fermentation medium for fermentation culture to obtain a fermentation liquid.

[0070] In the present invention, in order to increase the growth rate of the recombinant strain, preferably, the inoculation amount of the seed liquid is 5-10 parts by volume relative to 100 parts by volume of the acid-producing fermentation medium.

[0071] In the present invention, in order to increase the biomass of the recombinant strain, preferably, the fermentation conditions include: first fermenting at a rotation speed of 100-180 rpm and a temperature of 37-40°C for 10-15 hours; then inducing under anoxic conditions and avoiding light for 10-15 hours to obtain the fermentation liquid.

[0072] Based on the recombinant strain provided by the present invention, stable and efficient sonosensitizer precursor expression can be achieved, and then the recombinant strain is wrapped with a surface red blood cell membrane to form a camouflage, thereby improving the enrichment efficiency and biosafety of the recombinant strain at the tumor. In a fourth aspect, the present invention provides a composite nanoformulation, which contains the recombinant strain as described above or the recombinant strain constructed by the method as described above.

[0073] Preferably, the composite nanoformulation comprises the recombinant strain and an erythrocyte membrane coated around the recombinant strain.

[0074] In the present invention, a conventional method can be used to obtain an erythrocyte membrane carrying a membrane antigen, the recombinant strain is cultured to obtain the bacterial body and then resuspended to obtain a bacterial resuspension, the erythrocyte membrane is filtered through a membrane and mixed with the bacterial resuspension, and the erythrocyte membrane is repeatedly extruded 4-6 times at 20-30° C. by a cell refinement extruder, and then centrifuged to obtain a erythrocyte membrane-coated recombinant strain (CM-ENG).

[0075] The present invention will be described in detail below through examples.

[0076] In the following examples, Escherichia coli MG1655 was purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd. with a product number of ZC1262-1, pETDuet1 plasmid was purchased from Shenzhen BGI Co., Ltd. with a product number of WHC234305, pACYCDuet1 plasmid was purchased from Shenzhen BGI Co., Ltd. with a product number of WHC234307, 4T1-luc cells were purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd. with a product number of LZQ0016, Balb / c mice (Beijing Huafukang Biotechnology Co., Ltd., female mice, 4-5w), and a plasmid extraction kit was an endotoxin-free plasmid mini-extraction kit (DP118) purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. with a product number of DP118-02; unless otherwise specified, the remaining raw materials or reagents are conventional commercially available products.

[0077] RPMI-1640 cell culture medium was purchased from Gibco, with the catalog number Gibco#C11875500BT. The specific preparation process is as follows: according to the volume of culture medium to be prepared, weigh an appropriate amount of RPMI-1640 dry powder according to the instructions on the dry powder package; add the weighed dry powder to a certain volume of double distilled water, usually 1g of dry powder can prepare 100mL of culture medium, and stir until the dry powder is completely dissolved; add sodium bicarbonate (NaHCO 3 ), usually about 2 g per liter of culture medium. Sodium bicarbonate helps maintain the pH of the culture medium in the appropriate range for cell culture (usually 7.2-7.4); filter the prepared culture medium solution to sterilize, usually using a 0.22 μm filter membrane; add serum: mix the sterilized culture medium with an appropriate amount of serum, the serum addition ratio is usually 10% (v / v).

[0078] The formula of LB solid medium is: yeast 5g / L, peptone 10g / L, sodium chloride 10g / L, agar powder 15g / L;

[0079] The formula of LB liquid culture medium is: yeast 5g / L, peptone 10g / L, sodium chloride 10g / L.

[0080] The formula of liquid fermentation medium is: Na 2 HPO 4 12H 2 O 18.0g / L, KH 2 PO4 2 4.0g / L, NaCl 0.4g / L, NH 4 Cl 0.9g / L, MgSO 4 1.5 mM, CaCl 2 0.1mM, glucose 10g / L, yeast powder 2g / L, glycine 2g / L.

[0081] Example 1 Construction of recombinant plasmid

[0082] The 5-aminolevulinic acid synthase encoding gene RSHemA, the phosphoenolpyruvate carboxylase encoding gene PPC, the O-acetylserine efflux protein encoding gene eamA and the catalase encoding gene Catalase HPII were optimized and synthesized. Specifically, the amino acid sequence of 5-aminolevulinic acid synthase is shown in SEQ ID NO: 1, the nucleotide sequence of RSHemA is shown in SEQ ID NO: 5, the amino acid sequence of phosphoenolpyruvate carboxylase is shown in SEQ ID NO: 2, the nucleotide sequence of the encoding gene PPC is shown in SEQ ID NO: 6, the amino acid sequence of O-acetylserine efflux protein is shown in SEQ ID NO: 3, the nucleotide sequence of the encoding gene eamA is shown in SEQ ID NO: 7, the amino acid sequence of catalase is shown in SEQ ID NO: 4, and the nucleotide sequence of the encoding gene Catalase HPII is shown in SEQ ID NO: 8.

