Lentinula edodes strain jingxian 206 strain, specific molecular marker and application thereof

Abstract

The application discloses a Lentinula edodes Jingxian 206 strain, specific molecular markers and application thereof, relates to the field of agricultural microorganisms and molecular biology technologies. The Jingxian 206 strain is a hybrid strain obtained by taking Lentinula edodes 0912 as a parent strain, and has a preservation number of CGMCC No. 41673. The fruit body agronomic characters of the Jingxian 206 strain are systematically evaluated through three mushroom production pilot tests and one mushroom production pilot test. The results show that the Jingxian 206 strain has the advantages of early mushroom production, high yield of head mushroom, good uniformity of fruit bodies and the like, and has a good industrial application prospect. According to whole genome alignment analysis, specific variation sites of the Jingxian 206 strain are mined, specific molecular markers are designed based on the specific variation sites, and accurate identification and effective protection of the Jingxian 206 strain are realized.

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbiology and molecular biology technology, specifically relating to an early-maturing shiitake mushroom strain Jingxiang 206 and its specific molecular markers and applications. Background Technology

[0002] mushroom( Lentinula edodes Shiitake mushrooms (L.) are a typical edible and medicinal fungus belonging to the Basidiomycetes phylum of the Kingdom Fungi. They are wood-rotting fungi, naturally growing on the dead or weakened trunks of broad-leaved trees. Shiitake mushrooms are a high-quality protein source for humans, rich in functional components such as lentinan and trace elements. They possess edible and medicinal value, including immunomodulatory, anti-tumor potential, anti-inflammatory, and liver-protective properties, and have important applications in food processing, biomedicine, and agricultural ecology. Shiitake mushrooms are the mushroom with the highest total output, the largest total sales volume, and the largest production area in my country, with global annual consumption exceeding 5 million tons. Breeding superior new varieties plays a decisive role in the development of the edible fungi industry, showing significant development potential. However, the market suffers from a serious problem of shiitake mushroom varieties with the same name but different names, and the lack of technology and theoretical knowledge for identifying the authenticity of strains. Conventional molecular markers can only identify down to the genus level, failing to accurately distinguish the differences between various shiitake mushroom varieties and hindering the effective protection of existing cultivated varieties. This seriously damages the rights of breeders and affects the development of the shiitake mushroom industry. Most existing shiitake mushroom varieties suffer from problems such as excessively long mycelial age, long production cycles, prolonged facility occupation time, low biological efficiency, poor mushroom shape and quality, and a high number of deformed mushrooms. The color of shiitake mushroom fruiting bodies is mainly determined by melanin-like pigments and polyphenolic compounds; the darker the color, the higher the accumulation of these substances, which are major interfering factors in DNA or RNA extraction, posing a significant challenge to breeding. Therefore, there is an urgent need for shiitake mushroom varieties with short mycelial age, high yield of high-quality mushrooms, and light color. Simultaneously, the rapid development of breeding technologies such as genomics and molecular biology provides theoretical and technical support for the rapid selection and accurate identification of target varieties. Summary of the Invention

[0003] To address the aforementioned technical issues, this invention uses the widely cultivated shiitake mushroom variety 0912 in northern China as parent material and employs hybridization breeding technology to select the Jingxiang 206 strain. Four fruiting trials were conducted in Beijing and Hebei Province on the parental strains 0912, Jingxiang 206, and 25 hybrid strains. Agronomic traits of these strains were analyzed using phenomics analysis methods, and the phenotypic traits and stability of each strain's fruiting body were systematically evaluated. Based on genome-wide genetic differences, specific molecular markers were developed, enabling the precise identification and effective protection of the Jingxiang 206 strain, which is of great significance for the breeding and protection of new shiitake mushroom varieties.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: One of the objectives of this invention is to provide an early-maturing shiitake mushroom ( Lentinula edodesKyoka 206, its collection number is CGMCC No.41673.

[0005] The second objective of this invention is to provide the application of the early-maturing shiitake mushroom Jingxiang 206 in at least one of the following (1) to (4): (1) As a parent-bred variety; (2) Factory cultivation; (3) Preparation of shiitake fruiting bodies, mycelium and / or spores; (4) Preparation of food and / or medicine.

[0006] The third objective of this invention is to provide a specific primer, the nucleotide sequence of which is shown in SEQ ID NO.1 to SEQ ID NO.2.

[0007] The fourth objective of this invention is to provide a kit containing the specific primers.

