Compounds and methods for modulating alpha-synuclein expression

Abstract

Provided herein are compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of SNCA mRNA in a cell or subject, and in some instances, the amount of alpha-synuclein in a cell or subject. Such compounds, pharmaceutical compositions, and methods of use are useful for ameliorating at least one symptom or marker of synucleinopathies. Such synucleinopathies include Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multi-system atrophy (MSA), neurological Gaucher's disease, and Alzheimer's disease.

Description

[0001] sequence list This application is submitted together with the electronic sequence listing. The sequence listing is provided as a file named BIOL0468SEQ.xml, created on February 2, 2024, and is 3,338 KB in size. The information of the electronic sequence listing is incorporated herein by reference in its entirety. Technical Field

[0002] This article provides compounds, pharmaceutical compositions, and methods for reducing the amount or activity of α-synuclein (SNCA) RNA in cells or subjects, and in certain cases, reducing the amount of α-synuclein in cells or subjects. These compounds, pharmaceutical compositions, and methods can be used to improve at least one symptom or marker of synucleinopathy (or α-synucleinopathy). Such symptoms and markers include motor dysfunction, α-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmegma, autonomic dysfunction, ataxia, hallucinations, and seizures. Such synucleinopathy includes Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic dysfunction, multiple system atrophy (MSA), neurogenic Gaucher disease, and Alzheimer's disease. Background Technology

[0003] α-synuclein is a small, highly charged protein of 140 amino acid residues, primarily expressed in neurons of the central nervous system (CNS), specifically located at the presynaptic terminal near synaptic vesicles (Iwai et al., Neuron. 1995. 14: 467-475). α-synuclein is encoded by the SNCA gene. As demonstrated in vitro, α-synuclein can associate with lipid membranes by forming an amphiphilic α-helix (Davidson et al., J. Biol. Chem. 1998. 273: 9443-9449). Multiple studies have shown that α-synuclein is involved in regulating synaptic transmission, synaptic vesicle density, and neuronal plasticity (Cabin et al., J. Neurosci. 2002. 22: 8797-8807; Burre et al., Science. 2010. 329: 1663-1667; and Burre et al., J. Neurosci. 2015. 35: 5221-5232). It has been shown that SNCA inhibits synaptic vesicle release and disrupts SNARE complex-mediated lipid membrane fusion (DeWitt et al., Biochemistry. 2013. 52: 2385-2387; Abeliovich et al., Neuron. 2000. 25: 239-252). Reduced assembly of the SNARE complex is associated with neurological damage, thus suggesting a link between presynaptic α-synuclein aggregates and neurodegeneration (Kramer and Schulz-Schaeffer, J. Neurosci. 2007. 27: 1405-1410). α-synuclein gene knockout mouse models are non-fatal and exhibit intact brain morphology, suggesting that α-synuclein is not essential for neuronal development and / or that compensatory pathways exist (Abeliovich et al., Neuron. 2000. 25: 239-252).

[0004] Misfolding, aggregation, and fibrillation of α-synuclein are considered key factors in several neurodegenerative diseases, including Parkinson's disease, Lewy body variants of Alzheimer's disease, diffuse Lewy body disease, Lewy body dementia, and multiple system atrophy (Schulz-Schaeffer, Acta Neuropathol. 2010. 120: 131-143; Yoshida. Neuropathology. 2007. 27: 484-493). In each case, α-synuclein is misfolded and assembles into aggregates in the Lewy body and Lewy neurites (Uversky. J. Neurochem. 2007. 103: 17-37).

[0005] Point mutations, genomic duplications, or genomic triplet duplications in the SNCA gene are associated with Parkinson's disease and other synucleinopathies. For example, six missense mutations in the SNCA gene are associated with autosomal dominant Parkinson's disease (A53T, A30P, E46K, H50Q, G51D, and A53E). The clustering of mutations within the membrane-binding domain suggests that this region contributes to SNCA dysfunction. See For example, Brás et al., Cells. 2021.10: 375.

[0006] Currently, there are no acceptable options for treating synucleinopathies such as Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, and Alzheimer's disease. Therefore, one objective of this article is to provide compounds, pharmaceutical compositions, and methods of administration for the treatment of these synucleinopathies. Summary of the Invention

[0007] This document provides compounds, pharmaceutical compositions, and methods of use thereof for reducing the amount or activity of SNCA RNA, and in some embodiments, for reducing the amount of α-synuclein in cells or subjects. In some embodiments, the subject suffers from synucleinosis. In some embodiments, the subject suffers from Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease. In some embodiments, the compound that can be used to reduce the amount or activity of SNCA RNA is an oligomeric compound. In some embodiments, the compound that can be used to reduce the amount or activity of SNCA RNA is a modified oligonucleotide. In some embodiments, the compound that can be used to reduce the amount of α-synuclein is an oligomeric compound. In some embodiments, the compound that can be used to reduce the amount of α-synuclein is a modified oligonucleotide.

[0008] This article also provides methods for improving at least one symptom or marker of synucleinopathy. In some embodiments, synucleinopathy is Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease. In some embodiments, symptoms or markers include motor dysfunction, α-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disturbances, hyposmegma, autonomic failure, ataxia, hallucinations, or seizures. In some embodiments, improvement of one or more of these symptoms or markers may result in improved motor function, reduced α-synuclein aggregation, reduced neurodegeneration, cognitive decline, reduced dementia, improved sleep, improved sense of smell, reduced autonomic failure, reduced ataxia, reduced hallucinations, and / or reduced seizures. Attached Figure Description

[0009] Various aspects of this disclosure are set forth in the appended claims. A better understanding of the features and advantages of this disclosure will be obtained by referring to the following detailed description of illustrative embodiments in which the principles of this disclosure are utilized in the following drawings.

[0010] Figure 1 This study demonstrates the duration of action using the exemplary modified oligonucleotides described herein.

[0011] Figure 2 The tissue concentrations of the exemplary modified oligonucleotides described herein are shown.

[0012] Figure 3 The ASO concentrations using the exemplary modified oligonucleotides described herein are shown. Detailed Implementation

[0013] It should be understood that the foregoing general description and the following detailed description are exemplary and illustrative only, and not restrictive. In this document, unless otherwise specified, the use of the singular includes the plural. As used herein, unless otherwise specified, the use of “or” means “and / or”. Furthermore, the use of the term “including” and other forms such as “includes” and “included” is not restrictive. Moreover, unless otherwise specified, terms such as “element” or “component” cover both elements and components that comprise a single unit and elements and components that comprise more than one subunit.

[0014] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions thereof cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are hereby expressly incorporated herein by reference in whole or in part in respect of the documents discussed herein.

[0015] definition Unless specifically defined herein, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry as described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, as well as other data, mentioned throughout this disclosure are incorporated herein by reference in their entirety.

[0016] Unless otherwise stated, the following terms have the following meanings: As used herein, “2’-deoxynucleoside” means a nucleoside comprising a 2’-H(H)-deoxyribosyl sugar moiety. In some embodiments, the 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside and comprises a 2’-β-D-deoxyribosyl sugar moiety having the β-D ribosyl conformation found in naturally occurring deoxyribonucleic acid (DNA). In some embodiments, the 2’-deoxynucleoside or a nucleoside comprising an unmodified 2’-deoxyribosyl sugar moiety may comprise modified nucleotides or may comprise RNA nucleotides (uracil).

[0017] As used herein, “2’-MOE” refers to a 2’-OCH2CH2OCH3 group that replaces the 2’-OH group of the ribosyl sugar moiety. “2’-MOE sugar moiety” refers to a sugar moiety having a 2’-OCH2CH2OCH3 group that replaces the 2’-OH group of the ribosyl sugar moiety. Unless otherwise stated, the 2’-MOE sugar moiety is β-D configured. “MOE” refers to O-methoxyethyl.

[0018] As used in this article, "2'-MOE nucleoside" or "2'-O(CH2)2OCH3 nucleoside" refers to a nucleoside containing a 2'-MOE sugar moiety (or a 2'-OCH2 CH2OCH3 ribosyl sugar moiety).

[0019] As used herein, “2’-OMe” refers to a 2’-OCH3 group that replaces the 2’-OH group of the ribosyl sugar moiety. “2’-O-methyl sugar moiety” refers to a sugar moiety having a 2’-OCH3 group that replaces the 2’-OH group of the ribosyl sugar moiety. Unless otherwise stated, 2’-OMe has a β-D ribosyl stereochemistry.

[0020] As used in this article, "2'-OMe nucleoside" refers to a nucleoside containing the 2'-OMe sugar moiety.

[0021] As used herein, “2’-F” refers to a 2’-fluorine group that replaces the 2’-OH group of the furanyl sugar moiety. “2’-F sugar moiety” refers to a sugar moiety having a 2’-F group that replaces the 2’-OH group of the furanyl sugar moiety. Unless otherwise stated, the 2’-F sugar moiety is β-D-ribosyl.

[0022] As used in this article, "2'-F nucleoside" refers to a nucleoside containing a 2'-F modified sugar moiety.

[0023] As used herein, “2’-substituted nucleoside” means a nucleoside containing a 2’-substituted furanyl sugar moiety. As used herein, “2’-substituted” with respect to the sugar moiety means a sugar moiety containing at least one 2’-substituent other than H or OH.

[0024] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleobase.

[0025] As used herein, "debased sugar moiety" refers to the sugar moiety that is not attached to a nucleobase. Such debased sugar moieties are sometimes referred to in the art as "debased nucleosides".

[0026] As used herein, “administration” or “administering” means providing a drug or composition to a subject.

[0027] As used herein, “improvement” in relation to treatment means an improvement in at least one symptom or marker relative to the same symptom or marker in the absence of treatment. In some embodiments, improvement is a reduction in the severity or frequency of a symptom or marker, or a delay in the onset or slowing of the severity or frequency of a symptom or marker. In some embodiments, symptoms or markers include motor dysfunction, α-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disturbances, hyposmegma, autonomic dysfunction, ataxia, hallucinations, or seizures. The progression or severity of the indicator can be determined by subjective or objective measurements known to those skilled in the art.

[0028] As used herein, “antisense activity” means any detectable and / or measurable change attributable to the hybridization of an antisense compound with its target nucleic acid. In some embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or protein encoded by such a target nucleic acid compared to the level of the target nucleic acid or target protein in the absence of an antisense compound.

[0029] As used herein, “antense” means an antisense compound and optionally one or more additional features, such as sense compounds.

[0030] As used herein, “antisense compound” means antisense oligonucleotide and optionally one or more additional features, such as conjugation groups.

[0031] As used herein, “sense compound” means sense oligonucleotide and optionally one or more additional features, such as conjugation groups.

[0032] As used herein, "antisense oligonucleotide" means an oligonucleotide capable of hybridizing with a target nucleic acid and possessing at least one antisense activity, including the oligonucleotide moiety of an antisense compound. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0033] As used herein, "sense oligonucleotide" means an oligonucleotide capable of hybridizing with antisense oligonucleotides, including the oligonucleotide moiety of sense compounds. Sense oligonucleotides include, but are not limited to, sense RNAi oligonucleotides.

[0034] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0035] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the bicyclic sugar moiety is a furanyl sugar moiety. In some embodiments, the furanyl sugar moiety is a ribosyl sugar moiety. In some embodiments, the bicyclic sugar moiety does not contain a furanyl sugar moiety.

[0036] As used herein, the term "flat" or "flat-ended" in relation to an oligomeric duplex formed from two oligonucleotides means that there are no unpaired nucleotides at the ends (i.e., no protruding nucleotides). One or both ends of a double-stranded RNAi agent can be flat.

[0037] As used in this article, "cell-targeting portion" means a portion of a conjugate or conjugate that can bind to one or more specific cell types.

[0038] As used herein, “cerebrospinal fluid” or “CSF” refers to the fluid that fills the space surrounding the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” refers to a fluid that has certain properties similar to cerebrospinal fluid (e.g., osmotic pressure, pH, and / or electrolytes) and is biocompatible with CSF.

[0039] As used herein, "chiral enriched" in a population means a group of molecules having the same molecular formula, wherein if a particular chiral center is stereorandom as defined herein, the number or percentage of molecules within the population containing a particular stereochemical configuration at that particular chiral center is greater than the number or percentage of molecules within the population expected to contain the same particular stereochemical configuration at the same particular chiral center. A population of chiral enriched molecules, each containing multiple chiral centers, may contain one or more stereorandom chiral centers. In some embodiments, the molecule is a modified oligonucleotide. In some embodiments, the molecule is an oligomeric compound comprising a modified oligonucleotide. In some embodiments, the chiral center is located at the phosphorus atom of the thiophosphate nucleoside internucleotide bond. In some embodiments, the chiral center is located at the phosphorus atom of the methanesulfonyl phosphate nucleoside internucleotide bond.

[0040] As used herein, “cleavable portion” means a bond or group of atoms that breaks down after being administered to a subject, for example, within a cell, subject, or person.

[0041] As used herein, the term "complementary" for oligonucleotides means that when the nucleotide sequence of an oligonucleotide is aligned in opposite directions with the nucleotide sequence of another nucleic acid, at least 70% of the nucleotides of the oligonucleotide or one or more portions thereof can form hydrogen bonds with the nucleotides of the other nucleic acid or one or more portions thereof. As used herein, "complementary nucleobases" refers to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (… m C) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases are known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at each nucleoside. Instead, some mismatches are tolerable. As used herein, “perfect complementarity” or “100% complementarity” with respect to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to the other oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or, if the oligonucleotides are of the same length, to the other oligonucleotide or nucleic acid at each nucleoside.

[0042] As used in this article, the “complementary region” of an oligonucleotide is the series of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or a target nucleic acid.

[0043] As used herein, a "conjugation group" means a group of atoms directly attached to an oligonucleotide that imparts at least one property to the resulting conjugated oligonucleotide. A conjugation group comprises a conjugation moiety and a conjugation linker that attaches the conjugation moiety to the oligonucleotide.

[0044] As used herein, “conjugate linker” means a single bond or a group of atoms containing at least one bond that links the conjugate portion to the oligonucleotide.

[0045] As used herein, “conjugated moiety” means a group of atoms that, when covalently bound to a molecule, alters one or more properties of that molecule compared to the same molecule lacking a conjugated moiety. Such properties include, but are not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0046] As used herein, “continuous” in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleotide bonds that are adjacent to each other. For example, “continuous nucleobases” means nucleobases that are adjacent to each other in the sequence.

[0047] As used herein, “restricted ethyl” or “cEt” or “cEt sugar moiety” refers to the β-D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is... S Configuration.

[0048] As used in this article, "cEt nucleoside" refers to a nucleoside that contains the cEt sugar moiety.

[0049] As used herein, "deoxyregion" refers to a region of 5 to 12 consecutive nucleotides in which at least 70% of the nucleotides comprise a 2'-deoxy sugar moiety. In some embodiments, each nucleotide is selected from 2'-β-D-deoxynucleotides, bicyclic nucleotides, and 2'-substituted nucleotides. In some embodiments, the deoxyregion supports RNase H activity. In some embodiments, the deoxyregion is a gapmer space or an internal region.

[0050] As used herein, "diluent" means a component in the composition that lacks pharmacological activity but is pharmaceutically necessary or desired. For example, the diluent in an injectable composition may be a liquid, such as aCSF, PBS, or a saline solution.

[0051] As used herein, the term "double-stranded" in relation to a region or oligonucleotide means a double-stranded structure formed by complementary strands of nucleic acids (including, but not limited to, oligonucleotides) that have hybridized with each other. In some embodiments, the two strands of a double-stranded region are separate molecules. In some embodiments, the two strands are regions of the same molecule that have folded onto themselves (e.g., hairpin structures).

[0052] As used in this article, "double strand" or "double strand region" refers to a structure formed by two oligonucleotides or portions thereof that hybridize with each other.

[0053] As used herein, “gapmer” means a modified oligonucleotide comprising an inner region of multiple nucleotides supporting RNase H cleavage, located between an outer region containing one or more nucleotides, wherein the nucleotides comprising the inner region are chemically different from the one or more nucleotides comprising the outer region. The inner region may be referred to as a “gap,” and the outer region may be referred to as a “wing” or “wing segment.” In some embodiments, the inner region is a deoxygenated region. The position of the inner region or gap refers to the sequence of the nucleotides in the inner region and is counted starting from the 5' end of the inner region. Unless otherwise stated, “gapmer” refers to a glycosylation motif. In some embodiments, each nucleotide of the gap is a 2'-β-D-deoxynucleotide. In some embodiments, the gap contains a 2'-substituted nucleotide at position 1, 2, 3, 4, or 5, and the remainder of the gap's nucleotides is a 2'-β-D-deoxynucleotide. As used herein, the term “MOE gapmer” refers to a gapmer having a gap containing a 2'-β-D-deoxynucleotide and a wing containing a 2'-MOE nucleotide. As used herein, the term "mixed-wing gapmer" refers to a gapmer having wings containing modified nucleotides comprising at least two different sugar modifications. Unless otherwise stated, a gapmer may contain one or more modified nucleotide inter-bonds and / or modified nucleobases, and such modifications do not necessarily follow the sugar-modified gapmer pattern.

[0054] As used herein, a "hotspot region" is a series of nucleobases on a target nucleic acid that is readily reduced in quantity or activity by the action of oligomers, oligomer compounds, antisense compounds, or antisense agents. A hotspot region contains at least one portion complementary to an active antisense oligonucleotide.

[0055] As used herein, “hybridization” means the annealing of oligonucleotides and / or nucleic acids. While not limited to a specific mechanism, the most common hybridization mechanisms involve hydrogen bonds between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds. In some embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets.

[0056] As used herein, “nucleoside bond” refers to a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, “modified nucleoside bond” refers to any nucleoside bond other than a phosphodiester nucleoside bond. A “phosphothiophosphate nucleoside bond” or “PS nucleoside bond” is a modified nucleoside bond in which one of the non-bridging oxygen atoms in the phosphodiester nucleoside bond is replaced by a sulfur atom.

[0057] As used herein, “reverse nucleoside” means a nucleotide having a 3' to 3' and / or 5' to 5' internucleotide bond, as illustrated herein.

[0058] As used in this article, "reverse sugar moiety" means the sugar moiety of a reverse nucleoside or the debased sugar moiety having a 3' to 3' and / or 5' to 5' internucleotide bond.

[0059] As used in this article, “linked nucleosides” refers to nucleosides linked by a continuous sequence (i.e., there are no additional nucleosides between those linked nucleosides).

[0060] As used herein, “linker-nucleoside” refers to a nucleoside that directly or indirectly links an oligonucleotide to the conjugate moiety. Linker nucleosides reside within the conjugate linker of the oligomer. Linker nucleosides are not considered part of the oligonucleotide moiety of the oligomer, even if they are contiguous with the oligonucleotide.

[0061] As used in this article, "mismatch" or "non-complementary" means that when the first nucleic acid sequence and the second nucleic acid sequence are compared in opposite directions, the nucleobases of the first nucleic acid sequence are not complementary to the corresponding nucleobases of the second nucleic acid sequence or the target nucleic acid.

[0062] As used in this article, "motif" refers to the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or nucleoside bonds in an oligonucleotide.

[0063] As used herein, “non-bicyclic modified sugar moiety” means sugar moiety containing modified elements, such as substituents, that do not form a bridging bond between two atoms of the sugar to form a second ring.

[0064] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is a group other than the unmodified A, T, C, U, or G that can pair with at least one modified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0065] As used in this article, "nucleobase sequence" refers to the sequence of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or nucleoside inter-bond modifications.

[0066] As used herein, the “nucleobase sequence” of reference to SEQ ID NO refers only to the nucleobase sequence provided in SEQ ID NO, and therefore, unless otherwise stated, includes compounds in which each sugar moiety and each nucleoside bond may be independently modified or unmodified, regardless of whether the modifications indicated in the referenced SEQ ID NO are present.

[0067] As used herein, "nucleoside" refers to a compound or fragment of a compound that contains a nucleobase and a sugar moiety. The nucleobase and sugar moiety are either independently unmodified or modified.

[0068] As used herein, “modified nucleoside” means a nucleoside that contains modified nucleobases and / or modified sugar moieties. “Linked nucleoside” is a nucleoside linked by a continuous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0069] As used herein, “oligomer” means an oligomer compound and optionally one or more additional features, such as a second oligomer compound. An oligomer can be a single-chain oligomer compound or an oligomeric duplex formed from two complementary oligomer compounds.

[0070] As used herein, “oligomeric compound” means oligonucleotide and optionally one or more additional features, such as conjugation groups or terminal groups. An oligomeric compound may be paired with a second oligomeric compound complementary to the first oligomeric compound, or may not be paired. A “single-chain oligomeric compound” is an unpaired oligomeric compound.

[0071] The term "oligoduplex" refers to a duplex formed by two oligomers with complementary nucleobase sequences. Each oligomer in an oligoduplex may be referred to as a "duplex oligomer".

[0072] As used herein, "oligonucleotide" means a polymer of linked nucleosides connected by internucleotide bonds, wherein each nucleoside and internucleotide bond may be modified or unmodified. Unless otherwise stated, oligonucleotides consist of 8 to 50 linked nucleosides.

[0073] As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or inter-nucleoside bond is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not contain any nucleoside or inter-nucleoside modifications. An oligonucleotide may pair with a second oligonucleotide that is complementary to it, or it may not pair with another oligonucleotide. A "single-stranded oligonucleotide" is an unpaired oligonucleotide. A "double-stranded oligonucleotide" is an oligonucleotide that pairs with a second oligonucleotide.

[0074] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for administration to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solutions, or sterile artificial cerebrospinal fluid.

[0075] As used herein, "pharmaceutically acceptable salt" means a compound that is physiologically and pharmaceutically acceptable. Pharmacologically acceptable salts retain the desired biological activity of the parent compound without conferring undesirable toxicological effects.

[0076] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In some embodiments, the pharmaceutical composition has shown activity in free uptake assays in certain cell lines.

[0077] As used herein, "prodrug" refers to an inactive or less active form of a compound that, when administered to a subject, is metabolized to form an active or more active compound. In some embodiments, a prodrug comprises a cell-targeting moiety and at least one active compound.

[0078] As used in this article, “reduced or inhibited amount or activity” refers to a reduction or blockage of transcriptional expression or activity relative to untreated or control samples, and does not necessarily indicate complete elimination of transcriptional expression or activity.

[0079] As used herein, unless otherwise stated, “RNA” means RNA transcript and includes both precursor mRNA and mature mRNA.

[0080] As used herein, "RNAi agent" means an antisense agent that functions at least partially via RISC or Ago2 to regulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may contain conjugation groups and / or terminal groups. In some embodiments, RNAi agents regulate the amount, activity, and / or splicing of the target nucleic acid. The term RNAi agent does not include antisense agents that function primarily via RNase H.

[0081] As used herein, "RNase H agent" means an antisense agent that acts via RNase H to regulate target nucleic acids and / or proteins encoded by the target nucleic acids. In some embodiments, the RNase H agent is single-stranded. In some embodiments, the RNase H agent is double-stranded. The RNase H agent may contain conjugation groups and / or terminal groups. In some embodiments, the RNase H agent regulates the amount and / or activity of the target nucleic acid. The term RNase H agent does not include antisense agents that act primarily via RISC / Ago2.

[0082] As used herein, “antisense RNase H oligonucleotide” means an oligonucleotide containing a region complementary to the target sequence and containing at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.

[0083] As used herein, “antisense RNAi oligonucleotide” means an oligonucleotide containing a region complementary to the target sequence and containing at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.

[0084] As used in this article, “self-complementarity” in the context of oligonucleotides means an oligonucleotide that hybridizes at least partially with itself.

[0085] As used in this article, "single-stranded" refers to nucleic acids (including but not limited to oligonucleotides) that are not paired and are not part of a double strand. Single-stranded compounds can hybridize with complementary nucleic acids to form double strands, at which point they are no longer single-stranded.

[0086] As used in this article, "stable phosphate group" means 5'-phosphate analogs that are more stable in metabolism than the 5'-phosphate groups naturally present on DNA or RNA.

[0087] As used in this article, "standard" in vitro "Determination" refers to the determination described in Examples 1, 2, 3, 4, 5, 6, 7 or 8 and its reasonable variations.

[0088] As used in this article, "standard" in vivo "Determination" refers to the determination described in Examples 10, 11, 12, 13, 14 or 15 and its reasonable variations.

[0089] As used herein, in the context of a group of molecules with the same molecular formula, "stereoatactic" or "stereoatactic chiral center" refers to a chiral center that is uncontrolled during synthesis or enriched after synthesis for a particular absolute stereochemical configuration. A stereochemical configuration is atactic when it is the result of a synthetic method that does not aim to control the stereochemical configuration. For example, in a group of molecules containing stereoatactic chiral centers, those with stereoatactic chiral centers ( SThe number of molecules with a stereoironic chiral center (“racemic”) configuration can be related to the number of molecules with a stereoironic chiral center (“racemic”). R The number of molecules with the same stereochemical configuration is the same. When the stereochemical configuration of the chiral center is the result of a synthetic method that does not aim to control the stereochemical configuration, the stereochemical configuration is random. In some embodiments, the stereorandom chiral center is located at the phosphorus atom of the stereorandom thiophosphate nucleoside internucleotide bond or the methanesulfonyl phosphate nucleoside internucleotide bond.

[0090] As used herein, "subject" means human or non-human animal. In some embodiments, the subject is a human.

[0091] As used herein, “glycan moiety” means an unmodified or modified sugar moiety. As used herein, “unmodified sugar moiety” means, for example, the 2'-OH(H)β-D-ribosyl glycan moiety found in RNA (“unmodified RNA sugar moiety”) or the 2'-H(H)β-D-deoxyribosyl glycan moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl glycan moiety or a sugar substitute.

[0092] As used herein, “sugar substitute” means a modified sugar moiety other than the furanyl group that can link a nucleobase to another group, such as an internucleotide bond, conjugation group, or terminal group in an oligonucleotide. Modified nucleosides containing sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize with complementary oligomers or target nucleic acids.

[0093] As used herein, “symptom or sign” means any physical characteristic or test result that indicates the presence or extent of a disease or ailment. In some embodiments, symptoms are obvious to the subject or to a medical professional examining or testing the subject. In some embodiments, signs are obvious during invasive diagnostic tests (including, but not limited to, post-mortem tests). In some embodiments, symptoms and signs include motor dysfunction, alpha-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disturbances, hyposmegma, autonomic dysfunction, ataxia, hallucinations, or seizures.

[0094] As used herein, “target nucleic acid” and “target RNA” refer to nucleic acids that are designed to be affected by antisense compounds. Unless otherwise stated, target RNA refers to RNA transcripts and includes both precursor mRNA and mature mRNA.

[0095] As used in this article, "target region" refers to a portion of the target nucleic acid to which the oligomeric compound is designed to hybridize.

[0096] As used in this article, "terminal group" refers to a chemical group or atomic group covalently attached to the end of an oligonucleotide.

[0097] As used herein, “treatment” means improving a subject’s disease or condition by administering the oligomers or oligomers described herein. In some embodiments, treatment improves a subject’s symptoms relative to the same symptoms without treatment. In some embodiments, treatment reduces the severity or frequency of symptoms, or delays the onset of symptoms, slows the progression of symptoms, or reduces the severity or frequency of symptoms.

[0098] As used herein, "therapeutic effective amount" refers to the amount of a drug or composition that provides a therapeutic benefit to a subject. For example, a therapeutic effective amount improves the symptoms of a disease.

[0099] Some embodiments This disclosure provides the following non-limiting numbered embodiments: Example 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an isolength portion of an SNCA nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from modified sugars and modified nucleoside inter-bonds.

[0100] Example 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleosides from any of the nucleobase sequences of SEQ ID NO: 13-3334, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside internucleotide bond.

[0101] Example 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases complementary to: Equal-length portions of nucleobases 16,692-16,716 of SEQ ID NO: 1 or nucleobases 18,758-18,782 of SEQ ID NO: 2; Equal-length portions of nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2; Equal-length portions of nucleobases 18,621-18,649 of SEQ ID NO: 1 or nucleobases 20,687-20,715 of SEQ ID NO: 2; Equal-length portions of nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2; Equal-length portions of nucleobases 19,423-19,443 of SEQ ID NO: 1 or nucleobases 21,489-21,509 of SEQ ID NO: 2; Equal-length portions of nucleobases 19,555-19,575 of SEQ ID NO: 1 or nucleobases 21,621-21,641 of SEQ ID NO: 2; Equal-length portions of nucleobases 21,457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2; Equal-length portions of nucleobases 22,008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2; Equal-length portions of nucleobases 22,507-22,529 of SEQ ID NO: 1 or nucleobases 24,573-24,595 of SEQ ID NO: 2; Equal-length portions of nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2; Equal-length portions of nucleobases 25,049-25,090 of SEQ ID NO: 1 or nucleobases 27,115-27,156 of SEQ ID NO: 2; Equal-length portions of nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2; Equal-length portions of nucleobases 26,508-26,531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2; Equal-length portions of nucleobases 30,207-30,226 of SEQ ID NO: 1 or nucleobases 32,273-32,292 of SEQ ID NO: 2; Equal-length portions of nucleobases 31,412-31,438 of SEQ ID NO: 1 or nucleobases 33,478-33,504 of SEQ ID NO: 2; The equivalent length of nucleobases 33,027-33,057 of SEQ ID NO: 1 or nucleobases 35,093-35,123 of SEQ ID NO: 2; or Equal-length portions of nucleobases 48,460-48,489 of SEQ ID NO: 1 or nucleobases 50,526-50,555 of SEQ ID NO: 2; The modified oligonucleotide contains at least one modification selected from the modified sugar moiety and the modified nucleotide inter-bond.

