Macrolide drug-resistant bordetella pertussis detection kit and detection method

Abstract

The invention belongs to the technical field of biological detection, genotype detection of a mutation site of Bordetella pertussis 23S rRNA A2047G is realized based on a PCR-melting curve method, and then macrolide antibiotic resistant Bordetella pertussis is detected, and the following technical scheme is adopted: the detection kit for the macrolide antibiotic resistant Bordetella pertussis has the advantages that the genotype of the mutation site of the Bordetella pertussis 23S rRNA A2047G mutation site is detected; the kit comprises a reaction solution, a detection solution, a sensitive positive control, a drug-resistant positive control and a blank control. The detection method comprises the following steps: S1, taking a bordetella pertussis DNA sample as a template, simultaneously using sensitive positive control, drug-resistant positive control and blank control, and using the macrolide antibiotic drug-resistant bordetella pertussis detection kit in the patent for detection; and S2, data processing: after the reaction is finished, performing result judgment through a melting curve of the sample.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological detection, and particularly relates to a macrolide-resistant Bordetella pertussis detection kit and a detection method. BACKGROUND

[0002] Bordetella pertussis is the pathogen causing whooping cough, which is a highly contagious respiratory disease mainly affecting infants and young children, and can cause severe coughing attacks and complications. Macrolide antibiotics (such as erythromycin, azithromycin and clarithromycin) have long been the first-line drugs for treating whooping cough and preventing its spread, however, in recent years, the resistance of Bordetella pertussis to macrolide antibiotics has been reported worldwide, and the A2047G mutation in the 23S rRNA gene (Escherichia coli numbering system) is confirmed as one of the main resistance mechanisms.

[0003] The ribosome of Bordetella pertussis is composed of two subunits, 50S and 30S, and the 50S large subunit contains 23S rRNA and 5S rRNA as well as various proteins. 23S rRNA is the main component of the peptidyl transferase center (PTC) and is also the key target of macrolide antibiotics. The A2047G mutation refers to the substitution of adenine (A) at position 2047 in the 23S rRNA gene with guanine (G), which causes the following changes after the mutation: (1) change of spatial conformation, introduction of G changes the local RNA secondary structure, reducing the affinity of antibiotic molecules with ribosomes; (2) change of electrostatic interaction, change of amino distribution on the purine ring affects antibiotic binding; (3) weakening of intermolecular forces, directly affecting the hydrogen bond network between macrolide molecules and 23S rRNA.

[0004] This mutation leads to cross-resistance to 14-membered ring (such as erythromycin, clarithromycin), 15-membered ring (azithromycin) and 16-membered ring macrolides. The minimum inhibitory concentration (MIC) usually increases by 16-64 times, from sensitive (≤0.5 μg / mL) to resistant (≥8 μg / mL). It is worth noting that this mutation usually does not affect the fitness cost of bacteria, and the mutant strains can persist without antibiotic pressure.

[0005] Traditional methods for detecting bacterial resistance often use agar dilution or E-test methods. Bordetella pertussis grows slowly (requiring 3-5 days of culture), and traditional resistance detection methods may delay clinical decisions, leading to worsening of patient conditions. Furthermore, agar dilution or E-test methods are complex to operate and require strictly standardized conditions (such as culture medium, inoculum size, and culture environment); otherwise, the results may be unstable. In terms of sensitivity, these methods have limited ability to detect low-level or heterogeneous resistance (some mutant strains). Molecular biological methods for detecting 23S rRNA resistance sites (such as A2047G) in Bordetella pertussis have significant advantages over traditional drug susceptibility testing. This invention provides a PCR-melting curve-based detection method for detecting mutations in the 23S rRNA resistance sites (such as A2047G) of Bordetella pertussis, thereby detecting macrolide-resistant Bordetella pertussis. Compared to traditional drug susceptibility testing, this method offers advantages such as ease of operation, shorter processing time, higher sensitivity, and intuitive interpretation. Summary of the Invention

[0006] To achieve the above objectives, this invention provides a detection kit for macrolide-resistant Bordetella pertussis. The invention employs the following technical solution: A detection kit for macrolide-resistant Bordetella pertussis, the kit comprising: reaction solution, detection solution, sensitive positive control, resistant positive control, and blank control.

[0007] Preferably, the reaction solution comprises: 5×PCR buffer, 50mM MgCl2, 0.5mM dNTP, 5U / μl hot-start Taq enzyme, and 5U / μl UDG enzyme.