[0008] The fifth objective of this invention is to provide a method for identifying early-maturing shiitake mushroom Jingxiang 206, the method comprising using the specific primers or the kit.

[0009] Furthermore, the method includes: extracting total DNA from the shiitake mushroom strain to be identified, performing PCR amplification using the specific primers, and determining that the strain is early-maturing shiitake mushroom Jingxiang 206 if only one target band is amplified at 332 bp.

[0010] Furthermore, the PCR reaction system consists of: 1 µL each of forward and reverse primers, 10 µL of r-Taq enzyme, 2 µL of DNA template, and 6 µL of sterile water.

[0011] Furthermore, the PCR reaction conditions are as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 1 min, 35 cycles; 72 °C extension for 5 min, and termination of the reaction at 4 °C for storage.

[0012] Furthermore, the target band nucleotide sequence amplified by the specific primers is shown in SEQ ID NO.3.

[0013] The sixth objective of this invention is to provide the application of the specific primers, the kit, and / or any of the methods described in identifying early-maturing shiitake mushroom Jingxiang 206 and / or cultivating new shiitake mushroom varieties.

[0014] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention conducted three fruiting experiments on the parent strain 0912 and 26 hybrid strains in Beijing, and one pilot-scale fruiting experiment in Fuping, Hebei. Nineteen strains failed to form fruiting bodies, while seven hybrid strains formed fruiting bodies normally and stably. Analysis of fruiting body yield of the seven hybrid strains that produced fruiting bodies stably and the parent strain revealed that the Jingxiang 206 strain fruited 3-12 days earlier than other hybrid strains, requiring only 90 days from inoculation to fruiting body formation, the same as the parent strain. The results of the three fruiting experiments in Beijing showed that the Jingxiang 206 strain had a much higher rate of high-quality mushrooms than the parent strain, 1.4 times that of the parent strain. Four strains with higher yields were selected for a pilot-scale experiment in Fuping. The results showed that the Jingxiang 206 strain had the highest first-flush yield, 2.67 times that of the parent strain 0912. Therefore, the Jingxiang 206 strain is an early-maturing variety with a significant advantage in first-flush yield.

[0015] (2) This invention utilizes the DUS phenotypic analysis system for shiitake mushrooms to quantitatively analyze the single-fruit weight, cap-to-stem area ratio, cap roundness, cap gray value, and cap thickness of shiitake mushroom fruiting bodies. The results show that the Jingxiang 206 strain has the largest single-fruit weight, which is 1.37 times that of the parent strain. The cap-to-stem area ratio of the Jingxiang 206 strain is 4.69 cm². 2 The fruiting body size of strain Jingxiang 206 is 1.28 times that of the parent strain. The gray value of the cap of strain Jingxiang 206 is higher than that of the parent strain, indicating that the cap color of strain Jingxiang 206 is lighter than that of the parent strain. Furthermore, the cap thickness of strain Jingxiang 206 is significantly greater than that of the parent strain, being 1.32 times thicker. According to the coefficient of variation analysis, the coefficients of variation for all agronomic traits of strain Jingxiang 206 are lower than those of the parent strain, indicating better uniformity. Therefore, strain Jingxiang 206 has the advantages of larger fruiting bodies, thicker caps, lighter cap color, and better uniformity compared to the parent strain.

[0016] (3) In this invention, whole-genome sequencing was performed on 26 hybrid strains, and comparative analysis was conducted using the parental strains as a reference. A unique recombinant variant region was discovered in the Jingxiang 206 strain. Based on this sequence fragment, a pair of specific primers, namely 206 INS, was designed. PCR verification was performed on Jingxiang 206, the parental binuclear strain 0912, the parental mononuclear strain 0912 P1, and the parental mononuclear strain 0912 P2 using these primers. The results showed that the parental binuclear strain 0912 had two bands, indicating that it was a heterozygous strain. The two mononuclear strains (P1 and P2) each had a clear band at 332 bp and 155 bp, respectively. Jingxiang 206 only had one target band at 332 bp, indicating that the Jingxiang 206 strain was homozygous at this site. The 206 INS primers were validated in parental progeny strains. Results showed that 22 hybrid strains exhibited two clear bands, consistent with the parent strain, while 3 hybrid strains showed only one band at 155 bp, unlike the Jingxiang 206 strain. Further validation of the primers was performed using four cultivated shiitake mushroom strains and one wild shiitake mushroom strain. Results showed that the cultivated strains, Shiitake 808 and Shiitake Fuping T2, showed two clear target bands at 155 bp and 332 bp, respectively, consistent with the parent strain. The wild strain, Zixishan, showed only one target band at 155 bp, also unlike the Jingxiang 206 strain. The remaining two traditional cultivated strains, Qingyuan 9608 and Cr04, each showed one non-target band, also unlike the Jingxiang 206 strain. Therefore, the molecular markers developed in this invention can effectively distinguish the Jingxiang 206 strain from other cultivated strains, wild strains, and hybrid strains of the same lineage, achieving accurate identification of the Jingxiang 206 strain.

