Application of small nucleolus SnoRD89 in preparation of ovarian cancer targeting drug

Abstract

The invention belongs to the technical field of biological medicines, and relates to application of small nucleolus SnoRD89 in preparation of an ovarian cancer targeting drug. The invention discloses that SnoRD89 inhibits the malignant phenotype of ovarian cancer cells by influencing the RPL11 / MDM2 / P53 pathway for the first time. The invention finds a new effective method for targeted regulation and control of apoptosis signal channels, that is, ovarian cancer cell apoptosis is induced through siRNA of targeted SnoRD89, and the method is applied to basic medical research.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of a nucleolar small SnoRD89 in preparation of an ovarian cancer targeted drug. BACKGROUND

[0002] Ovarian cancer is one of the most malignant tumors in women worldwide. Ovarian cancer is a highly heterogeneous disease caused by multiple factors. The main high-risk factors for ovarian cancer include genetic factors, reproductive factors, environmental factors, etc. Although ovarian cancer is sensitive to platinum-based chemotherapy in the early stage of treatment, it is prone to develop drug resistance and metastasis, which is directly related to the poor prognosis of ovarian cancer. Therefore, timely and accurate treatment of ovarian cancer directly affects the prognosis of ovarian cancer patients. Exploring a new type of high-sensitivity and high-specificity ovarian cancer treatment target to improve the prognosis of ovarian cancer patients and improve the long-term quality of life is the focus and difficulty of clinical concern in recent years.

[0003] Small nucleolar RNA (SnoRNA) is a kind of non-coding RNA widely distributed in the nucleolus of eukaryotic cells, with a length of 60-300 nt. Mature SnoRNA forms a SnoRNPs complex by combining with Ribosomal Protein (RP), and is involved in ribosomal RNA processing, variable splicing, mRNA transcription silencing, etc. SnoRNA can be divided into H / ACA box SnoRNA (SNORAs) and C / D box SnoRNA (SNORDs) according to its structural basis. SNORAs form a complex with dyskerin, which is responsible for rRNA pseudouridylation modification, while SNORDs form a nucleolar RNA-protein complex with fibroin (FBL) and guide 2'-O-methylation modification. SnoRNA-guided rRNA modification, especially 2'-O-methylation modification, will affect ribosome biosynthesis, translation activity and fidelity.

[0004] In recent years, the relationship between SnoRNA and cancer has become a research hotspot in the field of cancer research, and more and more SnoRNAs have been proven to be abnormally expressed in various human cancers including ovarian cancer. It has been found that SnoRNA is related to tumor cell proliferation, apoptosis, epithelial-mesenchymal transition and migration and invasion, indicating that SnoRNA plays an important role in the biological process of tumors and gradually becomes a molecular marker for tumor diagnosis, prognosis and therapeutic target. Therefore, based on the abnormal expression and biological function of SnoRNA in ovarian cancer, exploring new SnoRNA as a molecular therapeutic target and prognostic marker for ovarian cancer has far-reaching clinical significance for improving the five-year survival rate of ovarian cancer patients and improving the prognosis of ovarian cancer. SUMMARY

[0005] Based on the above technical background, the application proposes a new application of nucleolar small RNA SnoRD89 as an ovarian cancer prognosis marker and treatment target in view of the problems existing in traditional ovarian cancer treatment and prognosis.

[0006] To achieve the above technical purpose, the application provides the following technical scheme:

[0007] The application of the nucleolar small SnoRD89 in the preparation of an ovarian cancer targeted drug, wherein the nucleolar small SnoRD89 inhibits the proliferation and invasion and migration abilities of ovarian cancer cells through an RPL11 / MDM2 / P53 pathway.

[0008] Further, the nucleolar small SnoRD89 reduces the protein level of P53.

[0009] Further, the nucleolar small SnoRD89 inhibits the expression of RPL11 in the nucleolus of ovarian cancer cells and promotes the expression of RPL11 in the nucleolus.

[0010] The nucleolar small SnoRD89 is derived from human chromosome 2 and is mainly expressed in the nucleolus of cells, and the deoxyribonucleotide sequence of SnoRD89 is: >NR_003070.1|SnoRD89

[0011] ACTGAGGAATGATGACAAGAAAAGGCCGAATTGCAGTGTCTCCATCA GCAGTTTGCTCTCCATGGGCACACGATGACAAAATATCCTGAAGCGAACC ACTAGTCTGACCTCAGT.

[0012] Compared with the prior art, the application has the following advantages:

[0013] 1. The application finds that SnoRD89 can be used as a prognosis marker and treatment target for ovarian cancer, and provides a new idea for improving the prognosis and treatment of ovarian cancer.

