Construction method and application of ovarian cancer BRCA1 mutant cell model based on CRISPR / Cas9

Abstract

The invention discloses a construction method and application of an ovarian cancer BRCA1 mutant cell model based on CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / associated protein 9). According to the invention, an ovarian cancer BRCA1 (c.5091 Tgt; A and c.5521 del) endogenous point mutation cell model is constructed by adopting a CRISPR / Cas9 technology, and experimental conditions of editing BRCA1 by CRISPR / Cas9 in ovarian cancer cells are optimized by adopting multiple transfections or by interfering a mismatch repair pathway key factor MLH1, so that the mutation rate is increased. According to the invention, the novel mutation c.5091 Tgt of BRCA1 is jointly verified in a manner of combining endogenous mutation and exogenous mutation; a and c.5521del can increase the sensitivity of ovarian cancer cells to carboplatin and interfere with the expression of carboplatin sensitive genes. Theoretical and experimental basis is provided for precise diagnosis and treatment and prognosis evaluation of ovarian cancer, and more clinical problems can be solved.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and specifically to a method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9 and its application. Background Art

[0002] Globally, ovarian cancer (Ovarian carcinoma, OV) has the highest mortality rate among gynecological malignancies and is a malignant tumor that seriously threatens women's health. The occurrence or development of 10%-15% of ovarian cancer is related to genetic factors, mainly caused by BRCA1 / 2 mutations. BRCA1 is a tumor suppressor gene involved in DNA repair and is closely related to the occurrence of cancer. The risk of ovarian cancer in an average woman's lifetime is 1.4%, while the cumulative ovarian cancer risk score of BRCA1 mutation carriers is as high as 44%.

[0003] BRCA1 / 2 is a genetic susceptibility gene for ovarian cancer. Mutations in BRCA1 / 2 may impair the high-fidelity repair function of the homologous recombination repair (HRR) pathway, increase genomic breakage and instability, and thus increase the risk of cancer. In addition, studies have also confirmed that BRCA mutations are associated with improved prognosis in patients with ovarian cancer, and they are more likely to undergo secondary cytoreductive surgery. Therefore, the discovery of pathogenic mutations in the BRCA1 / 2 genes can help assess the genetic susceptibility of patients with ovarian cancer, develop corresponding genetic management measures (including preventive surgery, regular screening programs, and family genetic risk assessments), and can also assist in developing precise diagnosis and treatment plans (such as predicting the efficacy of platinum chemotherapy / PARPi) and judging the prognosis of tumor patients, thereby providing precise diagnosis and treatment for patients and improving prognosis.

[0004] The CRISPR / Cas9 system is the most commonly used gene editing technology. There are three main types of CRISPR systems. The most commonly used Type II CRISPR system contains two components: Cas9 nuclease and artificial guide RNA (gRNA). When the Cas9-gRNA complex recognizes the NGG (N = A, T, C or G) protospacer adjacent motif (PAM) sequence, the gRNA pairs with the target DNA chain, recruits the Cas9 nuclease to cut the DNA chain, and generates a DNA double-strand break 3 bp upstream of the PAM. Double-strand breaks (DSBs) are mainly repaired by two mechanisms: one is the non-homologous end joining (NHEJ) repair mechanism that dominates in cells, which can lead to small insertions or deletions (indels); the other is homologous recombination repair (HDR), adding exogenous templates to generate new DNA. The latter is the introduction of an exogenous DNA template that needs to contain homologous sequences near the target site, usually requiring longer homologous arms (30-50 bp). HDR used by CRISPR / Cas9 is a complex process that depends on many variables, such as the cell type, chromatin state, and cell cycle of the target DNA. Although CRISPR gene editing has received widespread attention, how to improve its editing efficiency, especially for homology repair-related genes, remains a research difficulty.

[0005] Therefore, this study aims to establish a method for endogenous editing of the BRCA1 gene based on the classic CRISPR / Cas9 system, optimize its process, increase the BRCA1 mutation rate, and combine the amplification effect of the exogenous point mutation reporter system to doubly verify the function of the new mutation sites of the BRCA1 gene, thereby providing a theoretical and experimental basis for its application in the screening, precision diagnosis and treatment, and prognosis evaluation of ovarian cancer. Summary of the invention

[0006] This application is to solve the above-mentioned technical problems and proposes a method for constructing and applying a CRISPR / Cas9-based BRCA1 mutation cell model for ovarian cancer.

[0007] In a first aspect, the present invention provides a method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9, which is achieved by adopting the following technical scheme.

[0008] A method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9, comprising the following steps:

[0009] S1. Construction of lenti-Cas9 stable cell line;

[0010] S2. Construction of lentiGuide-Puro-gRNA recombinant vector: gRNA sequences containing BRCA1c.5091T>A and c.5521del point mutations are shown in SEQ ID NO.5 and SEQ ID NO.6;

[0011] S3. Transfect the lentiGuide-Puro-gRNA recombinant vector into the lenti-Cas9 stable cell line;

[0012] S4. Transfecting ssODN into gRNA and Cas9 to stabilize ovarian cancer cells: the ssODN sequences are shown in SEQ ID NO.13 and SEQ ID NO.14.

[0013] In a second aspect, the present invention provides an improved method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9, which is achieved by adopting the following technical scheme.

[0014] A method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9, which improves the efficiency of CRISPR / Cas9 editing the BRCA1 gene by multiple transfections of ssODN and / or interference with MLH1, a key factor in the mismatch repair pathway, based on the above method.

[0015] Furthermore, the number of transfections of ssODN was 2-3 times.

[0016] Furthermore, the siRNA sequences of the MLH1 molecules are shown in SEQ ID NOs. 47-49.

[0017] In a third aspect, the present invention provides a first use of an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9, which is achieved by adopting the following technical solution.

[0018] An application of the ovarian cancer BRCA1 mutation cell model prepared by the above method in the preparation of a product for evaluating the sensitivity of chemotherapy drugs.

[0019] In a fourth aspect, the present invention provides a second use of an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9, which is achieved by adopting the following technical solution.

[0020] An application of the ovarian cancer BRCA1 mutation cell model prepared by the above method in the preparation of ovarian cancer diagnosis and treatment or prognosis assessment products.

[0021] The present application achieves the following beneficial effects.

