A method for constructing an animal model of primary cardiomyopathy and application thereof

Abstract

The application belongs to the technical field of disease model construction, and particularly relates to a construction method of an animal model of primary cardiomyopathy and application thereof. The construction method of the animal model of primary cardiomyopathy provided by the application shows typical characteristics of primary cardiomyopathy, such as a reduced ratio of heart weight to body weight, a reduced ratio of heart weight to tibia length, a decreased cardiac ejection fraction, a decreased left ventricular short axis shortening rate, a decreased left ventricular end-diastolic diameter and left ventricular end-systolic diameter, and a significantly increased area of cardiac fibrosis. The animal model can be used in research on primary cardiomyopathy and screening of drugs for treating primary cardiomyopathy, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of disease model construction technology, specifically relating to a method for constructing an animal model of primary cardiomyopathy and its application. Background Technology

[0002] Primary cardiomyopathy (such as hypertrophic cardiomyopathy and dilated cardiomyopathy) is a group of hereditary diseases characterized by abnormalities in myocardial structure or function, and its pathogenesis is highly correlated with specific gene mutations (such as MYH7, MYBPC3, TNNT2, etc.). With the widespread use of gene sequencing technology, a large number of pathogenic mutation sites (such as missense mutations and splice site variations) with clear associations to disease phenotypes have been accumulated clinically. However, existing animal models are difficult to simulate the correspondence between human cardiomyopathy phenotypes, resulting in low efficiency in disease mechanism research and drug development.

[0003] Traditional chemical induction or surgical modeling (such as isoproterenol injection) only simulates the end-stage pathological phenotype and cannot reflect the disease development process driven by genetic factors, leading to a disconnect between mechanistic research and clinical practice. Existing models mostly focus on a few high-frequency mutations, while a large number of rare mutations in clinical practice lack corresponding models, hindering the development of personalized treatment strategies.

[0004] Therefore, constructing an animal model of primary cardiomyopathy is of great significance for the development of clinically relevant therapeutic drugs and the treatment of cardiomyopathy patients. Summary of the Invention

[0005] To overcome the shortcomings of the prior art, this invention provides a method for constructing an animal model of primary cardiomyopathy and its application. The animal model of primary cardiomyopathy obtained using this method can be used by researchers for in-depth and systematic research on primary cardiomyopathy, as well as for drug screening of primary cardiomyopathy.

[0006] This invention utilizes CRISPR technology to cut the DNA of a target gene, while providing a homologous template (Donor) with a point mutation. Through homologous recombination repair of DNA, base substitution is achieved in a specific exon, thus achieving the purpose of point mutation.

[0007] The point mutation site is located on Exon 16 of the PIEZO1 gene, specifically at position 123224720 on the antisense strand of chromosome 8. GRNA targets were designed at the introns flanking Exon 16, with the following base mutations: GGC. G ACCTG->GGC T ACCTG enables point mutations of amino acids.

[0008] To achieve the above objectives, the present invention employs the following technical solutions:

[0009] A first aspect of the present invention provides a method for constructing an animal model of primary cardiomyopathy, comprising the following steps:

[0010] S1. Modify the genome of mouse single-cell stage embryos to induce a point mutation in the PIEZO1 gene in the genome of mouse single-cell stage embryos;

[0011] S2. Select a genetically modified mouse single-cell stage embryo, wherein the PIEZO1 gene in the genome of the mouse single-cell stage embryo has a point mutation.

[0012] S3. Genetically modified mouse single-cell embryos are gestated in a surrogate mother to obtain first-generation mice with point mutations.

[0013] The PIEZO1 gene is numbered 234839; the point mutation site is located at position 123224720 on the antisense strand of chromosome 8 in the mouse reference genome, and the nucleotide base at this site is G or T. The nucleotide sequence of exon 16 of the PIEZO1 gene without the point mutation is as follows:

[0014] GTTGGGCGACCTGGGCCTGGAGCAGTTCAGTGTGTCGGAGCTCTTTTCCAGTATCCTCATCCCTGGCTTCTTCCTGCTGGCCTGCATCCTGCAGCTGCACTTCCACAGACCGTTCATGCAGCTCACTGACCTGGAGCACGTGCCGCCACCAGGCACCCGCCACCCTCGATGGGCTCACAG (SEQ ID NO. 1).

[0015] Furthermore, the construction method also includes step S4: hybridizing the first-generation mice from step S3 with wild-type mice to obtain the F1 generation of heterozygous mice with gene point mutations.

