DNA bar code for identifying chrysanthemum and wild chrysanthemum-based original species and application of DNA bar code
By developing species-specific DNA barcodes in the hypervariable region of the chloroplast genome, the problem that the existing technology cannot effectively identify chrysanthemums and wild chrysanthemums is solved, and the accurate identification of these two plants and the safe use of Chinese medicinal materials is achieved.
Patent Information
- Application Number
- CN202510096038.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2025-03-21
AI Technical Summary
The existing DNA barcode technology cannot effectively identify the chrysanthemum and wild chrysanthemum base species, resulting in difficulty in identifying Chinese medicinal materials.
Species-specific DNA barcodes were developed based on the hypervariable regions of chloroplasts and wild chrysanthemums. High-variable region sequences were analyzed and screened through mVISTA and PhyloSuite software, and primers were designed for PCR amplification and Sanger sequencing to verify identification capabilities.
Effective identification of chrysanthemums and wild chrysanthemums has been achieved, the accuracy of the identification of basic ingredients of Chinese medicinal materials has been ensured, the safety of clinical medicines of medicinal materials has been ensured, and the market supply has been standardized.
Smart Images
Figure CN119662894A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of identification of origin species of traditional Chinese medicine, and more particularly to a DNA barcode for identifying chrysanthemum and wild chrysanthemum original species and application thereof. Background Art
[0002] The Chinese Pharmacopoeia contains the dried inflorescence of Chrysanthemum morifolium Ramat., a plant of the Asteraceae family, and the dried inflorescence of Chrysanthemumindicum L., a closely related plant of the same genus. Both can clear away heat and detoxify, treat carbuncle, furuncle, erysipelas, and swelling and pain, and can clear the liver and improve eyesight. Chrysanthemum is pungent and cool to relieve the exterior symptoms, and its pungent and dispersing power is stronger, but its detoxifying power is not as good as that of wild chrysanthemum. Therefore, it is mainly used to disperse wind-heat, soothe the liver and improve eyesight, and is good at treating fever and headache caused by wind-heat cold or early stage of febrile disease, blurred vision caused by liver and kidney deficiency, headache and dizziness caused by hyperactivity of liver yang, and convulsions caused by liver heat. Wild chrysanthemum is more bitter and cold, and has a strong power of clearing heat and detoxifying, and is good at detoxifying and eliminating carbuncle. Therefore, it is often used clinically for sores, carbuncle, swelling and pain, and also relieves sore throat, and is good at treating sore throat, eczema, and skin itching. Therefore, species identification of the original plants of chrysanthemum and wild chrysanthemum is of great significance for precise clinical drug use.
[0003] DNA barcoding technology plays an important role in the identification of traditional Chinese medicines, and the guidelines for the molecular identification of traditional Chinese medicines using DNA barcoding have been included in the 2020 version of the Chinese Pharmacopoeia. However, due to the extremely close relationship between chrysanthemum and wild chrysanthemum, currently used barcoding identification technologies such as ITS2, psbA-trnH, matK, rbcL, and rpoC2 cannot directly identify the two effectively.
[0004] Therefore, the development of efficient universal molecular identification primers for chrysanthemum and wild chrysanthemum is extremely important.
[0005] Therefore, whether it is possible to provide a DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum and its application is an urgent problem to be solved by those skilled in the art. Summary of the invention
[0006] In view of this, the present invention provides a DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum and its application. Compared with traditional DNA barcodes, the chloroplast genome has more abundant variable sites and stronger species resolution. Therefore, based on the highly variable regions of the chloroplast genome of chrysanthemum and wild chrysanthemum, a species-specific DNA barcode for effectively identifying chrysanthemum and wild chrysanthemum is developed, which can be used for the original identification of chrysanthemum and wild chrysanthemum original plants, medicinal materials, decoction pieces and related Chinese patent medicines.
[0007] In order to achieve the above object, the present invention adopts the following technical solution:
[0008] A DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum. The nucleotide sequence of the DNA barcode is a combination of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5.
[0009] The present invention also provides a primer for amplifying the DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum, and the nucleotide sequences of the primers are as SEQ ID NO: 1 and SEQ ID NO: 2.