[0014] 2. Research shows that SnoRD89 is significantly up-regulated in tumor tissues of ovarian cancer patients compared with normal tissues, and using SnoRD89 as a molecular marker has good clinical significance.

[0015] 3. The results of the application show that interfering with SnoRD89 can inhibit the proliferation and migration and invasion abilities of ovarian cancer cells, indicating that SnoRD89 plays a role in promoting oncogenes in the occurrence and development of ovarian cancer, and provides a new idea for the clinical treatment of ovarian cancer, and is expected to become a new treatment target for ovarian cancer.

[0016] 4. The present application first discloses that SnoRD89 inhibits the malignant phenotype of ovarian cancer cells by affecting the RPL11 / MDM2 / P53 pathway. The present application finds a new effective method for the targeted regulation of the apoptosis signaling pathway, i.e. inducing apoptosis of ovarian cancer cells by targeting siRNA of SnoRD89 and applying it in basic medical research. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Fold Change top 20 of differentially expressed SnoRNs in the tissue chip in the specific embodiment.

[0018] Figure 2 Analysis results of SnoRD89 expression based on TCGA and GTEx databases in the specific embodiment.

[0019] Figure 3 SnoRD89 expression results in the high age group and patients with poor treatment effect in the specific embodiment.

[0020] Figure 4 Relationship between SnoRD89 and overall survival and 5-year survival of ovarian cancer patients in the specific embodiment.

[0021] Figure 5 Effect of SnoRD89 knockdown on the proliferation ability of ovarian cancer cells OVCAR-3 and CAOV-3 in cck8 and plate cloning experiments in the specific embodiment.

[0022] Figure 6 Effect of SnoRD89 knockdown on the migration ability of ovarian cancer CAOV-3 cells in the specific embodiment.

[0023] Figure 7 SnoRD89 single gene GSEA analysis results in the specific embodiment.

[0024] Figure 8 Effect of SnoRD89 on the mRNA level and protein level of P53 in the specific embodiment, which can be seen to have no effect on the mRNA level but to reduce the P53 protein level.

[0025] Figure 9 Effect of SnoRD89 overexpression on the expression of RPL11 in the nucleus of ovarian cancer cells in the specific embodiment, which can be seen to inhibit the expression of RPL11 in the nucleus and cytoplasm of ovarian cancer cells and promote its expression in the nucleolus. DETAILED DESCRIPTION

[0026] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific examples.

[0027] SnoRNA, SnoRD89, which is derived from human chromosome 2, located at 2q11.2, has 114 base pairs, is mainly expressed in the nucleolus of cells, and the deoxyribonucleotide sequence of SnoRD89 is:

[0028] > NR_003070.1 | SnoRD89

[0029] ACTGAGGAATGATGACAAGAAAAGGCCGAATTGCAGTGTCTCCATCAGCAGTTTGCTCTCCATGGGCACACGATGACAAAATATCCTGAAGCGAACCACTAGTCTGACCTCAGT

[0030] Example 1 Expression and clinical significance of SnoRD89 in ovarian cancer

[0031] (1) In this embodiment, bioinformatics technology is used to download RNA-Seq sequencing data and clinical data of 379 ovarian cancer patient tissue samples and normal ovarian tissue samples from TCGA and GTEx databases, respectively.

[0032] (2) The expression of SnoRNA in ovarian cancer tissue samples and normal ovarian tissue samples is compared, and the standard of P < 0.05 is used as the judgment of whether the expression of the gene has a significant difference, wherein SnoRD89 is abnormally highly expressed in ovarian cancer tissue samples (see Figure 1 and Figure 2 ), and the correlation between the expression of SnoRD89 and the state of the patient is analyzed ( Figure 3 ).

[0033] At the same time, the survival curve of the relationship between the expression of SnoRD89 in the tumor tissue of ovarian cancer patients and the survival time of patients is drawn using GraphPad prism. Among them, the expression of SnoRD89 is divided into low expression and high expression according to the median value of the expression in the tumor tissue of 379 ovarian cancer patients. The Log-rank (Mantel-Cox) test method is used, and the standard of P < 0.05 is used as the judgment of whether the difference in survival time of patients in the high expression group and the low expression group of SnoRD89 has statistical significance. The results show that patients with high expression of SnoRD89 have a poorer prognosis, and are related to the stage of the patient ( Figure 4 ).