[0083] Specifically, primers were designed with gene RSHemA and gene PPC as two target genes, containing restriction endonuclease Mfe I and Xho I restriction enzyme sites for subsequent enzyme digestion and ligation, and the 5' end of the primer should contain the corresponding restriction enzyme recognition sequence; PCR amplification: using the designed primers to amplify the two target genes RSHemA and PPC by PCR method; enzyme digestion: using the corresponding restriction endonucleases Mfe I and Xho I I double-digested the amplified gene fragments RSHemA and PPC and the plasmid vector pETDuet1 to produce compatible sticky ends; purification: purify the PCR product and the plasmid after enzyme digestion by gel electrophoresis, and recover the target gene fragments RSHemA and PPC and the linearized plasmid vector pETDuet1; connection: use DNA ligase to connect the two gene fragments RSHemA and PPC with the linearized plasmid vector pETDuet1; transformation: transform the connection product into Escherichia coli DH5α (purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd., product number ZC101-1); screening: spread the transformed bacteria on an LB plate containing the corresponding antibiotics, and screen out the recombinant clone bacteria pETDuet1-RSHemA-PPC-DH5α containing the recombinant plasmid pETDuet1-RSHemA-PPC.

[0084] Wherein, the nucleotide sequence of the RSHemA sequencing primer pair in the recombinant clone pMD-18T-RSHemA-PPC-DH5α is shown in SEQ ID NOs: 10-11, and the nucleotide sequence of the PPC sequencing primer pair is shown in SEQ ID NOs: 12-13;

[0085] RSHemA sequencing upstream primer: CGCGTCCTCCAAAATGTGTG (SEQ ID NO: 10),

[0086] RSHemA sequencing downstream primer: TCTTCAGGATACGCGCTTGG (SEQ ID NO: 11),

[0087] PPC sequencing upstream primer: CGCTGGCAATGATGCTAACC (SEQ ID NO: 12), PPC sequencing downstream primer: TGGTGTCTTCGCTCAGTTCC (SEQ ID NO: 13).

[0088] The Pvhb gene (nucleotide sequence as shown in SEQ ID NO: 9) and the eamA gene are arranged in nucleotide sequence order to form a Pvhb-eamA gene sequence, and primers are designed with the gene Pvhb-eamA and the gene Catalase HPII as two target genes, which contain restriction endonuclease Bgl II and Xho I restriction sites for subsequent restriction digestion and connection, and the 5' end of the primer should contain the corresponding restriction enzyme recognition sequence; PCR amplification: using the designed primers to amplify the two target genes Pvhb-eamA and Catalase HPII respectively by PCR method; enzyme digestion: using the corresponding restriction endonucleases Bgl II and Xho I to perform double enzyme digestion on the amplified gene fragments Pvhb-eamA and Catalase HPII and the plasmid vector pACYCDuet1 to generate compatible sticky ends; purification: purifying the PCR product and the plasmid after enzyme digestion by gel electrophoresis, and recovering the target gene fragments Pvhb-eamA and Catalase HPII; HPII and linearized plasmid vector pACYCDuet1; ligation: use DNA ligase to connect the two gene fragments Pvhb-eamA and Catalase HPII with the linearized plasmid vector pACYCDuet1; transformation: transform the ligation product into Escherichia coli DH5α; screening: spread the transformed bacteria on LB plates containing corresponding antibiotics, and screen out the bacterial clone pACYCDuet1-Pvhb-eamA-Catalase HPII-DH5α containing the recombinant plasmid pACYCDuet1-Pvhb-eamA-Catalase HPII;

[0089] Wherein, the nucleotide sequence of the Pvhb-eamA sequencing primer pair in the recombinant clone pACYCDuet1-Pvhb-eamA-Catalase HPII-DH5α is shown in SEQ ID NOs: 14-15, and the nucleotide sequence of the Catalase HPII sequencing primer pair is shown in SEQ ID NOs: 16-17;

[0090] Pvhb-eamA sequencing upstream primer: TGCTTGGCGCGTTTACTTTC (SEQ ID NO: 14),

[0091] Pvhb-eamA sequencing downstream primer: TAACGTCCCCCAGATCCCAT (SEQ ID NO: 15),

[0092] Catalase HPII sequencing upstream primer: TGAGCCAGGAGCAACTGAAG (SEQ ID NO: 16), Catalase HPII sequencing downstream primer: GTAATGTTTGGCGTTGCCGT (SEQ ID NO: 17).