[0022] The present invention is an efficient CRISPR / Cas9 gene editing technology for new mutation sites (c.5091T>A and c.5521del) of the BRCA1 gene. With the maturity and popularization of high-throughput sequencing technology, more and more hotspot mutations or changes in pathogenic gene domains have been found. Therefore, it is urgent for the clinic to construct accurate point mutation cells and animal models corresponding to the disease in order to further study the mechanism of disease occurrence, development and treatment, but the current efficient and accurate gene editing technology still faces great challenges. The present invention establishes a method for endogenous direct editing of the BRCA1 gene based on the classic CRISPR / Cas9 system, optimizes its process, improves the mutation rate of the BRCA1 gene, and combines the exogenous point mutation plasmid reporter system to verify the function of the new mutation site of the BRCA1 gene, thereby providing a theoretical and experimental basis for its application in the diagnosis and treatment of ovarian cancer and prognosis evaluation. This technology can not only mutate the wild type into a pathogenic type for research and exploration of pathogenic mechanisms and clinical phenotype verification, but also correct the pathogenic type back to the wild type for disease treatment. With the continuous optimization of the CRISPR / Cas9 gene editing system in application, it not only provides a theoretical and experimental basis for the application of precise diagnosis and treatment and prognosis evaluation of ovarian cancer, but also helps to solve more similar clinical problems, and has broad prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is the transfection effect of the CRISPR / Cas9 element of the present application (A. The working principle of the CRISPR / Cas9 gene editing tool using ssODN for homologous damage repair; B. The qRT-PCR verification results of SKOV3 and HEK293T cell lines transfected with gRNA and Cas9 plasmid. *P<0.05, *P<0.05, **P<0.01, ***P<0.001);

[0024] Figure 2 It is the Sanger sequencing map of the BRCA1 mutation site gRNA recombinant vector (lentiGuide-Puro-gRNA) of the present application (gRNAs targeting BRCA1c.5091T>A and c.5521del sites (gRNA 1-1 and gRNA1-2), respectively; the sequence of the lentiGuide-Puro original vector is above the sequencing peak map, and the sequence of the recombinant vector composed of the vector and gRNA is below);

[0025] Figure 3It is a diagram of the editing effect of the combined application of gRNA, Cas9 and ssODN in this application at different sites (A. The mutation of c.5091T>A in SKOV3 and HEK293T cells; B. The mutation of c.5521del in SKOV3 and HEK293T cells; the target site is indicated by a red box);

[0026] Figure 4 It is the off-target effect of gRNA1-1 and gRNA1-2 of the present application (the off-target genes predicted by COMSID were detected by qRT-PCR, and the results showed that the off-target effect was small);

[0027] Figure 5 It is the optimization of the transfection times of ssODN in the present application (A. Flow chart of transfection of ssODN; B. Sequencing results of ssODN c.5091T>A transfected at different times in SKOV3 and HEK293T cells, with the peak value quantification graph below; C. Sequencing results of ssODN c.5521del transfected at different times in SKOV3 and HEK293T cells);

[0028] Figure 6 The present invention is the gene editing after interfering with MLH1 in the MMR pathway (A. Expression level of MLH1 mRNA in SKOV3 and HEK293T cells; B. SKOV3 cells were transfected with si-MLH1-2 and 1-3 to study the effect of siRNAs at different targeting sites on the transcription level of MLH1 mRNA; C. In SKOV3 cells, si-NC, si-MLH1-2 and si-MLH1-3 were transfected for 48h, followed by ssODN transfection and Sanger sequencing; D. The sequencing data were quantitatively analyzed, with the sequencing peaks of the bases shown at the top and the types of bases at the site and their relative proportions listed at the bottom, showing a significant increase in the mutation rate (51% and 27%, respectively));

[0029] Figure 7 is the construction of exogenous point mutation / domain deletion plasmids and cell lines of the present application (AB. Specific locations of BRCA1 involved in point mutation and domain deletion plasmids; C. qRT-PCR results show the mRNA expression levels of BRCA1 gene in SKOV3 and HEK293T cells after transfection of empty plasmid (PLVX), point mutation plasmid (MUT-1 / MUT-2) and domain deletion plasmid (domain-del 1 / domain-del 2). P<0.05);

[0030] Figure 8This is the carboplatin drug inhibition experiment after BRAC1 point mutation in this application (among which, AB.CCK-8 detects the difference in sensitivity to carboplatin between the ovarian cancer SKOV3BRAC1c.5091T>A c.5521del endogenous point mutation cell line and the control group; CD.Carboplatin drug inhibition experiment of SKOV3BRAC1 exogenous point mutation and domain deletion cell line);

[0031] Fig. 9 It is the carboplatin sensitivity-related indicator of ovarian cancer in this application—the mRNA differential expression of carboplatin-sensitive genes in SKOV3 mutant cells and non-mutated cells;

[0032] Fig.10 is the genome instability detection result of the present application (AB. Whole exome sequencing evaluates the genome instability of point mutation cells and control cells; A is the number of genome instability fragments; B is the range of genome instability fragments);

[0033] Fig.11 It is the NMD phenomenon produced by the point mutation of this application (the results of UPF1 knockdown in AB.c.5091T>A / c.5521del cells, and the expression of BRCA1 after knockdown. 1:1 and 1:2 are different transfection ratios of siRNA and Lipo3000);

[0034] Fig.12 It is the experimental flow chart of this application. DETAILED DESCRIPTION

[0035] Part I: Construction of an ovarian cancer cell model using classic CRISPR / Cas9 tools with endogenous point mutations

[0036] 1. Construction of lenti-Cas9 stable cell line

[0037] 1. Cell Culture

[0038] After the human ovarian cancer cell line (SKOV3) and human embryonic kidney cell line (HEK293T) were revived and thawed, 1 ml of pre-prepared complete medium was added, and the cells were centrifuged at 1000 rpm / min for 5 minutes, the supernatant was discarded, and the cells were cultured with complete medium. Before the experiment, the cultured (SKOV3, HEK293T) were inoculated in a 6-well plate, and the cells were completely attached to the wall with a density of about 70%.