[0034] Example 2 Effect of SnoRD89 on malignant behavior of ovarian cancer

[0035] 1. Cell transfection experiment:

[0036] OVCAR-3 (OV) and CAOV-3 (CA) ovarian cancer cells were purchased from ATCC, and well-grown ovarian cancer cells OV and CA were inoculated into 6-well plates, respectively, and cultured in RPMI-1640 medium containing 10% fetal bovine serum for 24 h, and the culture conditions were 37°C, 5% CO2 constant temperature culture. When the cell fusion degree reached 70%-90%, transfection was performed. When the ovarian cancer cells were transfected, serum-free and double-antibody-free RPMI-1640 medium was used to dissolve transfection reagents Lip3000, P3000 and SnoRD89 silencing plasmid (the silencing plasmid was from the Jikai Company):

[0037] First, 5 μL of Lip3000 was added to an EP tube containing 100 μL of serum-free and double-antibody-free RPMI-1640 medium, vortexed, and incubated for 5 min to obtain a Lip3000 solution. 3 μg of SnoRD89 silencing plasmid was added to an EP tube containing 100 μL of medium, mixed well, and then 10 μL of P3000 was added, vortexed, and incubated for 5 min to obtain a plasmid solution. The Lip3000 solution and the plasmid solution were mixed, vortexed, and incubated for 15 min.

[0038] The original culture medium in the six-well plate was discarded, washed with PBS, and replaced with new culture medium. The above-mentioned mixed solution was added to the six-well plate at 200 μL per well, and the cell culture box (37°C, 5% carbon dioxide) was placed in the cell culture box.

[0039] The conditions of "incubator" and "incubation" referred to in the following experiments were 37°C, 5% carbon dioxide.

[0040] 2. Plate cloning experiment:

[0041] The ovarian cancer cells transfected with the SnoRD89 plasmid were collected, washed once with PBS, and digested into single cells with 0.25% trypsin. The digestion was terminated with RPMI-1640 medium containing 10% fetal bovine serum, and washed once with PBS. 800 cells per well were added to the six-well plate, and placed in the incubator for 12 days. The culture was terminated, the culture medium was discarded, the cells were washed with PBS, 1 mL of 0.5% crystal violet solution was added for staining for 1.5 h, and the cells were washed with PBS multiple times. Photographs were taken, and the number of colonies formed per well was calculated. Each group had 3 replicate wells.

[0042] 3. Cell proliferation detection experiment CCK8:

[0043] Collect ovarian cancer cells in good growth state, resuspend after digestion, and perform cell counting. Seed cells in 4 96-well plates, with 2000 ovarian cancer cells per well and 12 wells per 96-well plate; and 5000 ovarian cancer stem cells per well and 18 wells per 96-well plate. Incubate in an incubator for 24 h, and then perform transfection using serum-free and double-antibody-free RPMI-1640 medium:

[0044] First, add 0.2 μL of Lip3000 to an EP tube containing 10 μL of medium, vortex, and stand for 5 min to obtain a Lip3000 mixture. Add 0.1 μg of SnoRD89 plasmid to an EP tube containing 10 μL of medium, mix, and then add 0.2 μL of P3000, vortex, and stand for 5 min to obtain a plasmid mixture. Transfer the Lip3000 mixture and the plasmid mixture to the same EP tube, vortex, mix, and stand, and incubate at room temperature for 15 min. Discard the original medium in the six-well plate, wash the cells with PBS, and replace the medium. Add the incubated mixture to the six-well plate, 20 μL per well.

[0045] Place the 96-well plate with the transfected cells in a cell culture incubator, and at 24 h, 48 h, 72 h, and 96 h, add 10 μL of CCK8 reagent per well, shake to mix, incubate for 3 h, and measure the absorbance of the cells at 450 nm using a microplate reader. Take 6 replicates per group, and take the 4 replicates with the closest values for statistical analysis of the experimental results.

[0046] Figure 5 As shown, in the plate cloning experiment, knocking down SnoRD89 inhibited the proliferation of ovarian cancer cells; and in the cck8 experiment, knocking down SnoRD89 also inhibited the proliferation of ovarian cancer cells.

[0047] 4. Transwell cell migration experiment:

[0048] Discard the serum-containing RPMI-1640 medium in the cells transfected with the SnoRD89 silencing plasmid, and wash the cells with PBS. Then, culture the cells in serum-free RPMI-1640 medium, and starve for 12 h. Collect the cells, digest with trypsin, centrifuge, and discard the supernatant. Wash the cell pellet with PBS, resuspend the cell pellet in serum-free RPMI-1640 medium to obtain a single-cell suspension, and count the cells.