[0093] Example 2

[0094] a. Recombinant plasmid transformation

[0095] The recombinant plasmid pETDuet1-RSHemA-PPC (structure shown in the figure) was extracted from the recombinant clone pETDuet1-RSHemA-PPC-DH5α and the recombinant clone pACYCDuet1-Pvhb-eamA-Catalase HPII-DH5α. Figure 1 As shown) and the recombinant plasmid pACYCDuet1-Pvhb-eamA-Catalase HPII (structure as shown Figure 1 Then, the two recombinant plasmids were co-transformed into E. coli MG1655 competent cells by chemical transformation. The specific steps are as follows:

[0096] 1. Take E. coli MG1655 competent cells and place them in a centrifuge tube. Thaw them in an ice bath for 2 minutes, then add 3 μL of each of the two recombinant plasmids pETDuet1-RSHemA-PPC and pACYCDuet1-Pvhb-eamA-Catalase HPII, mix gently, and place in an ice bath for 30 minutes. The volume of DNA used should not exceed 1 / 10 of the volume of the competent cell solution.

[0097] 2. Heat shock: Place the centrifuge tube in a 42°C water bath for 90 seconds, then quickly transfer the tube to an ice bath to cool the cells for 3 minutes. Do not shake the centrifuge tube during the entire process.

[0098] 3. Recovery: Add 500 μL of sterile LB liquid culture medium (without antibiotics) to each centrifuge tube, mix well, and place at 37°C, shake on a shaker at 180 rpm, and culture for 60 minutes to allow the relevant resistance marker gene on the plasmid to express and the bacteria to recover;

[0099] 4. Plate coating: Pipette 100 μL of transformed competent cells and add them to LB solid medium containing corresponding antibiotics, spread the bacteria evenly, and culture at 37°C for 16 hours;

[0100] The recombinant bacteria containing both pETDuet1-RSHemA-PPC and pACYCDuet1-Pvhb-eamA-Catalase HPII were screened by coating plates (the construction process is as follows Figure 2 shown).

[0101] b. Characterization of recombinant bacterial construction

[0102] Pick the single colony on the plate for PCR, agarose gel electrophoresis, enzyme digestion and sequencing to confirm the successful construction of the recombinant engineered bacteria. Specifically, pick the single clone colony on the plate and add it to 3mL of LB liquid culture medium containing 50μg / mL ampicillin (concentration) and 25μg / mL chloramphenicol, shake culture at 37℃ for 16h, extract the recombinant plasmid with a plasmid extraction kit; send the recombinant plasmid to a sequencing company for sequencing and comparison, the results are as follows Figure 3 As shown, the sequences of RSHemA, PPC, eamA and CatalaseHPII were confirmed to be correct, proving that the recombinant Escherichia coli HPeC was successfully introduced with pETDuet1-RSHemA-PPC and pACYCDuet1-Pvhb-eamA-CatalaseHPII.

[0103] The process of obtaining the engineered bacteria pETDuet1-RSHemA-PPC-MG1655 that does not secrete 5-ALA: According to the chemical transformation method of recombinant Escherichia coli HPeC, the recombinant plasmid pETDuet1-RSHemA-PPC is transformed into Escherichia coli MG1655 competent cells to obtain recombinant Escherichia coli HP containing pETDuet1-RSHemA-PPC.

[0104] The process of obtaining catalase-free engineered bacteria: construct recombinant plasmids pETDuet1-RSHemA-PPC and pACYCDuet1-Pvhb-eamA according to the construction method of the recombinant plasmid in Example 1, and obtain recombinant clones pETDuet1-RSHemA-PPC-DH5α and pACYCDuet1-Pvhb-eamA-DH5α; transform the recombinant plasmids pETDuet1-RSHemA-PPC and pACYCDuet1-Pvhb-eamA into Escherichia coli MG1655 competent cells according to the chemical transformation method of recombinant Escherichia coli HPeC to obtain recombinant Escherichia coli HPe containing pETDuet1-RSHemA-PPC and pACYCDuet1-Pvhb-eamA.