[0039] 2. Lentiviral packaging

[0040] 1) Prepare virus solution: Inoculate HEK293T in a 6cm culture dish. After 12h, starve the cells for 4-6h, and transfect the cells according to the ratio of target plasmid (lenti-Cas9; Addgene 52962): psPAX2: pMD2.G = 4:3:1. Add 300μl of Opti-MEM culture medium to two EP tubes, add 8μg of the above mixed plasmid to one, and add 24μl PEI to the other. After flicking to mix, add the solution in the plasmid tube to the transfection reagent tube, invert to mix, and incubate at room temperature for 10-13min. Discard the original culture medium in the 6cm culture dish and replace it with a culture medium containing only 10% FBS. Evenly add the plasmid transfection reagent mixture to the cells and replace the medium after 6h.

[0041] 2) Collecting virus solution: Collect the culture solution of HEK293T transfected with the plasmid in a 50 ml centrifuge tube, centrifuge at 2000 rpm for 5 min, draw the supernatant with a syringe, and filter through a 0.45 μm filter membrane.

[0042] 3) Infect target cells: Take SKOV3 / HEK293T cells in good condition and inoculate them in 6-well plates. After 12 hours, starve the cells for 4-6 hours. Discard the original culture medium, add culture medium containing polybrene (0.02%-0.08%), and evenly add 1 ml of virus solution to each well. After 8 hours, replace with fresh complete culture medium. After 48 hours, perform drug screening according to the drug resistance tag (Blasticidin) on the target plasmid (SKOV3 (10μg / ml), HEK293T (7μg / ml)). After the control cells are completely dead, reduce the drug concentration and maintain the culture.

[0043] 3. RNA Extraction

[0044] Add 500μl Trizol reagent to a 6cm dish, place on ice for 3-5min, and transfer to a 1.5ml enzyme-free EP tube. The ratio of Trizol to nucleic acid extraction reagent (chloroform) is 5:1. Invert and mix well, place on ice for 5min, and centrifuge at 4℃12000rpm for 15min. Pipette 150μl of the upper transparent liquid phase, add isopropanol and mix well, and place on ice for 15min. Centrifuge at 4℃12000rpm for 10min, discard the supernatant, add 75% ethanol solution, and wash the precipitate. Centrifuge at 4℃12000rpm for 5min, discard the liquid, repeat the wash with 75% ethanol solution, discard the liquid, and place at room temperature for 5min. Add 20μl enzyme-free water, flick to mix, and store at -80℃.

[0045] 4. RNA Reverse Transcription and qRT-PCR

[0046] Each reaction system was 20 μl. 800 ng RNA was taken for reversal. 4 μl 4×g DNA wiper mix was added and supplemented to 16 μl with ddH2O. The mixture was mixed and centrifuged for 2 min at 42°C. 4 μl 5×qRT SuperMixⅡ was added and mixed and placed in a PCR instrument at 50°C for 15 min and 80°C for 2 min.

[0047] Prepare 18.0ul reaction system, and each sample needs 3 replicates. Include: 2×ChamQ Universal SYBRqPCR 10.0μl, Primer-F (10μM) 0.4μl, Primer-R (10μM) 0.4μl, ddH2O 7.2μl. Mix well, centrifuge briefly and dispense equally into each 200μl PCR tube, and finally add 2μl cDNA template. PCR program: 95℃30s, (95℃10s, 60℃30s, 95℃15s)×40 cycles, 60℃60s, 95℃15s. Data calculation: relative expression = 2 -△△Ct目的基因 ; △△Ct target gene = experimental group △Ct目的基因 -Control group △Ct目的基因 ; △Ct target gene = Ct (target gene) - Ct (reference gene of the same sample).

[0048] Detection primers:

[0049] Cas9-mRNA F: AGAATGAAGCGGATCGAAGA (SEQ ID NO.1)

[0050] Cas9-mRNA R: GCCATTCTGCAGGTAGTACA (SEQ ID NO.2)

[0051] GAPDH(H)-mRNA F: GAAATCCCATCACCATCTTCCAGG (SEQ ID NO.3)

[0052] GAPDH(H)-mRNA R:GAGCCCCAGCCTTCTCCATG(SEQ ID NO.4)

[0053] Results: Cas9 was stably expressed in both SKOV3 and HEK293T cells (*P<0.05) ( Figure 1 B right).

[0054] 2. Construction of lentiGuide-Puro-gRNA recombinant vector

[0055] 1. Design gRNA

[0056] Whole exome sequencing was performed on postoperative tissues of patients with high-grade serous ovarian cancer. Potential pathogenic mutation sites c.5091T>A and c.5521de on BRCA1 were obtained after pathogenicity rating. gRNA 1-1 and gRNA 1-2 targeting the above two sites were designed based on the CRISPOR database (http: / / crispor.gi.ucsc.edu / ).

[0057] gRNA 1-1:ATGCTGAGTTTGTGTGTGAA (SEQ ID NO.5)

[0058] gRNA 1-2: GCAGATGTGTGAGGCACCTG (SEQ ID NO. 6).

[0059] 2. Construction of Plasmid

[0060] 1) Enzyme digestion of vector plasmid for linearization, 20μl reaction system includes: lentiGuide-Puro (addgene #52963) 3μg, BsmBI 1μl, NEB Buffer 3.12.5μl, ddH2O for completion. For the control group, ddH2O was used instead of enzyme, mixed and centrifuged briefly, 55℃, 2h.

[0061] 2) Prepare agarose gel (0.8%), add DNA marker, lentiGuide-Puro original plasmid, and linearized lentiGuide-Puro fragment after enzyme digestion to different loading wells, run electrophoresis at 100V for 40min, and image the gel.

[0062] 3) Gel cutting and recovery: When using Buffer GW reagent for the first time, add 80ml of anhydrous ethanol and store at room temperature. Buffer GDP in a 37℃ water bath. Place the gel under a UV lamp, cut the gel of the target band, put it into a 1.5ml EP tube, calculate the weight of the gel, add GDP buffer according to the ratio of gel block mass (mg): Buffer GDP = 1:1, and incubate at 55℃ for 5min. Add the mixed solution to the adsorption column, centrifuge at 12000rpm for 1min, discard the waste liquid, add 300μl Buffer GDP, let it stand at room temperature for 1min, centrifuge at 12000rpm for 1min, and discard the waste liquid again. Add 700μl of GW buffer to the adsorption column, invert several times, and centrifuge at 12000rpm for 1min. Repeat once, finally discard the waste liquid, centrifuge at 12000rpm for 2min, let it stand at room temperature for 5min, so that Buffer GW can evaporate completely. Heat Buffer EB for 5-10 minutes in advance, place the adsorption column on a 1.5ml EP tube, add 50μl Buffer EB to the adsorption column, let stand at room temperature for 3 minutes, centrifuge at 12000rpm for 2 minutes, add the liquid in the EP tube to the adsorption column for the second time, centrifuge again, and store at -20℃.

