Catharanthus roseus ein3-eils transcription factor and application thereof

Abstract

The application discloses a Catharanthus roseus EIN3-EILs transcription factor and application thereof, relates to the field of biotechnology, and the nucleotide sequence of the transcription factor CrEIN3 is shown as SEQ ID NO:1, and the protein coding sequence is shown as SEQ ID NO:2. The overexpression method is as follows: cloning the Catharanthus roseus CrEIN3 gene; constructing an overexpression vector; obtaining an agrobacterium engineering strain through agrobacterium mediation; and transiently transforming the Catharanthus roseus petals. The Catharanthus roseus EIN3-EILs transcription factor CrEIN3 is applied to increasing the content of vinblastine in the Catharanthus roseus. Through transient overexpression of CrEIN3 in the Catharanthus roseus petals, the synthesis of vinblastine in the Catharanthus roseus petals can be remarkably improved, and this has important significance for efficient production of vinblastine in the Catharanthus roseus.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a Catharanthus roseus EIN3-EILs transcription factor and application thereof. BACKGROUND

[0002] Catharanthus roseus(L.)G.Don, as one of the model plants for studying terpenoid indole alkaloids(TIAs), can produce nearly 200 kinds of terpenoid indole alkaloids. TIAs are a class of secondary metabolites produced by plants in the process of long-term adaptation to ecological environment, some of which have strong pharmacological activity and are mainly used for clinical treatment of various diseases. Terpenoid indole alkaloids in C.roseus include ajmalicine, vindoline, catharanthine, serpentine, vinblastine and vincristine, etc. The bis-indole alkaloids vinblastine and vincristine occupy an indispensable position in most chemotherapy for Hodgkin's lymphoma, lymphosarcoma, neuroblastoma, and breast cancer, lung cancer and childhood leukemia. At present, the United States has approved a batch of commercial drugs using vincristine as raw material, such as vinorelbine, which is a sulfate salt of vincristine, and its function is extremely effective for the treatment of cancers such as acute leukemia, breast cancer, neuroblastoma, ovarian cancer, chronic lymphocytic leukemia, etc. In addition, studies have shown that ajmalicine and serpentine are used for the treatment of circulatory system diseases, especially for the relief of cerebrovascular disease mental disorders and allergic reactions, and vindoline and catharanthine have a certain effect on reducing blood lipids and can be used for the treatment of diseases such as diabetes.

[0003] At present, only C.roseus is the only plant source for producing catharanthine and vincristine, and only one ten-thousandth of the dry weight of C.roseus contains bis-indole alkaloids(nearly 500-750 kg of dry leaves produces 1.0 gram of catharanthine), and the extraction cost is high. It is difficult to synthesize alkaloids by in vitro cultured cells, and it is difficult to produce TIAs without specific induction, and at present it has been reported that artificial semi-synthesis can be used, but the substrate still needs to be extracted from C.roseus, and the industrial production efficiency is very low. So far, there is no other more economical way to obtain bis-indole TIAs, and the most effective way to improve the yield of TIAs is through metabolic engineering, so in-depth study of the molecular regulation mechanism of C.roseus alkaloid synthesis is the basis for improving the yield of TIAs.

[0004] All TIAs in periwinkle originate from the intermediate precursor 3α(S)-stritosidine. The upstream biosynthesis of TIAs is divided into the iridoid pathway (multi-step enzymatic reaction to synthesize secologanin) and the shikimic acid pathway (multi-step enzymatic reaction to synthesize tryptamine). Sesologanin is derived from isopentenyl diphosphate (IPP). In the presence of IPP, indole alkaloids are mainly synthesized in plastids via the MEP pathway. Further, secologanin and tryptamine undergo a condensation reaction with isostigmosiderin synthase (STR) to generate isostigmosiderin. Subsequently, in the downstream pathway, under the action of isostigmosiderin β-D-glucosidase (SGD), 3α(S)-stritosidine is converted to strictosidine aglycone, which can be used to synthesize various TIAs. Further, through a multi-step enzymatic reaction, dihydroprecondylcarpine acetate is formed, which then forms vinblastine and tabersonine under the action of catharanthine synthase (CS) and tabersonine synthase (TS). Tabersonine undergoes a seven-step reaction to form vendolyn. Finally, vinblastine and vendolyn form vinblastine under the action of peroxidase 1 (PRX1), generating the intermediate α-3',4'-anhydrovinblastine, which then undergoes multiple steps to generate anhydrovinblastine, vinblastine, and vincristine. Among them, DXS1, TDC, 7-DLGT, 7DLH, LAMT, SLS, Asα, and STR are upstream synthetic genes, and SGD, REDOX2, SAT, HL1, HL2, DAT, and PRX1 are downstream synthetic genes.