[0017] Preservation certificate statement: Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Cultures; Accession number: CGMCC No. 41673; Deposit date: November 28, 2024; Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Taxonomic nomenclature: Shiitake mushroom ( Lentinula edodes ). Attached Figure Description

[0018] Figure 1 The fruiting phenotypes of the Jingxiang 206 strain and its parent shiitake mushroom in Example 1 of this invention are shown.

[0019] Figure 2 This is a PCR amplification pattern of the 206 INS-specific primers in Example 1 of the present invention in the single and binucleate strains of Jingxiang 206 and its parent strain 0912.

[0020] Figure 3This is a PCR amplification pattern of hybrid strains 0912 and 26 in Example 1 of the present invention using 206 INS primers.

[0021] Figure 4 This is a PCR amplification pattern of Jingxiang 206, 0912, wild fungi, cultivated fungi, etc. using 206 INS primers in Example 1 of the present invention. Detailed Implementation

[0022] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventional methods.

[0023] The technical solution of the present invention will be further described in detail below with reference to the embodiments.

[0024] Example 1 1. Materials and Methods 1.1 Test Materials The tested shiitake mushroom strains are detailed in Table 1. The Jingxiang 206 strain (SP3×206) has been deposited at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 41673.

[0025] Table 1. Details of the tested strains

[0026]

[0027]

[0028] 1.2 Major Instruments, Equipment, Reagents, and Consumables The main instruments and equipment are shown in Table 2, and the main reagents and consumables are shown in Table 3.

[0029] Table 2 Main Instruments and Equipment

[0030] Table 3 Main Reagents and Consumables

[0031] 1.3 Preparation of Comprehensive PDA Culture Medium PDA composite medium: 200 g of peeled potatoes were boiled in 1 L of deionized water and filtered to obtain the supernatant. 20 g of anhydrous glucose, 3 g of potassium dihydrogen phosphate, 1.5 g of anhydrous magnesium sulfate, 5 g of peptone, 10 mg of vitamin B1 and 20 g of agar powder were added to the supernatant and sterilized at 121 °C for 30 min (see Table 3 for reagent sources).

[0032] 1.4 Activation of microbial strains The preserved strains were transferred and activated twice in PDA medium. The activated strains were cultured in a dark room at 25 ℃ for 1 to 2 weeks. When the mycelium grew to 3 / 4 of the culture dish, which is when the mycelial growth was strongest, the strains were inoculated into bags.

[0033] 1.5 Preparation of small mushroom sticks and spawn The spawn bags were prepared with a dry material weight of 500 g / bag, a formula ratio of 78% fine sawdust, 20% wheat bran, 1% lime, and 1% granulated sugar, a moisture content of 55%, and a pH value of 6.5–7.5. The polyethylene plastic bags used were 330 mm × 170 mm × 0.02 mm in size, and each spawn bag contained 1200 ± 50 g of wet material. After preparation, the bags were autoclaved at 121 ℃ for 150 min. After autoclaving, the spawn bags were transferred to a cooling room for natural cooling, and then inoculated in a clean bench. Twenty bags were inoculated for each variety, with 10 bags used for fruiting experiments and 10 bags used for preparing pilot-scale spawn. After inoculation, the spawn bags were incubated in a 25 ℃ constant temperature and humidity dark room for 40–50 days until the mycelium fully colonized.

[0034] 1.6 Preparation of mushroom spawn After the mycelium has fully colonized the substrate, the prepared pilot-scale spawn is transported to the Fuping base in Hebei Province for inoculation, cultivation, and fruiting trials. The fruiting spawn bags are prepared with a dry substrate weight of 1300 ± 50 g / bag, a formula of 78% sawdust, 20% wheat bran, 1% gypsum, and 1% light calcium carbonate, and a moisture content of 55%. Each bag contains 2400 ± 50 g of wet substrate. After high-temperature sterilization and cooling, 3-4 holes are punched in each spawn bag using a machine. The spawn, sterilized with potassium permanganate, is inserted into the holes, sealed with sterilized tape, and labeled. Each strain is used to inoculate 80 spawn bags.