[0010] The present invention also provides a method for identifying the original species of chrysanthemum and wild chrysanthemum, comprising the following steps:
[0011] (1) mVISTA was used to perform global comparison analysis of the chloroplast genomes of chrysanthemum and wild chrysanthemum, and PhyloSuite software was used to detect the degree of nucleotide variation in the chloroplast genomes of chrysanthemum and wild chrysanthemum. Finally, primers were designed using the screened hypervariable region sequences as templates;
[0012] (2) Validation of species-specific DNA barcodes of chrysanthemum and wild chrysanthemum;
[0013] Extract genomic DNA from chrysanthemum and wild chrysanthemum samples; use the genomic DNA as a template and use the above primers to perform PCR amplification; perform Sanger sequencing on the amplified products after electrophoresis; use Geneious software to splice the sequencing data, and use MEGA11.0 software to perform sequence comparison analysis;
[0014] If the nucleotide sequence of the sample is as shown in SEQ ID NO: 3, the sample is a chrysanthemum sample;
[0015] If the nucleotide sequence of the sample is as shown in SEQ ID NO: 4 or SEQ ID NO: 5, the sample is a Chrysanthemum indici sample.
[0016] Preferably, the reaction system of the PCR amplification reaction in step (2) is:
[0017] 2×Taq MasterMix 12.5μL, 2.5μM upstream and downstream primers 1μL each, DNA template 50ng, add sterile double distilled water to make up the volume to 25μL.
[0018] Preferably: PCR amplification reaction procedure is:
[0019] 94°C, 5 min; 94°C, 30 s, 55°C, 30 s, 72°C, 45 s, 40 cycles; 72°C, 10 min.
[0020] The present invention also provides the use of the DNA barcode and / or the primer in preparing origin identification and detection products of chrysanthemum and wild chrysanthemum origin plants, medicinal materials, decoction pieces and Chinese patent medicines.
[0021] The present invention also provides an origin identification and detection product for chrysanthemum and wild chrysanthemum origin plants, medicinal materials, decoction pieces and Chinese patent medicines. If the sequencing result shows that the nucleotide sequence of the sample is as shown in SEQ ID NO: 3, it is a chrysanthemum sample;
[0022] If the nucleotide sequence of the sample is as shown in SEQ ID NO: 4 or SEQ ID NO: 5, the sample is a Chrysanthemum indici sample.
[0023] Through the above technical scheme, it can be known that compared with the prior art, the present invention discloses a DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum and its application, and the technical effect achieved is that the present invention discloses a pair of species-specific primers that can effectively amplify the hypervariable region ycf1-Ch, which provides a basis for the classification and identification of the original species of chrysanthemum and wild chrysanthemum, ensuring the clinical drug safety of chrysanthemum and wild chrysanthemum medicinal materials, and regulating the chrysanthemum medicinal material market. Specifically, it includes screening the hypervariable region based on the chloroplast genome, designing the primers ycf1-Ch F / ycf1-Ch R with the screened hypervariable region ycf1-Ch sequence as a template, performing PCR amplification, and using Geneious and MEGA11.0 software to analyze and compare 5 chrysanthemum and 5 wild chrysanthemum samples after Sanger sequencing, verifying whether the screened species-specific DNA barcode has species identification ability, and obtaining the basic nucleotide sequence types of chrysanthemum and wild chrysanthemum. Then, 20 samples of chrysanthemum and 20 samples of wild chrysanthemum were used to verify the basic nucleotide sequence types obtained, so as to evaluate the species identification efficiency of the screened sequences and determine the species-specific DNA barcodes that can be used to identify chrysanthemum and wild chrysanthemum. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.
[0025] Figure 1 The accompanying drawing is an mVISTA global alignment of the chloroplast genomes of chrysanthemum and wild chrysanthemum provided by the present invention, wherein the letters above the arrows in the figure are the sequence names of the gene region and the intergenic region.
[0026] Figure 2 The attached figure shows the sequence relationship and SNP distribution diagram of the hypervariable region ycf1 provided by the present invention.
[0027] Figure 3 The attached figure is a PhyloSuite variation analysis diagram of the chloroplast genome of chrysanthemum and wild chrysanthemum provided by the present invention (Pi>0), A: Pi value of gene interval; B: Pi value of gene region.