[0049] RPMI-1640 medium containing 20% fetal bovine serum 600 μL was added to the lower chamber of the Transwell chamber, and the above-mentioned cell suspension 100 μL (containing 20,000 cells) resuspended in serum-free RPMI-1640 medium was added to the upper chamber, and after being placed in an incubator for 36 hours, the culture plate with the lower chamber was taken out, and the medium in the upper chamber and the chamber of the Transwell chamber was sucked out. 200 μL and 1 mL of PBS were added to the upper chamber and the lower chamber of the chamber, respectively, shaken, washed, and the PBS was repeatedly washed 3 times. The PBS in the upper chamber and the lower chamber was sucked out, 600 μL of polyformaldehyde was added to the lower chamber, and the cells were fixed for about 30 minutes, and then the cells were washed with PBS for 2 times. 600 μL of 0.5% crystal violet solution was added to the lower chamber, and the cells were stained for about 30 minutes. The chamber was washed with PBS for 3 times, the cells in the upper chamber of the Transwell chamber were wiped off with a cotton ball, and the cells were naturally dried. The chamber was taken out, the cells that penetrated into the lower chamber were photographed under a microscope, 5 fields of view were randomly selected for photography, and the number of cells that penetrated into the lower chamber was counted using Image J software. The statistical analysis was performed by unpaired t test, and the results are shown in Figure 6 Figure 6. The Transwell experiment proves that knocking down SnoRD89 can significantly reduce the migration ability of cancer cells.

[0050] Example 3 Mechanism of action of SnoRD89

[0051] 1. Reverse transcription-quantitative polymerase chain reaction (qRT-PCR): Referring to Example 2, the SnoRD89 overexpression plasmid was transfected, and then total RNA samples were extracted from the cells transfected with the SnoRD89 overexpression plasmid using TRIzol reagent. The cDNA of mRNA was synthesized from the total RNA using the ReverTra Ace qPCR RT Kit. qRT-PCR was performed on P53 using the SYBR qPCR mixture. A 10 μL reaction system was set up, and 40 cycles were amplified. The above operations were performed on a qRT-PCR instrument. Finally, melting curve analysis was performed to verify the specificity of the expected PCR product. The relative expression was calculated using the 2-ΔΔCt method. Three independent samples were prepared for each determination, and each experiment was performed 3 times.

[0052] 2. Western blot: After SnoRD89 transfection, proteins were extracted from ovarian cancer cells, separated by SDS-polyacrylamide gel electrophoresis, and transferred to a polyvinylidene fluoride (PVDF) membrane. The corresponding primary antibody (β-actin protein antibody and P53 protein antibody) was incubated at 4°C overnight, and the secondary antibody (IgG protein antibody) was observed by enhanced chemiluminescence (ECL) after binding.

[0053] In order to further study the reason why SnoRD89 affects the malignant behavior of ovarian cancer, the single gene GSEA analysis of SnoRD89 was performed in this embodiment, and the results showed that SnoRD89 high expression active ribosome pathway and protein ubiquitination degradation pathway, inhibited P53 pathway, see Figure 7 .

[0054] As shown in Figure 8 , after overexpression of SnoRD89 in ovarian cancer cells, the mRNA level and protein level of P53 were detected by qRT-PCR and Western blot, and the results showed that overexpression of SnoRD89 had no significant effect on the mRNA level of P53, but reduced the protein level of P53.

[0055] As shown in Figure 9 , after transfection of ovarian cancer cells with SnoRD89 overexpression plasmid, the cytoplasm, nucleolus and nucleolus components were separated by sucrose gradient separation method, and the distribution of RPL11 in different components was detected by Western blot, and the results showed that overexpression of SnoRD89 inhibited the expression of RPL11 in nucleolus of ovarian cancer cells, and promoted the expression of RPL11 in nucleolus.

[0056] The above results show that SnoRD89 promotes the ubiquitination degradation of P53 protein in ovarian cancer cells through RPL11-MDM2-P53 pathway, thereby playing the role of oncogene.

[0057] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. Application of nucleolus small SnoRD89 in preparation of an ovarian cancer targeted drug, wherein the nucleolus small SnoRD89 inhibits the proliferation and invasion and migration abilities of ovarian cancer cells through an RPL11 / MDM2 / P53 pathway.

2. Use according to claim 1, characterized in that, The nucleolus small SnoRD89 reduces the protein level of P53.

3. Use according to claim 1, characterized in that, The nucleolus small SnoRD89 inhibits the expression of RPL11 in the nucleoplasm of ovarian cancer cells and promotes the expression of RPL11 in the nucleolus.

4. Use according to claim 1, characterized in that, The nucleolus small SnoRD89 is derived from human chromosome 2 and is mainly expressed in the nucleolus of cells, and the deoxyribonucleotide sequence of SnoRD89 is: >NR_003070.1|SnoRD89 ACTGAGGAATGATGACAAGAAAAGGCCGAATTGCAGTGTCTCCATCA GCAGTTTGCTCTCCATGGGCACACGATGACAAAATATCCTGAAGCGAACC ACTAGTCTGACCTCAGT.

Images