Composition for gene editing and application thereof

Abstract

The invention discloses a composition for gene editing and application thereof. The composition comprises i) a CRISPR / Cas gene editing element and a delivery vector thereof, and ii) a recombinant adeno-associated virus (AAV) vector carrying a target gene, and the target gene comprises at least one selected from the following genes: a blood coagulation factor VIII (F8) gene, an LDLR gene, a TTR gene, a PAH gene, an F9 gene, a PCSK9 gene or an SERPINC1 gene. The composition for gene editing disclosed by the invention can realize efficient gene integration and expression, reduce immune response and increase safety, and is suitable for patients of all ages, so that effective treatment choices are provided for different people.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedicine, and in particular, to a composition for gene editing and its uses. Background Art

[0002] Hemophilia A (HA) is an X-chromosome-linked recessive hereditary hemorrhagic disease, mainly caused by gene mutations or deletions of coagulation factor VIII (FVIII). This disorder is characterized by difficult-to-stop bleeding after spontaneous or minor trauma, often starting in childhood. Repeated joint bleeding can gradually lead to joint movement disorders and disability in patients. In the male population, the incidence of HA is approximately 1 / 5000, while female hemophilia patients are extremely rare.

[0003] Currently, the mainstream clinical treatment method is the replacement therapy of coagulation factor VIII (F8) protein, that is, supplementing the lacking F8 coagulation factor in patients, which is divided into on-demand treatment and prophylactic treatment according to different purposes. The former refers to the replacement therapy given when there is obvious bleeding, aiming to stop bleeding in time; the latter refers to the regular and regular replacement therapy carried out after the first or multiple bleedings to prevent repeated bleeding from causing joint disability in hemophilia patients or life-threatening bleeding again.

[0004] Currently, there are a rich variety of drugs used in clinical treatment of hemophilia A, including long half-life (EHL) coagulation factor products, novel bypass agents, and non-coagulation factor drugs. EHL coagulation factor products extend the in vivo half-life of F8 through technical means. For example, BIVV001 (Efanesoctocog alfa), as the first F8 preparation not restricted by von Willebrand factor (vWF), its long-acting characteristics significantly reduce the dosing frequency and improve bleeding control, and has been approved by the FDA for clinical use. However, it still needs to be repeatedly infused through the intravenous route, there is a risk of inhibitor formation, affecting patient compliance, and the accessibility and cost issues in the market also still need attention.

[0005] Novel bypassing agents such as Eptacog beta bypass the deficiencies of F8 or F9 by directly activating F10, which is an important treatment option for hemophilia patients with inhibitors. Its good hemostatic effect and tolerance have been verified in multiple clinical trials. However, more research is needed to support dose optimization and its performance in special populations such as children and perioperative applications. In terms of non-coagulation factor drugs, Emicizumab significantly reduces the bleeding rate in patients with severe hemophilia A by mimicking the function of F8. Its convenient dosing regimen and good tolerance have brought innovation to prophylactic treatment. However, how to combine hemostatic agents during breakthrough bleeding to balance the risks of bleeding and thrombosis remains a major challenge in the application of this drug. Due to the mechanism of action of non-factor drugs, the long-term deficiency of physiological coagulation factors in patients may have a potential impact on bone and joint health. Therefore, such patients need regular follow-up and close monitoring to prevent joint lesions. New-generation F8 function-mimicking drugs such as Mim8 show higher potency and are undergoing early clinical trials. In addition, hemostatic rebalancing therapies such as TFPI, AT, and PS inhibitors provide innovative treatment ideas. Some drugs such as Concizumab and Fitusiran have entered late-stage clinical trials and show good efficacy and safety, but the risk of thromboembolic events still needs to be carefully evaluated.

[0006] In summary, traditional drug treatments still have multiple limitations in dealing with hemophilia, including the short duration of treatment, potential safety hazards, patient compliance issues, and high treatment costs. Gene therapy, by persistently expressing coagulation factors in vivo, can significantly improve these deficiencies and demonstrate greater application potential and clinical advantages.

[0007] Different from traditional therapies, gene therapy enables the body to continuously produce coagulation factors, achieving the effect of curing the disease. Factor VIII is a secreted protein mainly expressed in vascular endothelial cells of the liver. To achieve a cure, the expression element of the F8 gene needs to be effectively delivered into the body and ectopically expressed in appropriate cells. Adeno-associated virus (AAV), as the main gene therapy vector, can achieve persistent F8 expression by delivering the F8 gene expression element, thus achieving the effect of curing HA.

[0008] The first-generation gene therapy for hemophilia A using an AAV vector to overexpress factor VIII has entered the clinical trial stage and achieved certain therapeutic effects. In 2023, BioMarin launched the first gene therapy product for hemophilia A, with a cost as high as $2.9 million. However, follow-up data showed that over time, the FVIII activity level in patients continued to decline, with a maximum decline of 80%. Moreover, studies have shown that strong promoter or enhancer fragments carried by AAV may integrate near proto-oncogenes, posing a risk of tumorigenesis. In the case of pediatric patients, the loss of the vector due to hepatocyte division leads to a continuous decrease in FVIII levels. Therefore, only by achieving site-specific integration of the FVIII gene can HA patients of all ages be effectively cured.

[0009] The second-generation gene therapy products for hemophilia use AAV vectors to deliver CRISPR gene editing elements, target the albumin gene (ALB) locus for gene editing, and at the same time use AAV vectors to deliver exogenous FVIII templates, which are inserted at the double-strand break sites to achieve efficient expression and secretion of FVIII. This scheme uses AAV to introduce editing elements, and the persistent expression of Cas9-sgRNA poses a risk of continuous genome cleavage and may cause off-target events. In addition, studies have found that pre-existing neutralizing antibodies against the Cas9 protein and T cell memory exist in more than half of the human population (Charlesworth et al., Nat Med., 2019). These pre-existing immune responses may prevent drug delivery, trigger acute inflammation, cause the human immune system to initiate the destruction of edited cells, and reduce the editing efficiency.