[0005] EIN3 / EILs transcription factors are important nuclear transcription factors in the ethylene signaling pathway. They have been isolated from various higher plants and belong to a small family of transcription factors. These transcription factors are highly conserved at the N-terminus of their amino acid sequences and regulate the expression of related genes by directly binding to the primary ethylene responder element (PERE). They participate not only in important life activities such as fruit ripening, flower senescence, salt tolerance, frost tolerance, and resistance to mechanical stress, but also in regulating the synthesis of plant secondary metabolites.

[0006] CrEIN3 is an EIN3 / EILs transcription factor isolated from Catharanthus roseus, which can significantly increase the content of vinblastine when transiently expressed in the petals of Catharanthus roseus, indicating that it is a potential transcription factor that can promote the biosynthesis of vinblastine. Therefore, the transcription factor is of great significance for promoting the efficient synthesis of vinblastine. In known studies, the CrERF5 transcription factor in Catharanthus roseus responds to ethylene signals and has a regulatory effect on the synthesis of terpenoid indole alkaloids, but the gene function of the EIN3 / EIL1 type transcription factor in the ethylene signal pathway in Catharanthus roseus is rarely reported.

[0007] Therefore, the person skilled in the art is committed to developing a Catharanthus roseus EIN3 / EILs transcription factor CrEIN3, which can positively regulate the expression of key genes in the vinblastine biosynthesis pathway, thereby promoting the biosynthesis of vinblastine. SUMMARY

[0008] In view of the above defects of the prior art, the technical problem to be solved by the present application is to develop a Catharanthus roseus EIN3 / EILs transcription factor CrEIN3, which can positively regulate the expression of key genes in the vinblastine biosynthesis pathway, thereby promoting the biosynthesis of vinblastine.

[0009] To achieve the above-mentioned purpose, the present application provides a Catharanthus roseus EIN3-EILs transcription factor CrEIN3, the nucleotide sequence of the transcription factor CrEIN3 is shown in SEQ ID NO: 1, and the protein coding sequence is shown in SEQ ID NO: 2.

[0010] Further, the full-length sequence and related information of the Catharanthus roseus EIN3 / EILs transcription factor CrEIN3 gene.

[0011] Further, the CrEIN3 transcription factor can positively regulate the synthesis of vinblastine in Catharanthus roseus.

[0012] Further, CrEIN3 positively regulates the biosynthesis of vinblastine by activating the transcription of key enzyme genes DXS1, SGD and PRX1 in the vinblastine biosynthesis pathway, improving the gene expression of DXS1, SGD and PRX1.

[0013] The present application also provides a method for overexpressing the Catharanthus roseus EIN3-EILs CrEIN3 gene, comprising the following steps:

[0014] Step 1, cloning the Catharanthus roseus CrEIN3 gene;

[0015] Step 2, constructing an overexpression vector containing the CrEIN3 gene obtained in step 1;

[0016] Step 3, the overexpression vector obtained in step 2 is obtained by Agrobacterium mediation, and an Agrobacterium engineering strain containing the CrEIN3 gene overexpression vector is obtained;

[0017] Step 4, the positive strain of the Agrobacterium engineering strain obtained in step 3 is transiently transformed into a petunia petal.

[0018] Further, in step 3, the freeze-thaw method is used to introduce Agrobacterium, and the Agrobacterium is Agrobacterium tumefaciens GV3101.

[0019] Further, in step 4, the leaf disc method is used to transiently transform the petunia petal.