[0008] Preferably, the detection solution comprises primers F, R, and probe P, with concentrations of 1 μM, 5 μM, and 5 μM, respectively. Further, the 5' end of the probe is labeled with the reporter fluorescent dye FAM, and the 3' end is labeled with the quencher group BHQ1.

[0009] Preferably, the sensitive positive control is: ligating a fragment of the sensitive Bordetella pertussis amplification product into a pUC57 plasmid vector, and diluting it to 10⁻⁶ with sterile purified water. 6 copies / ml.

[0010] Preferably, the drug-resistant positive control is: ligating a fragment of the amplified product of drug-resistant Bordetella pertussis into a pUC57 plasmid vector, and diluting it with sterile purified water to a concentration of 10. 6 copies / ml.

[0011] Preferably, the blank control is sterile purified water.

[0012] This invention also provides a method for detecting macrolide-resistant Bordetella pertussis, comprising the following steps: S1. Using Bordetella pertussis DNA samples as templates, and simultaneously using sensitive positive controls, drug-resistant positive controls, and blank controls, the detection kit for macrolide antibiotic-resistant Bordetella pertussis in this patent is used for detection. S2. Data processing: After the reaction is completed, the results are determined by the melting curve of the sample.

[0013] Compared to traditional methods for detecting macrolide-resistant Bordetella pertussis (such as antibiotic susceptibility testing, phenotypic detection, or conventional PCR combined with sequencing), the PCR melting curve method has the following significant advantages: (1) Fast detection speed, shortening the reporting time Traditional methods, such as antibiotic susceptibility testing (e.g., E-test or agar dilution method), require bacterial culture (3-7 days) before drug susceptibility testing (an additional 1-2 days), which is time-consuming. In contrast, the PCR melting curve method only requires 2-3 hours after nucleic acid extraction (including amplification and dissolution analysis), without the need for culture, which significantly accelerates clinical diagnosis and epidemiological surveillance.

[0014] (2) High sensitivity, suitable for low-load samples Traditional phenotypic testing relies on live bacteria culture, which may result in false negatives if the bacterial count in the sample is low or the bacteria are dead (such as after antibiotic treatment). Melting curve analysis, on the other hand, is based on PCR amplification and can detect target genes with extremely low copy numbers (or even single mutant alleles), making it particularly suitable for low bacterial count samples from children or after vaccination.

[0015] (3) Easy to operate and highly automated Traditional methods require multiple manual operations (culturing, drug sensitivity testing, and result interpretation), while the melting curve method integrates nucleic acid amplification and detection into one, automatically generating results through a real-time fluorescence PCR instrument, reducing human error and making it suitable for high-throughput screening.

[0016] (4) Avoid biosafety risks Traditional culturing requires handling live bacteria, increasing the risk of laboratory exposure; the PCR-melting curve method requires inactivated nucleic acid samples, which better meets biosafety requirements.

[0017] (5) Intuitive interpretation Compared to other molecular biology detection methods (such as MGB probe method and Arms-PCR method), the PCR-melting curve method allows for direct interpretation of results through peak diagrams, making the interpretation process more intuitive. Attached Figure Description

[0018] Figure 1This is a list of primers and probes for this invention; Figure 2 This is a PCR amplification system; Figure 3 For the detection procedure; Figure 4 For validity assessment; Figure 5 As the standard for interpretation; Figure 6 For sensitivity testing; Figure 7 For clinical sample validation testing; Figure 8 Graphs showing the test results for drug-resistant positive control, sensitive positive control, and blank control; Figure 9 Image showing the DNA detection results of drug-resistant Bordetella pertussis; Figure 10 Image showing DNA test results for susceptible Bordetella pertussis; Figure 11 Peak diagram of clinical sample test results. Detailed Implementation

[0019] A detection kit for macrolide-resistant Bordetella pertussis, comprising: a reaction solution, a detection solution, a sensitive positive control, a resistant positive control, and a blank control. Wherein: (1) The reaction solution contains: 5×PCR buffer, 50mM MgCl2, 0.5mM dNTP, 5U / μl hot-start Taq enzyme, and 5U / μl UDG enzyme.

[0020] (2) The detection solution contains primers F and R, and probe P, with concentrations of 1 μM, 5 μM, and 5 μM, respectively. Furthermore, the 5' end of the probe is labeled with the reporter fluorescent dye FAM, and the 3' end is labeled with the quencher group BHQ1. The primer and probe sequences are as follows: Figure 1 As shown.

[0021] (3) The sensitive positive control is: the amplification product fragment of sensitive Bordetella pertussis is ligated into a pUC57 plasmid vector and diluted with sterile purified water to 10. 6 copies / ml.