[0102] Example 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases: SEQ ID NO: 78, 2564, 2697, 2747, 2789, 2936, 3063, 3081, 3142, 3189 or 3271; SEQ ID NO: 206, 231, 270, 316, 2486, 2558, 3041, 3076, 3137, 3184 or 3266; SEQ ID NO: 64, 128, 289, 921, 2744, 2853, 2922, 3031, 3057, 3099, 3123, 3132, 3160, 3207, 3231, 3289 or 3313; SEQ ID NO: 227, 427, 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176 or 3305; SEQ ID NO: 203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198 or 3280; SEQ ID NO: 205, 2594, 2686, 3028, 3097, 3158, 3205 or 3287; SEQ ID NO: 214, 247, 865, 1887, 1948, 3067, 3085, 3146, 3193 or 3275; SEQ ID NO: 167, 208, 248, 304, 1930, 3054, 3120, 3129, 3228 or 3310; SEQ ID NO: 196, 1814, 1909, 3042, 3109, 3170, 3217 or 3299; SEQ ID NO: 171, 207, 245, 489, 2390, 3053, 3119, 3128, 3227 or 3309; SEQ ID NO: 24, 133, 199, 228, 230, 276, 314, 946, 2759, 2818, 2873, 3069, 3087, 3148, 3195 or 3277; SEQ ID NO: 168, 193, 236, 313, 2446, 3049, 3116, 3177, 3224 or 3306; SEQ ID NO: 210, 223, 272, 273, 274, 1026, 1143, 3020, 3089, 3150, 3197 or 3279; SEQ ID NO: 287, 964, 1040, 1154, 3050, 3117, 3178, 3225 or 3307; SEQ ID NO: 119, 980, 1085, 1166, 3051, 3118, 3127, 3226 or 3308; SEQ ID NO: 194, 277, 1113, 1185, 1309, 3024, 3093, 3154, 3201 or 3283; or SEQ ID NO: 310, 803, 919, 1582, 1674, 3032, 3032, 3032, 3100, 3161, 3208, 3290 or 3290; The modified oligonucleotide contains at least one modification selected from the modified sugar moiety and the modified nucleotide inter-bond.

[0103] Example 5. An oligomeric compound according to any one of Examples 1 to 4, wherein when measured across the entire nucleobase sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NO: 1-9.

[0104] Example 6. An oligomeric compound according to any one of Examples 1 to 5, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, or 20 to 50 linked nucleosides.

[0105] Example 7. An oligomeric compound according to any one of Examples 1 to 6, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

[0106] Example 8. The oligomeric compound according to Example 7, wherein the modified nucleoside comprises a modified sugar moiety.

[0107] Example 9. The oligomer compound according to Example 8, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0108] Example 10. The oligomeric compound according to Example 9, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from the following: -O-CH2-; and -O-CH(CH3)-.

[0109] Example 11. An oligomeric compound according to any one of Examples 7 to 10, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

[0110] Example 12. The oligomeric compound according to Example 11, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a 2'-β-D-deoxyxylose sugar moiety, or a 2'-α-L-deoxyribosylose sugar moiety.

[0111] Example 13. An oligomeric compound according to any one of Examples 7 to 12, wherein the modified nucleoside comprises a sugar substitute.

[0112] Example 14. The oligomeric compound according to Example 13, wherein the sugar substitute is any one of morpholino, modified morpholino, ethylene glycol nucleic acid (GNA), hexavalent tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).

[0113] Example 15. An oligomeric compound according to any one of Examples 1 to 14, wherein the modified oligonucleotide is a gapmer.

[0114] Example 16. An oligomeric compound according to any one of Examples 1 to 15, wherein the modified oligonucleotide contains at least one modified nucleoside internucleotide bond.

[0115] Example 17. The oligomeric compound according to Example 16, wherein at least one nucleoside internucleotide bond is a phosphate diester nucleoside internucleotide bond.

[0116] Example 18. An oligomeric compound according to Example 16 or Example 17, wherein at least one modified nucleoside internucleotide bond is a thiophosphate nucleoside internucleotide bond.

[0117] Example 19. An oligomeric compound according to any one of Examples 16 to 18, wherein at least one modified nucleoside internucleotide bond is a methanesulfonyl phosphate nucleoside internucleotide bond.

[0118] Example 20. An oligomeric compound according to any one of Examples 16 to 19, wherein each nucleoside internucleotide bond is independently selected from phosphate diester nucleoside internucleotide bonds, thiophosphate nucleoside internucleotide bonds, and methanesulfonyl phosphate nucleoside internucleotide bonds.

[0119] Example 21. An oligomeric compound according to any one of Examples 16, 18 or 19, wherein each nucleoside internucleotide bond is independently selected from thiophosphate nucleoside internucleotide bonds and methanesulfonyl phosphate nucleoside internucleotide bonds.

[0120] Example 22. An oligomeric compound according to any one of Examples 16 to 18, wherein each nucleoside internucleotide bond is independently selected from phosphate diester nucleoside internucleotide bonds and thiophosphate nucleoside internucleotide bonds.

[0121] Example 23. An oligomeric compound according to any one of Examples 16 to 22, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 or 19 nucleotide internucleotide bonds are phosphate thioester nucleotide internucleotide bonds.

[0122] Example 24. An oligomeric compound according to any one of Examples 16 to 21, wherein at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight nucleoside internucleotide bonds of the modified oligonucleotide are methanesulfonyl phosphate nucleoside internucleotide bonds.

[0123] Example 25. The oligomeric compound according to any one of Examples 16 to 20, wherein the modified oligonucleotide has a sequence selected from 5'- soossssssssssos -3', 5'- soossssssssssoos -3', 5'-sooossssssssssos -3', 5'- sooossssssssssoos -3', 5'- soooossssssssssooos -3', 5'- soossssssssssooos -3', 5'- soossssssssssssss -3', 5'- sssssssssssssssssss -3', 5'- sooooossssssssssoss -3', 5'- ssssszzzzssssssssss -3', 5'-soooszzzzssssssooss -3', 5'- sooosssssssssssooss -3', 5'- sosssssssssssssooss -3', 5'- sooosszzsssssoss -3', 5'- sossssssssssssssoss -3', 5'-soosszzzzssssssooss -3', 5'- sossszzzzssssssooss -3', 5'- sossszzzzsssssssoss -3', 5'- sssssszsszzszssssss -3', 5'- ssssssssszzsssssoss -3', 5'-ssooszsssssszsssoss -3', 5'- ssosszsssssszzssoss -3', 5'- sssoszzzsssssssssss -3', 5'- ssoosszzsssssssosss -3', 5'- ssssszzsssszzssssss -3', 5'-sssssszssssszsssoss -3', 5'- soossssssssssssooss -3', 5'- sossszzsssszzssosss -3', 5'- sossszzsssszzsssoss -3', 5'- sossszzsssszzssssss -3', 5'-ssssszzsssszzssooss -3', 5'- ssssszssssszzssssss -3', 5'- sssssszsssszzssssss -3', 5'- ssssszzssssszssssss -3', 5'- ssssszzsssszsssssss-3', 5'- sossszssssszzssssss -3', 5'- sosssszsssszzssosss -3', 5'- sossszzssssszssosss -3', 5'- sossszzsssszsssssss -3', 5'- sossszssssszzssssss -3', 5'- sosssszsssszzssssoss -3', 5'- sossszzssssszssssoss -3', 5'- sossszzsssszsssssoss -3', 5'- szssszzssszzsszzss -3', 5'- zzssszzsssszzssssszz -3', 5'-zsssszzssszzsssssz -3', 5'- ssooszssssssszzsssss -3', 5'- sssoszsssssszzsssss -3', 5'- ssooszssssszzssssss -3', 5'- ssssszsssssszzssoss -3', 5'-sssszzsssssszzssssss -3', 5'- soooszzssssszsssooss -3', 5'- soooszzssssszzssooss -3', 5'- ssooszzsssssszsssooss -3', 5'- ssooszzssssszzsooss -3', 5'-sssoszzsssszssooss -3', 5'- sssoszzssssszzsooss -3', 5'- sssoszzssssszssss -3', and 5'- sssoszzssssszzsss -3', where each "s" represents a thiophosphate nucleoside inter-link, each "o" represents a phosphodiester nucleoside inter-link, and each "z" represents a methanesulfonyl phosphate nucleoside inter-link.

[0124] Example 26. An oligomeric compound according to any one of Examples 1 to 25, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

[0125] Example 27. The oligomeric compound according to Example 26, wherein the modified nucleobase is 5-methylcytosine.

[0126] Example 28. The oligomeric compound according to Example 27, wherein each cytosine is 5-methylcytosine.

[0127] Example 29. An oligomeric compound according to any one of Examples 1 to 28, wherein each nucleoside of the modified oligonucleotide is an unmodified adenine, unmodified guanine, unmodified thymine, unmodified cytosine, or 5-methylcytosine.

[0128] Example 30. An oligomeric compound according to any one of Examples 1 to 29, wherein the modified oligonucleotide comprises a deoxygenated region.

[0129] Example 31. The oligomeric compound according to Example 30, wherein each nucleoside in the deoxygenated region is a 2'-β-D-deoxynucleoside.

[0130] Example 32. An oligomeric compound according to Example 30 or Example 31, wherein the deoxygenated region is composed of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides.

[0131] Example 33. An oligomeric compound according to any one of Examples 30 to 32, wherein each nucleoside immediately adjacent to the deoxygenated region comprises a modified sugar moiety.

[0132] Example 34. An oligomeric compound according to any one of Examples 30 to 33, wherein the deoxygenated region is connected to a 5' region on the 5' side and to a 3' region on the 3' side, the 5' region being composed of 1 to 6 linked 5' region nucleosides, and the 3' region being composed of 1 to 6 linked 3' region nucleosides; wherein at least one nucleoside in the 5' region comprises a modified sugar moiety; and at least one nucleoside in the 3' region comprises a modified sugar moiety.

[0133] Example 35. The oligomeric compound according to Example 34, wherein each nucleoside in the 5' region comprises a modified sugar moiety.

[0134] Example 36. An oligomeric compound according to Example 34 or Example 35, wherein each nucleoside in the 3' region comprises a modified sugar moiety.

[0135] Example 37. An oligomeric compound according to any one of Examples 1 to 36, wherein the modified oligonucleotide is composed of 12-30, 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.

[0136] Example 38. An oligomeric compound according to any one of Examples 1 to 37, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0137] Example 39. An oligomeric compound according to any one of Examples 1 to 38, wherein the modified oligonucleotide comprises: The 5' region consists of 1-6 linked 5' region nucleotides; A central region consisting of 6-10 linked central nucleotides; and The 3' region consists of 1-6 linked 3' region nucleotides; Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

[0138] Example 40. An oligomeric compound according to any one of Examples 1 to 39, wherein the modified oligonucleotide has a glycosyl motif comprising: The 5' region consists of five linked 5'-region nucleotides; The central region consists of 10 connected central nucleotides; and The 3' region consists of 5 linked 3' nucleotides; among which Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

[0139] Example 41. The oligomeric compound according to Example 40, wherein the modified oligonucleotide has The 5' region consists of five linked 5'-region nucleotides; The central region consists of 10 connected central nucleotides; and The 3' region consists of 5 linked 3' nucleotides; among which Each of the 5' region nucleosides and each of the 3' region nucleosides contains a 2'-MOE sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

[0140] Example 42. An oligomeric compound according to any one of Examples 1 to 39, wherein the modified oligonucleotide has a glycosyl motif comprising: The 5' region consists of 6 linked 5' nucleotides; The central region consists of 10 connected central nucleotides; and The 3' region consists of four linked 3' nucleotides; Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

[0141] Example 43. The oligomeric compound according to Example 42, wherein the modified oligonucleotide has The 5' region consists of 6 linked 5' nucleotides; The central region consists of 10 connected central nucleotides; and The 3' region consists of four linked 3' nucleotides; Each of the 5' region nucleosides and each of the 3' region nucleosides contains a 2'-MOE sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

[0142] Example 44. An oligomeric compound according to any one of Examples 1 to 43, which is composed of the modified oligonucleotide.

[0143] Example 45. An oligomeric compound according to any one of Examples 1 to 43, wherein the oligomeric compound comprises a conjugation group.

[0144] Example 46. The oligomeric compound according to Example 45, wherein the conjugation group comprises a conjugation moiety and a conjugation linker.

[0145] Example 47. The oligomeric compound according to Example 46, wherein the conjugate connector is a phosphate diester connector.

[0146] Example 48. The oligomeric compound according to Example 46, wherein the conjugate connector is composed of single bonds.

[0147] Example 49. An oligomeric compound according to any one of Examples 46 to 48, wherein the conjugate linker is cleavable.

[0148] Example 50. An oligomeric compound according to any one of Examples 46, 47 or 49, wherein the conjugate linker comprises 1 to 3 linker-nucleosides, wherein at least one linker-nucleoside is linked to the conjugate moiety, to the modified oligonucleotide or to another linker-nucleoside via a phosphodiester bond.

[0149] Example 51. An oligomeric compound according to any one of Examples 45 to 50, wherein the conjugate group is attached to the 5' end of the modified oligonucleotide.

[0150] Example 52. An oligomeric compound according to any one of Examples 45 to 50, wherein the conjugate group is attached to the 3' end of the modified oligonucleotide.

[0151] Example 53. An oligomeric compound according to any one of Examples 1 to 49 or 51 to 52, wherein the oligomeric compound does not contain a linker nucleoside.

[0152] Example 54. An oligomeric compound according to any one of Examples 1 to 53, comprising a terminal group.

[0153] Example 55. The oligomer compound according to Example 54, wherein the terminal group is a debased sugar moiety.

[0154] Example 56. An oligomeric compound according to any one of Examples 1 to 55, wherein the oligomeric compound is an RNase H agent.

[0155] Example 57. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: A es m C es A es G es A es T dz A dz T dz T dz T ds T ds T ds G ds T ds T ds m C es T es G es m C es m C e (SEQ ID NO: 3335), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugated group or a terminal group.

[0156] Example 58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: Aes m C es G eo A eo m C es A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m C es T es T e (SEQ ID NO: 3336), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphate thioester nucleoside bond, z = methanesulfonylaminophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugated group or a terminal group.

[0157] Example 59. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: A es m C es A es G es A es T dz A dz T ds T ds T ds T ds T dz G dz T ds T ds m C es T es Ges m C es m C e (SEQ ID NO: 3337), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugated group or a terminal group.

[0158] Example 60. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: A e s T eo m C eo A eo m C eo G eo A ds m C ds A ds T ds T ds T ds T ds m C ds T ds T ds G eo m C es m C es T e (SEQ ID NO: 3338), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugated group or a terminal group.

[0159] Example 61. An oligomeric compound according to any one of Examples 57 to 60, wherein the modified oligonucleotide is a pharmaceutically acceptable salt.

[0160] Example 62. The oligomeric compound according to Example 61 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

[0161] Example 63. An oligomeric compound according to any one of Examples 1 to 62, wherein the oligomeric compound is a single-chain oligomeric compound.

[0162] Example 64. An oligomeric compound, which is based on the following chemical symbol: N 1 es m C es A es G es A es T dz A dz T dz T dz T d s T ds T ds G ds T ds T ds m C es T es G es m C es N 2 e (SEQ ID NO: 3346), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 2= Cytosine nucleobase, modified cytosine, debased sugar moiety, terminal group, or absent, wherein when N 2 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugation group.

[0163] Example 65. An oligomeric compound, which is based on the following chemical symbol: N 1 es m C es G eo A eo m C es A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m C es T es N 3 e (SEQ ID NO: 3347), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 3 = Thymine nucleobase, modified thymine, debased sugar moiety, terminal group or absent, wherein when N 3 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphate thioester nucleoside bond, z = methanesulfonylaminophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugation group.

[0164] Example 66. An oligomeric compound, which is based on the following chemical symbol: N 1 es m C es A es G es A es T dz A dz T ds T ds T d s T ds T dz G dz T ds T ds m C es T es G es m C es N 2 e (SEQ ID NO: 3348), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 2 = Cytosine nucleobase, modified cytosine, debased sugar moiety, terminal group, or absent, wherein when N 2 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugation group.

[0165] Example 67. An oligomeric compound, which is based on the following chemical symbol: N 1 es T eo m C eo A eo m C eo G eo A ds m C ds A ds T d s T ds T ds T ds m C ds T ds T ds G eo m C es m C es N 3 e (SEQ ID NO: 3349), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 3 = Thymine nucleobase, modified thymine, debased sugar moiety, terminal group or absent, wherein when N 3 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugation group.

[0166] Example 68. An oligomeric compound according to any one of Examples 64 to 67, wherein N 1 It is an adenine nucleobase.

[0167] Example 69. An oligomeric compound according to any one of Examples 64 to 67, wherein N 1 It is unmodified adenine.

[0168] Example 70. An oligomeric compound according to any one of Examples 64 to 67, wherein N 1 It is a modified adenine.

[0169] Example 71. An oligomeric compound according to any one of Examples 64 to 67, wherein N 1 It is hypoxanthine.

[0170] Example 72. The oligomeric compound according to any one of Examples 64 to 67, wherein N 1 It is the debased sugar portion.

[0171] Example 73. An oligomeric compound according to any one of Examples 64 to 67, wherein N 1 It is a terminal group.

[0172] Example 74. An oligomeric compound according to any one of Examples 64 to 67, wherein N 1 It does not exist.

[0173] Example 75. An oligomeric compound according to any one of Examples 64 to 74, wherein N 2 It is a modified cytosine.

[0174] Example 76. An oligomeric compound according to any one of Examples 64 to 74, wherein N 2 It is 5-methylcytosine.

[0175] Example 77. An oligomeric compound according to any one of Examples 64 to 74, wherein N 2 It is unmodified cytosine.

[0176] Example 78. An oligomeric compound according to any one of Examples 64 to 74, wherein N 2 It is the debased sugar portion.

[0177] Example 79. An oligomeric compound according to any one of Examples 64 to 74, wherein N 2 It is a terminal group.

[0178] Example 80. An oligomeric compound according to any one of Examples 64 to 74, wherein N 2 It does not exist.

[0179] Example 81. An oligomeric compound according to any one of Examples 64 to 74, wherein N 3 It is a modified thymine.

[0180] Example 82. The oligomeric compound according to any one of Examples 64 to 74, wherein N 3 It is unmodified thymine.

[0181] Example 83. An oligomeric compound according to any one of Examples 64 to 74, wherein N 3 It is the debased sugar portion.

[0182] Example 84. An oligomeric compound according to any one of Examples 64 to 74, wherein N 3 It is a terminal group.

[0183] Example 85. An oligomeric compound according to any one of Examples 64 to 74, wherein N 3 It does not exist.

[0184] Example 86. The oligomeric compound according to any one of Examples 64 to 80, wherein N 1 It is an adenine nucleobase, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

[0185] Example 87. An oligomeric compound according to any one of Examples 64 to 80 or 86, wherein N 1 It is an adenine nucleobase, and N 2 It is a modified cytosine.

[0186] Example 88. An oligomeric compound according to any one of Examples 64 to 80 or 86, wherein N 1 It is an adenine nucleobase, and N 2 It is the debased sugar portion.

[0187] Example 89. An oligomeric compound according to any one of Examples 64 to 80 or 86, wherein N 1 It is an adenine nucleobase, and N 2 It is a terminal group.

[0188] Example 90. An oligomeric compound according to any one of Examples 64 to 80 or 86, wherein N 1 It is an adenine nucleobase, and N 2 It does not exist.

[0189] Example 91. An oligomeric compound according to any one of Examples 64 to 80, wherein N1 It is a modified adenine, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

[0190] Example 92. An oligomeric compound according to any one of Examples 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It is a modified cytosine.

[0191] Example 93. An oligomeric compound according to any one of Examples 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It is 5-methylcytosine.

[0192] Example 94. An oligomeric compound according to any one of Examples 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It is the debased sugar portion.

[0193] Example 95. An oligomeric compound according to any one of Examples 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It is a terminal group.

[0194] Example 96. An oligomeric compound according to any one of Examples 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It does not exist.

[0195] Example 97. An oligomeric compound according to any one of Examples 64 to 80 or 91, wherein N 1 It is hypoxanthine, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

[0196] Example 98. An oligomeric compound according to any one of Examples 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It is a modified cytosine.

[0197] Example 99. An oligomeric compound according to any one of Examples 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It is 5-methylcytosine.

[0198] Example 100. An oligomeric compound according to any one of Examples 64 to 80 or 97, wherein N1 It is hypoxanthine, and N 2 It is the debased sugar portion.

[0199] Example 101. An oligomeric compound according to any one of Examples 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It is a terminal group.

[0200] Example 102. An oligomeric compound according to any one of Examples 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It does not exist.

[0201] Example 103. An oligomeric compound according to any one of Examples 64 to 80, wherein N 1 It is the debased sugar moiety, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

[0202] Example 104. An oligomeric compound according to any one of Examples 64 to 80, wherein N 1 It is a terminal group, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

[0203] Example 105. An oligomeric compound according to any one of Examples 64 to 80, wherein N 1 It does not exist, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

[0204] Example 106. An oligomeric compound according to any one of Examples 64 to 80, wherein N 1 It does not exist, and N 2 It does not exist.

[0205] Example 107. An oligomeric compound according to any one of Examples 64 to 74 or 81 to 85, wherein N 1 It is an adenine nucleobase, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

[0206] Example 108. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 107, wherein N 1 It is an adenine nucleobase, and N 3 It is a thymine nucleobase.

[0207] Example 109. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 107, wherein N 1 It is an adenine nucleobase, and N 3 It is a modified thymine.

[0208] Example 110. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 107, wherein N 1 It is an adenine nucleobase, and N 3 It is the debased sugar portion.

[0209] Example 111. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 107, wherein N 1 It is an adenine nucleobase, and N 3 It is a terminal group.

[0210] Example 112. The oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 107, wherein N 1 It is an adenine nucleobase, and N 3 It does not exist.

[0211] Example 113. An oligomeric compound according to any one of Examples 64 to 74 or 81 to 85, wherein N 1 It is a modified adenine, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

[0212] Example 114. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 113, wherein N 1 It is a modified adenine, and N 3 It is unmodified thymine.

[0213] Example 115. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 113, wherein N 1 It is a modified adenine, and N 3 It is the debased sugar portion.

[0214] Example 116. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 113, wherein N 1 It is a modified adenine, and N 3 It is a terminal group.

[0215] Example 117. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 113, wherein N 1It is a modified adenine, and N 3 It does not exist.

[0216] Example 118. An oligomeric compound according to any one of Examples 64 to 74 or 81 to 85, wherein N 1 It is hypoxanthine, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

[0217] Example 119. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 118, wherein N 1 It is hypoxanthine, and N 3 It is unmodified thymine.

[0218] Example 120. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 118, wherein N 1 It is hypoxanthine, and N 3 It is the debased sugar portion.

[0219] Example 121. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 118, wherein N 1 It is hypoxanthine, and N 3 It is a terminal group.

[0220] Example 122. An oligomeric compound according to any one of Examples 64 to 74, 81 to 85 or 118, wherein N 1 It is hypoxanthine, and N 3 It does not exist.

[0221] Example 123. An oligomeric compound according to any one of Examples 64 to 74 or 81 to 85, wherein N 1 It is the debased sugar moiety, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

[0222] Example 124. An oligomeric compound according to any one of Examples 64 to 74 or 81 to 85, wherein N 1 It is a terminal group, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

[0223] Example 125. An oligomeric compound according to any one of Examples 64 to 74 or 81 to 85, wherein N 1 It does not exist, and N 3It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

[0224] Example 126. An oligomeric compound according to any one of Examples 64 to 74 or 81 to 85, wherein N 1 It does not exist, and N 3 It does not exist.

[0225] Example 127. An oligomeric compound according to any one of Examples 64 to 126, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0226] Example 128. The oligomeric compound according to Example 127, wherein the conjugate connector is a phosphate diester connector.

[0227] Example 129. The oligomeric compound according to Example 127, wherein the conjugate linker is composed of single bonds.

[0228] Example 130. An oligomeric compound according to any one of Examples 127 to 129, wherein the conjugate linker is cleavable.

[0229] Example 131. An oligomeric compound according to any one of Examples 127, 128 or 130, wherein the conjugate linker comprises 1 to 3 linker-nucleosides, wherein at least one linker-nucleoside is linked to the conjugate moiety, to the oligomeric compound or to another linker-nucleoside via a phosphodiester bond.

[0230] Example 132. An oligomeric compound according to any one of Examples 64 to 131, wherein the conjugation group is attached to the oligomeric compound at the 5' end of the oligomeric compound.

[0231] Example 133. An oligomeric compound according to any one of Examples 64 to 131, wherein the conjugation group is attached to the oligomeric compound at the 3' end of the oligomeric compound.

[0232] Example 134. An oligomeric compound according to any one of Examples 64 to 133, wherein the oligomeric compound is a pharmaceutically acceptable salt.

[0233] Example 135. The oligomeric compound according to Example 133, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium and magnesium.

[0234] Example 136. An oligomeric duplex comprising a first oligomer and a second oligomer, the second oligomer comprising a second modified oligonucleotide, wherein the first oligomer is an oligomer found in any one of Examples 1 to 135.

[0235] Example 137. The oligoduplex according to Example 136, wherein the second modified oligonucleotide consists of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide includes a complementary region of at least 8 nucleosides that is at least 90% complementary to the equal-length portion of the first modified oligonucleotide.

[0236] Example 138. The oligoduplex according to Example 136 or Example 137, wherein the modified oligonucleotide of the first oligomeric compound comprises a 5'-stable phosphate ester group.

[0237] Example 139. The oligomeric duplex according to Example 138, wherein the stable phosphate ester group comprises cyclopropylphosphonate or vinylphosphonate.

[0238] Example 140. An oligoduplex according to any one of Examples 136 to 139, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0239] Example 141. The oligoduplex according to Example 140, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0240] Example 142. The oligoduplex according to Example 141, wherein the bicyclic sugar portion of the second modified oligonucleotide comprises a 2'-4' bridge selected from –O-CH2- and –O-CH(CH3)-.

[0241] Example 143. The oligoduplex according to Example 140, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0242] Example 144. The oligoduplex according to Example 143, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F modified sugar moiety, or a 2'-OMe modified sugar moiety.

[0243] Example 145. An oligomeric duplex according to any one of Examples 136 to 144, wherein at least one nucleoside interstrand of the second modified oligonucleotide is a modified nucleoside interstrand.

[0244] Example 146. The oligoduplex according to Example 145, wherein at least one modified nucleoside interchain of the second modified oligonucleotide is a phosphate thioester nucleoside interchain.

[0245] Example 147. An oligoduplex according to any one of Examples 136 to 146, wherein at least one nucleoside internucleotide bond of the second modified oligonucleotide is a phosphodiester nucleoside internucleotide bond.

[0246] Example 148. An oligomeric duplex according to any one of Examples 145 to 147, wherein at least one nucleoside bond of the second modified oligonucleotide is a methanesulfonyl phosphate nucleoside bond.

[0247] Example 149. An oligomeric duplex according to any one of Examples 136 to 148, wherein each nucleoside internucleotide bond of the second modified oligonucleotide is independently selected from phosphodiester nucleoside internucleotide bonds, thiophosphate nucleoside internucleotide bonds, or methanesulfonylaminophosphate nucleoside internucleotide bonds.

[0248] Example 150. An oligoduplex according to any one of Examples 136 to 149, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

[0249] Example 151. The oligoduplex according to Example 150, wherein at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.

[0250] Example 152. An oligomeric duplex according to any one of Examples 136 to 151, wherein the second modified oligonucleotide comprises a conjugation group.

[0251] Example 153. The oligomeric duplex according to Example 152, wherein the conjugation group comprises a conjugation moiety and a conjugation linker.

[0252] Example 154. The oligomeric duplex according to Example 153, wherein the conjugate connector is composed of single bonds.

[0253] Example 155. The oligomeric duplex according to Example 153 or Example 154, wherein the conjugate linker is cleavable.

