Simultaneous detection kit for equine encephalomyelitis virus and detection method of equine encephalomyelitis virus

Abstract

The invention relates to the technical field of DNA (Deoxyribose Nucleic Acid) detection, in particular to a triple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for simultaneously detecting equine encephalomyelitis viruses, a detection method and application. According to the invention, oriental equine encephalomyelitis, western equine encephalomyelitis and Venezuela equine encephalomyelitis viruses can be simultaneously and specifically detected in one reaction, and the sensitivity is as low as about 10 <-8 >.

Description

Technical Field

[0001] This application relates to the field of DNA detection technology, and particularly relates to a triple fluorescence RT-PCR primer and probe for simultaneously detecting equine encephalomyelitis virus (eastern type, western type, and Venezuelan type), a kit thereof, a detection method, and an application. Background Art

[0002] Equine encephalomyelitis, also known as equine epidemic encephalomyelitis, is a general term for a class of infectious diseases of horses caused by different types of viruses, mainly characterized by disorders of the central nervous system function, including eastern equine encephalomyelitis (EEE), western equine encephalomyelitis (WEE), and Venezuelan equine encephalomyelitis (VEE). The pathogen of equine encephalomyelitis belongs to the members of the Alphavirus genus of the Togaviridae family. The Alphavirus genus currently includes 29 species, which are divided into 10 complexes. Alphaviruses are maintained in endemic transmission cycles and occasionally spread to humans and domestic animals to cause diseases. The typical characteristics of human infection with Old World alphaviruses such as Ross River, Chikungunya, and Sindbis viruses are fever, rash, and polyarthritis, while infection with New World alphaviruses such as Venezuelan equine encephalomyelitis virus (VEEV), eastern equine encephalomyelitis virus (EEEV), and western equine encephalomyelitis virus (WEEV) can lead to fatal encephalomyelitis. The epidemiological cycles of the alphaviruses EEEV and WEEV are maintained in the forest or animal transmission cycles between ornithophilic mosquitoes and birds (Passeriformes and other birds) in nature, and they serve as a natural reservoir and an amplifying viral host. According to existing knowledge, more than 20 species of mosquitoes are involved in virus transmission, mainly the EEEV vector Culex nigripalpus and the WEEV vector Culex tarsalis. When the epidemic cycle is disrupted, EEEV and WEEV are transmitted to horses and humans through mosquitoes, resulting in epidemic outbreaks. Horses and humans are dead-end hosts and do not develop high-titer viremia. However, for VEEV, horses and humans serve as amplifying hosts and develop high-titer viremia, and can transmit the disease to other horses or humans through mosquitoes. In developed countries, the epidemiological studies on alphaviruses affecting humans are limited to EEEV, WEEV, and VEEV, and there is cross-immunity among these three viruses.

[0003] Virions of the genus Alphavirus have a lipid envelope that contains glycoprotein spikes composed of the E1 and E2 viral proteins, whose heterodimeric conformation contains two important glycosylation sites. The virion consists of an icosahedral nucleocapsid composed of repeating subunits of the C protein, which encloses the viral genome without any matrix intermediate. The viral gene is a single-stranded positive-sense RNA that includes two polyprotein genes. The 5' and 3' ends encode four non-structural proteins (NSP1-4) and viral structural proteins respectively. The heterodimer formed by the glycoproteins E1 and E2 is highly immunogenic and can induce neutralizing antibodies related to protection. E2 mediates viral attachment, E1 mediates pore formation and viral envelope-endosome membrane fusion, and the nucleocapsid is released into the cytoplasm. Once the genomic RNA is released, replication and protein synthesis occur. The structural proteins are synthesized from the subgenomic 26S positive-sense RNA strand and are translated into a single polyprotein (CapsidE3-E2-6K-E1), which is cleaved post-translationally into the capsid protein (C) and PE2-6K-E1, and further cleaved in the glycoproteins E1 and E2. The nucleocapsid is assembled and transferred to contain the viral glycoproteins E1 and E2, from which it emerges and acquires a lipid bilayer from the host cytoplasmic membrane.

[0004] Eastern equine encephalitis virus mainly maintains its natural ecology through alternating infections between birds and mosquitoes. Horses and humans are the terminal hosts of these two viruses. However, some horses can also develop transient viremia and transmit the virus to mosquitoes under appropriate conditions. The occurrence of eastern equine encephalitis is related to the climatic conditions where mosquitoes exist. It can occur throughout the year in tropical regions and mainly occurs from mid-summer to late autumn in temperate regions. WOAH lists it as a notifiable disease, and China lists it as a category II animal disease for entry and exit.