[0020] Further, the step of transiently transforming the petunia petal is:

[0021] The positive strain of the Agrobacterium engineering strain is inoculated in a liquid medium for expansion culture, and cultured at 28 DEG C overnight; the bacterial body is collected by centrifugation at 4500 rpm for 10 min; the bacterial body is resuspended with a liquid medium, and each bacterial liquid is diluted to an OD600 of 0.6 with the liquid medium; acetyl eugenol (AS) and MES are added, and after standing at room temperature for 3 h, the petunia petal is injected by an injection method, and then cultured in the dark for 1 day and under light for 3 days.

[0022] Further, the step of transiently transforming the petunia petal is:

[0023] The inoculation ratio is 1:100; the liquid medium is a liquid MS medium for resuspending the bacterial body, the final concentration of acetyl eugenol is 200 μmol / L; the concentration of MES is 10 mmol / L, and the pH value is 5.7.

[0024] Further, the method further comprises determining the TIAs content of the transiently overexpressed petunia petal.

[0025] Further, the determination of the TIAs content further comprises: extracting the petunia petal to obtain an extract, and determining the content of vinblastine and the intermediate product in the synthesis pathway of the extract by LC-MS.

[0026] Further, the vinblastine is amaroidine, vindoline, vinblastine, catharanthine, and anhydrous vinblastine; and the intermediate product in the synthesis pathway is tryptophan and tryptamine.

[0027] The application also provides a use of the petunia EIN3-EILs transcription factor CrEIN3 in increasing the content of vinblastine in petunia.

[0028] In the preferred embodiment 1 of the application, the cloning process of the CrEIN3 gene of petunia is described in detail.

[0029] In another preferred embodiment 2 of the present application, the construction process of the plant expression vector containing the CrEIN3 gene is described in detail;

[0030] In another preferred embodiment 3 of the present application, the construction process of the double luciferase reporter vector of the vincaine biosynthesis key enzyme gene DXS1, TDC, STR, SGD, PRX1 promoter is described in detail;

[0031] In another preferred embodiment 4 of the present application, the activation effect of the transcription factor CrEIN3 on the key enzyme gene DXS1, TDC, STR, SGD, PRX1 promoter is detected by tobacco transient transformation;

[0032] In another preferred embodiment 5 of the present application, the construction process of the CrEIN3 overexpression vector is described in detail;

[0033] In another preferred embodiment 6 of the present application, the process of Agrobacterium tumefaciens-mediated CrEIN3 overexpression promoting vincaine synthesis in the petal of Catharanthus roseus is described in detail;

[0034] In another preferred embodiment 7 of the present application, the process of LC-MS determination of the TIAs content of the petal of Catharanthus roseus transiently overexpressing is described in detail.

[0035] The present application has the following beneficial technical effects:

[0036] The present application provides a Catharanthus roseus CrEIN3 gene and its use, which encodes the EIN3 / EILs transcription factor CrEIN3 of Catharanthus roseus. The transcription factor can activate the activity of multiple key enzymes DXS1, SGD, 7-DLGT, 7DLH, ASα, REDOX2, SAT, HL2 and the transcription factor CrORCA3 in the vincaine biosynthesis pathway, and positively regulates the expression of the corresponding genes, thereby promoting the biosynthesis of vincaine. By transiently overexpressing CrEIN3 in the petal of Catharanthus roseus, the synthesis of vincaine in the petal of Catharanthus roseus can be significantly improved, which has important significance for the efficient production of vincaine in Catharanthus roseus.

[0037] The present application analyzes the EIN3 / EILs transcription factor in the transcriptome database of Catharanthus roseus, and first clones the full-length sequence of the CrEIN3 gene from Catharanthus roseus. The important transcription factor CrEIN3 for inducing the synthesis of vincaine by ethylene signal is found, which can be applied to metabolic engineering to improve the yield of vincaine, and provides a new strategy for metabolic regulation to improve the yield of vincaine. The present application provides a basis for changing the expression of the corresponding genes in Catharanthus roseus plants by using genetic engineering methods to improve the yield of vincaine. The CrEIN3 transcription factor can be applied to the improvement of the yield of vincaine by overexpression, which has important significance for the genetic engineering breeding of Catharanthus roseus and the large-scale production of vincaine.