[0254] Example 156. An oligomeric duplex according to Example 153 or Example 155, wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker-nucleoside is linked to the conjugate moiety, to the modified oligonucleotide, or to another linker-nucleoside via a phosphodiester bond.

[0255] Example 157. An oligomeric dichain according to any one of Examples 153 to 156, wherein the conjugate connector is a phosphate diester connector.

[0256] Example 158. An oligomeric duplex according to any one of Examples 152 to 157, wherein the conjugate group is attached to the 5' end of the second modified oligonucleotide.

[0257] Example 159. An oligomeric duplex according to any one of Examples 152 to 157, wherein the conjugate group is attached to the 3' end of the second modified oligonucleotide.

[0258] Example 160. An oligomeric duplex according to any one of Examples 152 to 157, wherein the conjugate group is attached via the 2' position of the ribosyl sugar moiety at the internal position of the second modified oligonucleotide.

[0259] Example 161. An oligomeric double chain according to any one of Examples 152 to 160, wherein the conjugation group comprises C22alkyl, C20alkyl, C16alkyl, C10alkyl, C21alkyl, C19alkyl, C18alkyl, C17alkyl, C15alkyl, C14alkyl, C13alkyl, C12alkyl, C11alkyl, C9alkyl, C8alkyl, C7alkyl, C6alkyl, C5alkyl, C22alkenyl, C20alkenyl, C16alkenyl, C10alkenyl, C21alkenyl, C19alkenyl, C18alkenyl, C17alkenyl, C15alkenyl, C14alkenyl, C13alkenyl, C12alkenyl, C11alkenyl, C9alkenyl, C8alkenyl, C7alkenyl, C6alkenyl or C5alkenyl.

[0260] Example 162. An oligomeric duplex according to any one of Examples 152 to 161, wherein the conjugation group comprises a cell-targeting portion.

[0261] Example 163. An oligoduplex according to any one of Examples 136 to 162, wherein the second modified oligonucleotide comprises a terminal group.

[0262] Example 164. The oligodichain according to Example 163, wherein the terminal group is a debased sugar moiety.

[0263] Example 165. An antisense agent comprising or composed of an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of Examples 1 to 135.

[0264] Example 166. An antisense agent, wherein the antisense agent is an oligomeric bichain according to any one of Examples 136 to 164.

[0265] Example 167. The antisense agent according to Example 165 or Example 166, wherein the antisense agent is: i) An RNase H agent that can reduce the amount of SNCA nucleic acid by activating RNase H; or ii) RNAi agents that can reduce the amount of SNCA nucleic acids by activating RISC / Ago2.

[0266] Example 168. An antisense agent according to any one of Examples 165 to 167, wherein the antisense agent comprises a conjugate group, and wherein the conjugate group comprises a cell-targeting portion.

[0267] Example 169. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3335), or a pharmaceutically acceptable salt thereof.

[0268] Example 170. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3336), or a pharmaceutically acceptable salt thereof.

[0269] Example 171. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3337), or a pharmaceutically acceptable salt thereof.

[0270] Example 172. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3338), or a pharmaceutically acceptable salt thereof.

[0271] Example 173. The modified oligonucleotide according to any one of Examples 169 to 172, wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

[0272] Example 174. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3335).

[0273] Example 175. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3336).

[0274] Example 176. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3337).

[0275] Example 177. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3338).

[0276] Example 178. A group of oligomeric compounds according to any one of Examples 1 to 135 or a group of modified oligonucleotides according to any one of Examples 169 to 177, wherein the group is chirally enriched with modified oligonucleotides, the modified oligonucleotides comprising at least one specific phosphate thioester nucleoside bond having a specific stereochemical configuration.

[0277] Example 179. The population according to Example 178, wherein the population is chirally enriched with modified oligonucleotides, the modified oligonucleotides comprising ( S At least one specific thiophosphate nucleoside bond in the p) configuration.

[0278] Example 180. The population according to Example 178, wherein the population is chirally enriched with modified oligonucleotides, the modified oligonucleotides comprising ( R At least one specific thiophosphate nucleoside bond in the p) configuration.

[0279] Example 181. The population according to Example 178, wherein the population is chirally enriched with modified oligonucleotides, the modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphate thioester nucleoside internucleotide bond.

[0280] Example 182. The population according to Example 178, wherein the population is chirally enriched at each thiophosphate nucleoside internucleotide bond having ( S Modified oligonucleotides with a p) configuration, or those having a (p) configuration at each thiophosphate nucleotide internucleotide bond. R p) Modified oligonucleotides.

[0281] Example 183. The population according to Example 178, wherein the population is chirally enriched at a specific thiophosphate nucleoside internucleotide bond having ( R p) configuration, and has (p) at each of the remaining thiophosphate nucleoside internucleotide bonds.S p) Modified oligonucleotides.

[0282] Example 184. The population according to Example 178, wherein the population is chirally enriched in the 5' to 3' direction and has a... S p、 S p and R A modified oligonucleotide with at least three consecutive thiophosphate nucleoside bonds in the p configuration.

[0283] Example 185. A group of oligomeric compounds according to any one of Examples 1 to 135, modified oligonucleotides according to any one of Examples 169 to 177, oligomeric duplexes according to any one of Examples 136 to 164, or antisense agents according to any one of Examples 165 to 168, wherein all phosphate thioester nucleoside internucleotide bonds of the modified oligonucleotide are stereorandom.

[0284] Example 186. A group of oligomeric compounds according to any one of Examples 1 to 135, modified oligonucleotides according to any one of Examples 169 to 177, oligomeric duplexes according to any one of Examples 136 to 164, or antisense agents according to any one of Examples 165 to 168, wherein all methanesulfonyl phosphate nucleoside internucleotide bonds of the modified oligonucleotide are stereorandom.

[0285] Example 187. A pharmaceutical composition comprising an oligomeric compound according to any one of Examples 1 to 135, a modified oligonucleotide according to any one of Examples 169 to 177, an oligomeric duplex according to any one of Examples 136 to 164, an antisense agent according to any one of Examples 165 to 168, or a group according to any one of Examples 178 to 186, and a pharmaceutically acceptable diluent.

[0286] Example 188. The pharmaceutical composition according to Example 187, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).

[0287] Example 189. A pharmaceutical composition according to Example 188, wherein the pharmaceutical composition comprises essentially an oligomeric compound according to any one of Examples 1 to 135, a modified oligonucleotide according to any one of Examples 169 to 177, an oligomeric duplex according to any one of Examples 136 to 164, an antisense agent according to any one of Examples 165 to 168, or a group according to any one of Examples 178 to 186, and aCSF.

[0288] Example 190. A pharmaceutical composition according to Example 188, wherein the pharmaceutical composition comprises essentially an oligomeric compound according to any one of Examples 1 to 135, a modified oligonucleotide according to any one of Examples 169 to 177, an oligomeric duplex according to any one of Examples 136 to 164, an antisense agent according to any one of Examples 165 to 168, or a group according to any one of Examples 178 to 186, and PBS.

[0289] Example 191. A method comprising administering to a subject an oligomeric compound according to any one of Examples 1 to 135, a modified oligonucleotide according to any one of Examples 169 to 177, an oligomeric duplex according to any one of Examples 136 to 164, an antisense agent according to any one of Examples 165 to 168, a population according to any one of Examples 178 to 186, or a pharmaceutical composition according to any one of Examples 187 to 190.

[0290] Example 192. The method according to Example 191, wherein the subject has or is at risk of developing synucleinosis.

[0291] Example 193. The method according to Example 191, wherein the subject has or is at risk of developing Parkinson's disease.

[0292] Example 194. The method according to Example 191, wherein the subject has or is at risk of developing multiple system atrophy (MSA).

[0293] Example 195. The method according to Example 191, wherein the subject has or is at risk of developing Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, neurogenic Gaucher disease, or Alzheimer's disease.

[0294] Example 196. A method for treating synucleinosis, the method comprising administering to a subject who has or is at risk of developing synucleinosis a therapeutically effective amount of an oligomeric compound according to any one of Examples 1 to 135, a modified oligonucleotide according to any one of Examples 169 to 177, an oligomeric duplex according to any one of Examples 136 to 164, an antisense agent according to any one of Examples 165 to 168, a population according to any one of Examples 178 to 186, or a pharmaceutical composition according to any one of Examples 187 to 190.

[0295] Example 197. The method according to Example 196, wherein the synucleinosis is Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease.

[0296] Example 198. The method according to Example 196, wherein the synucleinosis is Parkinson's disease.

[0297] Example 199. The method according to Example 196, wherein the synucleinosis is multiple system atrophy (MSA).

[0298] Example 200. The method according to any one of Examples 196 to 199, wherein at least one symptom or marker of synucleinosis is improved.

[0299] Example 201. The method according to Example 200, wherein the symptoms or signs are motor dysfunction, α-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, decreased sense of smell, autonomic dysfunction, ataxia, hallucinations, or epileptic seizures.

[0300] Example 202. The method according to any one of Examples 196 to 201, wherein the application of an oligomeric compound according to any one of Examples 1 to 135, a modified oligonucleotide according to any one of Examples 169 to 177, an oligomeric duplex according to any one of Examples 136 to 164, an antisense agent according to any one of Examples 165 to 168, a population according to any one of Examples 178 to 186, or a pharmaceutical composition according to any one of Examples 187 to 190 reduces or delays the onset or progression of motor dysfunction, α-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmegma, autonomic dysfunction, ataxia, hallucinations, or epileptic seizures.

[0301] Example 203. The method according to any one of Examples 191 to 202, wherein the oligomeric compound according to any one of Examples 1 to 135, the modified oligonucleotide according to any one of Examples 169 to 177, the oligomeric duplex according to any one of Examples 136 to 164, the antisense agent according to any one of Examples 165 to 168, the group according to any one of Examples 178 to 186, or the pharmaceutical composition according to any one of Examples 187 to 190 is administered to the central nervous system or systemically.

[0302] Example 204. The method according to any one of Examples 191 to 203, wherein the oligomeric compound according to any one of Examples 1 to 135, the modified oligonucleotide according to any one of Examples 169 to 177, the oligomeric duplex according to any one of Examples 136 to 164, the antisense agent according to any one of Examples 165 to 168, the group according to any one of Examples 178 to 186, or the pharmaceutical composition according to any one of Examples 187 to 190 is administered intrathecally.

[0303] Example 205. The method according to any one of Examples 191 to 204, wherein the subject is a human.

[0304] Example 206. A method for reducing the expression of SNCA in cells, the method comprising contacting the cells with an oligomeric compound according to any one of Examples 1 to 135, a modified oligonucleotide according to any one of Examples 169 to 177, an oligomeric duplex according to any one of Examples 136 to 164, an antisense agent according to any one of Examples 165 to 168, a population according to any one of Examples 178 to 186, or a pharmaceutical composition according to any one of Examples 187 to 190.

[0305] Example 207. The method according to Example 206, wherein the cell is a brain cell.

[0306] Example 208. The method according to Example 206 or Example 207, wherein the cell is a neuron or oligodendrocyte.

[0307] Example 209. The method according to any one of Examples 206 to 208, wherein the cell is a human cell.

[0308] Example 210. Use of the oligomeric compound according to any one of Examples 1 to 135, the modified oligonucleotide according to any one of Examples 169 to 177, the oligomeric duplex according to any one of Examples 136 to 164, the antisense agent according to any one of Examples 165 to 168, the group according to any one of Examples 178 to 186, or the pharmaceutical composition according to any one of Examples 187 to 190 for the treatment of synucleinosis.

[0309] Example 211. Use of the oligomeric compound according to any one of Examples 1 to 135, the modified oligonucleotide according to any one of Examples 169 to 177, the oligomeric duplex according to any one of Examples 136 to 164, the antisense agent according to any one of Examples 165 to 168, the group according to any one of Examples 178 to 186, or the pharmaceutical composition according to any one of Examples 187 to 190 for the preparation of a medicament for the treatment of synucleinosis.

[0310] Example 212. The use according to Example 210 or Example 211, wherein the synucleinosis is Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease.

[0311] Example 213. The use according to Example 210 or Example 211, wherein the synucleinosis is Parkinson's disease.

[0312] Example 214. The use according to Example 210 or Example 211, wherein the synucleinosis is multiple system atrophy (MSA).

[0313] I. certain oligonucleotides In some embodiments, this document provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleotide bond. Certain modified nucleosides and modified internucleotide bonds suitable for use in modified oligonucleotides are described below.

[0314] A. Some modified nucleosides The modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In some embodiments, a modified nucleoside comprising the following modified sugar moiety and / or the following modified nucleobase may be incorporated into an oligonucleotide.

[0315] 1. Some sugar portions In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In some embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may contain one or more substitutions corresponding to substitutions for other types of modified sugar moiety.

[0316] In some embodiments, the modified sugar moiety is a non-bicyclic modified furanyl sugar moiety containing one or more acyclic substituents (including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions). In some embodiments, the furanyl sugar moiety is a ribosyl sugar moiety. In some embodiments, one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched.

[0317] In some embodiments, the non-bicyclic modified sugar moiety contains a substituent group at the 2' position. Examples of suitable substituent groups for the 2' position of the modified sugar moiety include, but are not limited to: -F, -OCH3 (“OMe” or “O-methyl”), and -OCH2CH2OCH3 (“MOE”). In some embodiments, the 2'-substituent group is selected from: halogenated, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C. 10 Alkoxy, O-C1-C 10 Substituted alkoxy groups, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R) m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkyne, O-alkylene-O-alkyl, alkynyl, aryl, aralkyl, O-alkylaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m (R) n ) or OCH2C(=O)-N(R m (R) n ), where each R m and R n Independently H, amino protecting group, or substituted or unsubstituted C1-C 10Alkyl groups, -O(CH2)2ON(CH3)2 (“DMAOE”), or 2'-O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”). And 2'-substituent groups described in the following literature: Cook et al., US 6,531,584; Cook et al., US 5,859,221; and Cook et al., US 6,005,087.

[0318] Methods for synthesizing some of these 2'-substituent groups can be found, for example, in the following literature: Cook et al., US 6,531,584; and Cook et al., US 5,859,221. Certain embodiments of these 2'-substituent groups may be further substituted with one or more substituent groups independently selected from the group consisting of: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0319] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent group selected from the following: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R) m (R) n O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R) m (R) n )), where each R m and R n Independently H, amino protecting group, or substituted or unsubstituted C1-C 10 alkyl.

[0320] In some embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent group selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3 (“NMA”).

[0321] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent group selected from the following: F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”).

[0322] In some embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent group selected from the following: F, OCH3, and OCH2CH2OCH3.

[0323] In some embodiments, the modified furanyl sugar moiety and the nucleotide incorporated into such modified furanyl sugar moiety are further defined by isomer configurations. For example, in addition to the naturally occurring β-D-deoxyribosyl configuration, the 2'-deoxyfuranyl sugar moiety can have seven isomer configurations. Such modified sugar moieties are described, for example, in WO2020 / 072991. The 2'-modified sugar moiety has an additional stereocenter at the 2' position relative to the 2'-deoxyfuranyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomer configurations. Unless otherwise stated, the modified furanyl sugar moieties described herein are in the β-D-ribosyl isomer configuration.

[0324] In some embodiments, the non-bicyclic modified sugar moiety is a stereoisomer of DNA, such as the 2'-β-D-deoxyxylose moiety: .

[0325] In some embodiments, the non-bicyclic modified nucleoside comprises a 2'-α-L-deoxyribosyl sugar moiety: .

[0326] In some embodiments, the non-bicyclic modified sugar moiety contains a substituent group at the 4' position. Examples of suitable substituent groups for the 4' position of the modified sugar moiety include, but are not limited to, alkoxy groups. For example , methoxy), alkyl and substituents described in Manoharan et al., WO 2015 / 106128.

[0327] In some embodiments, the non-bicyclic modified sugar moiety contains a substituent group at the 3' position. Examples of suitable substituent groups for the 3' position of the modified sugar moiety include, but are not limited to, alkoxy groups. For example , methoxy), alkyl (e.g., methyl, ethyl).

[0328] In some embodiments, the non-bicyclic modified sugar moiety contains a substituent group at the 5' position. Examples of suitable substituent groups for the 5' position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy ( For example , methoxy) and alkyl (e.g., methyl) R or S ), ethyl).

[0329] In some embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridging sugar substituent, such as, for example, the 2'-F-5'-methyl sugar moiety described in Migawa et al., US2010 / 0190837, or alternative 2'-modified sugar moiety and 5'-modified sugar moiety as described in Rajeev et al., US2013 / 0203836.

[0330] In naturally occurring nucleic acids, sugars are linked together from 3' to 5'. In some embodiments, oligonucleotides contain one or more nucleoside or sugar moieties linked at alternative positions (e.g., at the 2' position or in reverse 5' to 3'). For example, when the bond is at the 2' position, the 2'-substituent group can be placed at the 3' position instead.

[0331] Certain modified sugar moieties contain substituents that bridge two atoms of the furanyl ring to form a second ring, thereby producing a bicyclic sugar moiety. In some embodiments, the bicyclic sugar moieties contain a bridge between the 4' and 2' furanyl ring atoms. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (in the presence of... S When configured, it is referred to as "restricted ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("restricted MOE" or "cMOE") and its analogues, 4'-C(CH3)(CH3)-O-2' and its analogues, 4'-CH2-N(OCH3)-2' and its analogues, 4'-CH2-ON(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2' and its analogues, 4'C(R) a R b )-N(R)-O-2'、4'-C(R a R b)-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, R a and R b Independently H, protecting group or C1-C 12 Alkyl groups. Representative U.S. patents teaching the preparation of such bicyclic sugar moieties include, but are not limited to: Imanshi et al., US 7,427,672; Swayze et al., US 7,741,457 and Swayze et al., US 8,022,193; Seth et al., US 8,278,283; Prakash et al., US 8,278,425; Seth et al., US 8,278,426.

[0332] In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 linked groups independently selected from: -[C(R a (R) b )] n -、-[C(R a (R) b )] n -O-、C(R a )=C(R b )-、C(R a )=N-、C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and N(R) a )-; in: X is 0, 1, or 2; n is 1, 2, 3 or 4; Each R a and R b Independently, it is H, protecting group, hydroxyl group, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or thionyl (S(=O)-J1); and each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl groups or protecting groups.

[0333] The additional bicyclic sugar moiety is known in the art; see, for example, Wan et al., J. Medicinal Chemistry 2016, 59, 9645-9667; Wengel et al., US 8,080,644; Ramasamy et al., US 6,525,191; Seth et al., US 7,547,684; and Seth et al., US 7,666,854.

[0334] In some embodiments, the bicyclic sugar moiety and the nucleoside incorporated into such a bicyclic sugar moiety are further defined by isomer configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA bicyclic nucleotides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21 (6365-6372). Adding locked nucleic acids to siRNA has been shown to improve the stability of siRNA in serum and reduce off-target effects (Elmen, J). wait people, (2005) Nucleic Acids Research 33(1):439-447;Mook, OR. people, (2007) Mol.Canc.Ther. 6(3):833-843; Grunweller, A. people, (2003) Nucleic Acids Research 31(12):3185-3193). In this document, the general description of bicyclic nucleosides includes two isomer configurations. Unless otherwise stated, when identifying a specific bicyclic nucleoside (…) in the exemplary embodiments described herein… For example When the LNA or cEt is in the position, they are in the β-D configuration.

[0335] In some embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted sugar and 4'-2'-bridging sugar).

[0336] In some embodiments, the modified sugar moiety is a sugar substitute. In some such embodiments, the oxygen atom of the sugar moiety is... For example The sugar moiety may be substituted with sulfur, carbon, or nitrogen atoms. In some such embodiments, the modified sugar moiety may also contain bridging substituents and / or non-bridging substituents as described herein. For example, some sugar substitutes contain a 4'-sulfur atom and substitutions at the 2' and / or 5' positions.

[0337] In some embodiments, the sugar substitute comprises a ring having atoms other than five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anisole nucleic acid (“ANA”), mannitol nucleic acid (“MNA”), and fluoroHNA. ("F-HNA") See, for example Egli et al. J Am Chem (2011) 133(41):16642-16649, Swayze et al., US 8,088,904; and Swayze et al., US 8,440,803) F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran, and nucleosides containing additional modified THP compounds having the following formula: Independently, for each of the aforementioned modified THP nucleotides: Bx is the nucleobase portion; T3 and T4 are each independently an internucleotide linker group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleotide linker group that links the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-terminal group or a 3'-terminal group; q1, q2, q3, q4, q5, q6 and q7 are each independently H, a C1-C6 alkyl group, a substituted C 1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and each of R1 and R2 is independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein X is O, S or NJ1, and each J1, J2 and J3 is independently H or C1-C6 alkyl.

[0338] In some embodiments, a modified THP nucleoside is provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In some embodiments, a modified THP nucleoside is provided, wherein one of R1 and R2 is F. In some embodiments, R1 is F and R2 is H; in some embodiments, R1 is methoxy and R2 is H; and in some embodiments, R1 is methoxyethoxy and R2 is H.

[0339] In some embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, nucleosides comprising a morpholine sugar moiety and their use in oligonucleotides have been reported. As used herein, the term "morpholine" refers to a sugar substitute having the following structure: .

[0340] In some embodiments, the morpholino may be modified, for example, by adding or altering various substituent groups derived from the morpholino structure described above. Such sugar substitutes are referred to herein as "modified morpholino".

[0341] In some embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids (“PNA”), acyclic butyl nucleic acids, and nucleosides and oligonucleotides described in Manoharan et al., US 10,913,767. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262.

[0342] In some embodiments, the sugar substitute is the “unlocked” sugar structure of an UNA (unlocked nucleic acid) nucleotide. An UNA is a nucleotide in which any bonds in the sugar moiety have been removed, thereby forming the unlocked sugar substitute. Representative U.S. publications teaching the preparation of UNA include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020.

[0343] In some embodiments, the sugar substitute is glycerol, found in GNA (glycolic acid) nucleosides as shown below: ( S )-GNA , Where Bx represents any nucleobase.

[0344] Many other bicyclic and tricyclic sugars and sugar substitutes are known in the art and can be used for modified nucleosides.

[0345] 2. certain modified nucleobases In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleosides, referred to as debased nucleosides. In some embodiments, the modified oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides containing hypoxanthine nucleosides). An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is a group of atoms other than the unmodified A, T, C, U, or G that can pair with at least one other nucleobase. 5-Methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleosides.

[0346] In some embodiments, the modified adenine has structure (I): I Where: R 2AIt is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl or substituted C1-C6 thioalkyl, C1-C6 alkoxy or substituted C1-C6 alkoxy; R 6A It is H, N(R) a (R) b ), acetyl, formyl, or O-phenyl; Y 7A It is N, and R 7A It either does not exist or is a C1-C6 alkyl group; or Y 7A It is C, and R 7A Selected from H, C1-C6 alkyl or CN(R) a (R) b );Y 8A It is N, and R 8A Does not exist, or Y 8A It is C, and R 8A Selected from H, halogens, OH, C1-C6 alkyl groups or substituted C1-C6 alkyl groups; R a and R b Independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together forming a 5- to 7-membered heterocycle; excluding Y. 7A This is the case of N; Y 8A It is C, R 8A It is H, R 2A It is H, and R 6A It is NH2 (unmodified adenine).

[0347] In some embodiments, unmodified guanine has structure (II): II Where R 2G It is N(R) a (R) b ); R 6G It is oxidative, and R 1G It's H, or R. 6G Selected from O-C1-C6 alkyl or S-C1-C6 alkyl, and R 1G Does not exist; Y 7G It is N, and R 7A It either does not exist or is a C1-C6 alkyl group; or Y 7G It is C, and R 7G Selected from H, C1-C6 alkyl or CN(R) a (R) b );Y 8G It is N, and R 8G Does not exist, or Y 8GIt is C, and R 8G Selected from H, halogens, OH, C1-C6 alkyl groups or substituted C1-C6 alkyl groups; R a and R b Independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together forming a 5- to 7-membered heterocycle; excluding Y. 7G This is the case of N; Y 8G It is C, R 8G It is H, R 2G It is NH2, and R 6G =O (unmodified guanosine).

[0348] In some embodiments, the modified thymine or the modified uracil has structure (III): III Where: X is selected from O or S, and R 5U Selected from H, OH, halogens, O-Cl-C 12 Alkyl, O-C1-C 12 Substituted alkyl groups, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 Alkenyl; where if each X is O, then R 5U It is neither H nor CH3 (which are unmodified uracil and unmodified thymine, respectively).

[0349] In some embodiments, the modified cytosine has structure (IV): IV Where: X is selected from O or S; R 4C It is N(R) a (R) b ); R 5C Selected from H, OH, halogens, O-Cl-C 12 Alkyl, O-C1-C 12 Substituted alkyl groups, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl; R a and R bIndependently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together forming a 5- to 7-membered heterocycle; excluding X which is O or R. 4C It is NH2, and R 5C This is the case for H (unmodified cytosine).

[0350] In some embodiments, the modified nucleobase is selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In some embodiments, the modified nucleobase is selected from: 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-propynyl (C C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-aza and other 8-substituted purines, 5-halogenated (especially 5-bromo), 5-trifluoromethyl, 5-halogenuracil and 5-halogenated cytosine, 7-methylguanine, 7-methyl Nucleotides include basal adenine, 2-F-adenine, 2-aminoadenine, 7-deazoguanine, 7-deazoguanine, 3-deazoguanine, 3-deazoguanine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, mixed bases, size-enlarged bases, and fluorinated bases. Other modified nucleotides include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include nucleobases in which purine or pyrimidine bases are replaced by other heterocycles (e.g., 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone). Other nucleobases include those disclosed in: Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., eds., CRC Press, 1993, 273-288; and nucleobases disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke ST, eds., CRC Press, 2008, 163-166 and 442-443.

[0351] Publications teaching the preparation of certain modified nucleosides and other modified nucleosides are, but are not limited to, Rogers et al., US 5,134,066; Benner et al., US 5,432,272; Matteucci et al., US 5,502,177; Froehler et al., US 5,594,121; and Cook et al., US 5,681,941.

[0352] In some embodiments, each nucleobase of the modified oligonucleotide of the present invention is selected from A, G, C, T, U, and m C.

[0353] In some embodiments, each nucleobase of the modified oligonucleotide of the present invention is selected from A, G, T, and m C (i.e., unmodified purines and 5-methylpyrimidine).

[0354] 3. Certain modified nucleoside bonds Naturally occurring RNA and DNA nucleoside linkages are 3' to 5' phosphodiester bonds. In some embodiments, the nucleosides of modified oligonucleotides may be linked together using one or more modified nucleoside linkages. Two main classes of linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing nucleoside linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, aminophosphate, thiophosphate (“P=S”), and dithiophosphate (“HS-P=S”), which contain a phosphodiester bond (“P=O”) (also referred to as an unmodified or naturally occurring bond). Representative non-phosphoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thiocarbonylcarbamate (-OC(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified nucleoside bonds, compared to naturally occurring phosphodiester nucleoside bonds, can be used to alter, and typically increase, the nuclease resistance of oligonucleotides. In some embodiments, nucleoside bonds with chiral atoms can be prepared as racemic mixtures or as individual enantiomers. Methods for preparing phosphorus-containing and phosphorus-free nucleoside bonds are well known to those skilled in the art.

[0355] In some embodiments, the modified nucleoside interbond is any modified nucleoside interbond described in WO2021 / 030778, which is incorporated herein by reference. In some embodiments, the modified nucleoside interbond comprises the following: , Independently, for each of these nucleoside linking groups of the modified oligonucleotide: X is selected from O or S; R1 is selected from H, C1-C6 alkyl groups, and substituted C1-C6 alkyl groups; and T is selected from SO2R2, C(=O)R3 and P(=O)R4R5, where: R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, and conjugate groups; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3 and conjugate groups; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and conjugate groups; and R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0356] In some embodiments, the modified nucleoside interbond comprises a methanesulfonyl phosphate linker group having the following formula: .

[0357] The methanesulfonyl phosphate nucleoside internucleotide bond contains a chiral center. In some embodiments, the modified oligonucleotide contains ( R p) and / or ( S p) Methanesulfonylaminophosphate, as shown in the following formulas, where "B" represents a nucleobase: .

[0358] In some embodiments, the thiophosphate nucleoside internucleotide bond may include a chiral center. In some embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) thiophosphates each comprise one or more of the following formulas, where "B" represents a nucleobase: .