[0005] According to WOAH data statistics, after 2005, eastern and western equine encephalitis mainly occurred in Belize, Brazil, Canada, Colombia, Costa Rica, Ecuador, Guyana (Latin America), Panama, Suriname, the United States, and Venezuela in the Americas. There is currently no report of eastern and western equine encephalitis outbreaks in China. With the rapid development of the modern horse industry, the breeding area of horses has extended from traditional grassland pastoral areas to the suburbs of economically developed regions, and the feeding method has gradually transformed from the traditional grazing mode to large-scale farming mainly based on stall feeding. Research centers for the horse industry have been established in Beijing, Inner Mongolia Autonomous Region, Hubei, Xinjiang Uygur Autonomous Region, etc., scientific research and development and application innovation teams have been formed, and research demonstration and promotion bases have been established. Therefore, it is particularly important to carry out the detection of eastern equine encephalitis.

[0006] Currently, most international references for the diagnosis of Eastern equine encephalomyelitis virus, Western equine encephalomyelitis virus, and Venezuelan equine encephalomyelitis virus are based on the diagnostic techniques described in the "Terrestrial Animal Diagnostic Tests and Vaccines Manual (Mammals, Birds, and Bees)" of the World Organization for Animal Health (WOAH). Virus diagnosis is carried out through two aspects: pathogen identification and serology. It mainly includes complement fixation test, hemagglutination inhibition test, ELISA test, and plaque reduction neutralization test. However, the sensitivity of these methods is relatively low, which is not conducive to the rapid detection of the virus. Therefore, there is a need to establish a highly sensitive, specific, and rapid detection method for monitoring the prevalence of the disease at any time and controlling it. At the same time, it can also be applied to the entry and exit inspections of animals such as horses.

[0007] In China, the detection methods in the original industry standards for entry-exit inspection and quarantine formulated by the Chongqing Customs Technical Center, namely the "Quarantine Technical Specification for Venezuelan Equine Encephalomyelitis" and the "Quarantine Technical Specification for Equine Encephalomyelitis (Eastern and Western Types)", are basically the same as the above international methods. The Shandong Customs Technical Center, the Beijing Customs Technical Center, and the Harbin Veterinary Research Institute have also conducted research on the diagnostic methods for equine encephalomyelitis, but they are all studies on the detection methods for single equine encephalomyelitis viruses. In view of this, this application is proposed. Summary of the Invention

[0008] To solve the above existing problems, this application has established a triple fluorescence quantitative RT-PCR amplification system and its detection method for simultaneously detecting the nucleic acids of equine encephalomyelitis viruses (Eastern, Western, and Venezuelan). Through the optimization of the entire system, this method has significant advantages in terms of sensitivity and specificity, and can provide high-throughput, low-cost, and easily popularized detection.

[0009] Specifically, this application adopts the following technical solutions:

[0010] This application first provides a primer-probe composition for co-detecting equine encephalomyelitis viruses, and the primers and probes are respectively directed against Eastern equine encephalomyelitis virus, Western equine encephalomyelitis virus, and Venezuelan equine encephalomyelitis virus.

[0011] Furthermore, the target regions of the primers and probes for Eastern equine encephalomyelitis virus, Western equine encephalomyelitis virus, and Venezuelan equine encephalomyelitis virus are as follows: the target region of Eastern equine encephalomyelitis virus is the structural protein region, the target region of Western equine encephalomyelitis virus is the E2 protein region, and the target region of Venezuelan equine encephalomyelitis virus is the E1 protein region.

[0012] Even further, the sequences of the primers are respectively shown as SEQ ID NO.1-6, or have at least 90% homology with SEQ ID NO.1-6.

[0013] Furthermore, the sequences of the probes are shown in SEQ ID NO. 7-9 respectively, or have at least 90% homology with SEQ ID NO. 7-9.

[0014] Preferably, the concentration ratio of the primer-probe is a proportional mixture.

[0015] In some ways, the 5' end of the probe is labeled with fluorescein, the 3' end is labeled with a fluorescence quenching gene, and each virus is labeled differently;

[0016] Preferably, the sequence after probe labeling is as follows:

[0017] SEQ ID NO.7: FAM-CTTGTTGTCAATCAGGTAAGCCCTGCA-BHQ1;

[0018] SEQ ID NO.8: ROX-CTGACGCTTCCTCCAGATAGGAC-BHQ2;

[0019] SEQ ID NO.9: CY5-CGCCTTGTTTACCAGGGTGTCAG-BHQ3.