[0028] Figure 4 The accompanying drawing is a comparison diagram of the ycf1-Ch sequence types of chrysanthemum and wild chrysanthemum provided by the present invention, wherein A: theoretical ycf1-Ch sequence types of chrysanthemum and wild chrysanthemum based on chloroplast genome data; B: a single sequence type of chrysanthemum; C: two sequence types of wild chrysanthemum samples. DETAILED DESCRIPTION
[0029] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0030] The embodiment of the present invention discloses a DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum and its application
[0031] Example 1
[0032] Obtaining species-specific DNA barcodes of chrysanthemum and wild chrysanthemum
[0033] The chloroplast genome sequences of chrysanthemum and wild chrysanthemum were downloaded from the NCBI database, and the chloroplast genomes of chrysanthemum C. morifolium Ramat. and wild chrysanthemum C. indicum L. were globally aligned using mVISTA analysis ( Figure 1 , reference accession numbers include: MH165289.1, MT919686.1, MT919684.1, MH165290.1, MT919687.1, MT919683.1). Among them, the ycf1-Ch sequence in the ycf1 gene has a large variation between the two species ( Figure 2 ). Therefore, this hypervariable region may be a potential molecular marker for species identification of chrysanthemum and wild chrysanthemum.
[0034] PhyloSuite was further used to calculate the nucleotide variation values (Pi) of all genes and intergenic regions in the chloroplast genomes of chrysanthemum and wild chrysanthemum, and to perform gene and intergenic region comparisons ( Figure 3 The average Pi value of the intergenic region is greater than that of the genic region, which is consistent with the results of mVISTA analysis. In the genic region, the Pi value of the ycf1 gene sequence is the largest (in the ycf1-Ch region, 5 SNP sites are densely clustered within a range of 119 bp ( Figure 2 ), meeting the basic requirements as a DNA barcode). Combining the Pi value with the mVISTA result analysis, the present invention screened ycf1-Ch as a specific DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum.
[0035] Example 2
[0036] Verification of species-specific DNA barcodes in Chrysanthemum and Chrysanthemum indica
[0037] 2.1 Experimental Materials
[0038] In this example, 5 samples of chrysanthemum and 5 samples of wild chrysanthemum were used to determine the basic nucleotide sequence types of chrysanthemum and wild chrysanthemum, respectively.
[0039] 2.2 Genome extraction
[0040] Take about 100 mg of the sample and grind it into fine powder using a grinder. The remaining steps are carried out according to the standard operating procedures of the plant genomic DNA extraction kit.
[0041] 2.3 PCR amplification
[0042] The ycf1-Ch F / ycf1-Ch R primers were designed using the screened hypervariable region ycf1-Ch sequence as a template, as shown in Table 1. They were synthesized by Beijing Qingke Biotechnology Co., Ltd. The primers were dissolved in sterile ultrapure water and diluted to 2.5 μM.
[0043] Table 1
[0044]
[0045] 25 μL reaction PCR amplification system: 2×Taq MasterMix 12.5 μL, upstream and downstream primers (2.5 μM) 1 μL each, DNA template about 50 ng, add sterile double distilled water to make up the volume to 25 μL.
[0046] PCR reaction condition parameters: 94°C, 5 min; (94°C, 30 s, 55°C, 30 s, 72°C, 45 s), 40 cycles; 72°C, 10 min.
[0047] 2.4 PCR product sequencing
[0048] After the PCR product showed a positive band after 1% ordinary agarose gel electrophoresis, it was subjected to Sanger bidirectional sequencing using an ABI3730XL sequencer, and the sequencing primers were the same as the PCR amplification primers.
[0049] In this example, the software Geneious was used for sequence splicing, and the software MEGA11.0 was used for sequence alignment analysis. First, Geneious was used to remove the primer regions at both ends of the sequence, and the low-quality parts at both ends of the sequencing results were removed, and the quality of the remaining parts was evaluated. After sequence splicing, the nucleotide types of the 5 chrysanthemum samples were all consistent with the theoretical analysis, which were Cm-Type types; 3 of the 5 wild chrysanthemum samples were consistent with the theoretical analysis, which were Ci-Type I types, and the other 2 wild chrysanthemum sample sequences were Ci-Type II types ( Figure 4 ).