[0063] 4) Oligo annealing: 10 μl reaction system including gRNA primer

[0064] gRNA1-1-F: ACACCGATGCTGAGTTTGTGTGTGAAG (SEQ ID NO.7);

[0065] gRNA1-1-R:AAAACTTCACACACAAACTCAGCATCG (SEQ ID NO.8);

[0066] gRNA1-2-F: ACACCGACCCACTCTCGGGTCACCAC G (SEQ ID NO.9);

[0067] gRNA1-2-R:AAAACGTGGGTGACCCGAGAGTGGGT CG (SEQ ID NO. 10).

[0068] According to gRNA-F (100μM) 1μl, gRNA-R (100μM) 1μl, 10×T4PNKBuffer 1μl, T4PNK 0.5μl, ddH2O 6.5μl, sample 2μl. PCR reaction conditions: 37℃30min, 95℃5min, then slowly reduce from 95℃ to 25℃, flick to mix, centrifuge, and put on the machine. The product after the reaction was diluted 1:199.

[0069] 5) Ligation: 10 μl reaction system, 50 ng of linear vector, 1 μl of oligo annealing product, 1 μl of 10×T4 Ligase Buffer, 1 μl of T4 DNA Ligase, and ddH2O for completion. Set the PCR reaction program: 16°C for 12-16 hours (overnight incubation). After centrifugation, store at -20°C.

[0070] Results: Sanger sequencing showed that gRNAs were successfully connected to the lentiGuide-Puro vector ( Figure 2 ).

[0071] 6) Transformation and amplification of plasmids:

[0072] Prepare LB solid culture medium. Take about 5μl of PCR product (plasmid ligation product) for transformation. Take out the competent cells (Stable3 / DH5α) from -80℃, dispense 20μl into each 1.5ml EP tube, add 5μl of plasmid to each, flick to mix, and let stand on ice for 30min. Place the above EP tubes on a floating plate, incubate in a 42℃ water bath for 60s, quickly transfer the EP to ice, and let stand for 3-5min. Add 300-500μl of LB liquid culture medium to each EP tube, place at 37℃, 220rpm and culture for 2h. Inoculate the plate and culture in a 37℃ incubator for 12-14h. Add monoclonal colonies to LB liquid culture medium containing 100μg / ml ampicillin antibiotics, culture at 37℃ 220rpm for 8-10h, and extract the plasmid using a kit (Kangwei Century, Jiangsu).

[0073] 3. Transfect gRNA into lenti-Cas9 stable cell line construction and verification

[0074] The gRNA was transfected into the above-mentioned lenti-Cas9 stable SKOV3 and HEK293T cell lines (the steps are the same as the Cas9 transfection in the construction of lenti-Cas9 stable cell lines). After transfection, the cells were screened with puromycin (Puro), and the screening concentrations were SKOV3 (1μg / ml) and HEK293T (1μg / ml), respectively. According to the experimental method qRT-PCR (for specific experimental steps, see step 5 in the construction of lenti-Cas9 stable cell lines), amplification was performed using the following primers:

[0075] gRNA-mRNA F: TTCTTGGGTAGTTTGCAGTT (SEQ ID NO.11)

[0076] gRNA-mRNA R: AGCCAAGAAATCGAAATACT (SEQ ID NO. 12).

[0077] Results: gRNA was stably expressed in cells (*P<0.05) ( Figure 1 B left), followed by transfection of ssODN.

[0078] 3. Transfection of ssODN into gRNA and Cas9 Stable Ovarian Cancer Cells

[0079] The target cells (SKOV3, HEK293T) were inoculated in a 6-well plate. The cells were completely attached to the wall and the density was about 70%. The supernatant was discarded and DMEM medium was added for 4 hours. Two 1.5 ml EP tubes were prepared, and 250 μl Opti-MEM medium was added to each. Among them, 8 μl P3000 and 4 μg ssODN were added to the tube for ssODN transfection, and the bottom of the tube was flicked to mix. 12 μl Lipo3000 was added to the transfection reagent tube, and the mixture was mixed inverted, that is, Lipo3000: P3000: ssODN = 3:2:1. The solution in the plasmid tube was mixed into the transfection reagent tube and allowed to stand at room temperature for 10-15 minutes. The culture medium was discarded and replaced with serum-containing culture medium, and the mixture was evenly added to the cells. Fresh complete culture medium was replaced 6-10 hours after transfection. The cells were collected 48 or 72 hours later and nucleic acid was extracted.

[0080] The ssODN sequence information is as follows:

[0081] ssODN1-1:

[0082] CTTTGAGTGTTTTTCATTCTGCAGATGCTGAGTTTGTGTG A GAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAA (SEQ ID NO. 13);

[0083] Note: The underlined and bold bases are the replaced bases

[0084] ssODN1-2:

[0085] GTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGAC Y GTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCT) (SEQ ID NO. 14).

[0086] Note: The underline and bold Y characters indicate the positions of deleted bases.

[0087] 4. Verification of point mutations

[0088] 1. DNA Extraction

[0089] Prepare the Mix solution for lysing cells: 500μl TNE solution, 5μl proteinase K at a concentration of 20mg / ml, and 50μl 10% SDS. Add 550μl lysis solution to each sample to resuspend the cells. After overnight incubation in a water bath, add 186μl saturated sodium chloride solution and shake vigorously up and down for 10-15s. Then add 736μl nucleic acid extraction solution (24:1) and place in a four-dimensional mixer for 60min to extract nucleic acids into the supernatant. Centrifuge at 4℃12000rpm for 15min, draw 400-600μl supernatant into a new 1.5ml EP tube, add 736μl isopropanol, place at -20℃ for 2h, and transfer to 4℃ 10min in advance. Centrifuge at 4℃15000rpm for 15min, discard the supernatant, and add 200μl 70% alcohol for washing. Centrifuge at 15000 rpm at 4°C for 5 min, discard the liquid, let stand at room temperature for 10 min, and add 20 μl TE buffer.