[0020] In some specific ways, the primer-probe composition is as follows:

[0021] For Eastern equine encephalitis virus:

[0022] SEQ ID NO.1: GCAGCGACCATACAACCAC (sense primer 1);

[0023] SEQ ID NO.2: CTCCTCGAGGCAGTCTTCC (antisense primer 2);

[0024] SEQ ID NO.6: FAM-CTTGTTGTCAATCAGGTAAGCCCTGCA-BHQ1 (probe);

[0025] For Western equine encephalitis virus:

[0026] SEQ ID NO.4: AAGGAGACGTCTGCCGGAT (sense primer 4);

[0027] SEQ ID NO.5: CGTAGGTGACGTTCTTGCC (antisense primer 5);

[0028] SEQ ID NO.6: ROX-CTGACGCTTCCTCCAGATAGGAC-BHQ2 (probe);

[0029] For Venezuelan equine encephalitis virus:

[0030] SEQ ID NO.7: ATTCCATTAGCCTTTGACATCC (Forward primer 7);

[0031] SEQ ID NO.8: CATTAAGAGTGCATTCGGCCG (Reverse primer 8);

[0032] SEQ ID NO.9: CY5-CGCCTTGTTTACCAGGGTGTCAG-BHQ3 (Probe).

[0033] This application also provides a product for simultaneously detecting equine encephalitis virus, comprising any one of the aforementioned primer-probe compositions.

[0034] Furthermore, the product is a detection kit;

[0035] Preferably, the detection kit further comprises a fluorescent RT-PCR buffer, Taq enzyme, reverse transcriptase, etc.

[0036] This application also provides the use of any one of the aforementioned primer-probe compositions in simultaneously detecting equine encephalitis virus.

[0037] This application also provides the use of any one of the aforementioned primer-probe compositions in preparing a kit for simultaneously detecting equine encephalitis virus.

[0038] Furthermore, the equine encephalitis virus includes Eastern equine encephalitis virus, Western equine encephalitis virus, and Venezuelan equine encephalitis virus.

[0039] This application also provides a method for simultaneously detecting equine encephalitis virus, comprising the step of detecting a sample to be tested using any one of the aforementioned primer-probe combinations or any one of the aforementioned products.

[0040] Furthermore, the simultaneous detection can detect Eastern equine encephalitis virus, Western equine encephalitis virus, and Venezuelan equine encephalitis virus simultaneously.

[0041] Even further, the amplification conditions in the detection process are as follows: 50°C, 15 min, 95°C, 5 min: 95°C, 10 s, 55°C, 30 s, 45 cycles; fluorescence collection is set at the 55°C annealing and extension stage.

[0042] Compared with the prior art, this application has at least the following advantages:

[0043] This application can simultaneously identify and detect viruses of the genus Alphavirus that cause Eastern equine encephalomyelitis (EEE), Western equine encephalomyelitis (WEE), and Venezuelan equine encephalomyelitis (VEE). This application makes full use of the high-efficiency amplification of fluorescence PCR detection technology, the good specificity of nucleic acid hybridization, and the multiplication effect of fluorescence detection technology. Primers and probe systems for virus genome detection are designed, optimized, and screened for three subtypes of equine encephalomyelitis viruses, which can be efficiently used for the detection of the genomes of the three equine encephalomyelitis viruses, with advantages such as high amplification efficiency and strong specificity. Moreover, in terms of sensitivity, the detection sensitivities of this application for Eastern equine encephalomyelitis virus, Western equine encephalomyelitis virus, and Venezuelan equine encephalomyelitis virus are all at 10 -8 or so.