[0010] In summary, although existing alternative therapies and gene therapy technologies have to some extent addressed the treatment needs of hemophilia A, there is still room for improvement in the long-term persistence of therapeutic effects, safety, and economic feasibility, and the needs of patients have not been fully met. There is a need to develop safer and more efficient gene therapy regimens to ensure the health of patients and the long-term stability of therapeutic effects. Summary of the Invention

[0011] Technical problems to be solved:

[0012] One aspect of the present invention provides a composition for gene editing, aiming at the disadvantages of existing gene therapies such as the risk of tumorigenesis and off-target events of CRISPR / Cas gene editing.

[0013] Specifically, the inventors of the present invention adopted the technical scheme of separately delivering CRISPR / Cas gene editing elements (for example, delivering using lipid nanoparticles (LNPs), etc.) and combining with AAV vectors to introduce editing templates of target pathogenic genes, and solved the following problems existing in the prior art:

[0014] (1) Reduce long-term treatment costs and improve quality of life: Compared with the high annual cost of hundreds of thousands of yuan for traditional alternative therapies, gene therapy can achieve a one-time treatment effect. In the long run, it can significantly reduce the treatment cost for patients. Patients no longer need to receive frequent infusions of clotting factors, and their quality of life will be significantly improved.

[0015] (2) Suitable for patients of all ages: By separately delivering CRISPR / Cas editing elements to mediate the site-specific integration of exogenous pathogenic gene templates in the genome, the inventor reduces the risk of tumorigenesis and prevents off-target events of CRISPR gene editing. Therefore, it is not limited to adult patients and also provides the possibility of treatment for pediatric patients.

[0016] (3) Safe integration of the F8 gene: When the target gene is the F8 gene, compared with the first-generation hemophilia gene therapy delivering the self-starting AAV-BDDF8 vector, the AAV-BDDF8 editing template delivered in one embodiment of the present disclosure does not carry promoter and enhancer elements. This means that even if random integration of the AAV vector occurs, it will not trigger the malignant amplification of hepatocytes, ensuring the safety of long-term treatment.

[0017] (4) Reduce immune response: In one embodiment of the present disclosure, the mRNA delivered by LNP has a short half-life in cells, which significantly shortens the expression time of the CRISPR-Cas9 editing element and avoids the long-term presence of Cas9 protein in the body, thereby minimizing the patient's immune response to Cas9.

[0018] (5) Efficient ectopic F8 expression: When the target gene is the F8 gene, in one embodiment of the present disclosure, through the CRISPR-Cas9 technology, the F8 gene can be efficiently and safely inserted into a specific gene locus of hepatocytes, thereby achieving long-term stable expression of F8 and ultimately curing hemophilia A.

[0019] (6) In one embodiment of the present disclosure, by introducing liver-targeting lipids (mannose lipid and glycocholic acid lipid) into the LNP delivery system, the targeting efficiency of gene therapy in the liver is significantly improved. This strategy not only improves the gene editing efficiency but also reduces the toxic and side effects on non-target organs, thereby enhancing the safety and effectiveness of the treatment.

[0020] Technical solution:

[0021] A composition for gene editing, the composition comprising:

[0022] i) CRISPR / Cas gene editing elements and their delivery vectors, and

[0023] ii) a recombinant adeno-associated virus (AAV) vector carrying a target gene

[0024] Among them, the target gene includes at least one selected from the following genes: coagulation factor VIII (F8) gene, LDLR gene, TTR gene, PAH gene, F9 gene, PCSK9 gene or SERPINC1 gene.

[0025] In some embodiments, by using the combination in the technical solution of the present disclosure, editing of multiple key genes for the above-mentioned multiple diseases can be achieved, so as to repair the above genes and simultaneously reduce risks such as off-target effects. Among them,

[0026] (1) Clinical relevance of LDLR (low-density lipoprotein receptor): The LDLR gene is closely related to hypercholesterolemia. Especially in familial hypercholesterolemia, defects in LDLR lead to the accumulation of LDL cholesterol, thereby increasing the risk of cardiovascular diseases. By editing the LDLR gene with CRISPR, its function can be restored, thereby reducing cholesterol levels and reducing the occurrence of cardiovascular diseases.

[0027] (2) Clinical relevance of TTR (transthyretin): Mutations in the TTR gene cause transthyretin amyloidosis (ATTR), a fatal genetic disease. TTR mutations cause abnormal accumulation of proteins in the body, affecting organ function, especially the heart and nervous system. Restoring TTR function through gene editing helps treat this fatal disease.

[0028] (3) Clinical relevance of PAH (phenylalanine hydroxylase): Mutations in the PAH gene cause phenylketonuria (PKU), a metabolic disorder that leads to the accumulation of phenylalanine, causing damage to the brain and nervous system. Repairing PAH through gene editing can effectively treat phenylketonuria and avoid its long-term nerve damage.

[0029] (4) Clinical relevance of F9 (coagulation factor IX): Mutations in the F9 gene cause hemophilia B, a genetic disease related to blood coagulation, manifested as continuous bleeding. Repair of the F9 gene can restore coagulation function and provide a treatment plan for patients with hemophilia B. Hemophilia B is very similar to hemophilia A (mutation in the F8 gene), and F9 gene editing is also applicable to gene therapy.

[0030] (5) Clinical relevance of PCSK9 (proprotein convertase subtilisin / kexin type 9): The PCSK9 gene plays an important role in cholesterol metabolism. Inhibition of PCSK9 can effectively reduce the level of low-density lipoprotein cholesterol (LDL-C) in the blood and reduce the occurrence of cardiovascular diseases. Editing the PCSK9 gene with CRISPR technology can provide a new direction for the treatment of cardiovascular diseases.

[0031] (6) Clinical relevance of SERPINC1 (serpin family C member 1): Antithrombin deficiency caused by SERPINC1 gene mutation is one of the main causes of deep vein thrombosis and pulmonary embolism. Repairing the SERPINC1 gene through gene editing can effectively prevent and treat thrombotic diseases caused thereby.

[0032] The combination delivery system in the technical solution of the present disclosure can perform gene editing on known sites of the above-mentioned multiple genes (such as LDLR-Exon4, TTR-Exon4, PAH-Exon7, F9-Exon1, etc.), with relatively high gene editing efficiency and no off-target events detected.

[0033] Further, in one embodiment, the above target gene may be the coagulation factor VIII (F8) gene.