[0105] Example 3

[0106] a. Characterization of the hypoxic response ability of recombinant engineered bacteria

[0107] The Western Blot experiment was used to evaluate the hypoxia response ability of the engineered bacteria. Specifically, the recombinant E. coli HPeC designed with the hypoxia promoter plasmid obtained in Example 2 was inoculated at a concentration of 3×10 8 cfu / times were inoculated into 30mL liquid fermentation medium, and induced at 37°C for 12h under different oxygen concentration environments (oxygen concentrations were 1.5v / v%, 5v / v%, 9v / v%, 13v / v%, and 21v / v% oxygen gas environments, respectively) to obtain induced bacteria. The samples of the induced bacteria treated with Ripa lysis buffer were used for Western Blot to specifically detect whether there was a target band (specifically, the band corresponding to the gene eamA, with a molecular weight of 32KD) to qualitatively determine the activation of the hypoxia response switch. The results are shown in Figure 4 shown.

[0108] from Figure 4 It can be seen that under normoxic conditions, that is, when the oxygen concentration is 21v / v%, the eamA protein controlled by the hypoxic promoter Pvhb is not significantly expressed. Under different concentrations of hypoxic conditions, the eamA protein controlled by the hypoxic promoter Pvhb has different concentrations of expression. At 13v / v% oxygen concentration, the expression of eamA is about 1.5 times higher than that under normoxic conditions, at 9v / v% oxygen concentration, the expression of eamA is about 2.2 times higher than that under normoxic conditions, at 5v / v% oxygen concentration, the expression of eamA is about 6 times higher than that under normoxic conditions, and at 1.5v / v% oxygen concentration, the expression of eamA is about 7 times higher than that under normoxic conditions.

[0109] b. Verification of 5-ALA expression ability of recombinant engineering bacteria

[0110] The recombinant E. coli HPeC obtained in Example 2 was inoculated at a concentration of 3×10 8 cfu / times were inoculated into 30 mL of liquid fermentation medium, and amplified at 37°C under normoxic conditions for 12 h, and then induced under hypoxic conditions (oxygen concentration was 1.5 v / v%) and light-proof conditions for 18 h to obtain bacterial liquid. The bacterial liquid was centrifuged and the supernatant was collected. The ability of recombinant E. coli HPeC to synthesize 5-ALA was characterized by using an ultraviolet spectrophotometer and a fluorescence spectrometer. The results are as follows: Figure 5 shown.

[0111] from Figure 5It can be seen that the ultraviolet absorption characteristic peak of 5-ALA in the supernatant of the culture fluid of the recombinant Escherichia coli HPeC obtained in Example 2 is located at 298nm. When the recombinant Escherichia coli is induced to synthesize 5-ALA under the condition of an oxygen concentration of 1.5v / v%, the absorption peak intensity of the induced 5-ALA increases with time. Specifically, the 5-ALA production increases by 10% after 5h, the production increases by about 40% after 9h of induction, and the production increases by about 150% after 18h of induction, indicating that the 5-ALA production increases with time.

[0112] c. Functional verification of protoporphyrin synthesis by recombinant engineering bacteria and characterization of its sonosensitivity activity

[0113] The cells synthesizing protoporphyrin were imaged using a fluorescence microscope. Specifically, the recombinant E. coli HPeC obtained in Example 2 was collected and inoculated at a concentration of 3×10 8 cfu / times were inoculated in 30 mL of liquid fermentation medium, and the supernatant after induction culture for 12 h at 37 ° C and 1.5 v / v% oxygen under hypoxic conditions was incubated with 4T1-luc cells at 37 ° C and 5 v / v% carbon dioxide concentration for 12 h. According to the appropriate time window, the excitation emission of protoporphyrin was selected for fluorescence spectral analysis to verify the synthesis of protoporphyrin (experimental synthetic protoporphyrin group) of recombinant Escherichia coli HPeC. The protoporphyrin content in the cells was detected and quantified using a fluorescence spectrometer. The results are shown in Figure 6 As shown; the same culture process was performed with Escherichia coli MG1655 as the original protoporphyrin group of cells.

[0114] from Figure 6 It can be seen that when the fluorescence spectrum of protoporphyrin was detected under the condition of 400nm wavelength excitation, in the original protoporphyrin group, the untreated 4T1-luc cells did not detect the protoporphyrin fluorescence signal near 625nm; in the experimental synthetic protoporphyrin group, the 4T1-luc cells incubated at 37°C for 12h with the recombinant Escherichia coli supernatant collected after centrifugation at 6000rpm for 10min could detect a significant fluorescence signal at 625nm; in the protoporphyrin standard group, the protoporphyrin standard purchased by the laboratory (Shanghai MacLean Biochemical Technology Co., Ltd., product number 553-12-8) had an emission peak at 625nm that was consistent with the experimental synthetic protoporphyrin group, proving that the 4T1-luc cells did additionally synthesize the sonosensitizer protoporphyrin after co-incubation with the recombinant Escherichia coli supernatant.