[0044] In addition, compared with ordinary RT-PCR, this application also has at least the characteristics of simple operation, time-saving and labor-saving, and accurate results. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the specific embodiments of this application or the technical solutions in the prior art, the following will briefly introduce the drawings required for use in the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of this application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0046] Figure 1 Results diagram of primer screening for Western equine encephalomyelitis virus;

[0047] Figure 2 Schematic diagram of the detection principle of this application;

[0048] Figure 3 Results diagram of the specificity test of the real-time fluorescence RT-PCR detection method established using the triple primers and corresponding probes of this application;

[0049] Figure 4 Results diagram of the sensitivity test of the real-time fluorescence RT-PCR method established using the triple primers and corresponding probes of this application for the detection of Eastern equine encephalomyelitis virus;

[0050] Figure 5 Results diagram of the sensitivity test of the real-time fluorescence RT-PCR method established using the triple primers and corresponding probes of this application for the detection of Western equine encephalomyelitis virus;

[0051] Figure 6 Results diagram of the sensitivity test of the real-time fluorescence RT-PCR method established using the triple primers and corresponding probes of this application for the detection of Venezuelan equine encephalomyelitis virus. Detailed implementation manners

[0052] Those skilled in the art can refer to the content herein to implement its applications. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in this application. The preparation methods and applications of this application have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate alterations and combinations to the preparation methods and applications herein without departing from the content, spirit, and scope of this application to implement and apply the technology of this application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this application belongs.

[0053] The following terms or definitions are provided only to assist in understanding this application. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0054] Unless otherwise defined hereinafter, the meanings of all technical terms and scientific terms used in the specific implementation manners of this application are intended to be the same as those commonly understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain this application.

[0055] As used in this application, the terms "comprising", "including", "having", "containing", or "involving" are inclusive or open-ended and do not exclude other unlisted elements or method steps. The term "consisting of" is considered to be a preferred embodiment of the term "comprising". If a certain group is defined hereinafter as including at least a certain number of embodiments, this should also be understood as disclosing a group preferably consisting only of these embodiments.

[0056] The indefinite article or definite article used when referring to a singular form noun, such as "a" or "an", "the", includes the plural form of the noun.

[0057] The terms "about" and "substantially" in this application indicate an accuracy range that those skilled in the art can understand and still ensure the technical effects of the features in question. This term generally represents a deviation of ±10% from the indicated value, preferably ±5%.

[0058] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily descriptive of an order or time sequence. It should be understood that the terms so applied can be interchanged in appropriate circumstances, and the embodiments described in this application can be implemented in an order different from that described or illustrated in this application.

[0059] As used herein, the term "nucleic acid" or "nucleic acid sequence" refers to any molecule, preferably a polymeric molecule, that contains ribonucleic acid, deoxyribonucleic acid, or analog units thereof. The nucleic acid can be single-stranded or double-stranded. The single-stranded nucleic acid can be a nucleic acid of one strand of denatured double-stranded DNA. Alternatively, the single-stranded nucleic acid can be a single-stranded nucleic acid that does not originate from any double-stranded DNA.

[0060] The technical solutions of the present application will be described clearly and completely below with reference to the accompanying drawings. Apparently, the described embodiments are some, but not all, of the embodiments of the present application. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present application without creative efforts shall fall within the protection scope of the present application.

[0061] Experimental Example 1: Design, screening, and optimization of primer-probe systems

[0062] 1. Selection of target regions

[0063] Eastern equine encephalitis virus (EEEV), Western equine encephalitis virus (WEEV), and Venezuelan equine encephalitis virus (VEEV) belong to the genus Alphavirus and are all single-stranded positive-strand RNA viruses. The virus particles are spherical and enveloped. Through whole-genome sequencing analysis, it is found that there are significant differences in the nucleotide sequences of their specific gene fragments. Their coding regions orderly encode 4 non-structural proteins and 5 structural proteins. The 3' end of the genome mainly encodes nucleocapsid protein, E2, and E1 glycoproteins. Glycoproteins play a key role in the virus infection process. For example, the E2 glycoprotein dominates the binding to the host cell surface receptor, determining the virus host range and tissue tropism, and the E1 glycoprotein is deeply involved in the process of the virus invading host cells. Therefore, the E protein is selected as the detection target fragment, which can not only determine the presence of the virus but also assist in the early diagnosis of the epidemic. At the same time, in combination with the detection strategy recommended by WOAH, the present application respectively selects the E2 structural protein region of Eastern equine encephalitis virus, the E2 protein region of Western equine encephalitis virus, and the E1 protein region of Venezuelan equine encephalitis virus as the target detection regions.