[0034] In the present disclosure, the delivery vector of the CRISPR gene editing element described in i) can be any suitable delivery vector. In some embodiments, the above delivery vector may be at least one selected from lipid nanoparticles, gold nanoparticles, adeno-associated virus vectors, lentiviral vectors, adenoviral vectors, cationic polymers, dendrimers, exosomes or virus-like particles.

[0035] Further, in one embodiment, the above delivery vector may be lipid nanoparticles.

[0036] Further, in some embodiments, the above lipid nanoparticles can target liver cells. The lipid nanoparticles can be targeted to liver cells by using techniques known in the art. For example, ligand modification (such as N-acetylgalactosamine modification, mannosyl lipid modification, glycocholic acid lipid modification, etc.), antibody or peptide conjugation, LNP component optimization (such as ionizable lipid design, PEGylated lipid regulation, etc.), helper lipid replacement, SORT technology, LNP particle size and surface charge adjustment, protein corona engineering, nanoparticle pre-clearance strategy, etc. In one embodiment, the surface of the above lipid nanoparticles can be modified with liver cell-specific ligands. Thereby helping the lipid nanoparticles to target liver cells.

[0037] In the present disclosure, the CRISPR gene editing element described in i) can be a suitable CRISPR gene editing element known in the art. In some embodiments, the above CRISPR gene editing element may include the mRNA of Cas nuclease and sgRNA.

[0038] Further, in some embodiments, the above-mentioned Cas nuclease is selected from: Cas9 protein and its variants, Cas12a (Cpf1), Cas12e (CasX), Cas12b1 (C2c1), Cas12b2, Cas12c (C2c3), C2c4, C2c8, C2c5, C2c10, C2c9, Cas13a (C2c2), Cas13d, Cas13c (C2c7) or Cas13b (C2c6).

[0039] Further, in some embodiments, the above-mentioned Cas nuclease can be SpCas9 and / or SaCas9.

[0040] To better achieve the object of the present disclosure, in some embodiments, the above-mentioned adeno-associated virus vector may not contain a promoter and / or an enhancer.

[0041] In some embodiments, the above-mentioned target gene is the coagulation factor VIII gene, and the coagulation factor VIII gene is integrated at at least one of the following sites in the hepatocyte genome: Alb site, TTR site, ApoE site, CYP3A4 site or G6PC site.

[0042] Another aspect of the present disclosure is to provide the use of the above-mentioned composition in the preparation of a medicament for treating hemophilia A.

[0043] Another aspect of the present disclosure is to provide a pharmaceutical composition, which includes the above-mentioned composition for gene editing and a pharmaceutically acceptable carrier.

[0044] Beneficial effects:

[0045] The composition for gene editing in the present invention can achieve efficient gene integration and expression, reduce the immune response, increase safety, and is applicable to patients of all ages, thus providing an effective treatment option for different populations. Description of the drawings

[0046] Figure 1 It is a schematic diagram of the preparation process of LNP in the embodiments of the present disclosure. Using a microfluidic method, a solution containing CRISPR editing elements (such as sgRNA, Cas9 mRNA) and target gene mRNA (such as GFP mRNA, Luc mRNA) is mixed with lipids to form LNP nanoparticles. This LNP system contains components such as ALC-0315, cholesterol, DSPC, and DOPE to ensure efficient liver-targeted delivery and good stability. The final product is dialyzed to remove free components and then used for downstream experiments;

[0047] Figure 2This is the particle size distribution measurement result graph of the LNP particles in the embodiments of the present disclosure. Dynamic light scattering (DLS) analysis shows that the LNP particle sizes of different formulations are uniform, distributed around 100 - 150 nm, indicating that the preparation of LNP has high repeatability and stability;

[0048] Figure 3 This is the encapsulation efficiency result graph of different target gene sites in the embodiments of the present disclosure. By optimizing the LNP formulation, high-efficiency CRISPR sgRNA encapsulation efficiency has been achieved, and the target sites include Alb-Exon2, LDLR-Exon4, TTR-Exon4, PAH-Exon7, F9-Exon1, PCSK9-Exon1, and SERPINC1-Exon3;

[0049] Figure 4 This is the verification result graph of the transfection effect of GFP mRNA in the embodiments of the present disclosure. Flow cytometry shows that HEK293T cells successfully express GFP after LNP delivers GFP mRNA, and compared with the wild-type (WT) control group, the transfected group has significant fluorescence signals (FITC / APC double positive);

[0050] Figure 5 This is the in vivo fluorescence imaging verification result graph of LNP delivering Luc mRNA in the embodiments of the present disclosure. After injecting LNP-encapsulated GFP-Luc mRNA into mice, significant fluorescence signals are detected by in vivo imaging technology, verifying the high efficiency of the LNP delivery system in vivo;

[0051] Figure 6 This is the statistical graph of gene editing efficiency in the embodiments of the present disclosure, showing the Indel (insertion-deletion mutation) rates of different targeting sites. Among them, the abscissa is different target sites, and the ordinate is the percentage of editing efficiency. The data indicate that the LNP delivery system has high editing efficiency at different sites;

[0052] Figure 7 This is the off-target event detection result graph detected by high-throughput sequencing at specific target sites (such as Pcsk9-Exon1 and Serpinc1-Exon3) in the embodiments of the present disclosure. The sequence alignment graph of each gene editing site shows the characteristics of the editing position, the mutation positions are marked with different colors, and the corresponding read counts are listed. The detection results show that all gene editing events occur at the target sites, and no off-target events are detected;

[0053] Figure 8This is the time flow chart of gene editing by AAV8-BDDF8 and LNP-SpCas9 systems in mice in the embodiments of the present disclosure. The figure shows that at week 0, mice were injected with LNP-encapsulated SpCas9 mRNA and sgRNA. The AAV8-BDDF8 vector was injected in the first 2 weeks (-2w). Since week 1, blood samples were collected every 1 or 2 weeks for the detection of gene expression and editing effects. Mice were sacrificed at week 8 and liver genomic DNA was extracted for further analysis;

[0054] Figure 9 This is a schematic diagram of the targeted integration of the AAV8-BDDF8-N6 vector into the Alb gene locus of mice. Among them, AAV8-BDDF8 contains the BDDF8 gene driven by the SA85 promoter and linked to the P2A sequence and N6 tag, with a PolyA tail at the end, and the integration position is in the E13 intron region;