[0016] Furthermore, DNA sequencing was performed on the F1 generation of heterozygous mice with the gene mutation to confirm that the target gene had mutated.

[0017] Furthermore, the nucleotide sequences of the sequencing primers are as follows:

[0018] F: GCTGTCACTTCACCTTCTGTCC (SEQ ID NO. 8); R: GCTCCTGTCTGCCTTCCTCAA (SEQ ID NO. 9).

[0019] Furthermore, the modification method is CRISPR / Cas9 technology, zinc finger nuclease technology, or transcription activator-like effector nuclease technology.

[0020] Further, step S1 includes introducing the following into a mouse single-cell stage embryo:

[0021] (i) a nuclease reagent or a polynucleotide encoding the nuclease reagent that targets the target sequence of exon 16 of the PIEZO1 gene;

[0022] (ii) a targeting vector containing donor DNA with a point mutation, the donor DNA containing a 5' homologous arm corresponding to the 5' targeting sequence of exon 16 of the PIEZO1 gene and a 3' homologous arm corresponding to the 3' targeting sequence of exon 16 of the PIEZO1 gene.

[0023] The nucleotide sequence of the donor DNA is as follows:

[0024] CTGCTGTGCCTCACCTTGTTCCAGGTGACCTAGGGAATGGGCAGGTAGGGCTCGTGGGTGGGGCTCTGTCCCTCACCTGCCCTGCTCACCAGCCACCCCACCCCCATCCTTCTGCAGGTCTACTACACCCTGTGGAGGAAGCTGCTGCGTGTCTTCTGGTGGCTCGTGGTGGCCTATACAATGCTCGTGCTCATCGCTGTGTACACCTTCCAGTTCCAGGACTTCCCCACCTATTGGCGCAACCTCACGGGCTTCACGGACGAGCAGTGAGTAGGGTAAATTAGGGGCAGTACCGCTGAGCGCTCTTCAGGGGGCGGTAGAGGCACCTTCCTCGTAACGTCCCATGCTCAGACTCTAAGATCTGGTTCAGGAGGGCTACTGGTTCAGGGCAGAGTAAAGGGCTGATGGTGCTCGCTCTCTTCTGCCAGGTTGGGCTACCTGGGCCTGGAGCAGTTCAGTGTGTCGGAGCTCTTTTCCAGTATCCTCATCCCTGGCTTCTTCCTGCTGGCCTGCATCCTGCAGCTGCACTACTTCCACAGACCGTTCATGCAGCTCACTGACCTGGAGCACGTGCCGCCACCAGGCACCCGCCACCCTCGATGGGCTCACAGGTGTTCTGCCTTCGAGAACCACGGGTGTTTTTTGGTCTGTGGGAACTGGGGTTGACGCTAAGGGCTGTGTCATAGAGTTAGCCGACCGTCCTGCGCTTGGGCGGGAGCCGTGAGGCAGCCTTAAGTTATGTAGACTTGGCCTAGAGTTTACAGGTGGACTGGTGGAGATGGGGTGGGGGGGCTGTCTCAGGGAAGGGAGAGCCAGGGACAAGGGCAGGAAGTGACACTTGGGCTTTCCCAGGCAGGATGCAGTGAGCGAGGCCCCTCTGCTTGAGCATCAGGAGGAAGAGGAAGTC (SEQ ID NO.2);

[0025] The nucleotide sequence of the 5' homologous arm is as follows:

[0026] TGCTGTGCCTCACCTTGTTCCAGGTGACCTAGGGAATGGGCAGGTAGGGCTCGTGGGTGGGGCTCTGTCCCTCACCTGCCCTGCTCACCAGCCACCCCACCCCATCCTTCTGCAGGTCTACTACACCCTGTGGAGGAAG CTGCTGCGTGTCTTCTGGTGGCTCGTGGTGGCCTATACAATGCTCGTGCTCATCGCTGTGTACACCTTCCAGTCCAGGACTTCCCCACCTATTGGCGCAACCTCACGGGCTTCACGGACGAGCAGTGAGTAGGGTA (SEQ ID NO.3);

[0027] The nucleotide sequence of the 3' homologous arm is as follows:

[0028] ATGTAGACTTGGCCTAGAGTTTACAGGTGGACTGGTGGAGATGGGGTGGGGGGGCTGTCTCAGGGAAGGGAGAGCCAGGGACAAGGGCAGGAAGTGACACTTGGGCTTTCCCAGGCAGGATGCAGTGAGCGAGGCCCCTCTGCTTGAGCATCAGGAGGAAGAGGAAG (SEQ ID NO. 4)

[0029] Furthermore, the nucleotide sequence of the targeting vector is shown in SEQ ID NO.7.