[0035] 1.7 Mycelium cultivation and fruiting body harvesting The inoculated mushroom logs were cultured in a constant temperature incubator at 25 ℃. After the mycelium had fully expanded, small holes were punctured to release a small amount of oxygen to promote mycelial growth, while larger holes were punctured to release a large amount of oxygen to promote color change in the shiitake mushroom logs. Once the logs had reached physiological maturity, they were placed in a fruiting greenhouse. The ambient temperature was maintained at 10–28 ℃, with a diurnal temperature range of 10 ℃, a relative humidity of 85–95%, adequate diffused light, and proper ventilation. The logs were spaced approximately 10 cm apart for fruiting management. The fruiting bodies were harvested when they reached 6–7 maturity and before the spores were released. For small logs, all fruiting bodies were harvested; for large logs, at least 90 fruiting bodies of each variety were collected for statistical analysis of agronomic traits.

[0036] 1.8 Agronomic Traits Analysis of Shiitake Fruiting Bodies Qualitative and quantitative analyses of the agronomic traits of collected shiitake fruiting bodies were performed using the DUS phenotypic analysis system. Specific analysis details are shown in Table 4.

[0037] Table 4 Measurement Standards for Major Agronomic Traits

[0038] 1.9 DNA extraction from the tested strains After each strain was cultured on PDA medium for 10 days, about 1 g of mycelium was scraped into a 2 mL centrifuge tube, and DNA was extracted using the CTAB method.

[0039] (1) Collect mycelia and quickly add 400 µL of extraction buffer (SDEB) and 400 µL of buffer (2×CTAB) to centrifuge tubes in a fume hood. (2) Immediately vortex mix to fully dissolve the powder in SDEB, and grind it for 5-8 minutes using a cell disruptor; (3) Add 250 µL of phenol and 250 µL of chloroform:isoamyl alcohol (24:1), and vortex at room temperature for 5 min; (4) Centrifuge at 13000 rpm and 4 ℃ for 5 min, and take 600 µL of supernatant; (5) Add 420 µL of isopropanol and mix by inverting the container 10 times. (6) Centrifuge at 13000 rpm and 4 ℃ for 10 min, then discard the supernatant. (7) Add 900 µL of 70% ethanol and mix well; (8) Centrifuge at 13000 rpm and 4 ℃ for 10 min, then discard the supernatant; (9) Add 100-150 µL of sterile water / TE containing RNase enzyme, vortex, and then incubate in a water bath at 37 °C for 30 min; (10) The dissolved DNA was temporarily stored on ice, and the DNA concentration and purity were measured using a micro-analyzer. The DNA quality was tested by running a 1% agarose gel.

[0040] 1.10 Molecular marker development and validation Based on whole-genome alignment analysis, the unique variant position in the genome of strain Jingxiang 206 was identified. Specific primers were designed using Primer3plus software to perform PCR amplification on the tested strain. PCR products were electrophoresed on 2% agarose gels and observed using a gel imaging system. The total PCR reaction volume (20 µL) consisted of: 1 µL each of forward and reverse primers, 10 µL of r-Taq enzyme, 2 µL of DNA template, and 6 µL of sterile water (adjustable according to DNA template concentration). PCR reaction conditions were: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 1 min, 35 cycles; 72 °C extension for 5 min; and termination of the reaction at 4 °C for storage. The PCR amplification products were verified by 2% agarose gel electrophoresis to confirm the effectiveness of the specific primer design.

[0041] 1.11 Agarose gel electrophoresis for imaging ① Preparation of 2% agarose gel: Dissolve 2 g of agarose in 100 mL of TAE solution, microwave for 2 min until the agarose solid is completely dissolved, and when the solution temperature drops to slightly warm but not solidified, add 2-3 µL of nucleic acid dye, mix well and pour into a gel casting plate to solidify for later use.

[0042] ②Spotting: Spot 100 bp DNA Marker into the first well, then spot the PCR amplification products into the other wells in sequence, 5 µL per well.

[0043] ③ Electrophoresis: Set the conditions to 120 V for 40 min. After the electrophoresis is completed, place the gel under a gel electrophoresis imaging instrument for analysis and observation.

[0044] Finally, the electrophoresis results were analyzed to verify the DNA extraction efficiency and the presence or absence of the target band.

[0045] The specific primer information for strain Kyoka 206 is shown in Table 5.