[0115] The reactive oxygen species generated during the sonodynamic process were detected using the widely used fluorescent molecular probe DCFH-DA (active oxygen detection kit CM-H2DCFDA, purchased from Bio-Tech Biotech Co., Ltd., product number S0035S). The recombinant E. coli HPeC that successfully expressed 5-ALA obtained in Example 2 was inoculated at a concentration of 3×10 8cfu / times were inoculated into 30mL liquid fermentation medium, cultured at 37°C, 1.5v / v% oxygen under hypoxic conditions for 12h to obtain bacterial solution, and the bacterial solution was centrifuged to obtain the bacterial solution supernatant. 5-ALA secreted by recombinant Escherichia coli was co-incubated with cultured 4T1-luc cells at 37°C for 12h and then ultrasonicated (ultrasonication conditions were 5min, 1MHZ, 50% duty cycle), and the production capacity of active oxygen was evaluated using fluorescence microscopy data. The results are shown in Figure 7 .

[0116] Figure 7 The results showed that 4T1-luc cells as the control group (denoted as the Ctrl group) did not produce reactive oxygen species, 4T1-luc cells did not produce reactive oxygen species after being treated with ultrasonic treatment (denoted as the Ctrl+US group), 4T1-luc cells did not produce reactive oxygen species in the sonodynamic treatment group (denoted as the WT+US group) after being co-incubated with wild Escherichia coli MG1655, cells co-incubated with the supernatant of the recombinant Escherichia coli HPeC obtained in Example 2 did not produce reactive oxygen species in the non-sonic dynamic treatment group (denoted as the HPeC group), while cells co-incubated with the supernatant of the recombinant Escherichia coli HPeC obtained in Example 2 and receiving the sonodynamic treatment group (denoted as the HPeC+US group) could produce obvious reactive oxygen species, and the positive control was the 5-ALA standard (aladdin / Aladdin, A107209) purchased by the laboratory, which was co-incubated with 4T1-luc cells and then ultrasonicated (denoted as the 5ALA+US group) and also produced weak reactive oxygen species.

[0117] d. Characterization of the catalase-enhanced sonodynamic effect

[0118] To simulate the hypoxic state of the tumor microenvironment, a normoxic group (oxygen concentration of 21 v / v%) and a hypoxic group (oxygen concentration of 1.5 v / v%) were set up to culture 4T1-luc cells. After being treated with ultrasound conditions in different groups, cell proteins were extracted and Western Blot experiments were performed to detect the improvement of the tumor microenvironment based on the expression of the hypoxia-inducible factor HIF protein. The fluorescent molecular probe Calcein-PI (Calcein / PI Cell Viability and Cytotoxicity Detection Kit, purchased from Beyotime Biotechnology Company, product number C2015S) was used to detect cell killing during the sonodynamic process. After centrifuging the bacterial solution of recombinant Escherichia coli HPeC, the bacterial solution supernatant was obtained. The 5-ALA supernatant secreted by the recombinant Escherichia coli was co-incubated with the cultured 4T1-luc cells and then sonicated. Fluorescence microscopy data was used to evaluate cell viability and whether catalase enhanced the effect of sonodynamics. The results are shown in the figure. Figure 8 and Fig. 9 shown.

[0119] from Figure 8It can be seen that under normoxic conditions, when hydrogen peroxide (added in an amount of 10 mM, simulating the hydrogen peroxide concentration in the tumor microenvironment) was added, the sonodynamic therapy group (referred to as the WT+US group) after 4T1-luc cells were co-incubated with wild-type E. coli MG1655 had no cell killing effect, and the sonodynamic therapy group (referred to as HPe+US) after 4T1-luc cells were co-incubated with the catalase-free engineered bacteria HPe and the sonodynamic therapy group (referred to as HPeC+US) after 4T1-luc cells were co-incubated with the supernatant of the recombinant E. coli HPeC obtained in Example 2 and then the cell killing effects of the ultrasound group (referred to as HPeC+US) reached 70% and 90%, respectively. Without the addition of hydrogen peroxide, the cell killing effects of the HPe+US group and the HPeC+US group were both about 50%.