[0030] Furthermore, the nuclease reagent comprises Cas9 nuclease and guide RNA.

[0031] Furthermore, the Cas nuclease is Cas9nickase mRNA.

[0032] Furthermore, the sequence of the guide RNA is shown in SEQ ID NO.5-6;

[0033] PIEZO1-L: GGTTCAGGAGGGCTACTG (SEQ ID NO. 5); PIEZO1-R: CTCTAGGCCAAGTCTACA (SEQ ID NO. 6).

[0034] In a second aspect, the invention provides the application of model mice obtained by the above-described method for constructing an animal model of primary cardiomyopathy in screening drugs for the treatment of primary cardiomyopathy.

[0035] The above one or more technical solutions have the following beneficial effects:

[0036] The method for constructing an animal model of primary cardiomyopathy provided by this invention can produce animals exhibiting typical characteristics of primary cardiomyopathy, such as a reduced ratio of heart weight to body weight, a decreased ratio of heart weight to tibia length, cardiac ejection fraction, left ventricular fractional shortening, decreased left ventricular end-diastolic diameter and left ventricular end-systolic diameter, and a significantly increased area of ​​cardiac fibrosis. This animal model can be used for the study of primary cardiomyopathy and for screening drugs for the treatment of primary cardiomyopathy, and its application prospects are broad. Attached Figure Description

[0037] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0038] Figure 1 The principle of constructing point mutant mice;

[0039] Figure 2 Sequencing analysis of point mutant mice;

[0040] Figure 3 This is a schematic diagram of cardiomyopathy caused by GOF PIEZO1 mutation; (A) shows the results of the heart weight to body weight ratio experiment; (B) shows the results of the heart weight to tibia length ratio experiment; (C) and (D) show the results of the echocardiography experiment; (E) shows the results of the cardiac Masson staining experiment; and (F) shows the statistical diagram of cardiac collagen fibers.

[0041] Figure 4 To validate the results of single-cell analysis and pathway enrichment, (A) is the UMAP map of cell types in cardiac tissue; (B) is the enrichment map of inhibitory pathways; (C) and (D) are the enrichment analysis of fatty acid pathway genes; (E) and (F) are the Oil Red staining and statistical analysis maps of the heart; (G) and (H) are the transmission electron microscopy and statistical analysis maps of the heart; (I) and (J) are the immunoblotting and statistical analysis maps of fatty acid pathway-related proteins.

[0042] Figure 5 This diagram illustrates how inhibiting GOF PIEZO1 mutation activity can improve cardiomyopathy. (A) and (B) show the results of echocardiography experiments on mouse hearts after inhibiting GOF PIEZO1 mutation activity; (C) and (D) show the results of Masson staining experiments on mouse hearts after inhibiting GOF PIEZO1 mutation activity; and (E) shows the results of Oil Red staining and transmission electron microscopy experiments on mouse hearts after inhibiting GOF PIEZO1 mutation activity. Detailed Implementation

[0043] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0044] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. Experimental methods in the following specific embodiments, unless specific conditions are specified, are generally performed according to conventional methods and conditions in molecular biology within the art, which are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., *Molecular Cloning: A Laboratory Manual*, or according to the conditions recommended by the manufacturer.

[0045] The present invention will be further illustrated with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Unless otherwise specified, experimental conditions not explicitly stated in the examples are generally performed under conventional conditions or as recommended by the selling company. Materials and reagents used in the examples, unless otherwise specified, are commercially available.

[0046] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0047] Example 1: Construction of GOF PIEZO1 mutant mice

[0048] like Figure 1 As shown, this invention utilizes CRISPR technology to cut the DNA of the target gene, while providing a homologous template Donor with a point mutation. Through homologous recombination repair of DNA, base substitution is achieved in a specific exon, thus achieving the purpose of point mutation.

[0049] 1. Design gRNA sequences targeting point mutation genes

[0050] gRNA target site sequences recognizing the L-terminal (5' end) and R-terminal (3' end) target sites were designed and synthesized targeting the 16th exon region of the mouse PIEZO1 gene. The two sgRNA recognition sites are located at the introns at both ends of the 16th exon of the mouse PIEZO1 gene, and their nucleotide sequences are shown in SEQ ID NO.1-2: PIEZO1-L: GGTTCAGGAGGGCTACTG (SEQ ID NO.5); PIEZO1-R: CTCTAGGCCAAGTCTACA (SEQ ID NO.6).