[0064] 2. Primer design, screening, and optimization:

[0065] Based on the above-determined targeting regions of the three equine encephalomyelitis viruses, preliminary primer design was carried out. The specific design process includes the following aspects: 1) Perform multiple sequence alignment analysis on the target gene regions, and screen out nucleotide sequences that are highly conserved and significantly specific among the three viruses as the core target regions for primer design; 2) It is necessary to systematically calculate and dynamically adjust the melting temperature parameters of the primers. The melting temperatures (Tm values) of each primer in the triple fluorescence RT-PCR system should maintain relative consistency. It is recommended to strictly control the difference range within the interval of 2 - 5 °C to ensure the synergistic reaction efficiency in the multiplex amplification system. Use molecular biology analysis software for initial Tm value calculation and adopt the GC content adjustment strategy for precise optimization; 3) Predict the secondary structure of the primers through professional bioinformatics tools, focusing on checking for possible hairpin structures formed within the primers and potential dimer effects between primers. Nonspecific structures may significantly reduce the primer annealing efficiency and cause non-target amplification. If such nonspecific structures are detected, iterative optimization of the primer sequences is required until they are eliminated; 4) Use BLAST alignment to verify the primer specificity, and strictly limit the homology threshold (<50%) of the primers with gene sequences of non-target species in public databases such as GenBank to ensure that the primer set has strict species specificity; 5) Introduce a site-directed mutagenesis error tolerance mechanism within the established primer framework, and improve the compatibility of the primers with virus gene mutations by introducing base modifications in a targeted manner while maintaining the sensitivity of the detection system.

[0066] After the above steps, the primer and probe sequences designed initially are as follows in the table:

[0067]

[0068]

[0069] Taking the primer screening of Western equine encephalomyelitis virus as an example:

[0070] Evaluate and screen the preliminary primer-probe sequences, and synthesize the primer-probes of Group 1 and Group 2 of the Western equine encephalomyelitis virus designed respectively. Under the condition that the primer-probe concentration, enzyme content, template concentration, etc. are all set to the same conditions, perform amplification reactions on the primer-probes of Group 1 and Group 2 simultaneously, and examine the Ct values and fluorescence intensities of the amplification reactions of the two groups of primer-probes. The combination with a smaller Ct value and a higher fluorescence intensity is the best. The specific screening results are shown in Figure 1 。

[0071] Through the above screening, the optimal primer and probe sequences finally determined in this application are as follows:

[0072]

[0073] In addition, on the basis of adopting the conventional RT-PCR detection technology, the present application also adds a nucleotide probe with fluorescent groups labeled at both ends. The fluorescent reporter group is labeled at the 5' end of the probe, and the fluorescent quenching group is labeled at the 3' end of the probe. The two types of fluorescent groups have the energy transfer characteristic, that is, the fluorescence emitted by the fluorescent reporter group can be absorbed by the fluorescent quenching group. When the two are far apart due to the cleavage of the group sequence by the enzyme, this energy transfer characteristic becomes weak, resulting in the enhancement of the fluorescence signal emitted by the reporter group. During the actual detection process, with the occurrence of the amplification reaction, at this time, Taq enzyme not only plays its role as a DNA polymerase, but also has exonuclease activity from the 5' end to the 3' end. Therefore, during the amplification and extension stage, it cuts off the probe paired with the template, resulting in the weakening or disappearance of the inhibitory effect of the fluorescent quenching group and the enhancement of the fluorescence signal of the reporter group, which is beneficial to the detection of the nucleic acid of Eastern equine encephalomyelitis virus (Eastern type, Western type, and Venezuelan type). For the detailed principle, please refer to the appendix Figure 2 。

[0074] Based on the above research, the finally established primer / probe system is as follows:

[0075] For the specific upstream primer for the nucleic acid of Eastern equine encephalomyelitis virus, its nucleotide sequence is as shown in SEQ ID No.1, the downstream primer's nucleotide sequence is SEQ ID No.2, and the probe sequence is SEQ ID No.3. The probe is labeled with a fluorescein at the 5' end of the probe sequence and a fluorescent quenching group at the 3' end of the probe sequence;

[0076] SEQ ID NO.1: GCAGCGACCATACAACCAC (sense primer 1);

[0077] SEQ ID NO.2: CTCCTCGAGGCAGTCTTCC (antisense primer 2);

[0078] SEQ ID NO.7: FAM-CTTGTTGTCAATCAGGTAAGCCCTGCA-BHQ1 (probe);

[0079] For the specific upstream primer for the nucleic acid of Western equine encephalomyelitis virus, its nucleotide sequence is as shown in SEQ ID No.4, the downstream primer's nucleotide sequence is SEQ ID No.5, and the probe sequence is SEQ ID No.6. The probe is labeled with a fluorescein at the 5' end of the probe sequence and a fluorescent quenching group at the 3' end of the probe sequence;