[0359] Representative internucleotide bonds with chiral centers include, but are not limited to, alkyl phosphate esters and thiophosphate esters. Modified oligonucleotides containing internucleotide bonds with chiral centers can be prepared as groups of modified oligonucleotides containing stereorandom internucleotide bonds, or as groups of modified oligonucleotides containing such internucleotide bonds exhibiting a specific stereochemical configuration. In some embodiments, the group of modified oligonucleotides contains thiophosphate internucleotide bonds, wherein all of the thiophosphate internucleotide bonds are stereorandom. In some embodiments, the group of modified oligonucleotides contains methanesulfonyl phosphate internucleotide bonds, wherein all of the methanesulfonyl phosphate internucleotide bonds are stereorandom. Such modified oligonucleotides can be produced using a randomly selected synthetic method that induces a stereochemical configuration for each internucleotide bond with a chiral center. Nevertheless, each individual internucleotide bond with a chiral center in each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides comprising one or more specific thiophosphate nucleoside internucleotides and / or methanesulfonyl phosphate nucleoside internucleotides, each exhibiting a specific, independently selected stereochemical configuration. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 65% of the molecules in the population. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 70% of the molecules in the population. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 80% of the molecules in the population. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 90% of the molecules in the population. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonyl phosphate bond is present in at least 99% of the molecules in the population. Such chiral enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art. For example The methods described in the following literature: Oka et al., JACS 125, 8307 (2003), Wan et al. Nucleic Acids Res .42, 13456 (2014) and WO 2017 / 015555. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides having at least one (Sp) conformation of a thiophosphate and / or a methanesulfonamide phosphate. In some embodiments, the modified oligonucleotide population is enriched with at least one (Rp) conformation of a thiophosphate and / or a methanesulfonamide phosphate. Unless otherwise stated, the nucleotide internucleotides having the chiral centers of the modified oligonucleotides described herein can be stereorandom or have a specific stereochemical configuration.

[0360] Neutral nucleoside interbonds include, but are not limited to, triphosphates, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), methyl acetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thiomethyl acetal (3'-S-CH2-O-5'). Other neutral nucleoside interbonds include nonionic bonds, including siloxanes (dialkylsiloxanes), carboxylic esters, formamides, sulfides, sulfonates, and amides (see, for example: Carbohydrate Modifications in Antisense Research ;YSSanghvi and PDCook, eds., ACS Symposium Series 580; Chapters 3 and 4, 40–65). Other neutral nucleoside interbonds include nonionic bonds, comprising a mixture of N, O, S, and CH2 components.

[0361] In some embodiments, the modified oligonucleotide comprises one or more reverse nucleosides, as shown below: , Each Bx represents any nucleobase independently.

[0362] In some embodiments, the reverse nucleoside is at the terminal end (i.e., the last nucleoside at one end of the oligonucleotide), so there will be only one of the aforementioned internucleotide bonds. In some such embodiments, additional features (such as conjugation groups) may be attached to the reverse nucleoside. Such terminal reverse nucleosides may be attached to either end or both ends of the oligonucleotide.

[0363] In some embodiments, nucleic acids can be linked from 2' to 5' instead of the standard 3' to 5' linkage. This linkage is illustrated below.

[0364] , Each Bx represents any nucleobase.

[0365] B. certain motifs In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleotide. In some embodiments, the modified oligonucleotide comprises one or more modified nucleotide interbonds. In such embodiments, the modified, unmodified, and differently modified sugar moiety, nucleotide, and / or nucleotide interbond of the modified oligonucleotide define a pattern or motif. In some embodiments, the patterns of the sugar moiety, nucleotide, and nucleotide interbond are each independent of each other. Therefore, the modified oligonucleotide can be described by its sugar motif, nucleotide motif, and / or nucleotide interbond motif (as used herein, the nucleotide motif describes modifications to the nucleotide sequence independent of the nucleotide sequence).

[0366] 1. certain glycosylations In some embodiments, the oligonucleotide comprises one or more types of modified and / or unmodified sugar motifs arranged along the oligonucleotide or its regions in a defined pattern or glycomolecular motif. In some cases, such glycomolecular motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0367] In some embodiments, the modified oligonucleotide includes a deoxygenated region. In some embodiments, each nucleotide in the deoxygenated region is a 2'-β-D-deoxynucleotide. In some embodiments, the deoxygenated region consists of 5 to 12 linked nucleotides. In some embodiments, the deoxygenated region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleotides. In some embodiments, at least one nucleotide in the deoxygenated region contains a modified sugar moiety. In some embodiments, exactly one nucleotide in the deoxygenated region contains a modified sugar moiety. In some embodiments, two or three nucleotides in the deoxygenated region contain modified sugar moieties.

[0368] In some embodiments, the deoxygenated region is connected to a 5' region on the 5' side and to a 3' region on the 3' side, the 5' region consisting of connected 5' region nucleosides, and the 3' region consisting of connected 3' region nucleosides; wherein the 3'th terminal nucleoside of the 5' region is a modified nucleoside, and the 5'th terminal nucleoside of the 3' region is a modified nucleoside. At least one nucleoside in the 5' region contains a modified sugar moiety; and at least one nucleoside in the 3' region contains a modified sugar moiety. These three regions (5' region, deoxygenated region, and 3' region) form a continuous nucleoside sequence. In some embodiments, the sugar moiety of the 3'th terminal nucleoside in the 5' region and the sugar moiety of the 5'th terminal nucleoside in the 3' region are each different from the sugar moiety of the corresponding adjacent nucleoside in the deoxygenated region, thereby defining the boundary between the 5' region, the deoxygenated region, and the 3' region. In some embodiments, each nucleoside in the 5' region and each nucleoside in the 3' region contains a modified sugar moiety. In some embodiments, the nucleosides within the 5' region contain the same sugar modification. In some embodiments, the nucleoside in the 5' region contains two or more different sugar modifications. In some embodiments, the nucleoside in the 3' region contains the same sugar modification. In some embodiments, the nucleoside in the 3' region contains two or more different sugar modifications.

[0369] In some embodiments, the 5' and 3' regions of the modified oligonucleotide each contain 1 to 8 nucleosides. In some embodiments, the 5' region contains 1 to 7 nucleosides. In some embodiments, the 5' region contains 1 to 6 nucleosides. In some embodiments, the 5' region contains 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In some embodiments, the 3' region contains 1 to 7 nucleosides. In some embodiments, the 3' region contains 1 to 6 nucleosides. In some embodiments, the 3' region contains 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[0370] In some embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif, defined by two outer regions or "wings" and a central or inner region or "gap". The three regions of the gapmer motif (5' wing, gap, and 3' wing) form a continuous nucleotide sequence, wherein at least some sugar moieties of the nucleotide in each wing differ from at least some sugar moieties of the nucleotide in the gap. Specifically, the sugar moieties of at least the nucleotide closest to the gap in each wing (the 3' end nucleotide of the 5' wing and the 5' end nucleotide of the 3' wing) differ from the sugar moieties of the adjacent gap nucleotide, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In some embodiments, the sugar moieties within the gap are identical to each other. In some embodiments, the gap contains one or more nucleotides having sugar moieties different from the sugar moieties of one or more other nucleotides in the gap. In some embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In some embodiments, the glycosylation of the 5' wing region is different from that of the 3' wing region (asymmetric gapmer).

[0371] In some embodiments, the wings of the gapmer contain 1 to 6 nucleotides. In some embodiments, each nucleotide of each wing of the gapmer contains a modified sugar moiety. In some embodiments, at least one nucleotide of each wing of the gapmer contains a modified sugar moiety. In some embodiments, at least two nucleotides of each wing of the gapmer contain a modified sugar moiety. In some embodiments, at least three nucleotides of each wing of the gapmer contain a modified sugar moiety. In some embodiments, at least four nucleotides of each wing of the gapmer contain a modified sugar moiety. In some embodiments, at least five nucleotides of each wing of the gapmer contain a modified sugar moiety.

[0372] In some embodiments, the gap in the gapmer contains 7 to 12 nucleotides. In some embodiments, each nucleotide in the gap in the gap contains a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, at least one nucleotide in the gap in the gap contains a modified sugar moiety.

[0373] In some embodiments, the gapmer is a deoxygapmer. In some embodiments, the nucleoside on the gap side of each wing / gap junction comprises a 2'-β-D-deoxyribosyl sugar moiety, and the nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In some embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, each nucleoside of each wing of the gapmer comprises a modified sugar moiety. In some embodiments, at least one nucleoside of the gap of the gapmer comprises a modified sugar moiety. In some embodiments, at least one nucleoside of the gap of the gapmer comprises a 2'-OMe sugar moiety.

[0374] In some embodiments, the modified oligonucleotide comprises or consists of a portion having a fully modified glycomolecular motif. In such embodiments, each nucleotide of the fully modified portion of the modified oligonucleotide comprises a modified glycomolecular motif. In some embodiments, each nucleotide of the entire modified oligonucleotide comprises a modified glycomolecular motif. In some embodiments, the modified oligonucleotide comprises or consists of a portion having a fully modified glycomolecular motif, wherein each nucleotide within the fully modified portion comprises the same modified glycomolecular motif, referred herein as a uniformly modified glycomolecular motif. In some embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In some embodiments, each nucleotide of a uniformly modified oligonucleotide comprises the same 2'-modification.

[0375] In this paper, the lengths (number of nucleotides) of the three regions of a gapmer can be provided using the notation [number of nucleotides in the 5' wing] – [number of nucleotides in the interstitial space] – [number of nucleotides in the 3' wing]. Therefore, a 3-10-3 gapmer consists of 3 linked nucleotides in each wing and 10 linked nucleotides in the interstitial space. In the case of a specific modification following this nomenclature, the modification is in each sugar moiety of each wing, and the interstitial nucleotides contain the 2'-β-D-deoxyribosyl sugar moiety. Therefore, a 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleotides in the 5' wing, 10 linked 2'-β-D-deoxyribosyl nucleotides in the interstitial space, and 5 linked 2'-MOE nucleotides in the 3' wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleotides in the 5' wing, 10 linked 2'-β-D-deoxyribosyl nucleotides in the interstitial space, and 3 linked cEt nucleotides in the 3' wing. A 5-8-5 gapmer consists of five linked nucleotides containing a modified sugar moiety in the 5' wing, eight linked 2'-β-D-deoxy nucleotides in the interstitial region, and five linked nucleotides containing a modified sugar moiety in the 3' wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5' wing and / or the 3' wing, two different modified sugar moieties in the interstitial region, or a combination thereof.

[0376] In some embodiments, the modified oligonucleotides disclosed herein are modified via specific sugar modifications. In some embodiments, the modified oligonucleotide is a 5-10⁻⁵ MOE gapmer. In some embodiments, the modified oligonucleotide is a 3-10⁻³ BNA gapmer. In some embodiments, the modified oligonucleotide is a 3-10⁻³ cEt gapmer. In some embodiments, the modified oligonucleotide is a 3-10⁻³ LNA gapmer. In some embodiments, the modified oligonucleotide is a 3-10⁻⁴ cEt gapmer. In some embodiments, the modified oligonucleotide is a 4-10⁻³ cEt gapmer. In some embodiments, the modified oligonucleotide is a 4-10⁻⁴ cEt gapmer. In some embodiments, the modified oligonucleotide is a 5-10⁻⁵ cEt gapmer. In some embodiments, the modified oligonucleotide is a 6-10⁻⁴ MOE gapmer.

[0377] In some embodiments, the modified oligonucleotides disclosed herein are modified by two or more sugar modifications. In some embodiments, the modified oligonucleotides are 3-10-3 mixed gapmers, wherein each nucleotide within the 5' and 3' wings contains a modified sugar moiety selected from the 2'-MOE and 2'-cEt sugar moieties, and the interstitial nucleotide contains a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotides are 3-10-4 mixed gapmers, wherein each nucleotide within the 5' and 3' wings contains a modified sugar moiety selected from the 2'-MOE and 2'-cEt sugar moieties, and the interstitial nucleotide contains a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotide is a 3-10-5 mixed gapmer, wherein each nucleoside within the 5' and 3' wings comprises a modified sugar moiety selected from the 2'-MOE and 2'-cEt sugar moieties, and the interstitial nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotide is a 4-9-4 mixed gapmer, wherein each nucleoside within the 5' and 3' wings comprises a modified sugar moiety selected from the 2'-MOE and 2'-cEt sugar moieties, and the interstitial nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotide is a 5-10-5 mixed gapmer, wherein each nucleoside within the 5' and 3' wings comprises a modified sugar moiety selected from the 2'-MOE and 2'-cEt sugar moieties, and the interstitial nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotide is a 6-10-4 mixed gapmer, wherein each nucleoside within the 5' and 3' wings contains a modified sugar moiety selected from the 2'-MOE sugar moiety and the 2'-cEt sugar moiety, and the gap nucleoside contains the 2'-β-D-deoxyribosyl sugar moiety.

[0378] In some embodiments, the modified oligonucleotides disclosed herein are modified by two or more sugar modifications within the interstitial region. In some embodiments, the modified oligonucleotide is a 3-10-3 mixed gapmer, wherein each nucleoside within the 5' and 3' wings comprises a 2'-cEt sugar moiety, and each nucleoside within the interstitial region comprises a sugar moiety selected from either a 2'-OMe sugar moiety or a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotide is a 5-10-5 mixed gapmer, wherein each nucleoside within the 5' and 3' wings comprises a 2'-MOE sugar moiety, and each nucleoside within the interstitial region comprises a sugar moiety selected from a 2'-β-D-deoxyxylosyl sugar moiety, a 2'-α-L-deoxyribosyl sugar moiety, and a 2'-β-D-deoxyribosyl sugar moiety.

[0379] In certain embodiments, the modified oligonucleotide has a polypeptide selected from the group consisting of 5'-kkkddddddddddkkkk-3', 5'-kkkddddddddddkkkk-3', 5'-kkkkddddddddddkkkk-3', 5'-kkkkddddddddddkkkk-3', 5'-kkkkkddddddddddkkkkk-3', 5'- kkkdyddddddddkkk -3', 5'- kkkddddddddddkeee -3', 5'- kkkddddddddddkkee -3', 5'- kkkddddddddddkeeee -3', 5'-ekkddddddddddkeeee -3', 5'- kkkddddddddddkkeee -3', 5'- eeeeedddddddddkeeeee -3', 5'- eeeeeeddddddddddeeee -3', 5'- eeeeeedddddddddddkkee -3', 5'- eeeeed[bDdx]dddddddddeeeee -3', 5'- eeeeedd[bDdx]dddddddeeeee -3', 5'- eeeeed[aLdr]dddddddddeeeee -3', 5'- eeeeedd[aLdr]dddddddeeeee -3' and 5'- eekkdddddddddkkee The oligonucleotide has a 5'-3' glycosyl inscription, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, each "k" represents a cEt sugar moiety, each "y" represents a 2'-O-methyl sugar moiety, each "[bDdx]" represents a 2'-β-D-deoxyxylosyl sugar moiety, and each "[aLdr]" represents a 2'-α-L-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotide has a 5'-3' glycosyl inscription, where each "e" represents a 2'-MOE sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotide has a 5'-eeeeedddddddddeeee-3' glycosyl motif, where each "e" represents a 2'-MOE sugar motif and each "d" represents a 2'-β-D-deoxyribosyl sugar motif.

[0380] 2. certain nucleobase sequences In some embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or its region. In some embodiments, each nucleobase is modified. In some embodiments, none of the nucleobases are modified. In some embodiments, each purine or each pyrimidine is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each uracil is modified. In some embodiments, each cytosine is modified. In some embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In some embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all other nucleobases in the modified oligonucleotide are unmodified.

[0381] In some embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In some such embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 3' end of the oligonucleotide. In some embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 5' end of the oligonucleotide.

[0382] In some embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleobase. In some such embodiments, a nucleoside containing the modified nucleobase is located in the central interstitial space of the oligonucleotide having the gapmer motif. In some such embodiments, the sugar moiety of the nucleoside is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0383] 3. certain nucleoside interbond motifs In some embodiments, the oligonucleotide comprises modified and / or unmodified internucleotide links arranged in a defined pattern or motif along the oligonucleotide or its region. In some embodiments, each internucleotide linking group is a phosphodiester internucleotide linking group (P=O). In some embodiments, each internucleotide linking group of the modified oligonucleotide is a thiophosphate internucleotide linking group (P=S). In some embodiments, each internucleotide linking group of the modified oligonucleotide is independently selected from thiophosphate internucleotide links and phosphodiester internucleotide links. In some embodiments, each thiophosphate internucleotide linking group is independently selected from stereorandom thiophosphates, (… S p) Thiophosphates and ( R p) Thiophosphates.

[0384] In some embodiments, the modified oligonucleotide's glycosylation motif is a gapmer, and all internucleotide bonds within the gap are modified. In some embodiments, some or all of the internucleotide bonds in the wings are unmodified phosphodiester internucleotide bonds. In some embodiments, the terminal internucleotide bonds are modified. In some embodiments, the modified oligonucleotide's glycosylation motif is a gapmer, and the internucleotide bond motif includes at least one phosphodiester internucleotide bond in at least one wing, wherein the at least one phosphodiester bond is not a terminal internucleotide bond, and the remaining internucleotide bonds are phosphate thioester internucleotide bonds. In some such embodiments, all phosphate thioester bonds in the phosphate thioester bonds are stereorandom. In some embodiments, all phosphate thioester bonds in the wing are (Sp) phosphate thioesters, and the gap contains at least one Sp, Sp, or Rp motif. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides containing such internucleotide bond motifs.

[0385] In some embodiments, the modified oligonucleotide has a nucleoside internucleotide motif comprising one or more methanesulfonyl phosphate linkers. In some embodiments, one or more thiophosphate nucleoside internucleotides or one or more phosphodiester nucleoside internucleotides of the nucleoside internucleotide motif herein are replaced by methanesulfonyl phosphate linkers.

[0386] In certain embodiments, the modified oligonucleotide has the following internucleoside linkage motifs: 5'-soossssssssssos -3', 5'- soossssssssssoos -3', 5'- sooossssssssssos -3', 5'-sooossssssssssoos -3', 5'- soooossssssssssooos -3', 5'- soossssssssssooos -3', 5'- soossssssssssssss -3', 5'- sssssssssssssssssss -3', 5'- sooooossssssssssoss-3', 5'- ssssszzzzssssssssss -3', 5'- soooszzzzssssssooss -3', 5'-sooosssssssssssooss -3', 5'- sosssssssssssssooss -3', 5'- sooosszzsssssoss -3', 5'- sossssssssssssssoss -3', 5'- soosszzzzssssssooss -3', 5'-sossszzzzssssssooss -3', 5'- sossszzzzsssssssoss -3', 5'- sssssszsszzszssssss -3', 5'- ssssssssszzsssssoss -3', 5'- ssooszsssssszsssoss -3', 5'-ssosszsssssszzssoss -3', 5'- sssoszzzsssssssssss -3', 5'- ssoosszzsssssssosss -3', 5'- ssssszzsssszzssssss -3', 5'- sssssszssssszsssoss -3', 5'-soossssssssssssooss -3', 5'- sossszzsssszzssosss -3', 5'- sossszzsssszzsssoss -3', 5'- sossszzsssszzssssss -3', 5'- ssssszzsssszzssooss -3', 5'-ssssszssssszzssssss -3', 5'- sssssszsssszzssssss -3', 5'- ssssszzssssszssssss -3', 5'- ssssszzsssszsssssss -3', 5'-sossszssssszzssosss -3', 5'- sosssszsssszzssosss -3', 5'- sossszzssssszsssosss -3', 5'- sossszzsssszssssosss -3', 5'- sossszssssszzssssss -3', 5'- sosssszsssszzsssoss -3', 5'- sossszzsssszssssoss -3', 5'- sossszzsssszsssssoss -3', 5'- szssszzsssszzsszzss -3', 5'- zzssszzsssszzssssszz -3', 5'- zsssszzsssszzsssssz -3', 5'-ssooszsssssszzsssoss -3', 5'- sssoszsssssszzsssss -3', 5'- ssooszssssssszzsssss -3', 5'- ssssszsssssszzsssss -3', 5'- sssszzsssssszzsssss -3', 5'-soooszzssssszsssooss -3', 5'- soooszzssssszzssooss -3', 5'- ssooszzssssszsssooss -3', 5'- ssooszzssssszzssooss -3', 5'- The oligonucleotide has a nucleoside internucleotide motif of sssoszzssssszssooss-3', 5'-sssoszzssssszzsooss-3', 5'-sssoszzssssszssosss-3', or 5'-sssoszzssssszzsosss-3', where each "s" represents a thiophosphate nucleoside internucleotide, each "o" represents a phosphodiester nucleoside internucleotide, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide. In some embodiments, the modified oligonucleotide has a nucleoside internucleotide motif of 5'-ssssszzsssszzsssss-3', where each "s" represents a thiophosphate nucleoside internucleotide, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide. In some embodiments, the modified oligonucleotide has a 5'-ssooszssssszsssss-3' nucleoside internucleotide motif, wherein each "s" represents a thiophosphate nucleoside internucleotide, each "o" represents a phosphodiester nucleoside internucleotide, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide. In some embodiments, the modified oligonucleotide has a 5'-ssssszzzzssssssssssThe 5'-3' internucleotide motif, where each "s" represents a thiophosphate internucleotide bond and each "z" represents a methanesulfonyl phosphate internucleotide bond. In some embodiments, the modified oligonucleotide has a 5'-3' internucleotide motif, where each "s" represents a thiophosphate internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0387] C. certain length The length of oligonucleotides can be increased or decreased without eliminating their activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), the ability of a series of oligonucleotides ranging from 13 to 25 nucleotides in length to induce target RNA cleavage in an oocyte injection model was tested. Oligonucleotides of 25 nucleotides in length with 8 or 11 mismatched bases near the end of the oligonucleotide were able to direct specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleotide oligonucleotides, including those with 1 or 3 mismatches.

[0388] In some embodiments, the oligonucleotide (including modified oligonucleotides) may have any of a variety of length ranges. In some embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In some such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X ≤ Y. For example, in some embodiments, the oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 Up to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-2918 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25 Composed of 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0389] In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 16 linked nucleosides. In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 17 linked nucleosides. In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 18 linked nucleosides. In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 19 linked nucleosides. In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 20 linked nucleosides.

[0390] D. Some modified oligonucleotides In some embodiments, the above modifications (sugars, nucleotides, internucleotide bonds) are incorporated into modified oligonucleotides. In some embodiments, the modified oligonucleotides are characterized by their modification motifs and total length. In some embodiments, these parameters are independent of each other. Therefore, unless otherwise stated, each internucleotide bond of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow a sugar-modified gapmer modification pattern. For example, internucleotide bonds within the wing regions of a sugar gapmer may be the same or different from each other, and may be the same or different from the internucleotide bonds in the interstitial regions of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleotides independent of a sugar-modified gapmer pattern. Unless otherwise stated, all modifications are independent of the nucleotide sequence.

[0391] E. certain groups of modified oligonucleotides A population of modified oligonucleotides (where all modified oligonucleotides in the population have the same molecular formula) can be a stereorandom population or a chiral enriched population. In a stereorandom population, all chiral centers of all oligonucleotides in the modified population are stereorandom. In a chiral enriched population, at least one specific chiral center in the modified oligonucleotides of the population is not stereorandom. In some embodiments, the modified oligonucleotides in the chiral enriched population are enriched for the β-D-ribosyl sugar moiety, and all thiophosphate nucleoside internucleotides are stereorandom. In some embodiments, the modified oligonucleotides in the chiral enriched population are enriched for both the β-D-ribosyl sugar moiety and at least one specific thiophosphate nucleoside internucleotide in a specific stereochemical configuration.

[0392] F. Nucleobase sequence In some embodiments, the oligonucleotide (or a portion thereof) has a nucleotide sequence complementary to a second oligonucleotide or an identified reference nucleic acid (or a portion thereof) (such as a target nucleic acid). In some embodiments, the nucleotide sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or the identified reference nucleic acid (or a portion thereof).

[0393] II. Some oligomers In some embodiments, this document provides oligomeric compounds comprising an oligonucleotide and optionally one or more conjugating groups and / or terminal groups. A conjugating group consists of a conjugated moiety and a conjugation linker that attaches the conjugated moiety to the oligonucleotide. The conjugating group may be attached to either end or both ends of the oligonucleotide and / or attached at any internal location. In some embodiments, the conjugating group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In some embodiments, the conjugating group is attached to either end or both ends of the oligonucleotide (such conjugating groups are also terminal groups). In some such embodiments, the conjugating group or terminal group is attached to the 3' and / or 5' end of the oligonucleotide.

[0394] A. certain conjugate groups In some embodiments, the oligonucleotide is covalently attached to one or more conjugation groups. In some embodiments, the conjugation groups alter one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0395] In some embodiments, the conjugation of one or more carbohydrate moieties to the modified oligonucleotide can alter one or more properties of the modified oligonucleotide. In some embodiments, the carbohydrate moieties are attached to the modified subunits of the modified oligonucleotide. For example, the ribose of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced by another moieties (e.g., a non-carbohydrate (preferably cyclic) carrier with a carbohydrate ligand attached). The ribonucleotide subunits in which the ribose has been so replaced are referred herein as ribose-replaced modified subunits (RRMS), which are the modified sugar moieties. The cyclic carrier can be a carbocyclic system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated cyclic system, or it can contain one or more double bonds. In some embodiments, the modified oligonucleotide is a gapmer.

[0396] In some embodiments, the conjugation group imparts new properties to the attached oligonucleotide. For example It can detect the fluorophore or reporter group of oligonucleotides. Some conjugation groups and conjugation moieties have been previously described, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), bile acids (Manoharan et al., ... Bioorg.Med.Chem.Lett ., 1994, 4 , 1053-1060), sulfides ,For exampleHexyl-S-triphenylmethylthiol (Manoharan et al., Ann.NYAcad.Sci ., 1992, 660 , 306-309; Manoharan et al., Bioorg.Med.Chem.Lett., 1993, 3 , 2765-2770), thiocholesterol (Oberhauser et al., Nucleic Acids Res ., 1992, 20 (533-538), aliphatic chains, For example Dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10 , 1111-1118; Kabanov et al., FEBS Lett ., 1990, 259 , 327-330; Svinarchuk et al., Biochimie , 1993, 75 , 49-54), phospholipids, such as di-hexadecyl-racemic-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate (Manoharan et al., Tetrahedron Lett ., 1995, 36 , 3651-3654; Shea et al., Nucleic Acids Res ., 1990, 18 , 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides ,1995, 14 (969-973) or the adamantane palmitoyl acetate moiety (Mishra et al., Biochim.Biophys.Acta ,1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholate moiety (Crooke et al., J. Pharmacol.Exp.Ther., 1996, 277 , 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids , 2015, 4 , e220; and Nishina et al., Molecular Therapy 2008, 16 , 734-740) or GalNAc cluster ( For example (WO2014 / 179620).

[0397] In some embodiments, the conjugation group consists of a lipid and a conjugation linker. In some embodiments, the conjugation group is a phosphate-linked lipid having the following structure: .

[0398] 1. Conjugate portion The conjugated portion includes, but is not limited to, intercalating agents, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin portions, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0399] In some embodiments, the conjugate portion comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, sulprofen, fenbufen, ketoprofen, etc. S )-(+)-Praprofen, carbofenac, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, leucovorin, benzothiazide, chlorothiazide, diazoxide, indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic drugs, antibacterial drugs or antibiotics.

[0400] In some embodiments, the conjugate portion is selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0401] In some embodiments, the conjugate portion is selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0402] 2. Conjugate joint The conjugated moiety is attached to the oligonucleotide via a conjugation linker. In some oligomers, the conjugation linker is a single chemical bond (i.e., the conjugated moiety is directly attached to the oligonucleotide via a single bond). In some embodiments, the conjugation linker comprises an oligomer with a chain structure, such as a hydrocarbon chain, or a repeating unit, such as an ethylene glycol, nucleoside, or amino acid unit.

[0403] In some embodiments, the conjugate connector comprises pyrrolidine.

[0404] In some embodiments, the conjugation connector comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In some such embodiments, the conjugation connector comprises groups selected from alkyl, amino, oxo, amide, and ether groups. In some embodiments, the conjugation connector comprises groups selected from alkyl and amide groups. In some embodiments, the conjugation connector comprises groups selected from alkyl and ether groups. In some embodiments, the conjugation connector comprises at least one phosphorus moiety. In some embodiments, the conjugation connector comprises at least one phosphate group. In some embodiments, the conjugation connector comprises at least one neutral linker group.

[0405] In some embodiments, the conjugate connector (including the conjugate connector described above) is a bifunctional connection portion. For example Bifunctional linkers are known in the art for attaching conjugate moieties to compounds, such as the oligonucleotides provided herein. Generally, a bifunctional linker comprises at least two functional groups. One functional group is selected to bind to a specific site on the compound, while the other functional group is selected to bind to the conjugate group. Examples of functional groups used in bifunctional linkers include, but are not limited to, electrophilic reagents for reacting with nucleophilic groups and nucleophilic reagents for reacting with electrophilic groups. In some embodiments, the bifunctional linker comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.