[0055] Figure 10 This is a schematic diagram of the expression at the DNA, mRNA and protein levels after gene editing in the embodiments of the present disclosure. Among them, after gene integration, mRNA containing Alb and BDDF8 is generated, and after translation, Alb and BDDF8 proteins are produced by self-cleavage of P2A, with an N6 tag at the end to ensure the expression of BDDF8 at the protein level;

[0056] Figure 11 This is a graph showing the detection results of F8 activity at different time points in hemophilia A mice after receiving LNP-delivered SpCas9 mRNA and sgRNA treatment. Among them, the vertical axis represents the percentage of F8 activity relative to the normal level, and the horizontal axis is different periods after LNP injection. The data show that the F8 activity is significantly increased after treatment;

[0057] Figure 12 This is a graph showing the results of high-throughput sequencing detection of gene editing at the ALB-Intron13 target site. Among them, each sequence alignment graph shows the mutation situation of the editing site. All detected gene editing events occurred at the target site, and no off-target events were detected;

[0058] Figure 13 This is a graph showing the detection results of liver function biochemical indexes (including ALB, AST, ALT, TBIL and UREA) of mice in the treatment group and the control group in the embodiments of the present disclosure. The results show that there is no significant difference (ns) in each index between the two groups, indicating that the LNP and AAV combined delivery system has no obvious adverse effect on the liver function of mice;

[0059] Figure 14This is a histological examination result diagram of liver tissues in the embodiments of the present disclosure, which respectively shows liver tissue sections of mice in the untreated group and the LNP-AAV combined delivery treatment group. The results show that the tissue structures of the two groups are normal and there are no obvious pathological changes, further indicating the safety of this delivery system.

[0060] Sequence description.

[0061]

[0062] Detailed implementation manners

[0063] The present invention discloses a composition for gene editing and its uses. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. And relevant personnel can obviously make changes or appropriate alterations and combinations to the content described in this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0064] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise clearly indicated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "having" etc. will be understood to include the stated elements or components, without excluding other elements or other components. The term "a" (or "an") includes plural referents. The term "plural" means two or more. Terms such as "such as", "for example" etc. are intended to indicate exemplary embodiments and are not intended to limit the scope of the present disclosure.

[0065] In the present disclosure, when a value range is provided, it should be understood that unless otherwise clearly indicated by the context, the endpoints are included in the range and each intermediate value between the upper and lower limits of the range and any other specified value or intermediate value within the specified range and any value within the smaller range between the specified values are all covered.

[0066] In the present disclosure, the term "about" generally means a variation within a range of 0.5% - 10% above or below the specified value, for example, within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.

[0067] In this disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those of ordinary skill in the art. Definitions of common terms in molecular biology can be found in Lewin’s GENES, Twelfth Edition, Jocelyn E. Krebs, Elliott S. Goldstein, Stephen T. Kilpatrick, published by Jones & Bartlett Learning. Definitions of common terms in biochemistry can be found in Lehninger Principles of Biochemistry, Eighth Edition, David L. Nelson, Michael M. Cox, published by W. H. Freeman. Definitions of common terms in cell biology can be found in Molecular Biology of the Cell, Sixth Edition, Bruce Alberts, Alexander Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter, published by Garland Science. Definitions of common terms in genetics can be found in Genetics: Analysis of Genes and Genomes, Eighth Edition, Daniel L. Hartl, Maryellen Ruvolo, published by Jones & Bartlett Learning.

[0068] Unless otherwise specified, experimental techniques herein employ conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, which can be found in standard books such as: Molecular Cloning: A Laboratory Manual; Cell Biology: A Laboratory Handbook, etc.

[0069] Term:

[0070] One or more components of the term "CRISPR / Cas" system can be used as nucleotide-binding components in the system. The nucleotide-binding molecule can be a Cas protein, a fragment thereof, or a mutant form thereof. The Cas protein may have reduced nuclease activity or no nuclease activity, and has (i) programmable binding of nucleic acids to the target DNA, and (ii) the ability to nick the target DNA sequence on one strand. The Cas / Cas protein / Cas nuclease described in this disclosure includes the CRISPR Cas9 protein and its variants, as well as equivalents of Cas9 such as Cas12a (Cpf1), Cas12e (CasX), Cas12b1 (C2c1), Cas12b2, Cas12c (C2c3), C2c4, C2c8, C2c5, C2c10, C2c9, Cas13a (C2c2), Cas13d, Cas13c (C2c7), or Cas13b (C2c6). In some embodiments, the guide RNA of the target gene can be designed and synthesized using methods in the prior art. To better achieve the objectives of this disclosure, in some other embodiments, the sequences of the sgRNA designed for the target gene are shown in SEQ ID No. 1-11. The above sgRNA can more effectively complete the editing of the target gene.

[0071] The term "gene editing element" refers to a nucleic acid sequence that is essential or non-essential during gene editing, and is the core tool for achieving precise modification of the genome, which can be transported to the target cell through a delivery vector. Depending on the technical type (such as CRISPR, ZFN, TALEN, etc.) and functional requirements, the composition of the gene editing element is different. In this disclosure, the gene editing element refers to the gene editing element of the CRISPR / Cas gene editing system. In some embodiments, the gene editing element includes: the mRNA sequence of a nuclease (such as Cas9, Cas12a, Cas13), the sgRNA sequence, and the PAM sequence. In some other embodiments, the gene editing element may further include at least one selected from the following elements: donor DNA template, reporter system (for example, fluorescent label (such as GFP), selection marker (such as antibiotic resistance gene), etc.), base editor (Base Editor, for example, deaminase (such as APOBEC1, TadA), Cas protein variant (such as nCas9, dCas9), etc.), prime editor (Prime Editor, for example, reverse transcriptase (such as M-MLV RT), pegRNA, etc.), epigenetic editor (for example, fusion methylase (such as DNMT3A), deacetylase (such as HDAC), etc.).