[0038] The concept, specific structure and generated technical effects of the present application will be further described below in combination with the drawings, so as to fully understand the purposes, features and effects of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 is a tobacco transient transformation CrEIN3 activation vinblastine synthesis pathway key enzyme gene promoter activity detection results chart of a preferred embodiment 4 of the present application;

[0040] Figure 2 is a standard curve of vinblastine and anhydrovinblastine of a preferred embodiment 7 of the present application;

[0041] Figure 3 is a CrEIN3 transcription factor in vinca regulating vinblastine and the expression amount of intermediate products in the synthesis pathway of a preferred embodiment 7 of the present application. DETAILED DESCRIPTION

[0042] The following reference drawings of the specification introduce a plurality of preferred embodiments of the present application, so that the technical content thereof is more clear and convenient to understand. The present application can be embodied by many different forms of embodiments, and the protection scope of the present application is not limited to the embodiments mentioned herein.

[0043] The experimental methods in the following examples not specified in the specific conditions are usually according to the conventional conditions, for example, the conditions described in Sambrook et al. Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions suggested by the manufacturer.

[0044] The agrobacterium involved in the present application is Agrobacterium tumefaciens, and the strain is GV3101 (pSoup19). The strain can be publicly purchased in the market.

[0045] Example 1, cloning of vinca CrEIN3 gene

[0046] 1. Extraction of total RNA of vinca genome

[0047] The total RNA of Catharanthus roseus was extracted as a template, and the amount was calculated according to the RNA concentration, and cDNA was obtained under the action of PowerScript reverse transcriptase; according to the nucleotide sequence (SEQ ID NO: 1) of the CrEIN3 gene, the sequence was obtained from the Catharanthus roseus genome sequencing result. The gene-specific primer was designed, and the CrEIN3 gene was amplified from the total cDNA by PCR, and the PCR product was recovered and purified, and then connected with the blunt-ended pLB vector (product of Tiangeng Biochemical Co., Ltd.) and sequenced to obtain the pLB-CrEIN3 plasmid vector, and the plasmid was extracted and sequenced.

[0048] Through the above steps, the coding sequence of the CrEIN3 transcription factor in Catharanthus roseus (SEQ ID NO: 1) was obtained, and the protein coding sequence (SEQ ID NO: 2) was deduced, wherein the start codon is ATG and the stop codon is TAA.

[0049] Example 2, construction of a plant expression vector containing the CrEIN3 gene

[0050] 1. Construction of overexpression vector pHB-CrEIN3-GFP

[0051] The CrEIN3 gene was amplified from the correctly sequenced blunt-ended vector pLB and constructed on the plant expression vector pHB-GFP. In order to facilitate the construction of the expression vector, the forward primer introduced a BamHI enzyme digestion site, and the reverse primer introduced a SpeI enzyme digestion site. The primer sequences are as follows:

[0052] Forward primer pHB-CrEIN3-GFP-FP:

[0053] CTCAAGCTTGGATCCATGATGATGTTTGAGGAAAT, i.e. SEQ ID NO. 3

[0054] Reverse primer pHB-CrEIN3-GFP-RP:

[0055] GCTCACCATACTAGTCGGATACCAGATTGGAATAT, i.e. SEQ ID NO. 4.

[0056] Example 3, construction of a double luciferase reporter vector for the promoters of the key enzyme genes DXS1, TDC, STR, SGD and PRX1 in the biosynthesis of vinblastine

[0057] 1. PCR amplification of the promoters of the key enzyme genes DXS1, TDC, STR, SGD and PRX1 in the biosynthesis of vinblastine.

[0058] According to the sequence information of the key enzyme genes of vinblastine biosynthesis in the NCBI database, the specific primers of DXS1, TDC, STR, SGD, PRX1 promoter amplification were designed, and the vinca genome DNA was used as a template for amplification. HindIII and PstI enzyme cutting sites were added to the upstream and downstream of the primers.

[0059] Table 1 specific primers for promoter amplification

[0060]

[0061]

[0062] 2. Connecting the promoter fragment into the dual luciferase reporter vector

[0063] The amplified DXS1, TDC, STR, SGD, PRX1 promoter sequences were constructed into the pGreenII0800-LUC vector by homologous recombination method through ClonExpress IIOne Step Cloning Kit (Novagen, Nanjing) kit, and plant dual luciferase detection reporter vectors pGreenII0800-ProDXS1, pGreenII0800-ProTDC, pGreenII0800-ProSTR, pGreenII0800-ProSGD, pGreenII0800-ProPRX1 were obtained.