[0051] 2. Construction of the homologous recombination template (Donor plasmid)

[0052] Based on the target sites of gRNAs with high endogenous activity, donor DNA fragments were designed, and donor DNA targeting vectors containing mutation sites were constructed. The nucleotide sequence of the donor DNA fragment is shown in SEQ ID NO.2.

[0053] The specific design approach is as follows: determine the homologous arm sequence; simultaneously, perform point mutations at designated locations on the gene; subsequently, design gRNA target sites on the introns flanking exon 16, and perform point mutations on the target sites (but without affecting exon splicing), so that the gRNA can no longer recognize and cleave the donor DNA, thus avoiding further mutations and improving the efficiency of point mutations.

[0054] The plasmid vector containing Donor DNA was constructed using a whole-genome synthesis method, and its nucleotide sequence is shown in SEQ ID NO.7.

[0055] 3. Establishment of stable point mutation mouse strains

[0056] Cas9 nickase mRNA (Viewsolid, 50 ng / μl), Cas9 target gRNA (Viewsolid, 10 ng / μl), and donor DNA vector (Viewsolid, 20 ng / μl) were co-microinjected into mouse zygotes. Gene knockout was achieved through direct injection into zygotes. Because gene knock-in occurs early in zygote development, even at the single-cell stage, the chimerism rate in mice is high, and the chance of successful transmission is higher than with blastocyst injection into ES cells. Genotypes were identified in mice two weeks after birth, and PCR was used to determine if founder mice with the gene point mutation had been obtained. The primers used for identification were: F: GCTTCACTTCACCTTCTGTCC (SEQ ID NO. 8); R: GCTTCGTCTGCCTTCCTCAA (SEQ ID NO. 9).

[0057] After obtaining founder mice with point mutations, these mice were crossed with wild-type mice to obtain stable, inherited heterozygous (+ / -) F1 generation mice with the point mutation. PCR amplification was performed using sequences as shown in SEQ ID NO. 8-9, and the amplified products were sequenced. The sequencing results are as follows: Figure 2 As shown, a point mutation in the target gene has been confirmed.

[0058] Example 2: Cardiac function testing in GOF PIEZO1 mutant mice

[0059] GOF PIEZO1 mutant mice were bred to 3 months of age, and their cardiac function and structure were examined using a small animal ultrasound system and pathological staining. For example... Figure 3 (A) and Figure 3 As shown in (B), the GOF PIEZO1 mutant mice have a reduced heart weight to body weight ratio and a decreased heart weight to tibia length ratio; Figure 3 (C) and Figure 3 As shown in (D), GOFPIEZO1 mutant mice exhibit decreased cardiac ejection fraction, left ventricular fractional shortening, left ventricular end-diastolic diameter, and left ventricular end-systolic diameter; Figure 3 (E) and Figure 3 As shown in (F), the area of ​​cardiac fibrosis was significantly increased in GOF PIEZO1 mutant mice. Based on these results, GOF PIEZO1 can induce a phenotype of primary cardiomyopathy in mice.

[0060] Example 3: Single-cell analysis and pathway enrichment verification of the hearts of normal mice and GOF PIEZO1 mutant mice.

[0061] Single-cell analysis of samples revealed that the GOF PIEZO1 mutation is closely related to the cardiac lipid metabolism pathway. Mice were sacrificed after echocardiography to collect fresh heart tissue for electron microscopy. Simultaneously, frozen sections of fixed heart tissue were prepared to examine changes in cardiac lipid droplets. Heart tissue was collected and mixed with protein lysis buffer (Beyotime, P0013B) and a mixture of protease phosphatase inhibitors (Beyotime, P1045). After vortexing and homogenization at low temperature, the supernatant was collected, and an equal proportion of 1× Loading Buffer was added. The mixture was then boiled at 100°C for 5 min. The prepared protein samples were then added to SDS-PAGE gel microwells for electrophoresis and transferred to PVDF membranes. Western blot experiments were used to verify the expression of fatty acid pathway-related proteins in single-cell results.

[0062] Single-cell analysis results as follows Figure 4(A) Figure 4 (B) Figure 4 (C) and Figure 4 As shown in (D), the GOFPIEZO1 mutation leads to abnormalities in the cardiac lipid metabolism pathway; as Figure 4 (E) in Figure 4 (F) Figure 4 (G) and Figure 4 As shown in (H), GOF PIEZO1 mutations lead to lipid accumulation in the heart; as Figure 4 (I) Figure 4 As shown in (J), the expression levels of fatty acid pathway-related proteins CPT1, CPT2, CD36, and PGC-1α decreased.