[0072] In some embodiments, the nuclease in the above gene editing element can be SpCas9 and / or SaCas9. SpCas9 (derived from Streptococcus pyogenes) and SaCas9 (derived from Staphylococcus aureus) are two widely used Cas9 nucleases in CRISPR gene editing. Structurally, SpCas9 consists of 1368 amino acids (about 160 kDa), while SaCas9 is smaller, containing only 1053 amino acids (about 120 kDa). This size difference directly determines their delivery compatibility: the coding gene of SpCas9 is relatively long (about 4.2 kb), which is difficult to be completely loaded into an adeno-associated virus (AAV) vector (the capacity upper limit is about 4.7 kb), and often needs to be split or a dual-vector system is used; while the SaCas9 gene is only about 3.2 kb, which can be packaged into AAV with a single vector and becomes the preferred tool for in vivo gene therapy, such as treating hereditary retinal diseases or transthyretin amyloidosis through AAV delivery. In terms of functional characteristics, their recognition requirements for the PAM sequence are different. SpCas9 strictly depends on NGG as the PAM, and the target selection is limited by the distribution of NGG in the genome; while the PAM recognized by SaCas9 is more relaxed (NNGRRT, the actual effective form is NGRRN), and the target coverage range is expanded by about 2 times, especially having advantages in GC-rich regions. In addition, SaCas9 naturally has high specificity, and the off-target risk is lower than that of SpCas9, and the latter often needs to be engineered (such as high-fidelity variants eSpCas9 or HypaCas9) to improve precision. In some embodiments, the mRNA sequence of the above SpCas9 is shown as SEQ ID No.12, and the mRNA sequence of the above SaCas9 is shown as SEQ ID No.13.

[0073] The term "delivery vector" in the present disclosure refers to a vehicle (vehicle or vector) that transports CRISPR / Cas gene editing elements to the surface or inside target cells. CRISPR delivery vectors are divided into two major categories: viral and non-viral. In some embodiments, the delivery vector can be at least one selected from lipid nanoparticles, gold nanoparticles, adeno-associated virus vectors, lentiviral vectors, adenovirus vectors, cationic polymers, dendrimers, exosomes or virus-like particles.

[0074] An LNP formulation capable of efficiently targeting and delivering to liver cells:

[0075] The liver is the most important metabolic organ in the body, and the surface of hepatocytes is rich in low-density lipoprotein receptors (LDLR). The surface modification of LNP enables it to bind efficiently to LDLR, promoting the entry of LNP into hepatocytes through LDLR-mediated endocytosis. Therefore, after in vivo injection, LNP can be preferentially delivered to hepatocytes through liver-specific receptor-mediated action. In some embodiments, the composition for gene editing of the present disclosure includes an LNP complex capable of efficiently targeting and delivering hepatocytes. This complex contains LNP and an operably linked CRISPR / Cas gene editing element.

[0076] To achieve the targeted delivery of lipid nanoparticles (LNP) to hepatocytes, it is necessary to synergistically optimize its composition, physical properties, and surface functionalization design through a multi-dimensional strategy. One of the core strategies is ligand modification. For example, coupling N-acetylgalactosamine (GalNAc) to the surface of LNP, which can specifically bind to the asialoglycoprotein receptor (ASGPR) highly expressed on the surface of hepatocytes, significantly improves the hepatocyte uptake efficiency (see Chenshuang Zhang et al. Prevent and Reverse Metabolic Dysfunction-Associated Steatohepatitis and Hepatic Fibrosis via mRNA-Mediated Liver-Specific Antibody Therapy. ACS Nano 2024, 18, 50, 34375–34390). In addition, the coupling of antibodies (such as anti-ASGPR antibodies) or targeting peptides (such as SP94 peptides) can also enhance the binding ability of LNP to hepatocytes. For example, hyaluronic acid-modified LNP can target liver fibrosis cells overexpressing CD44 and inhibit the fibrosis process (see Chen Guo et al. Emerging nanomedicine strategies for hepatocellular carcinoma therapy. iMetaOmics 04 July 2024).

[0077] In one embodiment, the inventors added mannosyl lipids and glycocholic acid lipids during the preparation of LNP, which can enhance the stability and targeting of LNP through the mediation of mannose receptors and bile acid transporters on the surface of hepatocytes, significantly improving the uptake efficiency of LNP in hepatocytes and contributing to the safety and efficacy of gene therapy. LNP releases mRNA or DNA into the cytoplasm by fusing with the cell membrane and rupturing the endosomal membrane. The cationic lipids in LNP can be charged in an acidic environment, forming a complex with nucleic acids, promoting the stability and efficiency during the delivery process.

[0078] The term "adeno-associated virus vector" (AAV vector) refers to any vector that contains or is derived from adeno-associated virus components and is capable of infecting mammalian cells (preferably human cells). AAV vectors generally refer to AAV-type virus particles (virions) carrying a payload, which can be constructed based on various serotypes, including serotype combinations, or in different genomic forms (e.g., single-stranded or self-complementary). In addition, AAV vectors can be replication-deficient and / or targeting. In some embodiments, the above-mentioned adeno-associated virus vectors include: AAV type 1, AAV type 2, AAV type 3 (including subtypes 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh8, AAVrh10, AAVrh.74, as well as snake-derived AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, caprine AAV, shrimp AAV, etc. In addition, it also includes the AAV serotypes and their branches reported by Gao et al. (Journal of Virology 78:6381, 2004) and Moris et al. (Virology 33:375, 2004), and all other known AAV types (see Chapter 69, Volume 2 of Virology, 4th Edition, Lippincott-Raven Publishers, edited by Fields et al.). In some embodiments, the above-mentioned AAV vectors include derivatives of known AAV vectors or modified / artificially designed AAV vectors.

[0079] Pharmaceutical composition:

[0080] In some embodiments, the pharmaceutical composition provided by the present disclosure includes: a) the above-mentioned composition for gene editing; b) a pharmaceutically acceptable carrier; c) optionally including diluents, excipients, buffers, preservatives, antioxidants, enzyme inhibitors; d) optionally including other therapeutic agents.

[0081] In some embodiments, for injection, the above-mentioned carrier is usually liquid. For other administration methods, the carrier can be solid or liquid, such as sterile pyrogen-free water or sterile pyrogen-free phosphate-buffered saline solution. For inhalation administration, the carrier is breathable and preferably in the form of solid or liquid particles. As an injection medium, water containing common additives for injection solutions is preferably used, such as stabilizers, salts or saline and / or buffers.