[0120] from Fig. 9 It can be seen that under the conditions of simulated tumor hypoxia (oxygen concentration 1.5 v / v%), when hydrogen peroxide was additionally added (simulating the hydrogen peroxide concentration of the tumor microenvironment), no cell killing effect was observed in the WT+US group. Compared with the HPe+US group, the 4T1-luc cells were co-incubated with the supernatant of the recombinant Escherichia coli HPeC obtained in Example 2 and then sonicated (HPeC+US group), and the cell killing was significantly improved, reaching a killing level similar to that under normoxic conditions.

[0121] Example 4 In vivo targeted enrichment

[0122] Preparation of engineered probiotics coated with red blood cell membrane (CM-ENG): 3 mL of anticoagulated mixed whole blood of homologous Balb / c mice (Beijing Huafukang Biotechnology Co., Ltd., female mice, 4-5 weeks) was taken and added to a 15 mL centrifuge tube containing 10 mL of 0.01 mol / L PBS buffer (purchased from HyClone, USA, product model SH30256.01, pH 7.2); low-speed centrifugation to separate red blood cells: centrifuge at 3000 rpm for 5 min, discard the supernatant and the white blood cells and platelet layer under the supernatant, and obtain about 1.5 mL of packed red blood cells; wash red blood cells: use 4°C pre-cooled 0.01 mol / L PBS buffer (pH 7.2) equivalent to 3 times the volume of packed red blood cells to wash 3 times, and centrifuge at 5000 rpm for 15 min at 4°C each time to obtain a precipitate; hemolysis treatment: add 4°C pre-cooled 0.01 mol / L PBS buffer (pH 7.2) at a volume ratio of 40:1 PBS buffer (pH 7.2) was mixed with the precipitate, placed at 4°C for 2 h, and then centrifuged at 9000 rpm for 20 min, and the supernatant was discarded; hemolysis and centrifugation were repeated until no red precipitate was visible to the naked eye. The approximately 800 μL precipitate obtained was the red blood cell membrane sample carrying membrane antigens.

[0123] Bacterial encapsulation process: The recombinant E. coli obtained in Example 2 was inoculated into LB liquid culture medium and cultured at 37°C until OD 600=0.5, centrifuged at 6500rpm for 12min, and discarded the supernatant; resuspended the bacterial precipitate with 2mL of 0.01mol / L PBS (1x) solution; the erythrocyte membrane sample was filtered using a 1μm filter membrane (purchased from Whatman, Whatman polycarbonate membrane, 1.0μm pore size track etched membrane, 110610), 2mL of the recombinant Escherichia coli bacterial resuspension and the extracted cell membrane were mixed in a 15mL centrifuge tube, and repeatedly extruded five times at room temperature 25°C through a cell refinement extruder (GENIZER, GExtruder, USA) and centrifuged at 6500rpm for 12min to obtain erythrocyte membrane-coated engineered probiotics (CM-ENG).

[0124] In order to study the biodistribution of the recombinant E. coli (ENG) and the recombinant E. coli coated with red blood cell membrane (CM-ENG) obtained in Example 2, a subcutaneous breast cancer mouse model was constructed, and the cultured 4T1-luc cells were diluted to a concentration of 5×10 7 cells / mL of cell suspension; 100 μL of cell suspension was drawn with a sterile syringe and inoculated into the right hind limb of a 5-week-old female mouse to monitor the growth of the tumor. When the tumor grew to a diameter of about 5-10 mm, a single tail vein injection of 100 μL of ENG bacterial solution or CM-ENG bacterial solution (the cell concentration in each bacterial solution was 1×10 9 cfu / mouse). At different time windows of 12h, 24h (1days), 48h (2days), 72h (3days), 120h (5days), and 168h (7days), we collected major organs such as heart, liver, spleen, lung, kidney, tumor, and blood for cryogenic grinding. The tissues were diluted and plated. When the recombinant E. coli grew into independent colonies, they were counted and the number of recombinant E. coli per gram of tissue was calculated at different times. The tumor targeting ability of the recombinant E. coli in vivo was evaluated. The results are shown in the figure. Fig.10 shown.

[0125] from Fig.10 It can be seen that the enrichment abundance of the recombinant E. coli HPeC obtained in Example 2 in the tumor of tumor-bearing mice reached the highest level at 24 h, which was 8×10 7 cfu / g, and the probiotic tumor targeting effect of the CM-ENG group coated with red blood cell membrane was better than that of the HPeC group without coating at each time point. Later, as the enrichment time of the engineered bacteria prolonged, they were gradually eliminated from the body.