[0090] 2. DNA fragment amplification

[0091] Specific primers for the target site (c.5091T>A and c.5521del) DNA level were designed using the NCBI-BLAST database. 50.0μl PCR Mix solution was prepared, including: 5×Q5Reation Buffer 10.0μl, dNTP (10mM) 1.0μl, Primer-F (10μM) 2.5μl, Primer-R (10μM) 2.5μl, Template DNA 1.0μg, Q5 Super Fidelity DNA Polymerase 0.5μl, ddH2O up to 50.0μl. PCR reaction program: (98℃30s, 98℃10s, 60℃30s)×35 cycles-72℃30s. 1× loading buffer was added to the PCR product, and DNA marker and sample were added to the loading well in sequence. Then, the electrophoresis results were observed by gel imaging after running on 1.5% agarose gel at 100V for 40min.

[0092] Specific primers for target loci (c.5091T>A and c.5521del) DNA level:

[0093] BRCA1-1-F CTTTGAGTTGTTTTTCATTCTGC (SEQ ID NO. 15);

[0094] BRCA1-1-R CAATTCTGAGGTGTTAAAGGG (SEQ ID NO. 16);

[0095] BRCA1-2-F GAGGCACCTGTGGTGA (SEQ ID NO. 17);

[0096] BRCA1-2-R GTAAGCTCATTCTTGGGGTC (SEQ ID NO. 18).

[0097] Results: Sanger sequencing (Shanghai Biotechnology, China) after transfection with ssODN was performed. Figure 3 , showing that after one transfection of ssODN, no significant point mutations occurred at the two mutation sites of BRCA1 gene, but Figure 3 A shows the target site has a trace amount of red editing substitution "T" peak generation, Figure 3 B shows the sequence misalignment peak for a minor "T" deletion as expected.

[0098] 5. Detection of off-target effects of BRAC1gRNA1-1 and gRNA1-2

[0099] 1. DNA level verification of off-target

[0100] The top 3 potential off-target sites of CRISPR / Cas9 gene editing tools predicted by the CRISPOR database (Table 1) mostly occur in introns or at the junctions of genes, and have different PAM sequences, which will not cause the cutting effect of Cas9.

[0101] Table 1 Top 3 off-target locations

[0102]

[0103]

[0104] The underlined bases in the above-mentioned sequences are mismatched base positions that cannot completely match the gRNA.

[0105] 2. Verification of off-target effects at the RNA level

[0106] Based on the prediction results of COMSID (https: / / crispr.bme.gatech.edu / ), the possible off-target genes of gRNA1-1 and gRNA1-2 were further verified. The top 5 genes RAB41, DFNA5, ARPCA, MUC16 and LRRC75A were selected for verification for gRNA1-1, and the top 5 genes CRTAC1, LAMB2, ARHGEF1, HMCN2 and SOCS2 were selected for verification for gRNA1-2. According to the experimental method qRT-PCR (for specific steps, see step 3 of lenti-Cas9 stable cell line construction), the SKOV3 mutant cell line was detected with primers (Table 2).

[0107] Table 2 Amplification primers for predicted off-target genes

[0108]

[0109] Results: There was no significant difference in the expression levels of off-target genes in ovarian cancer SKOV3 cells before and after gRNA transfection (p>0.05), and no off-target effect was shown ( Figure 4 ).

[0110] 3. Detection of off-target effects at the whole genome level: Further whole exome sequencing was performed on SKOV3 cells with successful BRCA1c.5091T>A mutation. The results showed that no mutations in the above-mentioned potential off-target genes were found in the cells of the control group and the experimental group, confirming that the selected gRNA had no off-target effects.

[0111] Part II Optimization model of CRISPR / Cas9 system for efficient editing of BRCA1 gene

[0112] 1. Optimizing the transfection time of ssODN

[0113] according to Figure 5 Process A explores the effect of multiple transfections on the efficiency of ssODN integration into cells. In SKOV3 and HEK293T cells including gRNA and Cas9, ssODN was transfected for different times according to the transfection method in step 3 of the first part, and DNA was extracted according to the experimental method. Sanger sequencing of cell DNA was performed (Shanghai Bioengineering, China) ( Figure 5 BC). Figure 5 The sequencing peak graph above B was input into the EditR (http: / / baseeditr.com / ) website to obtain Figure 5 The result below B.

[0114] Results: The sites targeted by gRNA1-1 showed the best effect after three ssODN transfections, whether in SKOV3 or HEK293T cells, with an editing efficiency of 29%. The fourth transfection did not further increase the peak value of the target site, which were 13% and 11%, respectively. The sites targeted by gRNA1-2 had the best effect after two ssODN transfections.

[0115] 2. Interference with the MLH1 molecule in the MMR pathway

[0116] When homologous repair-related genes are interfered with, the role of non-homologous repair MMR (mismatch repair) will dominate the DNA repair process, in which MLH1 is an important molecule in this pathway. Therefore, editing of homologous recombination repair can be promoted by interfering with the MLH1 molecule.

[0117] 1. According to step 3 in the construction of lenti-Cas9 stable cell lines, the expression level of MLH1 mRNA in SKOV3 and HEK293T cells was detected using MLH1 primers.

[0118] MLH1 Primers

[0119] MLH1-mRNA-F CTCTTCATCAACCATCGTCTGG (SEQ ID NO.45)

[0120] MLH1-mRNA R GCAAATAGGCTGCATACACTGTT (SEQ ID NO.46)

[0121] Results: The expression level of this gene was higher in ovarian cancer SKOV3 cells ( Figure 6 A).

[0122] 2. siRNA interference of MLH1 molecules: SKOV3 adherent cells were inoculated in 6-well plates. Two 1.5 ml EP tubes were prepared, and 250 μl Opti-MEM was added to each well. 7.5 μl (20 μM) siRNA was added to the plasmid tube. SKOV3 adherent cells were taken out of the incubator, the supernatant was discarded, 1.5 ml of culture medium containing 10% FBS was added, and 500 μl of plasmid transfection reagent mixture was evenly added to the cell supernatant, mixed evenly, and cultured in the incubator for 6-10 hours before changing the medium.