[0063] Example 4: Inhibition of PIEZO1 activity in GOF PIEZO1 mutant mice and detection of cardiac function in the animals.

[0064] The PIEZO1 inhibitor GsMTX4 (MCE, HY-P1410) was administered intraperitoneally to inhibit PIEZO1 activity. Four weeks after intraperitoneal injection, cardiac function was assessed in mice. Figure 5 (A) and Figure 5 As shown in (B), inhibiting PIEZO1 activity in GOF PIEZO1 mutant mice improved cardiac function impairment. Paraffin sections of mouse heart tissue fixed in 4% paraformaldehyde were prepared for pathological staining to record cardiac fibrosis markers, and changes in cardiac structure after inhibiting GOF PIEZO1 activity were observed. Figure 5 (C) and Figure 5 As shown in (D), inhibiting GOF PIEZO1 activity reduced the degree of cardiac fibrosis. Fresh mouse heart tissue was collected, and frozen sections of the heart were prepared simultaneously. Lipid metabolism in the mouse heart was detected by Oil Red staining and electron microscopy. Figure 5 As shown in (E), inhibiting GOF PIEZO1 activity improved cardiac lipid deposition in gene-modified mice. This demonstrates that targeting the GOF PIEZO1 protein and regulating its activity level confirms that inhibiting GOF PIEZO1 protein activity can regulate cardiac lipid deposition and thus exert a beneficial effect in the treatment of primary cardiomyopathy.

[0065] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. A method for constructing an animal model of primary cardiomyopathy, characterized in that, Includes the following steps: S1. Modify the genome of mouse single-cell stage embryos to induce a point mutation in the PIEZO1 gene in the genome of mouse single-cell stage embryos; S2. Select a genetically modified mouse single-cell stage embryo, wherein the PIEZO1 gene in the genome of the mouse single-cell stage embryo has a point mutation. S3. Genetically modified mouse single-cell embryos are gestated in a surrogate mother to obtain first-generation mice with point mutations. The gene number of PIEZO1 is 234839; the point mutation site is located at position 123224720 of the antisense strand of chromosome 8 in the mouse reference genome, and the nucleotide base at this site is G or T.

2. The method for constructing an animal model of primary cardiomyopathy as described in claim 1, characterized in that, The construction method also includes step S4: hybridizing the first-generation mice from step S3 with wild-type mice to obtain the F1 generation of heterozygous mice with gene point mutations.

3. The method for constructing an animal model of primary cardiomyopathy as described in claim 2, characterized in that, After obtaining the F1 generation of heterozygous mice with gene mutation, DNA sequencing was performed to confirm that the target gene had a point mutation; the primers for DNA sequencing are shown in SEQ ID NO. 8-9.

4. The method for constructing an animal model of primary cardiomyopathy as described in claim 1, characterized in that, Methods for modifying the genome of mouse single-cell embryos include CRISPR / Cas9 technology, zinc finger nuclease technology, or transcription activator-like effector nuclease technology.

5. The method for constructing an animal model of primary cardiomyopathy as described in claim 1, characterized in that, Step S1 includes introducing the following into mouse single-cell stage embryos: (i) A nuclease reagent targeting the target sequence of exon 16 of the PIEZO1 gene or a nucleotide molecule encoding the nuclease reagent; (ii) a targeting vector containing donor DNA with a point mutation, the donor DNA containing a 5' homologous arm corresponding to the 5' targeting sequence of exon 16 of the PIEZO1 gene and a 3' homologous arm corresponding to the 3' targeting sequence of exon 16 of the PIEZO1 gene. The nucleotide sequence of the donor DNA is shown in SEQ ID NO.

2.

6. The method for constructing an animal model of primary cardiomyopathy as described in claim 5, characterized in that, The nuclease reagent contains Cas9 nuclease and guide RNA.

7. The method for constructing an animal model of primary cardiomyopathy as described in claim 6, characterized in that, The Cas9 nuclease is Cas9nickase mRNA.

8. The method for constructing an animal model of primary cardiomyopathy as described in claim 6, characterized in that, The nucleotide sequence of the guide RNA is shown in SEQ ID NO.5-6.

9. The method for constructing an animal model of primary cardiomyopathy as described in claim 5, characterized in that, The nucleotide sequence of the targeting vector is shown in SEQ ID NO.

7.

10. The use of the model mice obtained by the method for constructing an animal model of primary cardiomyopathy according to any one of claims 1-9 in screening drugs for the treatment of primary cardiomyopathy.

Images