[0064] Example 4, tobacco transient transformation to detect the activation of transcription factor CrEIN3 on key enzyme gene DXS1, TDC, STR, SGD, PRX1 promoter

[0065] 1. Obtaining of Agrobacterium engineering strain

[0066] The pHB-GFP empty vector and the plant expression vector pHB-CrEIN3-GFP containing CrEIN3 in Example 2 were transformed into Agrobacterium GV3101 with pSoup19 helper plasmid by freeze-thaw method, and the plant dual luciferase detection reporter vectors pGreenII0800-ProDXS1, pGreenII0800-ProTDC, pGreenII0800-ProSTR, pGreenII0800-ProSGD, pGreenII0800-ProPRX1 in Example 3 were transformed into Agrobacterium GV3101 with pSoup19 helper plasmid by freeze-thaw method, and Agrobacterium engineering strains containing empty vector, CrEIN3 gene and promoter were obtained.

[0067] 2. Transient transformation of tobacco

[0068] The positive strains of the above-mentioned Agrobacterium engineering strains were inoculated in 10 ml liquid medium at a ratio of 1:100 for expansion culture, and cultured at 28°C overnight; the bacterial bodies were collected by centrifugation at 4500 rpm for 10 min; the bacterial bodies were resuspended with MS liquid medium, and each bacterial liquid was diluted to an OD600 of 0.6 with MS liquid medium; 200 μmol / L of acetyl-syringone (AS) and 10 mmol / L of MES (pH 5.7) were added, and the mixture was placed at room temperature for 3 h for standby.

[0069] The Agrobacterium engineering strains containing pHB-CrEIN3-GFP and empty vector were mixed with Agrobacterium engineering strains containing pGreenII0800-ProDXS1, pGreenII0800-ProTDC, pGreenII0800-ProSTR, pGreenII0800-ProSGD, and pGreenII0800-ProPRX1 plant dual-luciferase reporter vectors at a ratio of 1:1, and then injected into tobacco leaves grown for 4-5 weeks by injection infection with a 1 mL needle-free syringe, and then cultured in the dark for 1 day and then cultured under light for 1 day.

[0070] 3. Dual-Luciferase detection

[0071] The tobacco leaves cultured for 2 days were quickly frozen with liquid nitrogen and ground into powder. The Dual-Luciferase Reporter Assay System kit of Promega Company and GloMax 20 / 20 Luminometer fluorescence detector were used to detect the fluorescence intensity, and the operation was carried out according to the kit instructions. The results of activity detection of the tobacco transiently transformed CrEIN3 activated long-acting vinblastine synthesis pathway key enzyme gene promoter are shown in Figure 1 The results of Dual-LUC analysis of the candidate transcription factor on TIAs synthesis enzyme gene are shown in the figure, wherein A is not divided into DXS1, B is divided into TDC, C is divided into STR, D is divided into SGD, and E is divided into PRX1 promoter activation results; pHB-GFP empty vector as a control, it can be seen that the transcription factor CrEIN3 significantly activates the activity of DXS1, SGD, and PRX1 promoters.

[0072] Example 5, CrEIN3 overexpression vector construction

[0073] The CrEIN3 gene was amplified from the blunt-ended vector pLB with correct sequencing, and was constructed on the plant expression vector p2300. In order to facilitate the construction of the expression vector, a BcuI enzyme digestion site was introduced into the forward primer, and an Eco91I enzyme digestion site was introduced into the reverse primer. The primer sequences are as follows:

[0074] Forward primer:

[0075] p2300-CrEIN3-FP: GTAGATCTGACTAGTATGATGATGTTTGAGGAAAT

[0076] Reverse primer:

[0077] p2300-CrEIN3-RP: TTCGAGCTGGTCACCTTACGGATACCAGATTGGAA.