[0123] siRNA for MLH1 molecules:

[0124] Si-MLH1-1AUGAUUGAGAACUGUUUAGTT (SEQ ID NO. 47);

[0125] Si-MLH1-2AUGAAUGGUUACAUAUCCATT (SEQ ID NO. 48);

[0126] Si-MLH1-3UGGAAAUGGUGGAAGAUGATT (SEQ ID NO. 49).

[0127] result: Figure 6 B shows the knockdown effect of different si-MLH1. The si-MLH1-2 and si-MLH1-3 groups with better knockdown effects were selected for subsequent experiments. 48 hours after BRCA1 gene editing, cell DNA was extracted for PCR amplification and Sanger sequencing ( Figure 6 C).

[0128] Will Figure 6The sequencing peak graph of si-MLH1-2Cas9gRNA1-1ssODN and si-MLH1-3Cas9gRNA1-1ssODN transfected in C was input into the EditR website to obtain Figure 6 The result of D.

[0129] Results: Through the quantitative analysis of the peak graph, it can be seen that the cell mutation efficiency of the si-MLH1-3 group is higher (51%>27%).

[0130] Part III Construction of exogenous BRCA1 point mutation ovarian cancer cell line

[0131] In order to further verify the functional mechanism of BRCA1 endogenous point mutation constructed by CRISPR / Cas9, a BRCA1 mutation exogenous plasmid reporter system was designed and constructed ( Figure 7 A) Because the point mutation is located in the BRCT domain of BRCA1, a plasmid lacking the domain where the point mutation is located was also constructed.

[0132] 1. Design and construction of BRCA1 expression plasmid

[0133] 1. For the BRCA1 gene, select the NM_007294 transcript to construct an overexpression plasmid. Design qRT-PCR primers using the NCBI-BLAST database to detect the mRNA expression level of BRCA1 in ovarian cancer cells, and select HEK293T cells with high expression levels to amplify the target fragment.

[0134] 2. Removal of gDNA was completed using a kit (Novozyme, Nanjing). 10 μl reaction system, including 2 μg RNA, 2 μl 5× gDNA wiper mix, and ddH2O. Use a pipette to gently blow and mix. 42℃2min.

[0135] 3. Synthesis of long-fragment cDNA: 10 μl reaction system, including: 10 μl of the previous step mixture, 2 μl of 10×RT Mix, 2 μl of HiScript III Enzyme Mix, 1 μl of Oligo(dT)20VN, 5 μl of ddH2O. Use a pipette to mix gently. 37℃45min, 85℃5s.

[0136] 4. Amplify the CDS region fragment of BRCA1

[0137] The reaction system was 50.0 μl, including: 2×Phanta Max Buffer 25.0 μl, template cDNA 0.5-2.0 μl, dNTP Mix (10 mM) 1.0 μl, Primer-F (10 μM) 2.0 μl, Primer-R (10 μM) 2.0 μl, PhantaMax Super-Fidelity DNA Polymerase 1.0 μl, and ddH2O to complete. Because the CDS region of BRCA1 is long, it was amplified in two parts. Invert and mix well and put into the PCR instrument. Amplification program: 95℃180, 95℃15, 55-65℃15, 72℃120×35, 723004℃∝. The target fragment was recovered according to the fragment recovery step in step 2 of the gRNA recombinant vector construction.

[0138] 5. Enzyme digestion of vector plasmid

[0139] Linearized plasmid reaction system. 50μl system, including: PLVX-CMV 2μg, XhoI 1μl, 10×Buffer 2.15μl, ddH2O to make up. Mix well and react on the machine. The program is 37℃2h. After the reaction is completed, add BstbI restriction endonuclease to the above mixture, mix well and incubate at 65℃2h. Finally, perform agarose gel verification.

[0140] 6. Ligation of the target fragment and the linearized vector

[0141] The BRCA1 expression plasmid was constructed using the PLVX vector plasmid, which was digested with XhoI and BstBI and then the following two fragments were inserted.

[0142] Insert fragment 1 The first half of the cDNA sequence expressed by BRCA1 (gene sequence 1nt-4357nt) (SEQ ID NO.50)

[0143]

[0144] Insert fragment 2 The second half of the cDNA sequence expressed by BRCA1 (gene sequence 4358nt-5592nt) (SEQ ID NO.51)

[0145]

[0146] The forward amplification primer sequence for insert 1 is:

[0147] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ ID NO.52) The reverse amplification primer sequence of insert fragment 1 is:

[0148] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)

[0149] The forward amplification primer sequence for insert 2 is:

[0150] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)

[0151] The reverse amplification primer sequence for insert 2 is:

[0152] 2-BRCA-R: 5'-ccgtcgactgcagaattcgaaTCAGTAGTGGCTGTGGGGGA-3' (SEQ IDNO.55)

[0153] 2. Construction of BRCA1 point mutation and domain deletion plasmids

[0154] 1. Using seamless cloning, three pairs of upstream and downstream primers were designed for point mutations and two pairs of upstream and downstream primers were designed for domain deletions.

[0155] 2. The BRCA1 expression plasmid constructed above (the plasmid constructed in step 1) is used as an amplification template, and primers for point mutation and domain deletion are directly used for amplification and ligation.

[0156] (1) Point mutation

[0157] ①1-1 mutant plasmid (1c.5091T>A; MUT-1)

[0158] The PLVX vector plasmid was used, and after digestion with XhoI and BstBI, the following three fragments were inserted.