[0406] Examples of conjugation linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid succinimide (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugation linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 alkenyl or substituted or unsubstituted C2-C 10 Alkynyl, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0407] In some embodiments, the conjugate linker comprises 1-10 linker nucleosides. In some embodiments, the conjugate linker comprises 2-5 linker nucleosides. In some embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In some embodiments, the conjugate linker comprises a TCA motif. In some embodiments, such linker nucleosides are modified nucleosides. In some embodiments, such linker nucleosides comprise a modified sugar moiety. In some embodiments, the linker nucleosides are unmodified. In some embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from purines, substituted purines, pyrimidines, or substituted pyrimidines. In some embodiments, the cleavable portion is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, the linker nucleosides need to be cleaved from the oligomer after reaching the target tissue. Therefore, linker nucleosides are usually linked to each other via cleavable bonds and to the remainder of the oligomer. In some embodiments, such cleavable bonds are phosphodiester bonds.

[0408] In this document, linker nucleosides are not considered part of an oligonucleotide. Therefore, in embodiments where the oligomer compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percentage of complementarity with a reference nucleic acid, and where the oligomer compound also comprises a conjugate group containing a linker nucleoside (which contains a linker nucleoside), those linker nucleosides are not included in the length of the oligonucleotide and are not used to determine the percentage of complementarity between the oligonucleotide and the reference nucleic acid. For example, the oligomer compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides; and (2) a conjugate group comprising 1-10 linker nucleosides consecutive to the nucleoside of the modified oligonucleotide. The total number of consecutively linked nucleosides in such an oligomer compound exceeds 30. Alternatively, the oligomer compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and without a conjugate group. The total number of consecutively linked nucleosides in such an oligomer compound does not exceed 30. Unless otherwise stated, the linker nucleoside contains no more than 10 linker nucleosides. In some embodiments, the linker nucleoside contains no more than 5 linker nucleosides. In some embodiments, the conjugate linker contains no more than three linker nucleosides. In some embodiments, the conjugate linker contains no more than two linker nucleosides. In some embodiments, the conjugate linker contains no more than one linker nucleoside.

[0409] In some embodiments, it is necessary to cleave the conjugated group from the oligonucleotide. For example, in some cases, oligomeric compounds containing a specific conjugated moiety are better absorbed by a particular cell type, but once the oligomeric compound has been absorbed, it is necessary to cleave the conjugated group to release the unconjugated or parental oligonucleotide. Therefore, some conjugated linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moieties are cleavable bonds. In some embodiments, the cleavable moieties are atomic groups containing at least one cleavable bond. In some embodiments, the cleavable moieties contain atomic groups having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable moieties are selectively cleaved within a cell or subcellular compartment (such as a lysosome). In some embodiments, the cleavable moieties are selectively cleaved by endogenous enzymes (such as nucleases).

[0410] In some embodiments, the cleavable bond is selected from one or two esters of amides, esters, ethers, phosphate diesters, phosphate esters, carbamates, or disulfides. In some embodiments, the cleavable bond is one or two esters of phosphate diesters. In some embodiments, the cleavable portion comprises a phosphate ester or a phosphate diester. In some embodiments, the cleavable portion is a phosphate bond between an oligonucleotide and a conjugate portion or conjugate group.

[0411] In some embodiments, the cleavable portion comprises or is composed of one or more linker nucleosides. In some such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via cleavable bonds. In some embodiments, such cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxynucleoside attached to the 3' or 5'-terminal nucleoside of the oligonucleotide via a phosphate-nucleoside internucleotide bond and covalently attached to the conjugate linker or the remainder of the conjugate portion via a phosphate ester or thiophosphate bond. In some such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0412] 3. Cell-targeting component In some embodiments, the conjugation group comprises a cell-targeting portion. In some embodiments, the cell-targeting portion targets neurons. In some embodiments, the cell-targeting portion targets neurotransmitter receptors. In some embodiments, the cell-targeting portion targets neurotransmitter transporters. In some embodiments, the cell-targeting portion targets GABA transporters. See, for example, WO 2011 / 131693, WO 2014 / 064257.

[0413] In some embodiments, the conjugation group comprises a cell-targeting moiety having affinity for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In some embodiments, the conjugation group described herein comprises an anti-TfR1 antibody or a fragment thereof. In some embodiments, the conjugation group comprises a protein or peptide capable of binding to TfR1. In some embodiments, the conjugation group comprises an aptamer capable of binding to TfR1. In some embodiments, the anti-TfR1 antibody or a fragment thereof may be any antibody or fragment thereof known in the art, including but not limited to antibodies or fragments thereof described in the following documents: WO1991 / 004753; WO2013 / 103800; WO2014 / 144060; WO2016 / 081643; WO2016 / 179257; WO2016 / 207240; WO2017 / 221883; WO2018 / 129384; WO2018 / 124121; WO2019 / 151539; WO2020 / 132584; WO2020 / 028864; US 7,208,174; US 9,034,329; and US 10,550,188. In some embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.

[0414] In some embodiments, the conjugation group comprises a protein or peptide capable of binding TfR1. In some embodiments, the protein or peptide capable of binding TfR1 can be any protein or peptide known in the art, including but not limited to proteins or peptides described in the following documents: WO2019 / 140050; WO2020 / 037150; WO2020 / 124032; and US 10,138,483.

[0415] In some embodiments, the conjugation group comprises an aptamer capable of binding TfR1. In some embodiments, the aptamer capable of binding TfR1 can be any aptamer known in the art, including but not limited to the aptamers described in the following documents: WO2013 / 163303; WO2019 / 033051; and WO2020 / 245198.

[0416] B. certain terminal groups In some embodiments, the oligomeric compound comprises one or more terminal groups. In some such embodiments, the oligomeric compound comprises a stable 5'-phosphate ester. Stable 5'-phosphate esters include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates. In some embodiments, the terminal group comprises one or more debased sugar moieties and / or reverse nucleosides. In some embodiments, the terminal group comprises a reverse debased sugar moiety. In some embodiments, the reverse debased sugar moiety may be further attached to a conjugation group. In some embodiments, the terminal group comprises one or more 2'-linked nucleoside or sugar moieties. In some such embodiments, the 2'-linked group is a debased sugar moiety. Such terminal debased sugar moieties may be attached to either end or both ends of the oligonucleotide.

[0417] III. antisense activity In some embodiments, the oligomeric compound is capable of hybridizing with the target nucleic acid, thereby generating at least one antisense activity. In some embodiments, the oligomeric compound forms an oligomeric duplex with a second oligomeric compound containing a complementary nucleobase sequence. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In some embodiments, when the antisense compound is in standard... in vitro Antisense compounds are considered to have antisense activity when they reduce or inhibit the amount or activity of target nucleic acids by 50% or more during assays. In some embodiments, antisense compounds selectively affect one or more target nucleic acids. Such antisense compounds comprise nucleobase sequences that hybridize with one or more target nucleic acids to produce one or more desired antisense activities, and do not hybridize with one or more non-target nucleic acids, or do not hybridize with one or more non-target nucleic acids in a manner that produces a large amount of unwanted antisense activity.

[0418] In some antisense activities, hybridization of the antisense compound with the target nucleic acid induces the recruitment of proteins that cleave the target nucleic acid. For example, some antisense compounds induce RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In some embodiments, antisense compounds that are sufficiently "DNA-like" to induce RNase H activity are described herein. In some embodiments, one or more non-DNA-like nucleotides in the gapmer are resistant.

[0419] In some antisense activities, an antisense compound, or a portion thereof, is loaded into an RNA-induced silencing complex (RISC), ultimately causing cleavage of the target nucleic acid. For example, some antisense compounds cause the target nucleic acid to be cleaved by Argonaute. The antisense compound loaded into the RISC is an RNAi agent. RNAi agents can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0420] In some embodiments, hybridization of the antisense compound with the target nucleic acid does not induce the recruitment of proteins that cleave the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid causes alterations in the splicing of the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid causes inhibition of binding interactions between the target nucleic acid and proteins or other nucleic acids. In some embodiments, hybridization of the antisense compound with the target nucleic acid causes alterations in the translation of the target nucleic acid.

[0421] Antisense activity can be observed directly or indirectly. In some embodiments, the observation or detection of antisense activity involves the observation or detection of changes in the amount of the target nucleic acid or the protein encoded by such target nucleic acid, changes in the ratio of splice variants of the nucleic acid or protein, and / or phenotypic changes in cells or subjects.

[0422] IV. certain target nucleic acids In some embodiments, the oligomeric compound comprises or is composed of oligonucleotides containing a region complementary to the target nucleic acid. In some embodiments, the target nucleic acid is an endogenous RNA molecule. In some embodiments, the target nucleic acid encodes a protein. In some such embodiments, the target nucleic acid is selected from mature mRNA and precursor mRNA, including intronic regions, exonic regions, and untranslated regions. In some embodiments, the target RNA is mature mRNA. In some embodiments, the target nucleic acid is premRNA. In some embodiments, the target region is entirely within an intron. In some embodiments, the target region spans an intron / exon junction. In some embodiments, at least 50% of the target region is within an intron. In some embodiments, the target nucleic acid is the RNA transcript of a reverse-transcribed gene. In some embodiments, the target nucleic acid is non-coding RNA. In some embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0423] A. Complementarity / mismatch with target nucleic acids and duplex complementarity In some embodiments, the oligonucleotide is complementary to the target nucleic acid along its entire length. In some embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In some embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid along its entire length and includes a region that is 100% or completely complementary to the target nucleic acid. In some embodiments, the length of the completely complementary region is 6 to 20, 10 to 18, or 18 to 20 nucleotides.

[0424] Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated an oligonucleotide with 100% complementarity to bcl-2 mRNA and 3 mismatches with bcl-xL mRNA. In vitro and In the body It reduces the expression of both bcl-2 and bcl-xL. Furthermore, this oligonucleotide... In the body It exhibits potent antitumor activity. Maher and Dolnick ( Nucleic Acids Res (16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleotide oligonucleotides, as well as 28-nucleotide and 42-nucleotide oligonucleotides consisting of sequences of two or three tandem oligonucleotides, respectively, to inhibit the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleotide oligonucleotides was able to inhibit translation independently, although at a milder level than the 28- or 42-nucleotide oligonucleotides.

[0425] In some embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In some embodiments, antisense activity against the target is reduced due to this mismatch, but activity against non-target nucleic acids is reduced even more. Therefore, in some embodiments, the selectivity of the oligonucleotide is improved.

[0426] In some embodiments, the mismatch is specifically located within an oligonucleotide having a gapmer motif. In some embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, or 8 at the 5' end of the gap region. In some embodiments, the mismatch is located at position 9, 8, 7, 6, 5, 4, 3, 2, or 1 at the 3' end of the gap region. In some embodiments, the mismatch is located at position 1, 2, 3, or 4 at the 5' end of the wing region. In some embodiments, the mismatch is located at position 4, 3, 2, or 1 at the 3' end of the wing region.

[0427] B. SNCA In some embodiments, the oligomeric compounds described herein comprise or consist of oligonucleotides containing a region complementary to a target nucleic acid, wherein the target nucleic acid is an SNCA. In each of the above embodiments, the oligomeric compound may target an SNCA nucleic acid. In some embodiments, the SNCA nucleic acid has complementary sequences to SEQ ID NO: 1 (Ensembl accession number ENSG00000145335.17, Ensembl version 106 - April 2022), SEQ ID NO: 2 (GENBANK accession number NT_016354.20, truncated from nucleoside 30800000 to nucleoside 30919000), SEQ ID NO: 3 (GENBANK accession number: NM_001146055.1), SEQ ID NO: 4 (Ensembl IDENST00000618500.4, Ensembl version 106 - April 2022), SEQ ID NO: 5 (GENBANK accession number: NM_000345.3), SEQ ID NO: 6 (GENBANK accession number: JN709863.1), SEQ ID NO: The sequences shown in SEQ ID NO: 7 (GENBANK accession number: BC013293.2), SEQ ID NO: 8 (GENBANK accession number: NM_001146054.2), or SEQ ID NO: 9 (GENBANK accession number: HQ830269.1) are used. In some embodiments, contacting cells with an oligomeric compound complementary to any one of SEQ ID NO: 1-9 as described herein reduces the amount of SNCA RNA and, in some embodiments, reduces the amount of α-synuclein. In some embodiments, contacting cells with an oligomeric compound complementary to any one of SEQ ID NO: 1-9 as described herein results in a reduction in α-synuclein aggregation. In some embodiments, the oligomeric compound consists of a modified oligonucleotide. In some embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.

[0428] In some embodiments, contacting cells with an oligomeric compound complementary to any one of SEQ ID NO: 1-9 as described herein reduces the amount of SNCA RNA in the cells. In some embodiments, contacting cells with an oligomeric compound complementary to any one of SEQ ID NO: 1-9 as described herein reduces the amount of α-synuclein in the cells. In some embodiments, the cells are... In vitro.In some embodiments, the cells are in a subject. In some embodiments, the oligomeric compound consists of modified oligonucleotides. In some embodiments, contacting the subject's cells with an oligomeric compound complementary to any one of SEQ ID NO: 1-9 described herein can improve one or more symptoms or features of synucleinosis. In some embodiments, synucleinosis is Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease. In some embodiments, one or more symptoms or markers include Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, and Alzheimer's disease.

[0429] In some embodiments, when according to the standard in vitro When administered, the oligomeric compounds described herein that are complementary to any one of SEQ ID NO: 1-9 are capable of reducing the amount of in vitro SNCA RNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, when administered according to standards... in vivo When administered, the oligomeric compounds described herein that are complementary to any one of SEQ ID NO: 1-9 are capable of [determining / ... in vivo The amount of SNCA RNA is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, when according to standards... in vitro When administered, the oligomeric compounds described herein that are complementary to any one of SEQ ID NO: 1-9 are capable of [determining / ... in vitro The amount of α-synuclein is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, when according to standards... in vivo When administered, the oligomeric compounds described herein that are complementary to any of SEQ ID NO: 1-9 are capable of [determining / determining] [the following]. in vivoThe amount of α-synuclein is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound described herein that is complementary to any one of SEQ ID NO: 1-9 is capable of reducing the amount of SNCA RNA in the subject's cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound described herein that is complementary to any one of SEQ ID NO: 1-9 is capable of reducing the amount of α-synuclein protein or the amount of α-synuclein aggregates in the subject's cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0430] C. Certain target nucleic acids in certain tissues In some embodiments, the oligomeric compound comprises or is composed of oligonucleotides containing a region complementary to a target nucleic acid expressed in a pharmacologically relevant tissue. In some embodiments, the pharmacologically relevant tissue is the cells and tissues constituting the central nervous system (CNS). Such tissues include the brain and spinal cord. In some embodiments, the pharmacologically relevant tissue includes the motor cortex, frontal cortex, caudate nucleus, putamen, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, corpus callosum, deep cerebellar nucleus (DCN), entorhinal cortex, hippocampus, insular cortex, medulla oblongata, central gray matter, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculus, and basal anterior nuclei. In some embodiments, the cells are brain cells. In some embodiments, the cells include neurons and oligodendrocytes.

[0431] V. Some methods and uses Some embodiments provided herein relate to methods for reducing or inhibiting SNCA expression or activity, which can be used to treat, prevent, or improve synucleinopathy in a subject. In some embodiments, synucleinopathy is Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogaucher disease, or Alzheimer's disease.

[0432] In some embodiments, the method includes administering to the subject an oligomeric compound, a modified oligonucleotide, an oligoduplex, or an antisense agent, any of which has a nucleobase sequence complementary to the SNCA nucleic acid. In some embodiments, the subject has or is at risk of developing synucleinopathies. In some embodiments, the subject has or is at risk of developing Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease. In some embodiments, the subject has Parkinson's disease. In some embodiments, the subject has Lewy body dementia (DLB). In some embodiments, the subject has diffuse Lewy body disease. In some embodiments, the subject has Parkinson's dementia (PDD). In some embodiments, the subject has pure autonomic failure. In some embodiments, the subject has multiple system atrophy (MSA). In some embodiments, the subject has neurogenic Gaucher disease. In some embodiments, the subject has Alzheimer's disease.

[0433] In some embodiments, the method of treating synucleinopathy includes administering to a subject an oligomeric compound, a modified oligonucleotide, an oligoduplex, or an antisense agent, any of which has a nucleobase sequence complementary to the SNCA nucleic acid. In some embodiments, the subject has or is at risk of developing synucleinopathy. In some embodiments, the subject has or is at risk of developing Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogaucher disease, or Alzheimer's disease. In some embodiments, the subject has Parkinson's disease. In some embodiments, the subject has multiple system atrophy (MSA). In some embodiments, the subject has Alzheimer's disease. In some embodiments, at least one symptom or marker of synucleinopathy is improved. In some embodiments, at least one symptom or marker is motor dysfunction, α-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, decreased sense of smell, autonomic dysfunction, ataxia, hallucinations, or epileptic seizures.

[0434] In some embodiments, methods for reducing SNCA (e.g., RNA) expression or reducing α-synuclein expression in cells include contacting the cells with an oligomeric compound, a modified oligonucleotide, an oligoduplex, or an antisense agent, any of which has a nucleobase sequence complementary to the SNCA nucleic acid. In some embodiments, the subject has or is at risk of developing synucleinopathy. In some embodiments, the subject has or is at risk of developing Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease. In some embodiments, the subject has Parkinson's disease. In some embodiments, the subject has multiple system atrophy (MSA). In some embodiments, the subject has Alzheimer's disease. In some embodiments, the cells are brain cells. In some embodiments, the cells are neurons. In some embodiments, the cells are oligodendrocytes. In some embodiments, the cells are human cells.

[0435] Some embodiments involve oligomeric compounds, modified oligonucleotides, oligomeric duplexes, or antisense agents, any of which have a nucleobase sequence complementary to SNCA nucleic acids, for the treatment of synucleinosis or for the manufacture of drugs for the treatment of synucleinosis. In some embodiments, synucleinosis is Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic dysfunction, multiple system atrophy (MSA), neurogaucher disease, or Alzheimer's disease.

[0436] In any of the methods or uses described herein, the oligomeric compound, modified oligonucleotide, oligoduplex, or antisense agent can be any of the oligomeric compounds, modified oligonucleotides, oligoduplexes, or antisense agents described herein.

[0437] VI. Certain pharmaceutical compositions In some embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In some embodiments, the one or more oligomeric compounds are each composed of modified oligonucleotides. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds or thereof. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water or thereof. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate-buffered saline (PBS) or thereof. In some embodiments, the sterile PBS is pharmaceutical grade PBS. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”) or comprises one or more oligomeric compounds and artificial cerebrospinal fluid. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0438] In some embodiments, the pharmaceutical composition comprises modified oligonucleotides and artificial cerebrospinal fluid (aCSF). In some embodiments, the pharmaceutical composition consists of modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the pharmaceutical composition consists essentially of modified oligonucleotides and artificial cerebrospinal fluid. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0439] In some embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, anhydrous disodium hydrogen phosphate, calcium chloride dihydrate, and magnesium chloride hexahydrate. The pH of the aCSF solution is adjusted to the range of about 7.1 to 7.3 or to about 7.2 using a suitable pH adjuster (e.g., an acid, such as hydrochloric acid, and a base, such as sodium hydroxide).

[0440] In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In some embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0441] In some embodiments, the oligomeric compound may be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and formulation of pharmaceutical compositions depend on many criteria, including but not limited to route of administration, disease severity, or dosage.

[0442] In some embodiments, pharmaceutical compositions comprising oligomeric compounds encompass any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In some embodiments, pharmaceutical compositions comprising oligomeric compounds containing one or more oligonucleotides are capable of providing (directly or indirectly) their biologically active metabolites or residues when administered to a subject (including a human). Thus, for example, this disclosure also relates to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In some embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In some embodiments, a prodrug comprises one or more conjugate groups attached to an oligonucleotide, wherein such conjugate groups are cleaved by endogenous nucleases in vivo.

[0443] In some embodiments, the oligomeric compound is lyophilized and separated as a sodium salt. In some embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutically acceptable diluent includes sterile saline, sterile water, PBS, or aCSF. In some embodiments, the sodium salt of the oligomeric compound is mixed with PBS. In some embodiments, the sodium salt of the oligomeric compound is mixed with aCSF.

[0444] Lipid moieties have been used in nucleic acid therapy in various ways. In some of these methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In some methods, DNA complexes with mono- or poly-cationic lipids are formed in the absence of neutral lipids. In some embodiments, lipid moieties are selected to increase the distribution of agents to specific cells or tissues. In some embodiments, lipid moieties are selected to increase the distribution of agents to adipose tissue. In some embodiments, lipid moieties are selected to increase the distribution of agents to muscle tissue.

[0445] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those containing hydrophobic compounds. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0446] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more agents of the present invention to a specific tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0447] In some embodiments, the pharmaceutical composition comprises a cosolvent system. Some of these cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is an absolute ethanol solution comprising 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems can vary considerably without significantly altering their solubility and toxicity properties. Furthermore, the properties of the cosolvent components may differ: for example, other surfactants may be used instead of polysorbate 80™; the fractional size of polyethylene glycol may vary; other biocompatible polymers may replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides may replace glucose.

[0448] In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In some such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks' solution, Ringer's solution, or physiological saline buffer. In some embodiments, other components are included (e.g., components that contribute to solubility or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Some injectable pharmaceutical compositions are present in a single dosage form, such as an ampoule or a multi-dose container. Some injectable pharmaceutical compositions are oily or aqueous media containing suspensions, solutions, or emulsions, and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0449] Under certain conditions, some of the compounds disclosed herein act as acids. Although such compounds can be drawn or described as protonated (free acid) or ionized and associated with cations (salts), aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphodiester bonds of oligonucleotides in aqueous solutions exist in equilibrium between free acid, anionic, and salt forms. Unless otherwise stated, the compounds described herein are intended to include all such forms. Furthermore, some oligonucleotides have multiple such bonds, each in equilibrium. Thus, oligonucleotides in solution exist in multiple forms at multiple locations, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structures necessarily depict a single form. However, unless otherwise stated, such figures are also intended to include corresponding forms. In this document, the description of a compound's free acid structure followed by the term "or a pharmaceutically acceptable salt thereof" explicitly includes all such forms that can be fully or partially protonated / deprotonated / associated with cations or combinations of cations. In some embodiments, one or more specific cations are identified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In some embodiments, the description of the structure of the free acid of the compound and the subsequent term "or a pharmaceutically acceptable salt thereof" explicitly includes all such forms that can be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0450] In some embodiments, the modified oligonucleotide or oligomer is present in an aqueous solution with sodium. In some embodiments, the modified oligonucleotide or oligomer is present in an aqueous solution with potassium. In some embodiments, the modified oligonucleotide or oligomer is in PBS. In some embodiments, the modified oligonucleotide or oligomer is in water. In some such embodiments, the pH of the solution is adjusted to a desired pH using NaOH and / or HCl.

[0451] This article describes certain specific dosages. Dosages may be expressed in units of dosage. For clarity, the dosage (or units of dosage) of a modified oligonucleotide or oligomer in milligrams represents the mass of the free acid form of the modified oligonucleotide or oligomer. As mentioned above, in aqueous solution, the free acid is in equilibrium with its anionic and salt forms. However, for the purpose of dosage calculation, it is assumed that the modified oligonucleotide or oligomer exists as a solvent-free, sodium acetate-free, anhydrous, free acid.

[0452] In some embodiments, when the modified oligonucleotide or oligomer is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomer may be partially or completely deprotonated and associated with sodium ions. However, the mass of the protons is still included in the weight of the dose, and the mass of the sodium ions is not included in the weight of the dose. Thus, for example, a dose or dose unit of 10 mg of compound number 1482139 is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.61 mg of solvent-free, sodium acetate-free, anhydrous sodium-containing compound number 1482139.

[0453] In some embodiments, when the modified oligonucleotide or oligomer is in a solution containing sodium, potassium, calcium, and magnesium (such as aCSF), the modified oligonucleotide or oligomer may be partially or completely deprotonated and associated with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is still included in the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not included in the weight of the dose.

[0454] In some embodiments, when the oligomer compound contains a conjugating group, the mass of that conjugating group may be included in the dosage calculation of such oligomer compound. If the conjugating group also has an acid, it is also assumed that the conjugating group is fully protonated for dosage calculation purposes.

[0455] VII. Some oligomers In some embodiments, the oligonucleotides disclosed herein comprise a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any nucleobase sequence of SEQ ID NO: 13-3334. In some such embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside internucleotide bond. In some embodiments, the oligonucleotide comprises a conjugation group. In some embodiments, the oligonucleotide does not comprise a conjugation group. In some embodiments, the oligonucleotide comprises a terminal group. In some embodiments, the oligonucleotide does not comprise a terminal group.

[0456] In some embodiments, the oligomeric compounds disclosed herein comprise a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of 5'-ACAGATATTTTTGTTCTGCC-3' (SEQ ID NO: 3318). In some embodiments, the modified oligonucleotide comprises at least one modification selected from the modified sugar moiety and the modified nucleoside internucleotide bond. In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from the 2'-MOE sugar moiety, the 2'-OMe sugar moiety, the 2'-β-D-deoxyxylose sugar moiety, and the 2'-α-L-deoxyribosylose sugar moiety. In some embodiments, the modified nucleoside internucleotide bond is selected from the thiophosphate internucleotide bond and the methanesulfonyl phosphate internucleotide bond. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, the oligomeric compound contains a conjugating group. In some embodiments, the oligomeric compound does not contain a conjugating group. In some embodiments, the oligomeric compound contains a terminal group. In some embodiments, the oligomeric compound does not contain a terminal group.

[0457] In some embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3318. In some embodiments, the modified oligonucleotide has a modified glycosyl motif (from 5' to 3')eeeeeddddddddddeeeee, wherein each "e" is a 2'-MOE sugar motif and each "d" is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified oligonucleotide comprises a modified nucleoside internucleotide selected from thiophosphate nucleoside internucleotides and methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In some embodiments, each cytosine of the modified oligonucleotide is 5-methylcytosine.

[0458] In some embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3318. In some embodiments, the modified oligonucleotide has a modified glycosyl motif (from 5' to 3')eeeeeddddddddddeeeee, wherein each "e" is a 2'-MOE sugar motif and each "d" is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified oligonucleotide has a modified nucleoside internucleotide motif (from 5' to 3')ssssszzzzsssssssss, wherein each "s" is a thiophosphate nucleoside internucleotide bond and each "z" is a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In some embodiments, each cytosine of the modified oligonucleotide is 5-methylcytosine.

[0459] In some embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3318. In some embodiments, the modified oligonucleotide has a modified glycosyl motif (from 5' to 3')eeeeeddddddddddeeeee, wherein each "e" is a 2'-MOE sugar motif and each "d" is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified oligonucleotide has a modified nucleoside internucleotide motif (from 5' to 3')ssssszzsssszzssssss, wherein each "s" is a thiophosphate nucleoside internucleotide and each "z" is a methanesulfonyl phosphate nucleoside internucleotide. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In some embodiments, each cytosine of the modified oligonucleotide is 5-methylcytosine.

[0460] In some embodiments, the oligomeric compounds disclosed herein comprise a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of 5'-ACGACATTTTCTTGCCTCTT-3' (SEQ ID NO: 3319). In some embodiments, the modified oligonucleotide comprises at least one modification selected from the modified sugar moiety and the modified nucleoside internucleotide bond. In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from the 2'-MOE sugar moiety, the 2'-OMe sugar moiety, the 2'-β-D-deoxyxylose sugar moiety, and the 2'-α-L-deoxyribosylose sugar moiety. In some embodiments, the modified nucleoside internucleotide bond is selected from the thiophosphate internucleotide bond and the methanesulfonyl phosphate internucleotide bond. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, the oligomeric compound contains a conjugating group. In some embodiments, the oligomeric compound does not contain a conjugating group. In some embodiments, the oligomeric compound contains a terminal group. In some embodiments, the oligomeric compound does not contain a terminal group.

[0461] In some embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3319. In some embodiments, the modified oligonucleotide has a modified glycosyl motif (from 5' to 3')eeeeeddddddddddeeeee, wherein each "e" is a 2'-MOE sugar motif and each "d" is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified oligonucleotide comprises a modified nucleoside internucleotide selected from thiophosphate nucleoside internucleotides and methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In some embodiments, each cytosine of the modified oligonucleotide is 5-methylcytosine.

[0462] In some embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3319. In some embodiments, the modified oligonucleotide has a modified glycosyl motif (from 5' to 3')eeeeeddddddddddeeeee, wherein each "e" is a 2'-MOE sugar motif and each "d" is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified oligonucleotide has a modified internucleotide motif (from 5' to 3')ssooszsssssszsssoss, wherein each "s" is a thiophosphate internucleotide bond, each "o" is a phosphodiester internucleotide bond, and each "z" is a methanesulfonyl phosphate internucleotide bond. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In some embodiments, each cytosine of the modified oligonucleotide is 5-methylcytosine.