[0078] Example 6, Agrobacterium tumefaciens-mediated overexpression of CrEIN3 promotes vinblastine synthesis in Catharanthus roseus petals

[0079] 1. Obtaining of Agrobacterium engineering strain

[0080] The overexpression vector p2300-CrEIN3 was transformed into the pSoup19 helper plasmid Agrobacterium GV3101 by freeze-thaw method to obtain an Agrobacterium engineering strain containing the target vector.

[0081] 2. Transient transformation of Catharanthus roseus petals

[0082] The positive strain of the above Agrobacterium engineering strain was inoculated in 10 ml liquid medium at a ratio of 1:100 for expansion culture, and cultured at 28°C overnight; the bacterial cells were collected by centrifugation at 4500 rpm for 10 min; the bacterial cells were resuspended with MS liquid medium, and each bacterial liquid was diluted to an OD600 of 0.6 with MS liquid medium; 200 μmol / L of acetyl-syringone (AS) and 10 mmol / L of MES (pH 5.7) were added, and the mixture was incubated at room temperature for 3 h for standby.

[0083] The Agrobacterium engineering strain and P19 Agrobacterium were mixed at a ratio of 1:1, and then injected into the Catharanthus roseus petals by 1 mL needle-free syringe injection, and then cultured in the dark for 1 day and then under light for 3 days.

[0084] 3. Extraction of Catharanthus roseus petals

[0085] The cultured Catharanthus roseus petals were cut and frozen in liquid nitrogen, and then ground into powder. The powder sample was placed in an EP tube, 800 μL of methanol solution was added, and the mixture was shaken in a shaker for 2 min, mixed thoroughly until no more sample could be dissolved, and then ultrasonicated for 45 min (ultrasonic instrument was set at 55 W). The ultrasonicated sample was centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was filtered through a 0.22 μm filter and then placed in a new centrifuge tube, which was sealed with sealing film.

[0086] Example 7, LC-MS determination of TIAs content in transiently overexpressed Catharanthus roseus petals

[0087] 1. LC-MS conditions and preparation of standard solution

[0088] LC-MS experiments were performed on a Waters BEH C18 (2.1 mm*100 mm, 1.7 μm) column using an ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometer. The mobile phase A: formic acid / water 1 / 1000 (v), B: formic acid / acetonitrile 1 / 1000 (v), detection wavelength 254 nm, flow rate 0.35 mL / min, injection volume 2 μL. The ionization mode was ESI+.

[0089] Table 2: Gradient configuration of standard concentration

[0090]

[0091] 2. Preparation of standard curve

[0092] Record the chromatogram and chromatographic parameters, and perform regression analysis of peak area (Y) and standard content (X, μg) respectively. The standard curve of vinblastine and anhydrovinblastine is shown in Figure 2

[0093] 3. Determination of the content of vinblastine and intermediate products in the synthesis pathway

[0094] LC-MS was used to determine the accumulation of TIAs (amarine, vindoline, vinblastine, catharanthine, anhydrovinblastine) and intermediate products (tryptophan, tryptamine). The content of artemisinin in the sample (mg) was calculated by substituting the peak area into the linear regression equation, and then divided by the dry weight of the sample (g), thereby calculating the content of amarine, vindoline, vinblastine, catharanthine, anhydrovinblastine, tryptophan, and tryptamine in the petals of Catharanthus roseus. In this embodiment, LC-MS was used to determine the content of amarine, vindoline, vinblastine, catharanthine, anhydrovinblastine, tryptophan, and tryptamine in the petals of Catharanthus roseus. The metabolic engineering strategy of transforming CrEIN3 overexpression vector was used, and it was found that overexpression of CrEIN3 gene can significantly improve the content of anhydrovinblastine and vinblastine in the petals of Catharanthus roseus, which provides strong experimental evidence for using the gene for transcription regulation to further improve the content of vinblastine in Catharanthus roseus.