[0159] Three inserted fragments

[0160] Insert fragment 1 is the same as fragment 1 (1nt-4357nt) in the above BRCA1 expression plasmid construction

[0161] Insert fragment 2 is the same as the partial sequence of fragment 2 in the above BRCA1 expression plasmid construction (4358nt-5090nt)

[0162] Insert fragment 3 into the above BRCA1 expression plasmid with mutation (5091nt-5592nt) (SEQ ID NO.56)

[0163] 5091nt -A GAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGC TATTTCTGGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGT GGTGAAGGAGCTTTCATTCACCCTTGGCACAGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGA-5592nt

[0164] Note: The mutation position is the base in bold and underlined

[0165] The primer sequence for forward amplification of insert 1 is:

[0166] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ IDNO.52)

[0167] The primer sequence for reverse amplification of insert 1 is:

[0168] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)

[0169] The primer sequence for forward amplification of insert 2 is:

[0170] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)

[0171] The primer sequence for reverse amplification of insert 2 is:

[0172] CSBRCA-11-F: 5'-gtgtccgttctCACACAAACTCAGCATCTGTTTTCA-3' (SEQ ID NO.57)

[0173] The primer sequence for forward amplification of insert 3 is:

[0174] CSBRCA-11-R: 5'-gtttgtgtgAGAACGGACACTGAAATATTTTCTAGG-3' (SEQ ID NO.58)

[0175] The primer sequence for reverse amplification of insert 3 is:

[0176] 2-BRCA-R: 5'-ccgtcgactgcagaattcgaaTCAGTAGTGGCTGTGGGGGA-3' (SEQ IDNO.55)

[0177] ②1-2 mutant plasmid (c.5521del; MUT-2)

[0178] The PLVX vector plasmid was used, and after digestion with XhoI and BstBI, the following three fragments were inserted.

[0179] Three inserted fragments

[0180] Insert fragment 1 (same as fragment 1 in the above BRCA1 plasmid construction) 1nt-4357nt

[0181] Insert 2 (part of fragment 2 in the above BRCA1 plasmid construction) 4358nt-5520nt

[0182] Insert 3 (part of fragment 2 in the above BRCA1 plasmid construction) 5522nt-5592nt (SEQ ID NO.59)

[0183] 5522nt -YGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGA-5592nt

[0184] Note: The bold underlined Y character indicates the position of the deleted base

[0185] The primer sequence for forward amplification of insert 1 is:

[0186] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ IDNO.52)

[0187] The primer sequence for reverse amplification of insert 1 is:

[0188] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)

[0189] The primer sequence for forward amplification of insert 2 is:

[0190] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)

[0191] The primer sequence for reverse amplification of insert 2 is:

[0192] CSBRCA-12-F: 5'-agagtgctacacGTCCAACACCCACTCTCGGG-3' (SEQ ID NO.60)

[0193] The primer sequence for forward amplification of insert 3 is:

[0194] CSBRCA-12-R: 5'-tgttggacGTGTAGCACTCTACCAGTGCCAGG-3' (SEQ ID NO.61)

[0195] The primer sequence for reverse amplification of insert 3 is:

[0196] 2-BRCA-R: 5'-ccgtcgactgcagaattcgaaTCAGTAGTGGCTGTGGGGGA-3' (SEQ IDNO.55)

[0197] (2) Domain deletion

[0198] ① Domain-deleted plasmid (domain-del 1, missing two BRCT domains)

[0199] The PLVX vector plasmid was used, and after digestion with XhoI and BstBI, the following two fragments were inserted.

[0200] Two inserted fragments

[0201] Insert fragment 1 is the same as fragment 1 (1nt-4357nt) in the above BRCA1 plasmid construction

[0202] Insert 2 Partial sequence of fragment 2 in the above BRCA1 plasmid construction (4358nt-4929nt)

[0203] The primer sequence for forward amplification of insert 1 is:

[0204] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ IDNO.52)

[0205] The primer sequence for reverse amplification of insert 1 is:

[0206] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)

[0207] The primer sequence for forward amplification of insert 2 is:

[0208] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)

[0209] The primer sequence for reverse amplification of insert 2 is:

[0210] CSJGY-BRCA-1F: 5'-ccgtcgactgcagaattcgaaTGTTGAAGCTGTCAATTCTGGC-3' (SEQID NO.62)② Domain 2 deletion plasmid (domain-del 2; missing one BRCT domain)

[0211] The PLVX vector plasmid was used, and after digestion with XhoI and BstBI, the following two fragments were inserted.

[0212] Two inserted fragments

[0213] Insert fragment 1 is the same as fragment 1 (1nt-4357nt) in the above BRCA1 plasmid construction

[0214] Insert 2 Partial sequence of fragment 2 in the above BRCA1 plasmid construction (4358nt-5271nt)

[0215] The primer sequence for forward amplification of insert 1 is:

[0216] 1-BRCA-F: 5'-ctaccggactcagatctcgagATGGATTTATCTGCTCTTCGCG-3' (SEQ IDNO.52)

[0217] The primer sequence for reverse amplification of insert 1 is:

[0218] CSovBRCA-R: 5'-tactgCTTTTTCTGATGTGCTTTGTTCTGG-3' (SEQ ID NO.53)

[0219] The primer sequence for forward amplification of insert 2 is:

[0220] CSovBRCA-F: 5'-gcacatcagaaaaagCAGTATTAACTTCACAGAAAAGTAGTGAATAC-3'(SEQID NO.54)

[0221] The primer sequence for reverse amplification of insert 2 is:

[0222] CSJGY-BRCA-1R:5'-ccgtcgactgcagaattcgaaGTCCTGGGATTCTCTTGCTCG-3'(SEQ IDNO.63)

[0223] 3. Lentiviral packaging and construction of BRCA1 point mutation and domain deletion stable cell lines

[0224] The exogenous plasmid constructed above was transfected into SKOV3 and HEK293T cells according to the lentiviral packaging step in the first part, and primers (BRCA1-mRNA F: GAAACCGTGCCAAAAGACTTC (SEQ ID NO.64); BRCA1-mRNA

[0225] R:CCAAGGTTAGAGAGTTGGACAC (SEQ ID NO.65)) was detected by qRT-PCR.

[0226] Results: The point mutation and domain deletion plasmids were successfully transfected into ovarian cancer SKOV3 and normal control HEK293T cell lines ( Figure 7 C)(P<0.05).

[0227] Part IV: Functional verification of BRCA1 point mutations

[0228] 1. Carboplatin drug inhibition experiment

[0229] Wild-type cells and mutant cells that are growing well were diluted to 4 × 10 4 / ml, inoculated in a 96-well plate, added carboplatin after 12 hours, added 100μl CCK-8 and culture medium mix solution to each well, incubated at 37℃ for 2 hours. Shake on a flatbed shaker for 10 minutes, detect the absorbance at 450nm / 490nm with an enzyme reader, collect the results and analyze them.