[0080] SEQ ID NO.3: AAGGAGACGTCTGCCGGAT (sense primer 4);

[0081] SEQ ID NO.4: CGTAGGTGACGTTCTTGCC (Antisense primer 5);

[0082] SEQ ID NO.8: ROX-CTGACGCTTCCTCCAGATAGGAC-BHQ2 (Probe);

[0083] The nucleotide sequence of the specific upstream primer for Venezuelan equine encephalitis virus nucleic acid is as shown in SEQ ID No.7, the nucleotide sequence of the downstream primer is SEQ ID No.8, and the probe sequence is SEQ ID No.9. The 5' end of the probe sequence is labeled with a fluorophore, and the 3' end of the probe sequence is labeled with a fluorescence quenching group;

[0084] SEQ ID NO.5: ATTCCATTAGCCTTTGACATCC (Sense primer 7);

[0085] SEQ ID NO.6: CATTAAGAGTGCATTCGGCCG (Antisense primer 8);

[0086] SEQ ID NO.9: CY5-CGCCTTGTTTACCAGGGTGTCAG-BHQ3 (Probe).

[0087] Example 2. Further optimization of the detection system

[0088] Based on the optimal primer / probe system of Example 1, the triple fluorescence quantitative RT-PCR conditions for Venezuelan equine encephalitis virus nucleic acid (Eastern, Western, and Venezuelan) were optimized, specifically including the following aspects:

[0089] 1. Extract the genomic RNA of Venezuelan equine encephalitis virus from various source samples. Through experiments, the preferred methods for extracting the genomic RNA of Venezuelan equine encephalitis virus are: using the TIANamp Virus DNA / RNA Kit (Viral Genomic DNA / RNA Extraction Kit), or using the Trizol nucleic acid extraction method, or using an automatic nucleic acid extraction device and its supporting full-virus genome extraction kit (Promega Maxwell 16 Viral Total Nucleic Acid Purification kit).

[0090] 2. Determine the primer concentration, probe concentration, reverse transcriptase dosage, Taq DNA polymerase dosage, and determine the reaction system or use the reaction system specified by the kit. After optimization, the preferred reaction system is 30 μL, which are respectively 15 μL of 2×One Step RT-PCR Buffer Ⅲ (2×), 1 μL of TakaRa Ex Taq Hs, 1 μL of PrimerScript RT Enzyme Mix, probe concentration 20 μmol / L, 0.25 μL - 0.5 μL of probe, upstream primer concentration 20 μmol / L, 0.5 μL of upstream primer, downstream primer concentration 20 μmol / L, 0.5 μL of downstream primer, 3 μL - 5 μL of template RNA, and supplement RNaes-Free ddH2O to 30 μL, as shown in the following table:

[0091]

[0092] 3. Based on the characteristics of the selected reverse transcriptase, primers, and probes, determine the temperature and time of the reverse transcription, denaturation, annealing, and extension stages, and determine the reaction conditions; or determine the corresponding reaction conditions after verification according to the reaction conditions specified by the kit. After optimization, the preferred reaction conditions are: 50 °C / 15 min, 95 °C / 5 min: 95 °C / 10 s, 55 °C / 30 s, 45 cycles; fluorescence collection is set at the 55 °C annealing and extension stage.

[0093] 4. Establish the principle for judging the detection results. Perform 10-fold serial dilutions on standard plasmid samples known to contain the genomes of Eastern, Western, and Venezuelan equine encephalitis viruses, determine the sensitivity of the detection method, and through multiple repeated verifications, clarify the principle for judging the detection results.

[0094] 5. After preparing the reaction system, perform detection on the instrument to detect whether the test sample has a fluorescence curve specific to the genomes of Eastern, Western, and Venezuelan equine encephalitis viruses that conforms to the judgment principle. Specifically, if a specific fluorescence curve for the real-time fluorescence RT-PCR detection of Eastern, Western, and Venezuelan equine encephalitis viruses is obtained, it proves that the test sample contains Eastern, Western, and Venezuelan equine encephalitis viruses.

[0095] Example 3. Establishment of the detection system

[0096] According to the above optimization, establish the detection system of the present application, and the specific steps include the following aspects.