[0095] The CrEIN3 transcription factor of Catharanthus roseus EIN3 / EILs involved in the present application can improve the content of vinblastine in Catharanthus roseus. The coding sequence of the transcription factor is connected to a plant expression regulatory vector to construct a plant expression vector containing the coding sequence. The expression vector is transformed into Agrobacterium, and the Agrobacterium is transformed into the petals of Catharanthus roseus. The content of vinblastine in the petals of Catharanthus roseus obtained by the present application is significantly regulated, and the CrEIN3 transcription factor regulates the expression amount of vinblastine and intermediate products in the synthesis pathway in Catharanthus roseus as Figure 3 ​As shown in the table, ** represents significant difference from the control, *** represents extremely significant difference from the control; compared with the control group, the overexpression of CrEIN3 in the Catharanthus roseus petal sample significantly increased the content of vineridine by 37.60%, and vinblastine by 46.18%. The overexpression of CrEIN3 in the Catharanthus roseus petal sample significantly increased the content of vineridine and vinblastine. The application provides a transcription factor coding sequence for regulating the content of vinblastine in Catharanthus roseus, and lays a solid foundation for the efficient production of vinblastine by using the coding sequence.

[0096] The preferred embodiments of the application are described in detail above. It should be understood that those of ordinary skill in the art can make many modifications and variations without departing from the concept of the application. Therefore, any technical solutions obtained by logical analysis, reasoning or limited experiments based on the concept of the application and the prior art should be within the protection scope defined by the claims.

Claims

1. The application of the CrEIN3 transcription factor in activating the PRX1 gene in periwinkle to increase vincristine content, characterized in that... By transiently overexpressing the CrEIN3 transcription factor in periwinkle petals, CrEIN3 specifically binds to the promoter region of PRX1, a key enzyme in the synthesis of bisindole alkaloids, and activates its expression, thereby increasing the content of vincristine in periwinkle petals; the nucleotide sequence of the CrEIN3 transcription factor is shown in SEQ ID NO:1, and the protein coding sequence is shown in SEQ ID NO:

2.

2. The application as described in claim 1, characterized in that, The method for cloning and overexpressing the gene encoding the CrEIN3 transcription factor is as follows: using cDNA from petals of periwinkle during its full bloom as a template, the CrEIN3 gene fragment is obtained by PCR amplification using specific primers; the specific primer sequences are upstream primer 5'-ATGGCGGATCCATGAGTGGTTCTTCTGCT-3' and downstream primer 5'-ATGGCGAGCTCTTAGTTGATGCGGATGAG-3'; the CrEIN3 gene fragment is ligated to the p2300 vector through BamHI and SacⅠ restriction sites to construct the recombinant vector p2300-CrEIN3.

3. The application as described in claim 2, characterized in that, The transient overexpression is achieved through Agrobacterium-mediated transformation, specifically including: transforming the recombinant vector p2300-CrEIN3, which expresses the CrEIN3 transcription factor, into Agrobacterium GV3101 competent cells using a freeze-thaw method; screening for positive strains and inoculating them into LB broth medium; and incubating with shaking at 28°C and 200 rpm until the bacterial culture reaches OD. 600 =0.6, add acetylsuccinone to a final concentration of 200 μmol / L, and continue culturing for 30 minutes to obtain Agrobacterium transformation medium containing the CrEIN3 transcription factor expression vector.

4. The application as described in claim 3, characterized in that, The instantaneous transformation and culture method of periwinkle petals is as follows: Select sun-facing petals from the upper middle part of periwinkle that are 1-2 days after full bloom and free from damage, pests and diseases. Inject Agrobacterium transformation solution containing the CrEIN3 transcription factor expression vector along the main vein of the petal using a needleless syringe. The injection volume for each petal is 50 μL. After injection, place the petals in a sterile culture box at 25℃ and 60%-70% relative humidity and culture in the dark for 1 day. Then, culture in the light for 3 days under a photoperiod of 120 μmol・m⁻²・s⁻¹ and 16h light / 8h dark.

5. The application as described in claim 4, characterized in that, In the same batch of periwinkle petal samples that underwent transient transformation, the following were detected sequentially: the relative fluorescence activation activity of the CrEIN3 transcription factor on the PRX1 promoter was 3.5 ± 0.3 times that of the control group; the relative expression level of the PRX1 gene was ≥ 3 times higher than that of the control group; the vinblastine content in periwinkle petals was ≥ 45% higher than that of the control group; and the dehydrated vinblastine content was ≥ 35% higher than that of the control group.

Images