[0046] Table 5. Details of specific primers for strain Kyoka 206

[0047] 2. Agronomic traits analysis of shiitake fruiting bodies 2.1 Fruiting body yield analysis Three fruiting experiments were conducted in Beijing on the parent strain 0912 and 26 hybrid strains, and one pilot-scale fruiting experiment was conducted in Fuping, Hebei Province. Nineteen strains failed to form fruiting bodies, while seven hybrid strains formed fruiting bodies stably. Fruiting body yield analysis was performed on the seven hybrid strains that produced fruiting bodies stably and the parent strain (Table 6). The Jingxiang 206 strain fruited 3–12 days earlier than other hybrid strains, requiring only 90 days from inoculation to fruiting body formation, the same as the parent strain. The results of the three fruiting experiments in Beijing showed that the Jingxiang 206 strain had a significantly higher rate of high-quality fruiting bodies than the parent strain, 1.4 times higher. Four high-yielding strains were selected for a pilot-scale experiment in Fuping. The results showed that the Jingxiang 206 strain had the highest first-flush yield, 2.67 times that of the parent strain 0912. Therefore, the Jingxiang 206 strain is an early-maturing variety with a significant advantage in first-flush yield.

[0048] Table 6. Average total yield and biological efficiency per bag of fruiting strains

[0049] Note: Significance is... p <0.05 indicates .

[0050] 2.2 Analysis of agronomic traits of fruiting bodies The DUS phenotypic analysis system for shiitake mushrooms was used to quantitatively analyze the single fruiting body weight, cap-to-stem area ratio, cap roundness, cap gray value, and cap thickness (Table 7). The results showed that strain Jingxiang 206 had the highest single fruiting body weight, which was 1.37 times that of the parent strain. The cap-to-stem area ratio of strain Jingxiang 206 was 4.69 cm². 2 The gray value of the cap of strain Jingxiang 206 was 1.28 times that of the parent strain. The gray value of the cap of Jingxiang 206 was higher than that of the parent strain, indicating that the cap color of Jingxiang 206 was lighter than that of the parent strain. Furthermore, the cap thickness of Jingxiang 206 was significantly greater than that of the parent strain, being 1.32 times that of the parent strain. Figure 1 According to the coefficient of variation analysis, the coefficients of variation for all agronomic traits of strain Jingxiang 206 were smaller than those of the parent strain (Table 8), indicating better uniformity. Therefore, strain Jingxiang 206 has the advantages of larger fruiting bodies, thicker caps, lighter cap color, and better uniformity compared to the parent strain.

[0051] Table 7 Phenotypic Characteristics Analysis of Fruiting Entities

[0052] Note: Significance is... p <0.05 indicates .

[0053] Table 8. Analysis of the coefficient of variation of phenotypic traits of fruiting bodies

[0054] Note: Coefficient of variation = standard deviation of phenotypic trait / mean of phenotypic trait.

[0055] 3. Analysis of Molecular Marker Validation Results Whole-genome sequencing was performed on 26 hybrid strains, and comparative analysis was conducted using parental strains as a reference. A unique recombinant variant region was discovered in the Jingxiang 206 strain. Based on this sequence fragment, a pair of specific primers, 206INS, was designed. PCR verification was performed using these primers on Jingxiang 206, the parental 0912 binuclear strain, the parental 0912 P1 mononuclear strain, and the parental 0912 P2 mononuclear strain. The results showed that the parental 0912 binuclear strain had two bands, indicating that it was a heterozygous strain. The two mononuclear strains (P1 and P2) each had a clear band at 332 bp and 155 bp, respectively. Figure 2 The Kyoka 206 strain showed only one band at 332 bp, indicating that this site was homozygous. Validation of the 206 INS primers in parental progeny strains revealed that 22 hybrid strains, consistent with the parents, showed two clear bands, while 3 hybrid strains showed only one band at 155 bp, unlike the Kyoka 206 strain. Figure 3 The primers were further validated using four cultivated shiitake mushroom strains and one wild shiitake mushroom strain. The results showed that the two cultivated strains, Shiitake Mushroom 808 and Shiitake Mushroom Fuping T2, had clear target bands at 155 bp and 332 bp, respectively, compared to the parent strain. The wild strain, Zixishan, only had one target band at 155 bp, which was also different from Jingxiang 206. The other two traditional cultivated strains, Qingyuan 9608 and Cr04, each had a non-target band, which was also different from Jingxiang 206. Figure 4 ).