[0463] In some embodiments, the oligomeric compounds disclosed herein comprise a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases of 5'-ATCAGACATTTTCTTGCCT-3' (SEQ ID NO: 3328). In some embodiments, the modified oligonucleotide comprises at least one modification selected from the modified sugar moiety and the modified nucleoside internucleotide bond. In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from the 2'-MOE sugar moiety, 2'-OMe sugar moiety, 2'-β-D-deoxyxylose sugar moiety, and 2'-α-L-deoxyribosylose sugar moiety. In some embodiments, the modified nucleoside internucleotide bond is selected from the thiophosphate internucleotide bond and the methanesulfonyl phosphate internucleotide bond. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, the oligomeric compound contains a conjugating group. In some embodiments, the oligomeric compound does not contain a conjugating group. In some embodiments, the oligomeric compound contains a terminal group. In some embodiments, the oligomeric compound does not contain a terminal group.

[0464] In some embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3328. In some embodiments, the modified oligonucleotide has a modified glycosyl motif (from 5' to 3')eeeeeeddddddddddeeee, wherein each "e" is a 2'-MOE sugar motif and each "d" is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified oligonucleotide comprises a modified nucleoside internucleotide selected from thiophosphate nucleoside internucleotides and methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In some embodiments, each cytosine of the modified oligonucleotide is 5-methylcytosine.

[0465] In some embodiments, the modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 3328. In some embodiments, the modified oligonucleotide has a modified glycosyl motif (from 5' to 3')eeeeeeddddddddddeeee, wherein each "e" is a 2'-MOE sugar motif and each "d" is a 2'-β-D-deoxyribosyl sugar motif. In some embodiments, the modified oligonucleotide has a modified nucleoside internucleotide motif (from 5' to 3')sooooossssssssssssss, wherein each "s" is a phosphate thioester nucleoside internucleotide and each "o" is a phosphodiester nucleoside internucleotide. In some embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In some embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In some embodiments, each cytosine of the modified oligonucleotide is 5-methylcytosine.

[0466] In some embodiments, an oligomeric compound is disclosed herein, which is defined by the following chemical symbol: N 1 es m C es A e s G es A es T dz A dz T dz T dz T ds T ds T ds G ds T ds Tds m C es T es G es m C es N 2 e (SEQ ID NO: 3346), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 2 = Cytosine nucleobase, modified cytosine, debased sugar moiety, terminal group, or absent, wherein when N 2 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugating group. In some embodiments, N 1 It is an adenine nucleobase. In some embodiments, N 1 It is unmodified adenine. In some embodiments, N 1 It is a modified adenine. In some embodiments, N 1 It is hypoxanthine. In some embodiments, N 1 This is the debased sugar moiety. In some embodiments, N 1 , is a terminal group. In some embodiments, N 1 It does not exist. In some embodiments, N 2 It is a modified cytosine. In some embodiments, N 2 It is 5-methylcytosine. In some embodiments, N 2 It is unmodified cytosine. In some embodiments, N 2 This is the debased sugar moiety. In some embodiments, N 2 , is a terminal group. In some embodiments, N 2 It does not exist. In some embodiments, N3 It is a modified thymine. In some embodiments, N 3 It is unmodified thymine. In some embodiments, N 3 This is the debased sugar moiety. In some embodiments, N 3 , is a terminal group. In some embodiments, N 3 It does not exist. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It is a modified cytosine. In some embodiments, N 1 It is an adenine nucleobase, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is an adenine nucleobase, and N 2 , is a terminal group. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It does not exist. In some embodiments, N 1 It is a modified adenine, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is a modified adenine, and N 2 It is a modified cytosine. In some embodiments, N 1 It is a modified adenine, and N 2 It is 5-methylcytosine. In some embodiments, N 1 It is a modified adenine, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is a modified adenine, and N 2 , is a terminal group. In some embodiments, N 1 It is a modified adenine, and N 2 It does not exist. In some embodiments, N 1 It is hypoxanthine, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is hypoxanthine, and N 2 It is a modified cytosine. In some embodiments, N 1 It is hypoxanthine, and N 2 It is 5-methylcytosine. In some embodiments, N 1 It is hypoxanthine, and N 2This is the debased sugar moiety. In some embodiments, N 1 It is hypoxanthine, and N 2 , is a terminal group. In some embodiments, N 1 It is hypoxanthine, and N 2 It does not exist. In some embodiments, N 1 It is the debased sugar moiety, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is a terminal group, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It does not exist, and N 2 It does not exist. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It is a thymine nucleobase. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It is a modified thymine. In some embodiments, N 1 It is an adenine nucleobase, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is an adenine nucleobase, and N 3 , is a terminal group. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It does not exist. In some embodiments, N 1 It is a modified adenine, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is a modified adenine, and N 3 It is unmodified thymine. In some embodiments, N 1 It is a modified adenine, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is a modified adenine, and N 3 , is a terminal group. In some embodiments, N 1It is a modified adenine, and N 3 It does not exist. In some embodiments, N 1 It is hypoxanthine, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is hypoxanthine, and N 3 It is unmodified thymine. In some embodiments, N 1 It is hypoxanthine, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is hypoxanthine, and N 3 , is a terminal group. In some embodiments, N 1 It is hypoxanthine, and N 3 It does not exist. In some embodiments, N 1 It is the debased sugar moiety, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is a terminal group, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 3 It does not exist.

[0467] In some embodiments, an oligomeric compound is disclosed herein, which is defined by the following chemical symbol: N 1 es m C es G e o A eo m C es A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m Ces T es N 3 e (SEQ ID NO: 3347), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 3 = Thymine nucleobase, modified thymine, debased sugar moiety, terminal group or absent, wherein when N 3 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphate thioester nucleoside bond, z = methanesulfonylaminophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugating group. In some embodiments, N 1 It is an adenine nucleobase. In some embodiments, N 1 It is unmodified adenine. In some embodiments, N 1 It is a modified adenine. In some embodiments, N 1 It is hypoxanthine. In some embodiments, N 1 This is the debased sugar moiety. In some embodiments, N 1 , is a terminal group. In some embodiments, N 1 It does not exist. In some embodiments, N 2 It is a modified cytosine. In some embodiments, N 2 It is 5-methylcytosine. In some embodiments, N 2 It is unmodified cytosine. In some embodiments, N 2 This is the debased sugar moiety. In some embodiments, N 2 , is a terminal group. In some embodiments, N 2 It does not exist. In some embodiments, N 3 It is a modified thymine. In some embodiments, N 3It is unmodified thymine. In some embodiments, N 3 This is the debased sugar moiety. In some embodiments, N 3 , is a terminal group. In some embodiments, N 3 It does not exist. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It is a modified cytosine. In some embodiments, N 1 It is an adenine nucleobase, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is an adenine nucleobase, and N 2 , is a terminal group. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It does not exist. In some embodiments, N 1 It is a modified adenine, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is a modified adenine, and N 2 It is a modified cytosine. In some embodiments, N 1 It is a modified adenine, and N 2 It is 5-methylcytosine. In some embodiments, N 1 It is a modified adenine, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is a modified adenine, and N 2 , is a terminal group. In some embodiments, N 1 It is a modified adenine, and N 2 It does not exist. In some embodiments, N 1 It is hypoxanthine, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is hypoxanthine, and N 2 It is a modified cytosine. In some embodiments, N 1 It is hypoxanthine, and N 2 It is 5-methylcytosine. In some embodiments, N 1 It is hypoxanthine, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is hypoxanthine, and N2 , is a terminal group. In some embodiments, N 1 It is hypoxanthine, and N 2 It does not exist. In some embodiments, N 1 It is the debased sugar moiety, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is a terminal group, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It does not exist, and N 2 It does not exist. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It is a thymine nucleobase. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It is a modified thymine. In some embodiments, N 1 It is an adenine nucleobase, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is an adenine nucleobase, and N 3 , is a terminal group. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It does not exist. In some embodiments, N 1 It is a modified adenine, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is a modified adenine, and N 3 It is unmodified thymine. In some embodiments, N 1 It is a modified adenine, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is a modified adenine, and N 3 , is a terminal group. In some embodiments, N 1 It is a modified adenine, and N 3 It does not exist. In some embodiments, N1 It is hypoxanthine, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is hypoxanthine, and N 3 It is unmodified thymine. In some embodiments, N 1 It is hypoxanthine, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is hypoxanthine, and N 3 , is a terminal group. In some embodiments, N 1 It is hypoxanthine, and N 3 It does not exist. In some embodiments, N 1 It is the debased sugar moiety, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is a terminal group, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 3 It does not exist.

[0468] In some embodiments, an oligomeric compound is disclosed herein, which is defined by the following chemical symbol: N 1 es m C es A e s G es A es T dz A dz T ds T ds T ds T ds T dz G dz T ds T ds m C es T es G es m C es N 2 e (SEQ ID NO: 3348), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 2 = Cytosine nucleobase, modified cytosine, debased sugar moiety, terminal group, or absent, wherein when N 2 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugating group. In some embodiments, N 1 It is an adenine nucleobase. In some embodiments, N 1 It is unmodified adenine. In some embodiments, N 1 It is a modified adenine. In some embodiments, N 1 It is hypoxanthine. In some embodiments, N 1 This is the debased sugar moiety. In some embodiments, N 1 , is a terminal group. In some embodiments, N 1 It does not exist. In some embodiments, N 2 It is a modified cytosine. In some embodiments, N 2 It is 5-methylcytosine. In some embodiments, N 2 It is unmodified cytosine. In some embodiments, N 2 This is the debased sugar moiety. In some embodiments, N 2 , is a terminal group. In some embodiments, N 2 It does not exist. In some embodiments, N 3 It is a modified thymine. In some embodiments, N 3 It is unmodified thymine. In some embodiments, N 3 This is the debased sugar moiety. In some embodiments, N 3 , is a terminal group. In some embodiments, N 3 It does not exist. In some embodiments, N 1It is an adenine nucleobase, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It is a modified cytosine. In some embodiments, N 1 It is an adenine nucleobase, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is an adenine nucleobase, and N 2 , is a terminal group. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It does not exist. In some embodiments, N 1 It is a modified adenine, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is a modified adenine, and N 2 It is a modified cytosine. In some embodiments, N 1 It is a modified adenine, and N 2 It is 5-methylcytosine. In some embodiments, N 1 It is a modified adenine, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is a modified adenine, and N 2 , is a terminal group. In some embodiments, N 1 It is a modified adenine, and N 2 It does not exist. In some embodiments, N 1 It is hypoxanthine, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is hypoxanthine, and N 2 It is a modified cytosine. In some embodiments, N 1 It is hypoxanthine, and N 2 It is 5-methylcytosine. In some embodiments, N 1 It is hypoxanthine, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is hypoxanthine, and N 2 , is a terminal group. In some embodiments, N 1 It is hypoxanthine, and N 2 It does not exist. In some embodiments, N 1 It is the debased sugar moiety, and N 2It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is a terminal group, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It does not exist, and N 2 It does not exist. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It is a thymine nucleobase. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It is a modified thymine. In some embodiments, N 1 It is an adenine nucleobase, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is an adenine nucleobase, and N 3 , is a terminal group. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It does not exist. In some embodiments, N 1 It is a modified adenine, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is a modified adenine, and N 3 It is unmodified thymine. In some embodiments, N 1 It is a modified adenine, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is a modified adenine, and N 3 , is a terminal group. In some embodiments, N 1 It is a modified adenine, and N 3 It does not exist. In some embodiments, N 1 It is hypoxanthine, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is hypoxanthine, and N 3It is unmodified thymine. In some embodiments, N 1 It is hypoxanthine, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is hypoxanthine, and N 3 , is a terminal group. In some embodiments, N 1 It is hypoxanthine, and N 3 It does not exist. In some embodiments, N 1 It is the debased sugar moiety, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is a terminal group, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 3 It does not exist.

[0469] In some embodiments, an oligomeric compound is disclosed herein, which is defined by the following chemical symbol: N 1 es T eo m C e o A eo m C eo G eo A ds m C ds A ds T ds T ds T ds T ds m C ds T ds T ds G eo m C es m C es N 3 e (SEQ ID NO: 3349), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 3 = Thymine nucleobase, modified thymine, debased sugar moiety, terminal group or absent, wherein when N 3 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugating group. In some embodiments, N 1 It is an adenine nucleobase. In some embodiments, N 1 It is unmodified adenine. In some embodiments, N 1 It is a modified adenine. In some embodiments, N 1 It is hypoxanthine. In some embodiments, N 1 This is the debased sugar moiety. In some embodiments, N 1 , is a terminal group. In some embodiments, N 1 It does not exist. In some embodiments, N 2 It is a modified cytosine. In some embodiments, N 2 It is 5-methylcytosine. In some embodiments, N 2 It is unmodified cytosine. In some embodiments, N 2 This is the debased sugar moiety. In some embodiments, N 2 , is a terminal group. In some embodiments, N 2 It does not exist. In some embodiments, N 3 It is a modified thymine. In some embodiments, N 3 It is unmodified thymine. In some embodiments, N 3 This is the debased sugar moiety. In some embodiments, N 3 , is a terminal group. In some embodiments, N 3 It does not exist. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N1 It is an adenine nucleobase, and N 2 It is a modified cytosine. In some embodiments, N 1 It is an adenine nucleobase, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is an adenine nucleobase, and N 2 , is a terminal group. In some embodiments, N 1 It is an adenine nucleobase, and N 2 It does not exist. In some embodiments, N 1 It is a modified adenine, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is a modified adenine, and N 2 It is a modified cytosine. In some embodiments, N 1 It is a modified adenine, and N 2 It is 5-methylcytosine. In some embodiments, N 1 It is a modified adenine, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is a modified adenine, and N 2 , is a terminal group. In some embodiments, N 1 It is a modified adenine, and N 2 It does not exist. In some embodiments, N 1 It is hypoxanthine, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is hypoxanthine, and N 2 It is a modified cytosine. In some embodiments, N 1 It is hypoxanthine, and N 2 It is 5-methylcytosine. In some embodiments, N 1 It is hypoxanthine, and N 2 This is the debased sugar moiety. In some embodiments, N 1 It is hypoxanthine, and N 2 , is a terminal group. In some embodiments, N 1 It is hypoxanthine, and N 2 It does not exist. In some embodiments, N 1 It is the debased sugar moiety, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It is a terminal group, and N 2It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 2 It may be a cytosine nucleobase, modified cytosine, a debased sugar moiety, a terminal group, or absent. In some embodiments, N 1 It does not exist, and N 2 It does not exist. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It is a thymine nucleobase. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It is a modified thymine. In some embodiments, N 1 It is an adenine nucleobase, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is an adenine nucleobase, and N 3 , is a terminal group. In some embodiments, N 1 It is an adenine nucleobase, and N 3 It does not exist. In some embodiments, N 1 It is a modified adenine, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is a modified adenine, and N 3 It is unmodified thymine. In some embodiments, N 1 It is a modified adenine, and N 3 This is the debased sugar moiety. In some embodiments, N 1 It is a modified adenine, and N 3 , is a terminal group. In some embodiments, N 1 It is a modified adenine, and N 3 It does not exist. In some embodiments, N 1 It is hypoxanthine, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is hypoxanthine, and N 3 It is unmodified thymine. In some embodiments, N 1 It is hypoxanthine, and N 3 This is the debased sugar moiety. In some embodiments, N 1It is hypoxanthine, and N 3 , is a terminal group. In some embodiments, N 1 It is hypoxanthine, and N 3 It does not exist. In some embodiments, N 1 It is the debased sugar moiety, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It is a terminal group, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 3 It may be a thymine nucleobase, modified thymine, a debased sugar moiety, a terminal group, or be absent. In some embodiments, N 1 It does not exist, and N 3 It does not exist.

[0470] VIII. Certain compositions 1. Compound number 1601260 Compound number 1601260 was characterized as a 5-10-5 MOE of a nucleoside linked with the nucleobase sequence ACAGATATTTTTGTTCTGCC (SEQ ID NO: 3318) from 5' to 3'. The gapmer consists of nucleosides 1-5 and 16-20 (from 5' to 3') each being a 2'-MOE nucleoside, and nucleosides 6-15 each being a 2'-β-D-deoxy nucleoside, wherein the internucleotide bonds between nucleosides 1-2, 2-3, 3-4, 4-5, 5-6, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19 and 19-20 are thiophosphate internucleotide bonds, wherein the internucleotide bonds between nucleosides 6-7, 7-8, 8-9 and 9-10 are methanesulfonylaminophosphate internucleotide bonds, and each cytosine is 5-methylcytosine.

[0471] Compound number 1601260 is represented by the following chemical symbol: A es m C es A es G es A es T dz A dz T dz T dz T ds T ds T ds G ds T ds T ds m C es T es G es m C es m C e (SEQ ID NO: 3335), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and the compound does not contain conjugation groups or terminal groups.

[0472] Compound number 1601260 is represented by the following chemical structure: (SEQ ID NO: 3335) (structure 1) or a pharmaceutically acceptable salt thereof. The pharmaceutically acceptable salt of compound number 1601260 comprises one or more cations selected from sodium, potassium, calcium and magnesium.

[0473] The sodium salt of compound number 1601260 is represented by the following chemical structure: (SEQ ID NO: 3335) (Structure 2).

[0474] 2. Compound number 1616039 Compound number 1616039 was characterized as a 5-10-5 MOE of a nucleoside linked with the nucleobase sequence ACGACATTTTCTTGCCTCTT (SEQ ID NO: 3319) from 5' to 3'. The gapmer is defined as follows: each of nucleosides 1-5 and 16-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxy nucleoside; the internucleotide bonds between nucleosides 1-2, 2-3, 5-6, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 14-15, 15-16, 16-17, 18-19, and 19-20 are thiophosphate internucleotide bonds; the internucleotide bonds between nucleosides 3-4, 4-5, and 17-18 are phosphodiester internucleotide bonds; the internucleotide bonds between nucleosides 6-7 and 13-14 are methanesulfonylaminophosphate internucleotide bonds; and each cytosine is 5-methylcytosine.

[0475] Compound number 1616039 is represented by the following chemical symbol: A es m C es G eo A eo m C es A dz T ds T ds T ds T ds m C ds T d s T dz G ds m C ds m C es T eo m C es T es T e (SEQ ID NO: 3336), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphate thioester nucleoside bond, z = methanesulfonylaminophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and the compound does not contain conjugation groups or terminal groups.

[0476] Compound number 1616039 is represented by the following chemical structure: (SEQ ID NO: 3336) (structure 3), or a pharmaceutically acceptable salt thereof. The pharmaceutically acceptable salt of compound number 1616039 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

[0477] The sodium salt of compound number 1616039 is represented by the following chemical structure: (SEQ ID NO: 3336) (Structure 4).

[0478] 3. Compound number 1616357 Compound number 1616357 was characterized as a 5-10-5 MOE of a nucleoside linked with the nucleobase sequence (from 5' to 3') ACAGATATTTTTGTTCTGCC (SEQ ID NO: 3318). The gapmer consists of nucleosides 1-5 and 16-20 (from 5' to 3') each being a 2'-MOE nucleoside, and nucleosides 6-15 each being a 2'-β-D-deoxy nucleoside, wherein the internucleotide bonds between nucleosides 1-2, 2-3, 3-4, 4-5, 5-6, 8-9, 9-10, 10-11, 11-12, 14-15, 15-16, 16-17, 17-18, 18-19, and 19-20 are thiophosphate internucleotide bonds, and the internucleotide bonds between nucleosides 6-7, 7-8, 12-13, and 13-14 are methanesulfonylaminophosphate internucleotide bonds, and each cytosine is 5-methylcytosine.

[0479] Compound number 1616357 is represented by the following chemical symbol: A es m C es A es G es A es T dz A dz T ds T ds T ds T ds T dz G d z T ds T dsm C es T es G es m C es m C e (SEQ ID NO: 3337), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and the compound does not contain conjugation groups or terminal groups.

[0480] Compound number 1616357 is represented by the following chemical structure: (SEQ ID NO: 3337) (structure 5) or a pharmaceutically acceptable salt thereof. The pharmaceutically acceptable salt of compound number 1616357 comprises one or more cations selected from sodium, potassium, calcium and magnesium.

[0481] The sodium salt of compound number 1616357 is represented by the following chemical structure: (SEQ ID NO: 3337) (Structure 6).

[0482] 4. Compound number 1620605 Compound number 1620605 was characterized as a 6-10-4 MOE of a nucleoside linked with the nucleobase sequence (from 5' to 3') ATCACGACATTTTCTTGCCT (SEQ ID NO: 3328). The gapmer is wherein each of nucleosides 1-6 and 17-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxy nucleoside, wherein the internucleotide bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19 and 19-20 are thiophosphate internucleotide bonds, wherein the internucleotide bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7 and 17-18 are phosphodiester internucleotide bonds, and wherein each cytosine is 5-methylcytosine.

[0483] Compound number 1620605 is represented by the following chemical symbol: A es T eo m C eo A eo m C eo G eo A ds m C ds A ds T ds T ds T d s T ds m C ds T ds T ds G eo m C es m C es T e (SEQ ID NO: 3338), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and the compound does not contain conjugation groups or terminal groups.

[0484] Compound number 1620605 is represented by the following chemical structure: (SEQ ID NO: 3338) (structure 7) or a pharmaceutically acceptable salt thereof. The pharmaceutically acceptable salt of compound number 1620605 comprises one or more cations selected from sodium, potassium, calcium and magnesium.

[0485] The sodium salt of compound number 1620605 is represented by the following chemical structure: (SEQ ID NO: 3338) (Structure 8).

[0486] IX. Certain comparative compositions In some embodiments, compound 827599 is a comparative compound previously described in WO 2019 / 164562. Compound 827599 consists of the following nucleobase sequence (from 5' to 3'): ACAGATATTTTTGTTCTGCC, designated herein as SEQ ID NO: 3318. The glycosyl indices of compound 827599 are (from 5' to 3'): eeeeddddddddddeeeee; where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The internucleotide indices of compound 827599 are (from 5' to 3'): sossssssssssssssssooss; where each "s" represents a thiophosphate internucleotide bond and each "o" represents a phosphodiester internucleotide bond. Each cytosine nucleobase in compound number 827599 is 5-methylcytosine.

[0487] In some embodiments, compound 763364 is a comparative compound previously described in WO 2019 / 164562. Compound 763364 consists of the following nucleobase sequence (from 5' to 3'): ACGACATTTTCTTGCCTCTT, designated herein as SEQ ID NO: 3319. The glycosyl indices of compound 763364 are (from 5' to 3'): eeeeddddddddddeeeee; where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The internucleotide indices of compound 763364 are (from 5' to 3'): soooosssssssssssssooss; where each "s" represents a thiophosphate internucleotide bond and each "o" represents a phosphodiester internucleotide bond. Each cytosine nucleobase in compound number 763364 is 5-methylcytosine.

[0488] In some embodiments, the compounds described herein are superior to those described in WO2019 / 164562 because they exhibit one or more improved properties, such as duration of action and potency.

[0489] For example, in the determination shown in Example 13, compound numbers 1601260, 1616357, and 1616039 all exhibited longer durations than compound number 827599. in vivo Duration of action. Specifically, compounds 1601260, 1616357, and 1616039 reduced human SNCA RNA by 48%, 58%, and 60%, respectively, on day 224 post-administration. In contrast, compound 827599 reduced human SNCA RNA by 0% on day 224 post-administration. Therefore, in this assay, compounds 1601260, 1616357, and 1616039 all exhibited a longer duration of action than compound 827599.

[0490] For example, compared with compound number 827599 (see Example 14) and compound number 763364 (see Example 22), compound numbers 1601260, 1616357, and 1616039 all showed higher [performance / quality]. in vivo Efficacy. In particular, compounds 1601260, 1616357, and 1616039 showed efficacy in cortical brain tissue. 50 The concentrations were 46 µg, 29 µg, and 23 µg, respectively. In contrast, compound number 827599 showed ED in cortical brain tissue. 50The ED of 122 µg of compound number 763374 in cortical brain tissue 50 The value was 63 µg. Therefore, in these assays, the potency of compounds 1601260, 1616357, and 1616039 was higher than that of compounds 827599 and 763364.

[0491] X. Some hot spots 1. Nucleotides 16,692-16,716 of SEQ ID NO: 1 or 18,758-18 of SEQ ID NO: 2, 782 In some embodiments, nucleotides 16,692-16,716 of SEQ ID NO: 1 or nucleotides 18,758-18,782 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 16,692-16,716 of SEQ ID NO: 1 or within nucleotides 18,758-18,782 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0492] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkddddddddddkeee, ekkddddddddddkeeeee, kkddddddddddkkeee, or kkkddddddddddkeeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0493] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soosssssssssssssoos, soossssssssssssos, soossssssssssssos, soosssssssssssssos, soossssssssssssssss or soooosssssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0494] The nucleobase sequences of SEQ ID NO:78, 2564, 2697, 2747, 2789, 2936, 3063, 3081, 3142, 3189 and 3271 are complementary to the same length portions of nucleobases 16,692-16,716 of SEQ ID NO:1 or nucleobases 18,758-18,782 of SEQ ID NO:2.

[0495] The nucleobase sequences of compounds numbered 1483635, 1484499, 1485433, 1486327, 1486437, 1486657, 1535220, 1535277, 1535335, 1535391, 1535466, 1535496, 1535524, 1535578, and 1535629 are complementary to the same length portions of nucleobases 16,692-16,716 of SEQ ID NO: 1 or nucleobases 18,758-18,782 of SEQ ID NO: 2.

[0496] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 16,692-16,716 of SEQ ID NO: 1 or within nuclei 18,758-18,782 of SEQ ID NO: 2 are used in standard in vitro At least 72% reduction of SNCA mRNA was achieved in the assay. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 16,692-16,716 of SEQ ID NO:1 or within nucleotides 18,758-18,782 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 88.9% in SNCA mRNA.

[0497] 2. Nucleotides 18,568-18,593 of SEQ ID NO: 1 or 20,634-20 of SEQ ID NO: 2. 659 In some embodiments, nucleotides 18,568-18,593 of SEQ ID NO: 1 or nucleotides 20,634-20,659 of SEQ ID NO: 2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 18,568-18,593 of SEQ ID NO: 1 or within nucleotides 20,634-20,659 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0498] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkddddddddddkeee, kkdddddddddkkeee, or kkkddddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0499] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motif of the modified oligonucleotide is (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssooos, soosssssssssssosos, soossssssssssososos or soooosssssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0500] The nucleobase sequences of SEQ ID NO:206, 231, 270, 316, 2486, 2558, 3041, 3076, 3137, 3184 and 3266 are complementary to the same length portions of nucleobases 18,568-18,593 of SEQ ID NO:1 or nucleobases 20,634-20,659 of SEQ ID NO:2.

[0501] The nucleobase sequences of compounds numbered 1482920, 1484352, 1534261, 1534329, 1534428, 1534460, 1535214, 1535272, 1535330, 1535386, 1535439, 1535460, 1535518, and 1535573 are complementary to the same length portions of nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2.

[0502] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 18,568-18,593 of SEQ ID NO: 1 or within nuclei 20,634-20,659 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 73% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 18,568-18,593 of SEQ ID NO:1 or nucleotides 20,634-20,659 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 88.1% in SNCA mRNA.

[0503] 3. Nucleotides 18,621-18,649 of SEQ ID NO: 1 or 20,687-20 of SEQ ID NO: 2. 715 In some embodiments, nucleotides 18,621-18,649 of SEQ ID NO: 1 or nucleotides 20,687-20,715 of SEQ ID NO: 2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 18,621-18,649 of SEQ ID NO: 1 or within nucleotides 20,687-20,715 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0504] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0505] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssos, soossssssssssssos, soosssssssssssssss, soossssssssssssssss or soooosssssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0506] The nucleobase sequences of SEQ ID NO:64, 128, 289, 921, 2744, 2853, 2922, 3031, 3057, 3099, 3123, 3132, 3160, 3207, 3231, 3289 and 3313 are complementary to the same length portions of nucleobases 18,621-18,649 of SEQ ID NO:1 or nucleobases 20,687-20,715 of SEQ ID NO:2.

[0507] The nucleobase sequences of compounds numbered 1485236, 1485314, 1485897, 1486071, 1486591, 1533975, 1534327, 1535209, 1535240, 1535266, 1535297, 1535315, 1535324, 1535355, 1535381, 1535411, 1535437, 1535455, 1535487, 1535513, 1535543, 1535568, 1535598, and 1535628 are within nucleobases 18,621-18,649 of SEQ ID NO: 1 or SEQ ID NO: The equal-length portions of the nucleobases 20,687-20,715 are complementary.