[0082] Examples:

[0083] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below in conjunction with specific embodiments.

[0084] Example 1: Preparation of the composition.

[0085] 1. In vitro transcription and purification of SpCas9 / SaCas9 mRNA.

[0086] Using the plasmids shown in SEQ ID No. 14 and SEQ ID No. 15 as template sequences, transcription was carried out using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) in vitro transcription kit. During transcription, the modified mRNA was synthesized by completely replacing uridine with N1-methylpseudouridine-5'-triphosphate (Trilink Biotechnologies). At the same time, Trilink Reagent AG (Trilink Biotechnologies) was used to cap the mRNA to form a Cap-1 structure, and a poly(A) tail with a length of approximately 90 nucleotides was added. The synthesized mRNA was purified by RNA Cleanup Kit (New England Biolabs) kit, and its concentration was determined by a Nanodrop instrument, and the purity was determined by gel electrophoresis analysis.

[0087] 2. sgRNA sequence and synthesis.

[0088] Design sgRNAs targeting intron 13 of the mouse Alb gene (sgAlb-Intron13, TAAACTGTTGTTAGGCCAT), intron 3 of the TTR gene (sgTRR-Intron3, TATCACCGGAAAGAACAAGCCGG), intron 2 of the ApoE gene (sgApoE-Intron2, GTCTCGGCTCTGAACTACATAGG), intron 4 of the CYP3A4 gene (sgCYP3A4-Intron4, TGCCATTTTTTTCAGTCCTA), intron 3 of the G6PC gene (sgG6PC-Intron3, AAGTCATCTAGACTTGCATA), exon 4 of the LDLR gene (sgLDLR-Exon4, GTCACAGACCCAGCTGCGA), exon 4 of the TTR gene (sgTTR-Exon4, CCCATACTCCTACAGCACCA), exon 7 of the PAH gene (sgPAH-Exon7, AAGAATGATACTTACGGTTC), exon 1 of the F9 gene (sgF9-Exon1, GAAGCACCTGAACACCGTCA), exon 1 of the PCSK9 gene (sgPCSK9-Exon1, GGCTGATGAGGCCGCACATG), and exon 3 of the SERPINC1 gene (sgSERPINC1-Exon3, GTGCATTTACCGCTCCCCT) using the CHOPCHOP website. The above sgRNA sequences were synthesized to obtain sgRNAs for experiments.

[0089] 3. Packaging and parameter characterization of liposome nanoparticles LNP.

[0090] The prepared SpCas9 mRNA and sgRNA were pre-dissolved in a 50 mM sodium citrate solution with a pH of 4. The lipid components included ALC-0315 (molar ratio 30% - 60%), cholesterol (molar ratio 30% - 60%), DSPC (molar ratio 5% - 20%), DOPE (molar ratio 5% - 20%), DMG-PEG2000 (molar ratio 0.5% - 4%), and mannosyl lipid / glycocholic acid lipid (molar ratio 2% - 20%). These lipid components were all dissolved in absolute ethanol. According to the N / P ratio (the charge ratio of nucleic acid to cationic lipid) of 6 and the required nucleic acid mass, the various lipid components were mixed as the oil phase, and the sodium citrate solution containing the nucleic acid was used as the water phase. Through microfluidic pump and microfluidic chip technology, precise mixing and self-assembly of the oil phase and water phase were achieved, and the flow rate ratio was controlled between 1:2 and 1:4, thus efficiently preparing liposome nanoparticles encapsulating SpCas9 mRNA and sgRNA. Subsequently, dialysis was performed using a Biotech Grade Cellulose Ester (CE) Dialysis Membrane (Spectrum lab) with a molecular cut-off of 300 kDa, and the dialysis buffer was 1xPBS for 3 h. Finally, the LNP was filtered through a Filter Unit (Millipore) with a pore size of 0.22 μm. The schematic diagram of the LNP preparation process is shown in Figure 1 Figure [].

[0091] The average particle size, polydispersity index (PDI), and zeta potential of the LNP were measured using dynamic light scattering technology with a Zetasizer Nano (Malvern Instruments, Malvern, UK). The encapsulation efficiency of LNP mRNA was determined using the Quant-iT TM RiboGreen TM RNA Assay Kit (Thermo Fisher Scientific, Waltham, MA). The result graph of the particle size distribution measurement of the LNP particles is shown in Figure 2 Figure []. Dynamic light scattering (DLS) analysis showed that the LNP particles with different formulations had a uniform particle size, distributed around 100 - 150 nm, indicating high repeatability and stability in the preparation of LNP.

[0092] The results of the encapsulation efficiency at different target gene sites are shown in Figure 3As shown. The results indicate that through optimizing the LNP formulation, efficient encapsulation efficiency of CRISPR sgRNA was achieved, with target sites including Alb-Exon2, LDLR-Exon4, TTR-Exon4, PAH-Exon7, F9-Exon1, PCSK9-Exon1, and SERPINC1-Exon3.

[0093] The transfection effect of the LNP formulation was verified by transfecting HEK293T cells with GFP mRNA. The results are as Figure 4 shown. Flow cytometry showed that HEK293T cells successfully expressed GFP after LNP-mediated delivery of GFP mRNA, and there were significant fluorescence signals (FITC / APC double positive) in the transfection group compared with the wild-type (WT) control group.

[0094] The delivery effect of the LNP formulation was verified by in vivo fluorescence imaging using LNP-mediated delivery of Luc mRNA. The results are as Figure 5 shown. The results indicate that after injecting LNP-encapsulated GFP-Luc mRNA into mice, significant fluorescence signals were detected by in vivo imaging technology, verifying the high efficiency of the LNP delivery system in vivo.

[0095] The results of using LNP to package SpCas9 mRNA and sgRNA for in vivo gene editing targeting multiple gene loci are as Figure 6 、 7 shown. The results indicate that the LNP delivery system in this example has high editing efficiency at different sites, and all gene editing events occurred at the target sites, and no off-target events were detected.

[0096] 4. Packaging of AAV8-BDDF8-Donor.