[0056] The above results demonstrate that this molecular marker can effectively distinguish the Jingxiang 206 strain from other cultivated strains, wild strains, and hybrid strains of the same lineage, thus enabling accurate identification of the Jingxiang 206 strain.

[0057] The target nucleotide sequence of the primers for strain Kyoka 206 (SEQ ID NO.3) is as follows: CAACCAAGACACCCAGACCTGGTTCCACTCCCAAGAAATCAACATCCTCCTCGACTCCCCCGAGGTGTGTAGGACGTGGATGGAGGGTGTGCGGAGGAATCAGGGTACTGGTAAGTTTTTTTTTCTTTTTTACCCTTTTACCCTACGGGGGGTTTTTTTTACCTGCAGGGGTTTTTTCTTTTACCCTACGGGGTGGTTTTTTTTACCTACGGAGGTTGAGGTACTGATTATCAATACTTTGCTTTTCTTTGCTTTTCTCCCTCTCTCCACCCTTCCCTCCCTCACAGAAACCTACGGTCGAGTATCCTCCTTAGACGGGTGTTGGCATGATC Nucleotide sequence of the target band of the specific primer for monokaryotic strain P1 of variety 0912 (SEQ ID NO. 4): CAACCAAGACACCCAGACCTGGTTCCACTCCCAAGAAATCAACATCCTCCTCGACTCCCCCGAGGTGTGTAGGACGTGGATGGAGGGTGTGCGGAGGAATCAGGGTACTGGTAAGTTTTTTTTTCTTTTTTACCCTTTTACCCTACGGGGGGTTTTTTTTACCTGCAGGGGTTTTTTCTTTTACCCTACGGGGTGGTTTTTTTTACCTACGGAGGTTGAGGTACTGATTATCAATACTTTGCTTTTCTTTGCTTTTCTCCCTCTCTCCACCCTTCCCTCCCTCACAGAAACCTACGGTCGAGTATCCTCCTTAGACGGGTGTTGGCATGATC Nucleotide sequence of the target band of the specific primer for monokaryotic strain P2 of variety 0912 (SEQ ID NO. 5): CAACCAAGACACCCAGACCTGGTTCCACTCCCAAGAAATCAACATCCTCCTCGACTCCCCCGAGGTGTGTCGTGCGTGGATGGAGGGTGTGCGGAGGAATCAGAACACCGAGGTGTATGGAAGAGTGTCGGAGGTAGACGGGTGTTGGCATGATC 4 Conclusions Based on the analysis of fruiting agronomic traits, this invention shows that the Jingxiang 206 strain requires only 90 days for fruiting body formation, and its first flush yield is 2.67 times that of its parent strain. Furthermore, its single-fruit weight, cap thickness, cap color, and uniformity are all superior to those of its parent strain, making it an early-maturing, high-quality variety suitable for cultivation in the Beijing-Tianjin-Hebei region. Based on whole-genome analysis, specific molecular markers for Jingxiang 206 were designed to effectively distinguish it from other 0912 hybrid varieties and cultivated and wild varieties, enabling precise identification and protection of the Jingxiang 206 strain.

[0058] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A single early-maturing shiitake mushroom ( Lentinula edodes Kyoka 206, characterized in that, Its accession number is CGMCCNo.41673.

2. The use of the early-maturing shiitake mushroom Jingxiang 206 according to claim 1 in at least one of the following (1) to (3): (1) As a parent-bred variety; (2) Factory cultivation; (3) Prepare fruiting bodies, mycelium and / or spores of shiitake mushroom.

3. A method for identifying the early-maturing shiitake mushroom Jingxiang 206 as described in claim 1, characterized in that, The method includes: extracting total DNA from the shiitake mushroom strain to be identified, performing PCR amplification using specific primers, and determining that the strain is early-maturing shiitake mushroom Jingxiang 206 if only one target band is amplified at 332 bp; the nucleotide sequence of the specific primers is shown in SEQ ID NO.1 to SEQ ID NO.2; the nucleotide sequence of the target band amplified by the specific primers is shown in SEQ ID NO.

3.

4. The method according to claim 3, characterized in that, The PCR reaction system consisted of 1 µL each of forward and reverse primers, 10 µL of r-Taq enzyme, 2 µL of DNA template, and 6 µL of sterile water.

5. The method according to claim 4, characterized in that, The PCR reaction conditions were as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 1 min, 35 cycles; 72 °C extension for 5 min, and 4 °C to terminate the reaction and store.

Images