[0097] 1. Preparation of the template to be tested

[0098] Method 1: Extract the genomic RNA of Eastern, Western, and Venezuelan equine encephalitis viruses using the Trizol nucleic acid extraction method. The specific operation steps are as follows:

[0099] Step 1: Add 100 μL of the supernatant of the sample (serum / plasma / sample cell culture lysate, etc.) into an RNase-Free centrifuge tube (1.5 mL), then add 300 μL of Trizol tissue extraction solution thereto, and shake well on an oscillator. Then centrifuge at 12,000 rpm for 10 min in a low-temperature ultra-high-speed refrigerated centrifuge (4 °C), and transfer the supernatant to a new RNase-Free centrifuge tube (1.5 mL).

[0100] Step 2: Add 400 μL of pre-cooled isopropanol to the collected supernatant, shake well on an oscillator, and then centrifuge at 12,000 rpm for 10 min in a low-temperature ultra-high-speed refrigerated centrifuge.

[0101] Step 3: Carefully discard the supernatant to obtain the RNA precipitate, add 600 μL of 75% ethanol, gently shake the centrifuge tube to suspend the precipitate.

[0102] Step 4: Centrifuge at 12,000 g for 10 min at 4 °C, and try to discard the supernatant as much as possible.

[0103] Step 5: Air-dry at room temperature or dry in vacuum for 5 - 10 min. (Note: The RNA sample should not be overly dried, otherwise it will be difficult to dissolve)

[0104] Step 6: After the ethanol has completely evaporated, add 50 - 70 μL of RNase-Free ddH2O to fully dissolve it, and store it for standby at -20 °C.

[0105] Method 2: Use a fully automatic nucleic acid extractor and its supporting extraction reagents, etc. to extract the genomic RNA of Eastern equine encephalitis virus, Western equine encephalitis virus, and Venezuelan equine encephalitis virus. For example, use the nucleic acid automatic extraction equipment of Promega Maxwell brand and its supporting full-virus genome extraction kit (Promega Maxwell 16 Viral Total Nucleic Acid Purification kit) to automatically extract the genomic RNA of Eastern equine encephalitis virus, Western equine encephalitis virus, and Venezuelan equine encephalitis virus.

[0106] 2. Reaction system and reaction conditions for real-time fluorescence RT-PCR detection:

[0107] Select the commercial kit TakaRa One-Step Prime The reaction system established by the RT-PCR Kit (Perfect RealTime) is 30 μL, which are respectively: 15 μL of 2× One Step RT-PCR Buffer Ⅲ (2×), 1 μL of TakaRa Ex Taq Hs, 1 μL of Primer Script RT Enzyme Mix, the probe concentration is 20 μmol / L, 0.25 μL - 0.5 μL of the probe, the upstream primer concentration is 20 μmol / L, 0.5 μL of the upstream primer, the downstream primer concentration is 20 μmol / L, 0.5 μL of the downstream primer, 3 μL - 5 μL of template RNA, and supplemented with RNaes-Free ddH2O to 30 μL.

[0108] Place the reaction tubes added with reaction reagents and test samples into a fluorescence PCR instrument, set the corresponding fluorescence collection conditions according to the fluorescent reporter group labeled by the probe, and perform the amplification detection of the target fragment according to the reaction conditions (42℃ - 50℃ for 30 min; 95℃ for 3 min; 95℃ for 15 sec, 55℃ - 60℃ for 30 sec, amplify for 35 - 40 cycles, and start collecting fluorescence signals at the end of 55℃ - 60℃), observe the detection results in real time, and evaluate the results based on the detection results.

[0109] Example 4, Detection Specificity Evaluation

[0110] In a 30 μL reaction system, add positive plasmids of equine encephalomyelitis virus (eastern type, western type, and Venezuelan type) and genomic RNAs of other animal disease viruses (including equine influenza virus, equine viral arteritis virus, West Nile fever virus, equine herpesvirus type 1, etc.) into different detection reaction tubes as templates respectively. Add primers and probes specific to equine encephalomyelitis virus (eastern type, western type, and Venezuelan type) into each reaction tube according to the method system of Example 3, and perform real-time fluorescence RT-PCR detection according to the reaction system and conditions of this application.

[0111] The results are as Figure 3 shown. Only the reaction tubes added with positive plasmids of equine encephalomyelitis virus (eastern type, western type, and Venezuelan type) show specific S-shaped amplification curves, and there are no corresponding specific amplification curves in other reaction tubes. The detection system of this application can specifically detect only equine encephalomyelitis virus (eastern type, western type, and Venezuelan type), and there is no amplification of the genomic RNAs of other animal viruses.