[0508] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 18,621-18,649 of SEQ ID NO: 1 or within nuclei 20,687-20,715 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 61% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 18,621-18,649 of SEQ ID NO:1 or nucleotides 20,687-20,715 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 85.7% in SNCA mRNA.

[0509] 4. Nucleotides 18,721-18,752 of SEQ ID NO: 1 or 20,787-20 of SEQ ID NO: 2. 818 In some embodiments, nucleotides 18,721-18,752 of SEQ ID NO: 1 or nucleotides 20,787-20,818 of SEQ ID NO: 2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 18,721-18,752 of SEQ ID NO: 1 or within nucleotides 20,787-20,818 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixed cEt / MOE gapmer.

[0510] In some embodiments, the gapmer is a 3-10-3 cEt gapmer. In some embodiments, the gapmer is a 3-10-4 cEt gapmer. In some embodiments, the gapmer is a 4-10-3 cEt gapmer. In some embodiments, the gapmer is a 4-10-4 cEt gapmer. In some embodiments, the gapmer is a 3-10-4 or 3-10-5 mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkddddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0511] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssos, soosssssssssssos, soosssssssssssssoos or soossssssssssssssss; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0512] The nucleobase sequences of SEQ ID NO:227, 427, 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176 and 3305 are complementary to the same length portions of nucleobases 18,721-18,752 of SEQ ID NO:1 or nucleobases 20,787-20,818 of SEQ ID NO:2.

[0513] The nucleobase sequences of compounds numbered 1482396, 1483241, 1485037, 1485579, 1486302, 1486305, 1533429, 1534037, 1534406, 1535257, 1535316, 1535372, 1535428, 1535446, 1535504, 1535615 and 1535621 are complementary to the same length portions of nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2.

[0514] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 18,721-18,752 of SEQ ID NO: 1 or within nuclei 20,787-20,818 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 66% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 18,721-18,752 of SEQ ID NO:1 or nucleotides 20,787-20,818 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 85.6% in SNCA mRNA.

[0515] 5. Nucleotides 19,423-19,443 of SEQ ID NO: 1 or 21,489-21 of SEQ ID NO: 2. 509 In some embodiments, nucleotides 19,423-19,443 of SEQ ID NO: 1 or nucleotides 21,489-21,509 of SEQ ID NO: 2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 19,423-19,443 of SEQ ID NO: 1 or within nucleotides 21,489-21,509 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0516] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkddddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0517] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motif of the modified oligonucleotide is (from 5' to 3'): soosssssssssssos, soosssssssssssoos, soossssssssssssooos, soosssssssssssos, soooosssssssssssoos or soooosssssssssssssooos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0518] The nucleobase sequences of SEQ ID NO:203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198 and 3280 are complementary to the same length portions of nucleobases 19,423-19,443 of SEQ ID NO:1 or nucleobases 21,489-21,509 of SEQ ID NO:2.

[0519] The nucleobase sequences of compounds numbered 1484583, 1485328, 1485484, 1534314, 1534320, 1535215, 1535230, 1535287, 1535345, 1535401, 1535477, 1535533 and 1535588 are complementary to the same length portions of nucleobases 19,423-19,443 of SEQ ID NO: 1 or nucleobases 21,489-21,509 of SEQ ID NO: 2.

[0520] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 19,423-19,443 of SEQ ID NO: 1 or within nuclei 21,489-21,509 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 79% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 19,423-19,443 of SEQ ID NO:1 or nucleotides 21,489-21,509 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 88.6% in SNCA mRNA.

[0521] 6. Nucleotides 19,555-19,575 of SEQ ID NO: 1 or 21,621-21 of SEQ ID NO: 2, 641 In some embodiments, nucleotides 19,555-19,575 of SEQ ID NO: 1 or nucleotides 21,621-21,641 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 19,555-19,575 of SEQ ID NO: 1 or within nucleotides 21,621-21,641 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0522] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0523] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motif of the modified oligonucleotide is (from 5' to 3'): soosssssssssssos, soosssssssssssoos, soosssssssssssooos, soooosssssssssssos, soooosssssssssssoos or soooossssssssssssooos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0524] The nucleobase sequences of SEQ ID NO:205, 2594, 2686, 3028, 3097, 3158, 3205 and 3287 are complementary to the same length portions of nucleobases 19,555-19,575 of SEQ ID NO:1 or nucleobases 21,621-21,641 of SEQ ID NO:2.

[0525] The nucleobase sequences of compounds numbered 1485166, 1486157, 1534324, 1535238, 1535292, 1535295, 1535352, 1535409, 1535484, 1535540 and 1535596 are complementary to the same length portions of nucleobases 19,555-19,575 of SEQ ID NO: 1 or nucleobases 21,621-21,641 of SEQ ID NO: 2.

[0526] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 19,555-19,575 of SEQ ID NO: 1 or within nuclei 21,621-21,641 of SEQ ID NO: 2 are used in standard in vitro At least 77% reduction of SNCA mRNA was achieved during the assay. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 19,555-19,575 of SEQ ID NO:1 or nucleotides 21,621-21,641 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 89.5% in SNCA mRNA.

[0527] 7. Nucleotides 21,457-21,501 of SEQ ID NO: 1 or 23,523-23 of SEQ ID NO: 2. 567 In some embodiments, nucleotides 21,457-21,501 of SEQ ID NO: 1 or nucleotides 23,523-23,567 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 21,457-21,501 of SEQ ID NO: 1 or within nucleotides 23,523-23,567 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0528] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkddddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0529] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssos, soosssssssssssos, soossssssssssssss, soosssssssssssssss or soooossssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0530] The nucleobase sequences of SEQ ID NO:214, 247, 865, 1887, 1948, 3067, 3085, 3146, 3193 and 3275 are complementary to the same length portions of nucleobases 21,457-21,501 of SEQ ID NO:1 or nucleobases 23,523-23,567 of SEQ ID NO:2.

[0531] The nucleobase sequences of compounds numbered 1483319, 1483650, 1483923, 1485260, 1534362, 1535224, 1535282, 1535339, 1535396, 1535470, 1535528, 1535563, 1535583 and 1535631 are complementary to the same length portions of nucleobases 21,457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2.

[0532] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 21,457-21,501 of SEQ ID NO: 1 or within nuclei 23,523-23,567 of SEQ ID NO: 2 are used in standard in vitro At least 73% reduction of SNCA mRNA was achieved during the assay. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 21,457-21,501 of SEQ ID NO:1 or nucleotides 23,523-23,567 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 86.6% in SNCA mRNA.

[0533] 8. Nucleotides 22,008-22,030 of SEQ ID NO: 1 or 24,074-24 of SEQ ID NO: 2. 096 In some embodiments, nucleotides 22,008-22,030 of SEQ ID NO: 1 or nucleotides 24,074-24,096 of SEQ ID NO: 2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 22,008-22,030 of SEQ ID NO: 1 or nucleotides 24,074-24,096 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0534] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0535] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssos, soosssssssssssos, soossssssssssssss, soosssssssssssssss or soooossssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0536] The nucleobase sequences of SEQ ID NO:167, 208, 248, 304, 1930, 3054, 3120, 3129, 3228 and 3310 are complementary to the same length portions of nucleobases 22,008-22,030 of SEQ ID NO:1 or nucleobases 24,074-24,096 of SEQ ID NO:2.

[0537] The nucleobase sequences of compounds numbered 1483819, 1484024, 1486466, 1534334, 1534403, 1535206, 1535263, 1535321, 1535377, 1535434, 1535452, 1535510, 1535565 and 1535625 are complementary to the same length portions of nucleobases 22,008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2.

[0538] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 22,008-22,030 of SEQ ID NO: 1 or within nuclei 24,074-24,096 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 75% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 22,008-22,030 of SEQ ID NO:1 or nucleotides 24,074-24,096 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 89% in SNCA mRNA.

[0539] 9. Nucleotides 22,507-22,529 of SEQ ID NO: 1 or 24,573-24 of SEQ ID NO: 2. 595 In some embodiments, nucleotides 22,507-22,529 of SEQ ID NO: 1 or nucleotides 24,573-24,595 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 22,507-22,529 of SEQ ID NO: 1 or nucleotides 24,573-24,595 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0540] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0541] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motif of the modified oligonucleotide is (from 5' to 3'): soosssssssssssos, soosssssssssssoos, soosssssssssssooos, soooosssssssssssos, soooosssssssssssoos or soooossssssssssssooos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0542] The nucleobase sequences of SEQ ID NO:196, 1814, 1909, 3042, 3109, 3170, 3217 and 3299 are complementary to the same length portions of nucleobases 22,507-22,529 of SEQ ID NO:1 or nucleobases 24,573-24,595 of SEQ ID NO:2.

[0543] The nucleobase sequences of compounds numbered 1484851, 1485878, 1534284, 1535251, 1535308, 1535365, 1535422, 1535440, 1535498, 1535553 and 1535609 are complementary to the same length portions of nucleobases 22,507-22,529 of SEQ ID NO: 1 or nucleobases 24,573-24,595 of SEQ ID NO: 2.

[0544] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 22,507-22,529 of SEQ ID NO: 1 or within nuclei 24,573-24,595 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 78% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 22,507-22,529 of SEQ ID NO:1 or nucleotides 24,573-24,595 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 89.4% in SNCA mRNA.

[0545] 10. Nucleotides 22,614-22,637 of SEQ ID NO: 1 or 24,680-24 of SEQ ID NO: 2. 703 In some embodiments, nucleotides 22,614-22,637 of SEQ ID NO: 1 or nucleotides 24,680-24,703 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 22,614-22,637 of SEQ ID NO: 1 or within nucleotides 24,680-24,703 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0546] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0547] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motif of the modified oligonucleotide is (from 5' to 3'): soosssssssssssos, soosssssssssssoos, soosssssssssssooos, soooosssssssssssos, soooosssssssssssoos or soooossssssssssssooos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0548] The nucleobase sequences of SEQ ID NO:171, 207, 245, 489, 2390, 3053, 3119, 3128, 3227 and 3309 are complementary to the same length portions of nucleobases 22,614-22,637 of SEQ ID NO:1 or nucleobases 24,680-24,703 of SEQ ID NO:2.

[0549] The nucleobase sequences of compounds numbered 1482571, 1486455, 1533179, 1534179, 1534332, 1535205, 1535262, 1535320, 1535376, 1535433, 1535451, 1535509, and 1535564 are complementary to the same length portions of nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2.

[0550] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 22,614-22,637 of SEQ ID NO: 1 or within nuclei 24,680-24,703 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 57% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 22,614-22,637 of SEQ ID NO:1 or nucleotides 24,680-24,703 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 87.2% in SNCA mRNA.

[0551] 11. Nucleotides 25,049-25,090 of SEQ ID NO: 1 or 27,115-27 of SEQ ID NO: 2. 156 In some embodiments, nucleotides 25,049-25,090 of SEQ ID NO: 1 or nucleotides 27,115-27,156 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 25,049-25,090 of SEQ ID NO: 1 or nucleotides 27,115-27,156 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0552] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkddddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0553] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssos, soosssssssssssos, soossssssssssssss, soosssssssssssssss or soooossssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0554] The nucleobase sequences of SEQ ID NO:24, 133, 199, 228, 230, 276, 314, 946, 2759, 2818, 2873, 3069, 3087, 3148, 3195 and 3277 are complementary to the same length portions of nucleobases 25,049-25,090 of SEQ ID NO:1 or nucleobases 27,115-27,156 of SEQ ID NO:2.

[0555] The nucleobase sequences of compounds numbered 1484502, 1484512, 1484515, 1485351, 1485506, 1485716, 1534281, 1534299, 1534409, 1534422, 1534454, 1535227, 1535284, 1535342, 1535398, 1535472, 1535530, 1535585, 1535592 and 1535633 are complementary to the same length portions of nucleobases 25,049-25,090 of SEQ ID NO: 1 or nucleobases 27,115-27,156 of SEQ ID NO: 2.

[0556] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 25,049-25,090 of SEQ ID NO: 1 or within nuclei 27,115-27,156 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 71% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 25,049-25,090 of SEQ ID NO:1 or nucleotides 27,115-27,156 of SEQ ID NO:2 were used in the standard assay. in vitro The assay achieved an average reduction of 85.5% in SNCA mRNA.

[0557] 12. Nucleotides 26,367-26,388 of SEQ ID NO: 1 or 28,433-28 of SEQ ID NO: 2. 454 In some embodiments, nucleotides 26,367-26,388 of SEQ ID NO: 1 or nucleotides 28,433-28,454 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 26,367-26,388 of SEQ ID NO: 1 or nucleotides 28,433-28,454 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0558] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0559] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssos, soosssssssssssos, soossssssssssssss, soosssssssssssssss or soooossssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0560] The nucleobase sequences of SEQ ID NO:168, 193, 236, 313, 2446, 3049, 3116, 3177, 3224 and 3306 are complementary to the same length portions of nucleobases 26,367-26,388 of SEQ ID NO:1 or nucleobases 28,433-28,454 of SEQ ID NO:2.

[0561] The nucleobase sequences of compounds numbered 1485739, 1486339, 1534264, 1534442, 1534444, 1535258, 1535317, 1535373, 1535429, 1535447, 1535505, 1535560, 1535616 and 1535622 are complementary to the same length portions of nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2.

[0562] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 26,367-26,388 of SEQ ID NO: 1 or within nuclei 28,433-28,454 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 76% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 26,367-26,388 of SEQ ID NO:1 or nucleotides 28,433-28,454 of SEQ ID NO:2 were used in the standard assay. in vitro The assay achieved an average reduction of 90.5% in SNCA mRNA.

[0563] 13. Nucleotides 26,508-26,531 of SEQ ID NO: 1 or 28,574-28 of SEQ ID NO: 2. 597 In some embodiments, nucleotides 26,508-26,531 of SEQ ID NO: 1 or nucleotides 28,574-28,597 of SEQ ID NO: 2 contain a hotspot region. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 26,508-26,531 of SEQ ID NO: 1 or within nucleotides 28,574-28,597 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0564] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0565] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssos, soosssssssssssos, soossssssssssssss, soosssssssssssssss or soooossssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0566] The nucleobase sequences of SEQ ID NO:210, 223, 272, 273, 274, 1026, 1143, 3020, 3089, 3150, 3197 and 3279 are complementary to the same length portions of nucleobases 26,508-26,531 of SEQ ID NO:1 or nucleobases 28,574-28,597 of SEQ ID NO:2.

[0567] The nucleobase sequences of compounds numbered 1484579, 1485953, 1534266, 1534267, 1534268, 1534341, 1534391, 1535203, 1535229, 1535286, 1535344, 1535400, 1535476, 1535532, 1535587 and 1535636 are complementary to the same length portions of nucleobases 26,508-26,531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2.

[0568] In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 26,508-26,531 of SEQ ID NO: 1 or nucleotides 28,574-28,597 of SEQ ID NO: 2 are used in standard in vitro The assay achieved a reduction of at least 78% in SNCA mRNA. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 26,508-26,531 of SEQ ID NO:1 or nucleotides 28,574-28,597 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 89.3% in SNCA mRNA.

[0569] 14. Nucleotides 30,207-30,226 of SEQ ID NO: 1 or 32,273-32 of SEQ ID NO: 2. 292 In some embodiments, nucleotides 30,207-30,226 of SEQ ID NO: 1 or nucleotides 32,273-32,292 of SEQ ID NO: 2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 30,207-30,226 of SEQ ID NO: 1 or within nucleotides 32,273-32,292 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0570] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0571] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soossssssssssssoos, soossssssssssssos, soosssssssssssos, soossssssssssssss, soosssssssssssssss or soooossssssssssssos; wherein each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond.

[0572] The nucleobase sequences of SEQ ID NO:287, 964, 1040, 1154, 3050, 3117, 3178, 3225 and 3307 are complementary to the same length portions of nucleobases 30,207-30,226 of SEQ ID NO:1 or nucleobases 32,273-32,292 of SEQ ID NO:2.

[0573] The nucleobase sequences of compounds numbered 1485060, 1485105, 1486348, 1534322, 1535260, 1535318, 1535374, 1535430, 1535448, 1535506, 1535561, 1535617 and 1535623 are complementary to the same length portions of nucleobases 30,207-30,226 of SEQ ID NO: 1 or nucleobases 32,273-32,292 of SEQ ID NO: 2.

[0574] In some embodiments, modified oligonucleotides complementary to the same length portions within nuclei 30,207-30,226 of SEQ ID NO: 1 or within nuclei 32,273-32,292 of SEQ ID NO: 2 are used in standard in vitro At least 81% reduction of SNCA mRNA was achieved during the assay. In some embodiments, modified oligonucleotides complementary to the same length portions within nucleotides 30,207-30,226 of SEQ ID NO:1 or nucleotides 32,273-32,292 of SEQ ID NO:2 were used in the standard assay. in vitro The assay showed an average reduction of 92.9% in SNCA mRNA.

[0575] 15. Nucleotides 31,412-31,438 of SEQ ID NO: 1 or 33,478-33 of SEQ ID NO: 2. 504 In some embodiments, nucleotides 31,412-31,438 of SEQ ID NO: 1 or nucleotides 33,478-33,504 of SEQ ID NO: 2 contain hotspot regions. In some embodiments, the modified oligonucleotide is complementary to an equal-length portion within nucleotides 31,412-31,438 of SEQ ID NO: 1 or within nucleotides 33,478-33,504 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide is 16 nucleotides long. In some embodiments, the modified oligonucleotide is 17 nucleotides long. In some embodiments, the modified oligonucleotide is 18 nucleotides long. In some embodiments, the modified oligonucleotide is 20 nucleotides long. In some embodiments, the modified oligonucleotide is a gapmer. In some embodiments, the modified oligonucleotide is a cEt gapmer. In some embodiments, the modified oligonucleotide is a MOE gapmer. In some embodiments, the modified oligonucleotide is a mixture of cEt / MOE gapmers.

[0576] In some embodiments, the gapmer is a 3-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻³ cEt gapmer. In some embodiments, the gapmer is a 4-10⁻⁴ cEt gapmer. In some embodiments, the gapmer is a 5-10⁻⁵ cEt gapmer. In some embodiments, the gapmer is a 3-10⁻⁴ or 3-10⁻⁵ mixed cEt / MOE gapmer. In some embodiments, the glycosylation of the mixed cEt / MOE gapmer is (from 5' to 3'): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; where "k" represents the cEt sugar moiety, "e" represents the 2'-MOE sugar moiety, and "d" represents the 2'-β-D-deoxyribosyl sugar moiety.

[0577] In some embodiments, the internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, the internucleotide bond motifs of the modified oligonucleotide are (from 5' to 3'): soosssssssssssos, soosssssssssssoos, soossssssssssssooos, soosssssssssssos, soossssssssssssss, soosssssssssssssss or soo...

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an isolength portion of an SNCA nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from modified sugars and modified nucleoside inter-bonds.

2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleosides comprising any one of the nucleobase sequences of SEQ ID NO: 13-3334, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside internucleotide bond.

3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases complementary to: Equal-length portions of nucleobases 16,692-16,716 of SEQ ID NO: 1 or nucleobases 18,758-18,782 of SEQ ID NO: 2; Equal-length portions of nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2; Equal-length portions of nucleobases 18,621-18,649 of SEQ ID NO: 1 or nucleobases 20,687-20,715 of SEQ ID NO: 2; Equal-length portions of nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2; Equal-length portions of nucleobases 19,423-19,443 of SEQ ID NO: 1 or nucleobases 21,489-21,509 of SEQ ID NO: 2; Equal-length portions of nucleobases 19,555-19,575 of SEQ ID NO: 1 or nucleobases 21,621-21,641 of SEQ ID NO: 2; Equal-length portions of nucleobases 21,457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2; Equal-length portions of nucleobases 22,008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2; Equal-length portions of nucleobases 22,507-22,529 of SEQ ID NO: 1 or nucleobases 24,573-24,595 of SEQ ID NO: 2; Equal-length portions of nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2; Equal-length portions of nucleobases 25,049-25,090 of SEQ ID NO: 1 or nucleobases 27,115-27,156 of SEQ ID NO: 2; Equal-length portions of nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2; Equal-length portions of nucleobases 26,508-26,531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2; Equal-length portions of nucleobases 30,207-30,226 of SEQ ID NO: 1 or nucleobases 32,273-32,292 of SEQ ID NO: 2; Equal-length portions of nucleobases 31,412-31,438 of SEQ ID NO: 1 or nucleobases 33,478-33,504 of SEQ ID NO: 2; The equivalent length of nucleobases 33,027-33,057 of SEQ ID NO: 1 or nucleobases 35,093-35,123 of SEQ ID NO: 2; or Equal-length portions of nucleobases 48,460-48,489 of SEQ ID NO: 1 or nucleobases 50,526-50,555 of SEQ ID NO: 2; The modified oligonucleotide contains at least one modification selected from the modified sugar moiety and the modified nucleotide inter-bond.

4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases: SEQ ID NO: 78, 2564, 2697, 2747, 2789, 2936, 3063, 3081, 3142, 3189 or 3271; SEQ ID NO: 206, 231, 270, 316, 2486, 2558, 3041, 3076, 3137, 3184 or 3266; SEQ ID NO: 64, 128, 289, 921, 2744, 2853, 2922, 3031, 3057, 3099, 3123, 3132, 3160, 3207, 3231, 3289 or 3313; SEQ ID NO: 227, 427, 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176 or 3305; SEQ ID NO: 203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198 or 3280; SEQ ID NO: 205, 2594, 2686, 3028, 3097, 3158, 3205 or 3287; SEQ ID NO: 214, 247, 865, 1887, 1948, 3067, 3085, 3146, 3193 or 3275; SEQ ID NO: 167, 208, 248, 304, 1930, 3054, 3120, 3129, 3228 or 3310; SEQ ID NO: 196, 1814, 1909, 3042, 3109, 3170, 3217 or 3299; SEQ ID NO: 171, 207, 245, 489, 2390, 3053, 3119, 3128, 3227 or 3309; SEQ ID NO: 24, 133, 199, 228, 230, 276, 314, 946, 2759, 2818, 2873, 3069, 3087, 3148, 3195 or 3277; SEQ ID NO: 168, 193, 236, 313, 2446, 3049, 3116, 3177, 3224 or 3306; SEQ ID NO: 210, 223, 272, 273, 274, 1026, 1143, 3020, 3089, 3150, 3197 or 3279; SEQ ID NO: 287, 964, 1040, 1154, 3050, 3117, 3178, 3225 or 3307; SEQ ID NO: 119, 980, 1085, 1166, 3051, 3118, 3127, 3226 or 3308; SEQ ID NO: 194, 277, 1113, 1185, 1309, 3024, 3093, 3154, 3201 or 3283; or SEQ ID NO: 310, 803, 919, 1582, 1674, 3032, 3032, 3032, 3100, 3161, 3208, 3290 or 3290; The modified oligonucleotide contains at least one modification selected from the modified sugar moiety and the modified nucleotide inter-bond.

5. The oligomeric compound according to any one of claims 1 to 4, wherein when measured across the entire nucleobase sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NO: 1-9.

6. The oligomeric compound according to any one of claims 1 to 5, wherein the modified oligonucleotide comprises 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, or 20 to 50 linked nucleosides.

7. The oligomeric compound according to any one of claims 1 to 6, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

8. The oligomer of claim 7, wherein the modified nucleoside comprises a modified sugar moiety.

9. The oligomer of claim 8, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

10. The oligomer of claim 9, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

11. The oligomeric compound according to any one of claims 7 to 10, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

12. The oligomer according to claim 11, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a 2'-β-D-deoxyxylose sugar moiety, or a 2'-α-L-deoxyribosylose sugar moiety.

13. The oligomeric compound according to any one of claims 7 to 12, wherein the modified nucleoside comprises a sugar substitute.

14. The oligomer according to claim 13, wherein the sugar substitute is any one of morpholino, modified morpholino, ethylene glycol nucleic acid (GNA), hexavalent tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).

15. The oligomeric compound according to any one of claims 1 to 14, wherein the modified oligonucleotide is a gapmer.

16. The oligomeric compound according to any one of claims 1 to 15, wherein the modified oligonucleotide comprises at least one modified nucleoside internucleotide bond.

17. The oligomer according to claim 16, wherein at least one nucleoside internucleotide bond is a phosphate diester nucleoside internucleotide bond.

18. The oligomeric compound according to claim 16 or claim 17, wherein at least one modified nucleoside internucleotide bond is a thiophosphate nucleoside internucleotide bond.

19. The oligomeric compound according to any one of claims 16 to 18, wherein at least one modified nucleoside internucleotide bond is a methanesulfonyl phosphate nucleoside internucleotide bond.

20. The oligomeric compound according to any one of claims 16 to 19, wherein each nucleoside internucleotide bond is independently selected from phosphate diester nucleoside internucleotide bonds, thiophosphate nucleoside internucleotide bonds, and methanesulfonylaminophosphate nucleoside internucleotide bonds.

21. The oligomeric compound according to any one of claims 16, 18 or 19, wherein each nucleoside internucleotide bond is independently selected from thiophosphate nucleoside internucleotide bonds and methanesulfonyl phosphate nucleoside internucleotide bonds.

22. The oligomeric compound according to any one of claims 16 to 18, wherein each nucleoside internucleotide bond is independently selected from phosphate diester nucleoside internucleotide bonds and thiophosphate nucleoside internucleotide bonds.

23. The oligomeric compound according to any one of claims 16 to 22, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 or 19 nucleotide internucleotide bonds of the modified oligonucleotide are phosphate thioester nucleotide internucleotide bonds.

24. The oligomeric compound according to any one of claims 16 to 21, wherein at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight nucleoside bonds of the modified oligonucleotide are methanesulfonyl phosphate nucleoside bonds.

25. The oligomeric compound according to any one of claims 16 to 20, wherein the modified oligonucleotide has a sequence selected from 5'- soossssssssssos -3', 5'- soossssssssssoos -3', 5'- sooossssssssssos-3', 5'- sooossssssssssoos -3', 5'- soooossssssssssooos -3', 5'-soossssssssssooos -3', 5'- soossssssssssssss -3', 5'- sssssssssssssssssss -3', 5'- sooooossssssssssoss -3', 5'- ssssszzzzssssssssss -3', 5'-soooszzzzssssssooss -3', 5'- sooosssssssssssooss -3', 5'- sosssssssssssssooss -3', 5'- sooosszzsssssoss -3', 5'- sossssssssssssssoss -3', 5'-soosszzzzssssssooss -3', 5'- sossszzzzssssssooss -3', 5'- sossszzzzsssssssoss -3', 5'- sssssszsszzszssssss -3', 5'- ssssssssszzsssssoss -3', 5'-ssooszsssssszsssoss -3', 5'- ssosszsssssszzssoss -3', 5'- sssoszzzsssssssssss -3', 5'- ssoosszzsssssssosss -3', 5'- ssssszzsssszzssssss -3', 5'-sssssszssssszsssoss -3', 5'- soossssssssssssooss -3', 5'- sossszzsssszzssosss -3', 5'- sossszzsssszzsssoss -3', 5'- sossszzsssszzssssss -3', 5'-ssssszzsssszzssooss -3', 5'- ssssszssssszzssssss -3', 5'- sssssszsssszzssssss -3', 5'- ssssszzssssszssssss -3', 5'- ssssszzsssszsssssss-3', 5'- sossszssssszzssssss -3', 5'- sosssszsssszzssosss -3', 5'- sossszzssssszssosss -3', 5'- sossszzsssszsssssss -3', 5'- sossszssssszzssssss -3', 5'- sosssszsssszzssssoss -3', 5'- sossszzssssszssssoss -3', 5'- sossszzsssszsssssoss -3', 5'- szssszzssszzsszzss -3', 5'- zzssszzsssszzssssszz -3', 5'-zsssszzssszzsssssz -3', 5'- ssooszssssssszzsssss -3', 5'- sssoszsssssszzsssss -3', 5'- ssooszssssszzssssss -3', 5'- ssssszsssssszzssoss -3', 5'-sssszzsssssszzssssss -3', 5'- soooszzssssszsssooss -3', 5'- soooszzssssszzssooss -3', 5'- ssooszzsssssszsssooss -3', 5'- ssooszzssssszzsooss -3', 5'-sssoszzsssszssooss -3', 5'- sssoszzssssszzsooss -3', 5'- sssoszzssssszssss -3', and 5'- sssoszzssssszzsss -3', where each "s" represents a thiophosphate nucleoside inter-link, each "o" represents a phosphodiester nucleoside inter-link, and each "z" represents a methanesulfonyl phosphate nucleoside inter-link.

26. The oligomeric compound according to any one of claims 1 to 25, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

27. The oligomer compound according to claim 26, wherein the modified nucleobase is 5-methylcytosine.

28. The oligomeric compound of claim 27, wherein each cytosine is 5-methylcytosine.

29. The oligomeric compound according to any one of claims 1 to 28, wherein each nucleoside of the modified oligonucleotide is an unmodified adenine, unmodified guanine, unmodified thymine, unmodified cytosine, or 5-methylcytosine.