[0097] Pack the AAV8-BDDF8-Donor vector using the method described in Zhang, J.P. et al. Curing hemophilia A by NHEJ-mediated ectopic F8 insertion in the mouse. Genome Biol 20, 276, doi:10.1186 / s13059-019-1907-9 (2019). In this prior art, the transfection conditions, plasmid composition, culture, and purification steps in the packaging process of the AAV8-BDDF8-Donor vector have been elaborated in detail. To maintain consistency and accuracy with the original text, the relevant methods in this article are directly cited in this experiment, including but not limited to PEI-based transfection, plasmid ratio and usage, medium replacement, addition of Benzonase and NaCl, collection and clarification of the supernatant, and subsequent concentration and purification steps, so as to obtain the packaged AAV8-BDDF8-Donor. The AAV8-BDDF8-N6 Donor plasmid sequence is shown in SEQ ID No. 16.

[0098] Through the steps 1 to 4 above, the composition described in this example was obtained.

[0099] Example 2: Effect verification.

[0100] 1. Intravenous injection into the tail vein of hemophilia A mice.

[0101] Hemophilia A (HA) mice (129×B6 mice carrying a knockout of exon 16 of the F8 gene) were purchased from Jackson Laboratory (Bar Harbor, ME). These experimental mice were initially constructed by Dr. H. Kazazian (University of Pennsylvania). The mice were housed in the National Key Laboratory of Blood and Health. Animal experiments were conducted in accordance with the protocol approved by the Institutional Animal Care and Use Committee of SKLEH. The basic method of tail vein injection is to dissolve the AAV8-BDDF8-Donor prepared in Example 1 in sodium lactate Ringer's solution equivalent to 10% of the mouse body weight and inject it into 5- to 8-week-old HA mice from the tail vein within 5-6 s. The injection dose is 2E+12 vg / kg. Two weeks later, the LNP-SpCas9 mRNA-sgRNA prepared in Example 1 was injected again at a total RNA dose of 1 mg / kg. To prevent bleeding, 0.5 IU of F8 protein (Xyntha; Wyeth Pharmaceuticals) was intravenously injected into each mouse simultaneously with AAV / LNP.

[0102] 2. Immunosuppression.

[0103] For short-term immunosuppressive therapy, cyclophosphamide (50 mg / kg / time) and / or methylprednisolone (50 mg / kg / time) were intraperitoneally injected on the day of AAV injection. The immunosuppressive regimen was once a week for 3 consecutive weeks (4 times in total).

[0104] 3. Blood collection and plasma separation from mice.

[0105] Mouse plasma was separated by tail vein blood collection. Prepare 1.5 mL EP tubes before blood collection, and add 10 μL of 3.2% sodium citrate solution (i.e., 1:9) in advance as an anticoagulant. Gently cut the tail vein with a blade, and use a pipette to draw the required blood volume (100 μL). After the blood sample collection, use hemostatic powder (MiracleCorp) to stop the bleeding at the mouse wound. The blood sample was centrifuged at 2000×g at 25 °C for 20 min, and the supernatant was the plasma, which was transferred to a new test tube, immediately frozen on dry ice, and stored at -80 °C. Immediately before measuring the F8 biological activity, the plasma sample was rapidly thawed at 37 °C.

[0106] The experimental verification of the time course and mechanism of gene editing of the AAV8-BDDF8 and LNP-SpCas9 systems prepared in this example in mice. The experimental time course is as Figure 8 shown. The schematic diagram of the AAV8-BDDF8-N6 vector targeting and integrating into the Alb gene locus of mice is as Figure 9 shown. The expression levels at the DNA, mRNA, and protein levels after gene editing are as Figure 10 shown.

[0107] 4. Detection of F8 activity.

[0108] The coagulation activity of F8 was measured using the Sysmex CA1500 system (Sysmex, Kobe, Japan). Siemens reagents (Siemens; Marburg, Germany) include Dade Actin activated cephaloplastin reagent (Siemens; B4218-1) and factor VIII-deficient plasma (Siemens; OTXW17). Mouse plasma samples were diluted 4-fold with Dade Owren’s Veronal Buffer (Siemens; B4234-25). The F8 activity assay was performed by adding 5 μl of the sample to be tested + 45 μl of OV Buffer + 50 μl of F8-deficient plasma + 50 μl of aPTT reagent, incubating at 37 °C for 2 min; adding 50 μl of 25 mM calcium chloride to start coagulation; measuring the clot formation time using the Sysmex CA1500 system; preparing a standard curve by diluting human standard plasma (Siemens), and normal mouse plasma as a positive control. The results are as Figure 11As shown. The results showed that the activity of F8 was significantly increased after treatment.

[0109] 5. Analysis of liver injury markers.

[0110] Blood was collected from the orbital cavity of mice. After the blood samples coagulated naturally at room temperature for 1 hour, they were centrifuged at 2000×g at 25°C for 20 minutes. The upper-layer serum was aspirated and transferred to a new test tube, and immediately stored at -80°C. The serum was rapidly thawed at 37°C immediately before detection. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), and bilirubin levels were measured using a diagnostic kit (Beckman Coulter, Inc. Teco Diagnostics). Serum ALT, AST, albumin, and total bilirubin were measured using Olympus AU5400 (IDEXX Memphis, TN). The results were as Figure 12 shown. The results showed that there were no significant differences (ns) in each index between the two groups, indicating that the LNP and AAV combined delivery system had no obvious adverse effects on the liver function of mice.

[0111] 6. Paraffin section and HE staining of liver tissue.

[0112] The freshly dissected liver was fixed in 4% paraformaldehyde for 48 hours, followed by dehydration treatment. The water was replaced successively with gradient ethanol solutions, the ethanol was removed by xylene, and the tissue samples were impregnated in molten paraffin to embed them in paraffin blocks. After the paraffin solidified, the paraffin blocks were cut into 4-5 μm thick sections using a microtome and attached to glass slides. The sections were dewaxed after baking in an oven at 60°C and rehydrated using gradient ethanol solutions. Then, the sections were stained in hematoxylin solution to show the cell nuclei, and subsequently counterstained with eosin solution for the cytoplasm. After staining, the sections were dehydrated and cleared with gradient ethanol and xylene, and finally sealed with neutral balsam, and the tissue structure was observed under a microscope. The results were as Figure 14 shown. The results showed that the tissue structures of the two groups were normal and there were no obvious pathological changes, further indicating the safety of the delivery system.