[0126] Application Example 1: Effect of sonodynamic therapy of intelligent biosynthetic engineered bacteria on mouse breast cancer model

[0127] 4T1 mouse breast cancer cells (purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd., product number LZQ0016) were grown in RPMI-1640 cell culture medium to the exponential growth phase, digested with 0.5% trypsin, and then centrifuged at 800 rpm for 5 min. After the supernatant culture medium was removed, the cells were washed twice with PBS and counted. Each BALB / C mouse was inoculated with 100 μL in situ in the mouse mammary gland, i.e., 2×10 6 After inoculation, the mice were kept in a clean animal room until the tumor volume of the mice grew to about 100 mm 3 The mice were randomly divided into 5 groups: (1) PBS group (as control), (2) HP+sound dynamic therapy of engineered bacteria that do not secrete 5-ALA (HP+SDT group), (3) recombinant Escherichia coli obtained in Example 2 (HPeC group), (4) HPe+sound dynamic therapy of engineered bacteria without catalase (HPe+SDT group), and (5) recombinant Escherichia coli obtained in Example 2+sound dynamic therapy (HPeC+SDT group). Each group of mice was injected with 12.5 mg / kg of the corresponding engineered bacteria, and sonic dynamic therapy (ultrasound frequency of 1.0 MHz and intensity of 1.5 W·cm) was performed 24 hours after the single injection. -2 , duty cycle 50%, ultrasound duration 5min), body weight, food intake and tumor volume of mice were monitored daily during treatment. Fig.11 shown.

[0128] from Fig.11 It can be seen that the five groups of tumor-bearing mice had different therapeutic effects after treatment. The tumor volume of the mice in the PBS group reached 1500mm on day 21. 3 The tumor volume of the engineered bacteria HP+SDT group that did not secrete 5-ALA also reached 1500mm 21 days after ultrasound treatment. 3 The tumor volume of the HPeC group mice treated with only the recombinant E. coli obtained in Example 2 reached 1400 mm on day 21. 3 The tumor volume of the HPe+SDT group, which secreted 5-ALA but did not contain catalase, was controlled to 500 mm after 21 days of sonodynamic therapy. 3 , the tumor size of the HPeC+SDT group was controlled within 300mm after sonodynamic therapy 3 , indicating a better tumor growth inhibitory effect.

[0129] Application Example 2: Effect of sonodynamic therapy of intelligent biosynthetic engineered bacteria on mouse pancreatic cancer model

[0130] Panc02 mouse pancreatic ductal adenocarcinoma cells (purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd., product number ZQ0946) were grown in RPMI-1640 cell culture medium to the exponential growth phase, digested with 0.5% trypsin, and then centrifuged at 800 rpm for 5 min. The supernatant culture medium was removed and washed twice with PBS before cell counting. 100 μL of each C57BL / 6 mouse was inoculated in situ in the mouse pancreas, i.e., 5×10 6 After inoculation, the mice were kept in a clean animal room until the tumor volume of the mice grew to about 100 mm 3 The mice were randomly divided into 6 groups: (1) PBS group (as control), (2) engineered bacteria without 5-ALA secretion + ultrasound (HP+SDT group), (3) recombinant Escherichia coli obtained in Example 2 (HPeC group), (4) engineered bacteria without catalase + ultrasound (HPe+SDT group), (5) recombinant Escherichia coli obtained in Example 2 + ultrasound (HPeC+SDT group), and each group of mice was injected with 12.5 mg / kg of the corresponding engineered bacteria. 24 hours after the single injection, the mice were treated with sonodynamic therapy (ultrasound frequency of 1.0 MHz, intensity of 1.5 W·cm -2 , duty cycle 50%, ultrasound duration 5min); during the treatment period, the body weight, food intake and tumor volume of the mice were monitored daily. Fig.12 shown.

[0131] from Fig.12 It can be seen that within 7 days after treatment, the tumor volume of the control group mice increased from 100mm 3 Progress to 300mm 3 , the tumor volume of the HP+SDT group reached 300mm after ultrasound treatment 3 , the tumor volume of HPeC group reached 250mm 3 The tumor progression of the HPe+SDT group with catalase-free bacteria that secrete 5-ALA was slower than that of the above two groups, and the volume reached 210mm 3 After sonodynamic therapy, the tumor volume of the HPeC+SDT group was significantly reduced to 50 m 3 , indicating significant tumor growth inhibitory efficacy.

[0132] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A recombinant strain for in situ synthesis of protoporphyrin, characterized in that: The recombinant strain is obtained by genetic engineering modification of the starting strain. Compared with the starting strain, the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the recombinant strain are enhanced.