30. The oligomeric compound according to any one of claims 1 to 29, wherein the modified oligonucleotide comprises a deoxygenated region.

31. The oligomer according to claim 30, wherein each nucleoside in the deoxygenated region is a 2'-β-D-deoxynucleoside.

32. The oligomer compound according to claim 30 or claim 31, wherein the deoxygenated region is composed of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides.

33. The oligomeric compound according to any one of claims 30 to 32, wherein each nucleoside immediately adjacent to the deoxygenated region comprises a modified sugar moiety.

34. The oligomer compound according to any one of claims 30 to 33, wherein the deoxygenated region is connected to a 5' region on the 5' side and to a 3' region on the 3' side, the 5' region being composed of 1 to 6 linked 5' region nucleosides, and the 3' region being composed of 1 to 6 linked 3' region nucleosides; wherein at least one nucleoside in the 5' region comprises a modified sugar moiety; and at least one nucleoside in the 3' region comprises a modified sugar moiety.

35. The oligomer of claim 34, wherein each nucleoside in the 5' region comprises a modified sugar moiety.

36. The oligomeric compound of claim 34 or claim 35, wherein each nucleoside in the 3' region comprises a modified sugar moiety.

37. The oligomeric compound according to any one of claims 1 to 36, wherein the modified oligonucleotide is composed of 12-30, 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.

38. The oligomeric compound according to any one of claims 1 to 37, wherein the modified oligonucleotide consists of 20 linked nucleosides.

39. The oligomeric compound according to any one of claims 1 to 38, wherein the modified oligonucleotide comprises: The 5' region consists of 1-6 linked 5' region nucleotides; A central region consisting of 6-10 linked central nucleotides; and The 3' region consists of 1-6 linked 3' region nucleotides; Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

40. The oligomeric compound according to any one of claims 1 to 39, wherein the modified oligonucleotide has a glycosyl motif, the glycosyl motif comprising: The 5' region consists of five linked 5'-region nucleotides; The central region consists of 10 connected central nucleotides; and The 3' region consists of 5 linked 3' nucleotides; among which Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

41. The oligomeric compound of claim 40, wherein the modified oligonucleotide has The 5' region consists of five linked 5'-region nucleotides; The central region consists of 10 connected central nucleotides; and The 3' region consists of 5 linked 3' nucleotides; among which Each of the 5' region nucleosides and each of the 3' region nucleosides contains a 2'-MOE sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

42. The oligomeric compound according to any one of claims 1 to 39, wherein the modified oligonucleotide has a glycosyl motif, the glycosyl motif comprising: The 5' region consists of 6 linked 5' nucleotides; The central region consists of 10 connected central nucleotides; and The 3' region consists of four linked 3' nucleotides; Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

43. The oligomeric compound of claim 42, wherein the modified oligonucleotide has The 5' region consists of 6 linked 5' nucleotides; The central region consists of 10 connected central nucleotides; and The 3' region consists of four linked 3' nucleotides; Each of the 5' region nucleosides and each of the 3' region nucleosides contains a 2'-MOE sugar moiety, and each of the central region nucleosides contains a 2'-β-D-deoxyribosyl sugar moiety.

44. The oligomeric compound according to any one of claims 1 to 43, wherein it comprises the modified oligonucleotide.

45. The oligomeric compound according to any one of claims 1 to 43, wherein the oligomeric compound comprises a conjugating group.

46. ​​The oligomer compound of claim 45, wherein the conjugation group comprises a conjugation moiety and a conjugation linker.

47. The oligomer compound according to claim 46, wherein the conjugate connector is a phosphate diester connector.

48. The oligomer compound of claim 46, wherein the conjugate connector is composed of a single bond.

49. The oligomer compound according to any one of claims 46 to 48, wherein the conjugate linker is cleavable.

50. The oligomer compound according to any one of claims 46, 47 or 49, wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker-nucleoside is linked to the conjugate moiety, to the modified oligonucleotide or to another linker-nucleoside via a phosphodiester bond.

51. The oligomeric compound according to any one of claims 45 to 50, wherein the conjugation group is attached to the 5' end of the modified oligonucleotide.

52. The oligomeric compound according to any one of claims 45 to 50, wherein the conjugation group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

53. The oligomeric compound according to any one of claims 1 to 49 or 51 to 52, wherein the oligomeric compound does not contain a linker nucleoside.

54. The oligomeric compound according to any one of claims 1 to 53, comprising a terminal group.

55. The oligomer of claim 54, wherein the terminal group is a debased sugar moiety.

56. The oligomeric compound according to any one of claims 1 to 55, wherein the oligomeric compound is an RNase H agent.

57. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: A es m C es A es G es A es T d z A dz T dz T dz T ds T ds T ds G ds T ds T ds m C es T es G es m C es m C e (SEQ ID NO: 3335), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugated group or a terminal group.

58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: A es m C es G eo A eo m C e s A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m C es T es T e (SEQ ID NO: 3336), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphate thioester nucleoside bond, z = methanesulfonylaminophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugated group or a terminal group.

59. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: A es m C es A es G es A es T d z A dz T ds T ds T ds T ds T dz G dz T ds T ds m C es T es G es m C es m C e (SEQ ID NO: 3337), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugated group or a terminal group.

60. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: A es T eo m C eo A eo m C e o G eo A ds m C ds A ds T ds T ds T ds T ds m C ds T ds T ds G eo m C es m C es T e (SEQ ID NO: 3338), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugated group or a terminal group.

61. The oligomeric compound according to any one of claims 57 to 60, wherein the modified oligonucleotide is a pharmaceutically acceptable salt.

62. The oligomer of claim 61, wherein the oligomer is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

63. The oligomer compound according to any one of claims 1 to 62, wherein the oligomer compound is a single-chain oligomer compound.

64. An oligomeric compound, defined by the following chemical symbol: N 1 es m C es A es G es A es T dz A dz T dz T dz T ds T ds T ds G ds T d s T ds m C es T es G es m C es N 2 e (SEQ ID NO: 3346), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 2 = Cytosine nucleobase, modified cytosine, debased sugar moiety, terminal group, or absent, wherein when N 2 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugation group.

65. An oligomeric compound, defined by the following chemical symbol: N 1 es m C es G eo A eo m C es A dz T ds T ds T ds T ds m C ds T ds T dz G ds m C ds m C es T eo m C es T es N 3 e (SEQ ID NO: 3347), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 3 = Thymine nucleobase, modified thymine, debased sugar moiety, terminal group or absent, wherein when N 3 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphate thioester nucleoside bond, z = methanesulfonylaminophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugation group.

66. An oligomeric compound, defined by the following chemical symbol: N 1 es m C es A es G es A es T dz A dz T ds T ds T ds T ds T dz G dz T d s T ds m C es T es G es m C es N 2 e (SEQ ID NO: 3348), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 2 = Cytosine nucleobase, modified cytosine, debased sugar moiety, terminal group, or absent, wherein when N 2 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and z = methanesulfonylaminophosphate nucleoside internucleotide bond; and The oligomeric compound optionally contains a conjugation group.

67. An oligomeric compound, defined by the following chemical symbol: N 1 es T eo m C eo A eo m C eo G eo A ds m C ds A ds T ds T ds T ds T ds m C d s T ds T ds G eo m C es m C es N 3 e (SEQ ID NO: 3349), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, N 1 = Adenine nucleobase, modified adenine, hypoxanthine, debased sugar moiety, terminal group, or absent, wherein when N 1 When it is absent, the bonds between its sugars and nucleosides are also absent. N 3 = Thymine nucleobase, modified thymine, debased sugar moiety, terminal group or absent, wherein when N 3 When it is absent, its sugar is also absent. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond; and The oligomeric compound optionally contains a conjugation group.

68. The oligomeric compound according to any one of claims 64 to 67, wherein N 1 It is an adenine nucleobase.

69. The oligomer compound according to any one of claims 64 to 67, wherein N 1 It is unmodified adenine.

70. The oligomeric compound according to any one of claims 64 to 67, wherein N 1 It is a modified adenine.

71. The oligomeric compound according to any one of claims 64 to 67, wherein N 1 It is hypoxanthine.

72. The oligomeric compound according to any one of claims 64 to 67, wherein N 1 It is the debased sugar portion.

73. The oligomer compound according to any one of claims 64 to 67, wherein N 1 It is a terminal group.

74. The oligomeric compound according to any one of claims 64 to 67, wherein N 1 It does not exist.

75. The oligomer compound according to any one of claims 64 to 74, wherein N 2 It is a modified cytosine.

76. The oligomeric compound according to any one of claims 64 to 74, wherein N 2 It is 5-methylcytosine.

77. The oligomer compound according to any one of claims 64 to 74, wherein N 2 It is unmodified cytosine.

78. The oligomeric compound according to any one of claims 64 to 74, wherein N 2 It is the debased sugar portion.

79. The oligomer compound according to any one of claims 64 to 74, wherein N 2 It is a terminal group.

80. The oligomeric compound according to any one of claims 64 to 74, wherein N 2 It does not exist.

81. The oligomeric compound according to any one of claims 64 to 74, wherein N 3 It is a modified thymine.

82. The oligomeric compound according to any one of claims 64 to 74, wherein N 3 It is unmodified thymine.

83. The oligomeric compound according to any one of claims 64 to 74, wherein N 3 It is the debased sugar portion.

84. The oligomeric compound according to any one of claims 64 to 74, wherein N 3 It is a terminal group.

85. The oligomeric compound according to any one of claims 64 to 74, wherein N 3 It does not exist.

86. The oligomeric compound according to any one of claims 64 to 80, wherein N 1 It is an adenine nucleobase, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

87. The oligomeric compound according to any one of claims 64 to 80 or 86, wherein N 1 It is an adenine nucleobase, and N 2 It is a modified cytosine.

88. The oligomeric compound according to any one of claims 64 to 80 or 86, wherein N 1 It is an adenine nucleobase, and N 2 It is the debased sugar portion.

89. The oligomeric compound according to any one of claims 64 to 80 or 86, wherein N 1 It is an adenine nucleobase, and N 2 It is a terminal group.

90. The oligomeric compound according to any one of claims 64 to 80 or 86, wherein N 1 It is an adenine nucleobase, and N 2 It does not exist.

91. The oligomeric compound according to any one of claims 64 to 80, wherein N 1 It is a modified adenine, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

92. The oligomeric compound according to any one of claims 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It is a modified cytosine.

93. The oligomeric compound according to any one of claims 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It is 5-methylcytosine.

94. The oligomeric compound according to any one of claims 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It is the debased sugar portion.

95. The oligomeric compound according to any one of claims 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It is a terminal group.

96. The oligomeric compound according to any one of claims 64 to 80 or 91, wherein N 1 It is a modified adenine, and N 2 It does not exist.

97. The oligomeric compound according to any one of claims 64 to 80 or 91, wherein N 1 It is hypoxanthine, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

98. The oligomeric compound according to any one of claims 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It is a modified cytosine.

99. The oligomeric compound according to any one of claims 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It is 5-methylcytosine.

100. The oligomeric compound according to any one of claims 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It is the debased sugar portion.

101. The oligomeric compound according to any one of claims 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It is a terminal group.

102. The oligomeric compound according to any one of claims 64 to 80 or 97, wherein N 1 It is hypoxanthine, and N 2 It does not exist.

103. The oligomeric compound according to any one of claims 64 to 80, wherein N 1 It is the debased sugar moiety, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

104. The oligomeric compound according to any one of claims 64 to 80, wherein N 1 It is a terminal group, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

105. The oligomeric compound according to any one of claims 64 to 80, wherein N 1 It does not exist, and N 2 It is a cytosine nucleobase, a modified cytosine, a debased sugar moiety, a terminal group, or none at all.

106. The oligomeric compound according to any one of claims 64 to 80, wherein N 1 It does not exist, and N 2 It does not exist.

107. The oligomeric compound according to any one of claims 64 to 74 or 81 to 85, wherein N 1 It is an adenine nucleobase, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

108. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 107, wherein N 1 It is an adenine nucleobase, and N 3 It is a thymine nucleobase.

109. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 107, wherein N 1 It is an adenine nucleobase, and N 3 It is a modified thymine.

110. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 107, wherein N 1 It is an adenine nucleobase, and N 3 It is the debased sugar portion.

111. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 107, wherein N 1 It is an adenine nucleobase, and N 3 It is a terminal group.

112. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 107, wherein N 1 It is an adenine nucleobase, and N 3 It does not exist.

113. The oligomeric compound according to any one of claims 64 to 74 or 81 to 85, wherein N 1 It is a modified adenine, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

114. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 113, wherein N 1 It is a modified adenine, and N 3 It is unmodified thymine.

115. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 113, wherein N 1 It is a modified adenine, and N 3 It is the debased sugar portion.

116. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 113, wherein N 1 It is a modified adenine, and N 3 It is a terminal group.

117. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 113, wherein N 1 It is a modified adenine, and N 3 It does not exist.

118. The oligomeric compound according to any one of claims 64 to 74 or 81 to 85, wherein N 1 It is hypoxanthine, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

119. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 118, wherein N 1 It is hypoxanthine, and N 3 It is unmodified thymine.

120. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 118, wherein N 1 It is hypoxanthine, and N 3 It is the debased sugar portion.

121. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 118, wherein N 1 It is hypoxanthine, and N 3 It is a terminal group.

122. The oligomeric compound according to any one of claims 64 to 74, 81 to 85, or 118, wherein N 1 It is hypoxanthine, and N 3 It does not exist.

123. The oligomeric compound according to any one of claims 64 to 74 or 81 to 85, wherein N 1 It is the debased sugar moiety, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

124. The oligomeric compound according to any one of claims 64 to 74 or 81 to 85, wherein N 1 It is a terminal group, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

125. The oligomeric compound according to any one of claims 64 to 74 or 81 to 85, wherein N 1 It does not exist, and N 3 It is a thymine nucleobase, a modified thymine, a debased sugar moiety, a terminal group, or is absent.

126. The oligomeric compound according to any one of claims 64 to 74 or 81 to 85, wherein N 1 It does not exist, and N 3 It does not exist.

127. The oligomeric compound according to any one of claims 64 to 126, wherein the conjugation group comprises a conjugation moiety and a conjugation linker.

128. The oligomer compound according to claim 127, wherein the conjugate connector is a phosphate diester connector.

129. The oligomer compound of claim 127, wherein the conjugate linker is composed of a single bond.

130. The oligomeric compound according to any one of claims 127 to 129, wherein the conjugate linker is cleavable.

131. The oligomer compound according to any one of claims 127, 128 or 130, wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker-nucleoside is linked to the conjugate moiety, to the oligomer compound or to another linker-nucleoside via a phosphodiester bond.

132. The oligomer compound according to any one of claims 64 to 131, wherein the conjugation group is attached to the oligomer compound at the 5' end of the oligomer compound.

133. The oligomer compound according to any one of claims 64 to 131, wherein the conjugation group is attached to the oligomer compound at the 3' end of the oligomer compound.

134. The oligomer compound according to any one of claims 64 to 133, wherein the oligomer compound is a pharmaceutically acceptable salt.

135. The oligomer of claim 133, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium and magnesium.

136. An oligoduplex comprising a first oligomer and a second oligomer, the second oligomer comprising a second modified oligonucleotide, wherein the first oligomer is an oligomer according to any one of claims 1 to 135.

137. The oligoduplex of claim 136, wherein the second modified oligonucleotide comprises 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide includes a complementary region of at least 8 nucleosides that is at least 90% complementary to the equal-length portion of the first modified oligonucleotide.

138. The oligoduplex of claim 136 or claim 137, wherein the modified oligonucleotide of the first oligomer compound comprises a 5'-stable phosphate ester group.

139. The oligomeric duplex of claim 138, wherein the stable phosphate ester group comprises cyclopropylphosphonate or vinylphosphonate.

140. The oligoduplex according to any one of claims 136 to 139, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

141. The oligoduplex of claim 140, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

142. The oligoduplex of claim 141, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2'-4' bridge selected from –O-CH2- and –O-CH(CH3)-.

143. The oligoduplex of claim 140, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

144. The oligoduplex according to claim 143, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F modified sugar moiety, or a 2'-OMe modified sugar moiety.

145. The oligoduplex according to any one of claims 136 to 144, wherein at least one nucleoside internucleotide of the second modified oligonucleotide is a modified nucleoside internucleotide.

146. The oligoduplex according to claim 145, wherein at least one modified nucleoside interchain of the second modified oligonucleotide is a phosphate thioester nucleoside interchain.

147. The oligodichain according to any one of claims 136 to 146, wherein at least one nucleoside internucleotide bond of the second modified oligonucleotide is a phosphodiester nucleoside internucleotide bond.

148. The oligodichain according to any one of claims 145 to 147, wherein at least one nucleoside bond of the second modified oligonucleotide is a methanesulfonyl phosphate nucleoside bond.

149. The oligoduplex according to any one of claims 136 to 148, wherein each nucleoside bond of the second modified oligonucleotide is independently selected from phosphodiester nucleoside bonds, thiophosphate nucleoside bonds, or methanesulfonylaminophosphate nucleoside bonds.

150. The oligoduplex according to any one of claims 136 to 149, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

151. The oligoduplex of claim 150, wherein at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.

152. The oligomeric double strand according to any one of claims 136 to 151, wherein the second modified oligonucleotide comprises a conjugation group.

153. The oligomeric duplex according to claim 152, wherein the conjugation group comprises a conjugation moiety and a conjugation linker.

154. The oligomeric duplex according to claim 153, wherein the conjugate connector is composed of single bonds.

155. The oligomeric duplex according to claim 153 or claim 154, wherein the conjugate linker is pyrolytic.

156. The oligomeric duplex according to claim 153 or claim 155, wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker-nucleoside is linked to the conjugate moiety, to the modified oligonucleotide, or to another linker-nucleoside via a phosphodiester bond.

157. The oligomeric dichain according to any one of claims 153 to 156, wherein the conjugate connector is a phosphate diester connector.

158. The oligomeric double strand according to any one of claims 152 to 157, wherein the conjugation group is attached to the 5' end of the second modified oligonucleotide.

159. The oligomeric double strand according to any one of claims 152 to 157, wherein the conjugation group is attached to the 3' end of the second modified oligonucleotide.

160. The oligoduplex according to any one of claims 152 to 157, wherein the conjugation group is attached via the 2' position of the ribosyl sugar moiety at an internal position of the second modified oligonucleotide.

161. The oligomeric dichain according to any one of claims 152 to 160, wherein the conjugation group comprises C22alkyl, C20alkyl, C16alkyl, C10alkyl, C21alkyl, C19alkyl, C18alkyl, C17alkyl, C15alkyl, C14alkyl, C13alkyl, C12alkyl, C11alkyl, C9alkyl, C8alkyl, C7alkyl, C6alkyl, C5alkyl, C22alken, C20alken, C16alken, C10alken, C21alken, C19alken, C18alken, C17alken, C15alken, C14alken, C13alken, C12alken, C11alken, C9alken, C8alken, C7alken, C6alken, or C5alken.

162. The oligomeric duplex according to any one of claims 152 to 161, wherein the conjugation group comprises a cell-targeting portion.

163. The oligoduplex according to any one of claims 136 to 162, wherein the second modified oligonucleotide comprises a terminal group.

164. The oligodichain according to claim 163, wherein the terminal group is a debased sugar moiety.

165. An antisense agent comprising or consisting of an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of claims 1 to 135.

166. An antisense agent, wherein the antisense agent is an oligomeric dichain according to any one of claims 136 to 164.

167. The antisense agent according to claim 165 or claim 166, wherein the antisense agent is: i) An RNase H agent that can reduce the amount of SNCA nucleic acid by activating RNase H; or ii) RNAi agents that can reduce the amount of SNCA nucleic acids by activating RISC / Ago2.

168. The antisense agent according to any one of claims 165 to 167, wherein the antisense agent comprises a conjugate group, and wherein the conjugate group comprises a cell-targeting portion.

169. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3335), or a pharmaceutically acceptable salt thereof.

170. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3336), or a pharmaceutically acceptable salt thereof.

171. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3337), or a pharmaceutically acceptable salt thereof.

172. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 3338), or a pharmaceutically acceptable salt thereof.

173. The modified oligonucleotide according to any one of claims 169 to 172, wherein it is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

174. A modified oligonucleotide based on the following chemical structure: (SEQID NO: 3335) 175. A modified oligonucleotide based on the following chemical structure: (SEQID NO: 3336) 176. A modified oligonucleotide based on the following chemical structure: (SEQID NO: 3337) 177. A modified oligonucleotide based on the following chemical structure: (SEQID NO: 3338) 178. A group of oligomeric compounds according to any one of claims 1 to 135 or a group of modified oligonucleotides according to any one of claims 169 to 177, wherein the group is chirally enriched with modified oligonucleotides, the modified oligonucleotides comprising at least one specific phosphate thioester nucleoside internucleotide bond having a specific stereochemical configuration.

179. The population of claim 178, wherein the population is chirally enriched with modified oligonucleotides, the modified oligonucleotides comprising ( S At least one specific thiophosphate nucleoside bond in the p) configuration.

180. The population of claim 178, wherein the population is chirally enriched with modified oligonucleotides, the modified oligonucleotides comprising ( R At least one specific thiophosphate nucleoside bond in the p) configuration.

181. The population according to claim 178, wherein the population is chirally enriched with modified oligonucleotides, the modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphate thioester nucleoside internucleotide bond.

182. The population according to claim 178, wherein the population is chirally enriched at each thiophosphate nucleoside internucleotide bond having ( S Modified oligonucleotides with a p) configuration, or those having a (p) configuration at each thiophosphate nucleotide internucleotide bond. R p) Modified oligonucleotides.

183. The population according to claim 178, wherein the population is chirally enriched at a specific thiophosphate nucleoside internucleotide bond having ( R p) configuration, and has (p) at each of the remaining thiophosphate nucleoside internucleotide bonds. S p) Modified oligonucleotides.

184. The population according to claim 178, wherein the population chiral enrichment has a [missing information] in the 5' to 3' direction. S p、 S p and R A modified oligonucleotide with at least three consecutive thiophosphate nucleoside bonds in the p configuration.

185. The group of oligomeric compounds according to any one of claims 1 to 135, modified oligonucleotides according to any one of claims 169 to 177, oligomeric duplexes according to any one of claims 136 to 164, or antisense agents according to any one of claims 165 to 168, wherein all phosphate thioester nucleoside internucleotide bonds of the modified oligonucleotide are stereorandom.

186. The group of oligomeric compounds according to any one of claims 1 to 135, modified oligonucleotides according to any one of claims 169 to 177, oligomeric duplexes according to any one of claims 136 to 164, or antisense agents according to any one of claims 165 to 168, wherein all methanesulfonyl phosphate nucleoside internucleotide bonds of the modified oligonucleotide are stereorandom.

187. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 135, a modified oligonucleotide according to any one of claims 169 to 177, an oligomeric duplex according to any one of claims 136 to 164, an antisense agent according to any one of claims 165 to 168, or a group according to any one of claims 178 to 186, and a pharmaceutically acceptable diluent.

188. The pharmaceutical composition of claim 187, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).

189. The pharmaceutical composition of claim 188, wherein the pharmaceutical composition comprises substantially the oligomeric compound of any one of claims 1 to 135, the modified oligonucleotide of any one of claims 169 to 177, the oligomeric duplex of any one of claims 136 to 164, the antisense agent of any one of claims 165 to 168, or the group of any one of claims 178 to 186, and aCSF.

190. The pharmaceutical composition of claim 188, wherein the pharmaceutical composition comprises substantially the oligomeric compound of any one of claims 1 to 135, the modified oligonucleotide of any one of claims 169 to 177, the oligomeric duplex of any one of claims 136 to 164, the antisense agent of any one of claims 165 to 168, or the group of any one of claims 178 to 186, and PBS.

191. A method comprising administering to a subject an oligomeric compound according to any one of claims 1 to 135, a modified oligonucleotide according to any one of claims 169 to 177, an oligomeric duplex according to any one of claims 136 to 164, an antisense agent according to any one of claims 165 to 168, a group according to any one of claims 178 to 186, or a pharmaceutical composition according to any one of claims 187 to 190.

192. The method of claim 191, wherein the subject has or is at risk of developing synucleinosis.

193. The method of claim 191, wherein the subject has or is at risk of developing Parkinson's disease.

194. The method of claim 191, wherein the subject has or is at risk of developing multiple system atrophy (MSA).

195. The method of claim 191, wherein the subject has or is at risk of developing Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, neurogenic Gaucher disease, or Alzheimer's disease.

196. A method for treating synucleinosis, the method comprising administering to a subject who has or is at risk of developing synucleinosis a therapeutically effective amount of an oligomeric compound according to any one of claims 1 to 135, a modified oligonucleotide according to any one of claims 169 to 177, an oligomeric duplex according to any one of claims 136 to 164, an antisense agent according to any one of claims 165 to 168, a group according to any one of claims 178 to 186, or a pharmaceutical composition according to any one of claims 187 to 190.

197. The method of claim 196, wherein the synucleinosis is Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease.

198. The method of claim 196, wherein the synucleinosis is Parkinson's disease.

199. The method of claim 196, wherein the synucleinosis is multiple system atrophy (MSA).

200. The method according to any one of claims 196 to 199, wherein at least one symptom or marker of synucleinosis is improved.

201. The method of claim 200, wherein the symptoms or signs are motor dysfunction, α-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, decreased sense of smell, autonomic dysfunction, ataxia, hallucinations, or epileptic seizures.

202. The method according to any one of claims 196 to 201, wherein the administration of the oligomeric compound according to any one of claims 1 to 135, the modified oligonucleotide according to any one of claims 169 to 177, the oligomeric duplex according to any one of claims 136 to 164, the antisense agent according to any one of claims 165 to 168, the group according to any one of claims 178 to 186, or the pharmaceutical composition according to any one of claims 187 to 190 reduces or delays the onset or progression of motor dysfunction, α-synuclein aggregation, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmegma, autonomic dysfunction, ataxia, hallucinations, or epileptic seizures.

203. The method according to any one of claims 191 to 202, wherein the oligomeric compound according to any one of claims 1 to 135, the modified oligonucleotide according to any one of claims 169 to 177, the oligomeric duplex according to any one of claims 136 to 164, the antisense agent according to any one of claims 165 to 168, the group according to any one of claims 178 to 186, or the pharmaceutical composition according to any one of claims 187 to 190 is administered to the central nervous system or systemically.

204. The method according to any one of claims 191 to 203, wherein the oligomeric compound according to any one of claims 1 to 135, the modified oligonucleotide according to any one of claims 169 to 177, the oligomeric duplex according to any one of claims 136 to 164, the antisense agent according to any one of claims 165 to 168, the group according to any one of claims 178 to 186, or the pharmaceutical composition according to any one of claims 187 to 190 is administered intrathecally.

205. The method according to any one of claims 191 to 204, wherein the subject is a human being.

206. A method for reducing the expression of SNCA in cells, the method comprising contacting the cells with an oligomeric compound according to any one of claims 1 to 135, a modified oligonucleotide according to any one of claims 169 to 177, an oligomeric duplex according to any one of claims 136 to 164, an antisense agent according to any one of claims 165 to 168, a population according to any one of claims 178 to 186, or a pharmaceutical composition according to any one of claims 187 to 190.

207. The method of claim 206, wherein the cell is a brain cell.

208. The method of claim 206 or claim 207, wherein the cell is a neuron or an oligodendrocyte.

209. The method according to any one of claims 206 to 208, wherein the cell is a human cell.

210. Use of the oligomeric compound according to any one of claims 1 to 135, the modified oligonucleotide according to any one of claims 169 to 177, the oligomeric duplex according to any one of claims 136 to 164, the antisense agent according to any one of claims 165 to 168, the group according to any one of claims 178 to 186, or the pharmaceutical composition according to any one of claims 187 to 190 for the treatment of synucleinosis.

211. Use of the oligomeric compound according to any one of claims 1 to 135, the modified oligonucleotide according to any one of claims 169 to 177, the oligomeric duplex according to any one of claims 136 to 164, the antisense agent according to any one of claims 165 to 168, the group according to any one of claims 178 to 186, or the pharmaceutical composition according to any one of claims 187 to 190 for the preparation of a medicament for the treatment of synucleinosis.

212. The use according to claim 210 or claim 211, wherein the synucleinosis is Parkinson's disease, Lewy body dementia (DLB), diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neurogenic Gaucher disease, or Alzheimer's disease.

213. The use according to claim 210 or claim 211, wherein the synucleinosis is Parkinson's disease.

214. The use according to claim 210 or claim 211, wherein the synucleinosis is multiple system atrophy (MSA).

Images