[0113] 7. Sanger sequencing to analyze gene editing efficiency.

[0114] Genomic DNA of mouse liver and other organs was isolated using the DNeasy Blood&Tissue Kit (Qiagen). DNA samples from treated and untreated hemophilic mice were used to analyze gene editing efficiency. Primer3Plus was used to design primers to amplify fragments of 300 - 500 bp around the On-target sequence (gene loci are shown in Table 1 and Table 2). The target sequence was amplified using KAPA HiFi DNA polymerase. The PCR reaction conditions were: 98°C for 2 min; 98°C for 5 s, 64°C for 10 s, 72°C for 5 s, for 30 cycles. After obtaining the sequencing files, the Synthego website was used to analyze gene editing efficiency. The results are as Figure 6 shown. The experimental results show that there are certain differences in the gene editing efficiency of different sgRNAs (sgAlb-Intron13, sgLDLR-Exon4, sgPAH-Exon4, sgF9-Exon7, sgPCSK9-Exon1, sgSERPINC1-Exon3), and the percentage of Indels is roughly between 30% and 60%. The data indicate that the LNP delivery system can achieve high editing efficiency at different gene loci.

[0115] Table 1 Gene loci for gene editing-mediated AAV-BDDF8 integration by LNP-SpCas9 / SaCas9 mRNA-sgRNA

[0116] Target Sites Sequence sgAlb-Intron13 TAAACTGTTGTTAGGCCAT sgTRR-Intron3 TATCACCGGAAAGAACAAGCCGG sgApoE-Intron2 GTCTCGGCTCTGAACTACATAGG sgCYP3A4-Intron4 TGCCATTTTTTTCAGTCCTA sgG6PC-Intron3 AAGTCATCTAGACTTGCATA

[0117] Table 2 Gene editing of key gene loci targeted by LNP-SpCas9 / SaCas9 mRNA-sgRNA for various diseases

[0118] Target Sites Sequence sgLDLR-Exon4 GTCACAGACCCAGCTGCGA sgTTR-Exon4 GTCACAGACCCAGCTGCGA sgPAH-Exon7 AAGAATGATACTTACGGTTC sgF9-Exon1 GAAGCACCTGAACACCGTCA sgPCSK9-Exon1 GGCTGATGAGGCCGCACATG sgSERPINC1-Exon3 GTGCATTTACCGCTCCCCT

[0119] 8. Dual-end sequencing combined with the OligoTag-Seq Pipeline was used to analyze off-target events.

[0120] This experiment employed the OliTag-seq technology, a CRISPR / Cas9 gene editing off-target detection process based on published research findings, to analyze the off-target events of LNP-SpCas9 mRNA-sgRNA (see Yang, Z. X. et al. OliTag-seq enhances in cellulo detection of CRISPR-Cas9 off-targets. Commun Biol 7, 696, doi:10.1038 / s42003-024-06360-w (2024)). Briefly, this experiment used 1 μg of genetically edited mouse gDNA, which was fragmented to 500 - 700 bp using a Covaris S220 instrument, and then purified using Select-a-Size DNA Clean&Concentrator MagBeads from ZymoResearch. The DNA fragments were subjected to end repair, A-tail addition, and adapter ligation using the KAPA Hyper Prep Kit. The purified DNA was amplified by two rounds of nested PCR, and the amplification products were used for 150 bp paired-end sequencing. The sequencing data was analyzed for off-target events through a customized OliTag-seq process. The results are as Figure 7 , 13 shown. The experimental results indicate that all detected gene editing events occurred at the target sites, and no off-target events were detected.

[0121] 9. Statistical analysis in this example.

[0122] In this example, Graphpad Prism 7.0 (Graphpad software, San Diego, CA) was used for plotting and statistical analysis. In each independent experiment, the mean ± S.E.M. of each treatment group was determined. Welch's unpaired T-test was used to determine the significance between the treatment group and the control group. A P-value < 0.05 was considered a significant difference: *, P < 0.05; **, P < 0.01; ***, P < 0.001.

[0123] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A composition for gene editing, characterized in that: The composition comprises: i) CRISPR / Cas gene editing elements and their delivery vectors, and ii) a recombinant adeno-associated virus (AAV) vector carrying the target gene, Wherein, the target gene includes at least one selected from the following genes: coagulation factor VIII (F8) gene, LDLR gene, TTR gene, PAH gene, F9 gene, PCSK9 gene or SERPINC1 gene.

2. The composition according to claim 1, characterized in that The target gene is the coagulation factor VIII (F8) gene.

3. The composition according to claim 1 or 2, characterized in that The delivery vector is at least one selected from lipid nanoparticles, gold nanoparticles, adeno-associated virus vectors, lentiviral vectors, adenoviral vectors, cationic polymers, dendrimers, exosomes, or virus-like particles; Preferably, the delivery vehicle is a lipid nanoparticle.

4. The composition according to claim 3, characterized in that The lipid nanoparticles target liver cells.

5. The composition according to claim 4, characterized in that The surface of the lipid nanoparticle is modified with a liver cell-specific ligand.

6. The composition according to claim 1, characterized in that The CRISPR gene editing element includes mRNA and sgRNA of Cas nuclease; Preferably, the Cas nuclease is selected from: Cas9 protein and variants thereof, Cas12a, Cas12e, Cas12b1, Cas12b2, Cas12c, C2c4, C2c8, C2c5, C2c10, C2c9, Cas13a, Cas13d, Cas13c, or Cas13b; More preferably, the Cas nuclease is SpCas9 and / or SaCas9.

7. The composition according to claim 1, characterized in that The adeno-associated viral vector does not contain a promoter and / or an enhancer.

8. The composition according to claim 5, characterized in that The target gene is a coagulation factor VIII gene, and the coagulation factor VIII gene is integrated at at least one of the following sites in the liver cell genome: an Alb site, a TTR site, an ApoE site, a CYP3A4 site or a G6PC site.

9. Use of the composition according to any one of claims 3 to 8 in the preparation of a medicament for treating hemophilia A.

10. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the composition for gene editing as described in any one of claims 1 to 8, and a pharmaceutically acceptable carrier.

Images