[0112] Example 5, Detection Sensitivity Evaluation

[0113] In a 30 μL reaction system, serially dilute the positive plasmids of equine encephalomyelitis virus (eastern type, western type, and Venezuelan type) with known concentrations by 10-fold, and perform real-time fluorescence RT-PCR detection according to the method system of Example 3.

[0114] The detailed evaluation results are as Figures 4-6 shown. The results indicate that the triple real-time fluorescence RT-PCR detection method of the present application has very high detection sensitivity: the detection sensitivity for Eastern equine encephalomyelitis virus is 10 -7 , the detection sensitivity for Western equine encephalomyelitis virus is 10 -8 , and the detection sensitivity for Venezuelan equine encephalomyelitis virus is 10 -8 , which is significantly better than the existing detection means.

[0115] In addition, when using the detection system of the present application to detect the genomic RNA of equine encephalomyelitis virus (Eastern, Western, and Venezuelan), the operation is simple and fast. The entire real-time fluorescence detection time is about 90 minutes, which is at least about 1 hour less than the reaction time of ordinary RT-PCR detection. Moreover, the detection results can be observed in real time during the reaction process, without the need for electrophoresis of amplification products and observation under ultraviolet light, etc.

[0116] The foregoing description of specific exemplary embodiments of the present application is for the purposes of illustration and exemplification. These descriptions are not intended to limit the present application to the precise forms disclosed, and it is obvious that many changes and variations can be made in light of the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present application and its practical applications, so that those skilled in the art can implement and utilize various different exemplary embodiments of the present application, as well as various different selections and changes. The scope of the present application is intended to be defined by the claims and their equivalents.

Claims

1. A primer-probe composition for co-detection of equine encephalomyelitis virus, characterized in that, The primer-probes are respectively directed against Eastern equine encephalomyelitis virus, Western equine encephalomyelitis virus and Venezuelan equine encephalomyelitis virus.

2. The primer-probe composition according to claim 1, wherein The target regions of the primer-probes for Eastern equine encephalomyelitis virus are the E2 structural protein regions, the target regions for Western equine encephalomyelitis virus are the E2 protein regions, and the target regions for Venezuelan equine encephalomyelitis virus are the E1 protein regions.

3. The primer-probe composition according to any one of claims 1-2, characterized in that, The sequences of the primers are respectively as shown in SEQ ID NO.1-6, or have at least 90% homology with SEQ ID NO.1-6.

4. The primer-probe composition according to any one of claims 1-3, characterized in that The sequences of the probes are respectively as shown in SEQ ID NO.7-9, or have at least 90% homology with SEQ ID NO.7-9.

5. The primer-probe composition according to any one of claims 1-4, characterized in that The 5'-end of the probe is labeled with fluorescein, and the 3'-end is labeled with a fluorescence quenching gene; preferably, the sequences of the probes after labeling are as follows: SEQ ID NO.7: FAM-CTTGTTGTCAATCAGGTAAGCCCTGCA-BHQ1; SEQ ID NO.8: ROX-CTGACGCTTCCTCCAGATAGGAC-BHQ2; SEQ ID NO.9: CY5-CGCCTTGTTTACCAGGGTGTCAG-BHQ3.

6. A product for simultaneously detecting equine encephalomyelitis virus, characterized in that, Comprising the primer-probe composition according to any one of claims 1-5.

7. The product according to claim 7, characterized in that, The product is a detection kit; preferably, the detection kit further comprises a fluorescent RT-PCR buffer, Taq enzyme and reverse transcriptase.

8. Use of the primer-probe composition according to any one of claims 1-5 in co-detecting equine encephalomyelitis virus, or use in preparing a kit for co-detecting equine encephalomyelitis virus.

9. The application according to claim 8, characterized in that, The equine encephalomyelitis virus includes Eastern equine encephalomyelitis virus, Western equine encephalomyelitis virus and Venezuelan equine encephalomyelitis virus.

10. A method for co-detecting equine encephalomyelitis virus, characterized in that, Including the step of detecting a test sample using the primer-probe combination according to any one of claims 1-5 or the product according to any one of claims 6-7; preferably, the co-detection can simultaneously detect Eastern equine encephalomyelitis virus, Western equine encephalomyelitis virus and Venezuelan equine encephalomyelitis virus.

Images