2. The recombinant strain according to claim 1, characterized in that The catalase is an Escherichia coli catalase tetramer of HPII structure, which comprises a subunit with heme as a cofactor; Preferably, the recombinant strain contains a gene encoding a 5-aminolevulinic acid synthase whose amino acid sequence is shown in SEQ ID NO: 1, a gene encoding a phosphoenolpyruvate carboxylase whose amino acid sequence is shown in SEQ ID NO: 2, a gene encoding an O-acetylserine efflux protein whose amino acid sequence is shown in SEQ ID NO: 3, and a gene encoding a catalase whose amino acid sequence is shown in SEQ ID NO: 4; Preferably, the nucleotide sequence of the gene encoding 5-aminolevulinic acid synthase is shown as SEQ ID NO: 5, the nucleotide sequence of the gene encoding phosphoenolpyruvate carboxylase is shown as SEQ ID NO: 6, the nucleotide sequence of the gene encoding O-acetylserine efflux protein is shown as SEQ ID NO: 7, and the nucleotide sequence of the gene encoding catalase is shown as SEQ ID NO:

8.

3. The recombinant strain according to claim 1 or 2, characterized in that The recombinant strain contains a recombinant vector I expressing 5-aminolevulinic acid synthase and phosphoenolpyruvate carboxylase and a recombinant vector II expressing O-acetylserine efflux protein and catalase; Preferably, the recombinant vector I further contains a vector plasmid I, and the recombinant vector II further contains an anaerobic promoter and a vector plasmid II; Preferably, the vector plasmid I is pETDuet1 plasmid, the vector plasmid II is pACYCDuet1 plasmid, and the nucleotide sequence of the anaerobic promoter is shown in SEQ ID NO: 9; Preferably, the starting strain is a probiotic, preferably Escherichia coli MG1655.

4. A method for constructing a recombinant strain for in situ synthesis of protoporphyrin, characterized in that: The method comprises: genetically modifying a starting strain so as to enhance the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the starting strain.

5. The method according to claim 4, characterized in that The method for enhancing the activities of 5-aminolevulinic acid synthase, phosphoenolpyruvate carboxylase, O-acetylserine efflux protein and catalase of the starting strain is to exogenously introduce a gene encoding 5-aminolevulinic acid synthase with an amino acid sequence as shown in SEQ ID NO: 1, a gene encoding phosphoenolpyruvate carboxylase with an amino acid sequence as shown in SEQ ID NO: 2, a gene encoding O-acetylserine efflux protein with an amino acid sequence as shown in SEQ ID NO: 3, and a gene encoding catalase with an amino acid sequence as shown in SEQ ID NO: 4; Preferably, the nucleotide sequence of the gene encoding 5-aminolevulinic acid synthase is shown as SEQ ID NO: 5, the nucleotide sequence of the gene encoding phosphoenolpyruvate carboxylase is shown as SEQ ID NO: 6, the nucleotide sequence of the gene encoding O-acetylserine efflux protein is shown as SEQ ID NO: 7, and the nucleotide sequence of the gene encoding catalase is shown as SEQ ID NO:

8.

6. The method according to claim 5, characterized in that The process of exogenous introduction includes: constructing a recombinant vector I expressing 5-aminolevulinic acid synthase and phosphoenolpyruvate carboxylase and a recombinant vector II expressing O-acetylserine efflux protein and catalase, and co-transforming the recombinant vector I and the recombinant vector II into the starting strain; Preferably, the recombinant vector I further contains a vector plasmid I, and the recombinant vector II further contains an anaerobic promoter and a vector plasmid II; Preferably, the vector plasmid I is pETDuet1 plasmid, the vector plasmid II is pACYCDuet1 plasmid, and the nucleotide sequence of the anaerobic promoter is shown in SEQ ID NO:

9.

7. The method according to any one of claims 4 to 6, characterized in that The starting strain is a probiotic, preferably Escherichia coli MG1655.

8. Use of the recombinant strain according to any one of claims 1 to 3 or the method according to any one of claims 4 to 7 in synthesizing 5-aminolevulinic acid and / or preparing tumor sonodynamic therapy drugs.

9. The use according to claim 8, characterized in that: The tumor is selected from at least one of triple-negative breast cancer, pancreatic cancer, melanoma and non-small cell lung cancer.

10. A composite nano preparation, characterized in that: The composite nanoformulation contains the recombinant strain described in any one of claims 1 to 3 or the recombinant strain constructed by the method described in any one of claims 4 to 7; Preferably, the composite nanoformulation comprises the recombinant strain and an erythrocyte membrane coated around the recombinant strain.

Images