[0050] The nucleotide sequence Cm-Type of the chrysanthemum sample is: CAAATACTTTTAAAAGGAAAGA AAATTCCATTATTTATACCGAGAGAAATATATGAATCAAGTGAAACTC AAACAGAAAAGGATTTG, as shown in SEQ ID No. 3;
[0051] The wild chrysanthemum sample has two sequence types, Ci-Type I is: GAAATACTTTTAAAAG GAAAGAAAATTCCATTATTTATACCGAGAGAAATATATGAATCAAGTG AAACTCAAACAGAAAAGGATTCT, as shown in SEQ ID No.4;
[0052] Ci-Type II is: M (custom M=C and G hybrid type, the overlapping peak of the sequencing peak graph) AAATA CTTTTAAAAGGAAAGAAAATTCCATTATTTATACCGAGAGAAATATAT GAATCAAGTGAAACTCAAACAGAAAAGGATTCN (custom N=T and G hybrid type, the overlapping peak of the sequencing peak graph), as shown in SEQ ID No.5.
[0053] Example 3
[0054] Application of species-specific DNA barcoding in chrysanthemum and wild chrysanthemum
[0055] The species-specific DNA barcode sequences of chrysanthemum and wild chrysanthemum obtained above were further applied to the molecular identification of 20 chrysanthemum and 20 wild chrysanthemum samples.
[0056] The sequencing results were compared and analyzed using MEGA11.0 software, and the results showed that all 20 chrysanthemum samples were of Cm-Type type; 11 of the 20 wild chrysanthemum samples were of Ci-Type I type and 9 were of Ci-Type II type. The present invention obtains nucleotide sequence type information that can be used to identify chrysanthemum and wild chrysanthemum.
[0057] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.
[0058] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum, characterized in that: The nucleotide sequence of the DNA barcode is a combination of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO:
5.
2. A primer for amplifying the DNA barcode for identifying the original species of chrysanthemum and wild chrysanthemum as claimed in claim 1, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:
2.
3. A method for identifying the original species of chrysanthemum and wild chrysanthemum, characterized in that: The steps include: (1) mVISTA was used to perform global comparison analysis of the chloroplast genomes of chrysanthemum and wild chrysanthemum, and PhyloSuite software was used to detect the degree of nucleotide variation in the chloroplast genomes of chrysanthemum and wild chrysanthemum. Finally, primers were designed using the screened hypervariable region sequences as templates; (2) Validation of species-specific DNA barcodes of chrysanthemum and wild chrysanthemum; Extract genomic DNA from chrysanthemum and wild chrysanthemum samples; Using genomic DNA as a template, PCR amplification is performed using the primers described in claim 2; The amplified products were subjected to electrophoresis and Sanger sequencing. The sequencing data were spliced using Geneious software, and sequence alignment was performed using MEGA 11.0 software. If the nucleotide sequence of the sample is as shown in SEQ ID NO: 3, it is a chrysanthemum sample; If the nucleotide sequence of the sample is as shown in SEQ ID NO: 4 or SEQ ID NO: 5, the sample is a Chrysanthemum indici sample.
4. The method according to claim 3, characterized in that The reaction system of the PCR amplification reaction in step (2) is: 2×Taq MasterMix 12.5μL, 2.5μM upstream and downstream primers 1μL each, DNA template 50ng, add sterile double distilled water to make up the volume to 25μL.
5. The method according to claim 4, characterized in that The PCR amplification reaction procedure is: 94°C, 5 min; 94°C, 30 s, 55°C, 30 s, 72°C, 45 s, 40 cycles; 72°C, 10 min.
6. Use of the DNA barcode according to claim 1 and / or the primers according to claim 2 in preparing origin identification and detection products of chrysanthemum and wild chrysanthemum origin plants, medicinal materials, decoction pieces and Chinese patent medicines.
7. A product for identifying and detecting the origin of chrysanthemum and wild chrysanthemum origin plants, medicinal materials, decoction pieces and Chinese patent medicines, characterized in that: If the nucleotide sequence of the sample is as shown in SEQ ID NO: 3, it is a chrysanthemum sample; If the nucleotide sequence of the sample is as shown in SEQ ID NO: 4 or SEQ ID NO: 5 according to the sequencing results, it is a Chrysanthemum indici sample.