[0230] 1. BRCA1 endogenous point mutation cells:

[0231] Carboplatin drug inhibition assay was performed on SKOV3 cell lines based on the endogenous constructed SKOV3BRAC1c.5091T>A / c.5521del.

[0232] Results: Compared with the control group Cas9+gRNA1-1, the carboplatin sensitivity of Cas9+gRNA1-1+ssODN in the BRAC1c.5091T>A mutation group was increased (IC50 33.76μg / ml vs. 29.73μg / ml, **P<0.01, Figure 8 A). Compared with the control group Cas9+gRNA1-2, the carboplatin sensitivity of the BRAC1c.5521del mutation group Cas9+gRNA1-2+ssODN was also increased (IC50 34.32μg / ml vs. 28.67μg / ml, ***P=0.0001, Figure 8 B).

[0233] 2. BRCA1 exogenous point mutation cells:

[0234] Results: The point mutations and the corresponding domain deletions produced the same effect, which was consistent with the results of endogenous point mutations. The mutation groups all increased the sensitivity to carboplatin (see Figure 8C). In SKOV3 cells, the sensitivity of the point mutation (BRAC1c.5091T>A) cell line (MUT-1, IC50=28.65μg / ml) and the domain deletion cell line (domain-del1, IC50=31.6μg / ml) to carboplatin was increased relative to the control group (PLVX, IC50=36.18μg / ml). At another site (c.5521del), the sensitivity of the point mutation cell line (MUT-2, IC50=30.47μg / ml) and the domain deletion cell line (domain-del 2, IC50=30.25μg / ml) to carboplatin was also increased relative to the control group (PLVX, IC50=36.45μg / ml).

[0235] In normal HEK293T cells, compared with the control group (PLVX, IC50 = 45.70 μg / ml), the point mutation cell line (MUT-1, IC50 = 34.17 μg / ml) and the domain-deleted cell line (domain-del 1, IC50 = 39.13 μg / ml) showed increased sensitivity to carboplatin ( Figure 8 D) At another site, compared with the control group (PLVX, IC50=47.83 μg / ml), the sensitivity of the point mutation cell line (MUT-2, IC50=33.11 μg / ml) and the domain deletion cell line (domain-del 2, IC50=37.11 μg / ml) to carboplatin was also increased.

[0236] 2. Verification of carboplatin sensitivity-related gene expression levels

[0237] The drug resistance database DRESIS (http: / / dresis.idrblab.net / ) was used to search for carboplatin-sensitive genes in ovarian cancer patients. The results showed that when carboplatin was sensitive, TP53 and TIMP1 were upregulated, while AREG, CCND1, MAPK1, GRB2, and RPS6KA3 were downregulated. Therefore, mRNA was extracted from SKOV3 wild cells and mutant cells, and the above 7 genes were detected by qRT-PCR (Table 3). The experimental results were consistent with the database prediction results ( Fig. 9 ).

[0238] Table 3 Amplification primers for carboplatin resistance gene

[0239]

[0240]

[0241] 3. Determination of genomic instability

[0242] In SKOV3 cells, for the c.5091T>A site, whole exome sequencing was performed on the control group cells (Cas9+gRNA1-1, NC), 72h experimental group cells (Cas9+gRNA1-1+ssODN+carboplatin treatment for 72h), and 96h experimental group cells (Cas9+gRNA1-1+ssODN+carboplatin treatment for 96h).

[0243] Results: It was shown that point mutations could increase the number and range of unstable genomic fragments ( Fig.10 ).

[0244] BRCA1 point mutations produce NMD

[0245] Combined with bioinformatics prediction, BRCA1c.5091T>A mutation will produce NMD, while BRCA1c.5521del mutation will not produce NMD. Based on this, siRNA interference targeting UPF1, a key factor in the NMD pathway (GGGCCUUAACAAGAAGAGATT SEQID NO.80) was designed. According to step 3 of the first part, siRNA was transfected into 293T c.5091T>A / c.5521del cells. Two gradients were designed based on the ratio of transfection reagent to si-UPF, namely si-UPF11:1 and 1:2. The results showed that it successfully knocked down si-UPF1( Fig.11 A). Due to the reduction of UPF1, the mRNA expression of BRCA1 in the mutant (c.5091T>A) cell line increased. It can be seen that UPF1 is involved in regulating the expression of BRCA1 mRNA. Therefore, it is inferred that the reduction of BRCA1 expression caused by c.5091T>A is caused by the NMD effect mediated by UPF1, but the c.5521del mutant cell line did not have a similar result ( Fig.11 B).

[0246] The embodiments of this specific implementation method are all preferred embodiments of the present application, and are not intended to limit the protection scope of the present application. Therefore, all equivalent changes made based on the structure, shape, and principle of the present application should be included in the protection scope of the present application.

Claims

1. A method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9, characterized in that: The following steps are involved: S1. Construction of lenti-Cas9 stable cell line; S2. Construction of lentiGuide-Puro-gRNA recombinant vector: gRNA sequences containing BRCA1 c.5091T>A and c.5521del point mutations are shown in SEQ ID NO.5 and SEQ ID NO.6; S3. Transfect the lentiGuide-Puro-gRNA recombinant vector into the lenti-Cas9 stable cell line; S4. Transfecting ssODN into gRNA and Cas9 to stabilize ovarian cancer cells: the ssODN sequences are shown in SEQ ID NO.13 and SEQ ID NO.

14.

2. A method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9, characterized in that: Based on the method described in claim 1, the efficiency of CRISPR / Cas9 editing of the BRCA1 gene is improved by multiple transfections of ssODN and / or interference with MLH1, a key factor in the mismatch repair pathway.

3. The method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9 according to claim 2, characterized in that: The number of transfections of ssODN was 2-3 times.

4. The method for constructing an ovarian cancer BRCA1 mutation cell model based on CRISPR / Cas9 according to claim 2, characterized in that: The siRNA sequences of MLH1 molecules are shown in SEQ ID NOs. 47-49.

5. Use of an ovarian cancer BRCA1 mutation cell model prepared by the method of any one of claims 1 to 4 in the preparation of a product for evaluating the sensitivity of chemotherapeutic drugs.

6. Use of an ovarian cancer BRCA1 mutation cell model prepared by the method of any one of claims 1 to 4 in the preparation of a product for ovarian cancer diagnosis and treatment or prognosis assessment.

Images