[0022] (4) The drug-resistant positive control is as follows: the amplification product fragment of drug-resistant Bordetella pertussis is ligated into a pUC57 plasmid vector and diluted with sterile purified water to 10. 6 copies / ml.

[0023] (5) The blank control standard is sterile purified water.

[0024] A method for detecting macrolide-resistant Bordetella pertussis includes the following experimental steps: (1) Main reagents and instruments: The detection reagents in Example 1 were used; the real-time fluorescence quantitative PCR instrument was the Shanghai Hongshi SLAN-96 real-time fluorescence quantitative PCR instrument. The amplification system of fluorescence quantitative PCR is as follows: Figure 2 As shown.

[0025] (2) Sample requirements: Use Bordetella pertussis DNA solution as template.

[0026] (3) Detection process and result interpretation: A. Primer and probe design: The primers and probes for the detection reagents were designed based on the A2047G mutation site of the 23S rRNA gene of Bordetella pertussis. The primers and probes are shown in Table 1.

[0027] B. The positive control for drug resistance was as follows: the amplified product fragment of drug-resistant Bordetella pertussis was ligated into a pUC57 plasmid vector and diluted to 10 with sterile purified water. 6 copies / ml.

[0028] C. The sensitive positive control was prepared by ligating the amplified fragment of the sensitive Bordetella pertussis into a pUC57 plasmid vector and diluting it with sterile purified water to a concentration of 10. 6 copies / ml.

[0029] C. Blank control: The blank control is sterile purified water that does not contain any DNA fragments.

[0030] D. Detection and Assembly: Add 17.5 μl of reaction solution, 2.5 μl of detection solution, and 5 μl of DNA sample to a total detection system of 25 μL. The reaction conditions are: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 15 s, 60℃ annealing and extension for 45 s, 50 cycles; 95℃ denaturation for 1 min, 60℃ annealing for 3 min, followed by melting curve scanning at 60℃-75℃. Figure 3 As shown.

[0031] E. Validity assessment: Positive and blank controls must meet the criteria in Table 4; otherwise, the experimental results are considered invalid.

[0032] F. Result Interpretation: The drug resistance of the test sample is interpreted based on the melting peak of the test sample.

[0033] (4) Experimental results: A. Results of drug-resistant positive control, sensitive positive control, and blank control tests are as follows: Figure 8As shown, the peak shapes of the drug-resistant positive control and the sensitive positive control were good. The melting peak temperature of the drug-resistant positive control was 70.5℃, and the melting peak temperature of the sensitive positive control was 65.5℃. The blank control had no melting peak.

[0034] B. Dilute the DNA of drug-resistant Bordetella pertussis and the DNA of susceptible Bordetella pertussis to 10 μL respectively. 6 10 5 10 4 10 3 The above samples were tested at CFU / ml. The experimental results show that the peak shapes of both Bordetella pertussis samples were good. Figures 9-10 The reagents involved in this invention can detect as low as 10. 3 A sample of CFU / ml.

[0035] C. Sensitivity Test Results: DNA from drug-resistant and susceptible *Bordetella pertussis* was diluted to 1000, 500, and 250 CFU / ml, respectively, and each concentration was tested 20 times. The results showed that the limit of detection for the established macrolide antibiotic-resistant *Bordetella pertussis* detection system was 1000 CFU copies / ml.

[0036] D. Clinical Sample Validation: Twenty clinical samples were collected and tested for drug resistance using the macrolide-resistant Bordetella pertussis detection kit of this invention. The test results showed good peak shape. Figure 11 The interpretation results were completely consistent with the clinical results.

[0037] E. In summary, the test results show that the method of the present invention has good sensitivity, high specificity, and a clear and intuitive interpretation process, and the test results are accurate and reliable.

[0038] F. The detection principle of this kit is based on probe-based PCR-melting curve technology. Probe-based PCR-melting curve technology is a nucleic acid molecule detection technology based on fluorescent probes. Its technical principle mainly relies on the specific hybridization of fluorescently labeled oligonucleotide probes with the target DNA sequence and the melting behavior caused by increasing temperature. By monitoring the changes in fluorescence signal in real time, the melting characteristics of nucleic acid molecules are reflected, thereby achieving qualitative analysis of the target sequence.

[0039] G. The core of this technology lies in the use of probes designed using fluorescence resonance energy transfer (FRET) or fluorescence quenching mechanisms (such as TaqMan probes, molecular beacons, two-hybrid probes, etc.). These probes are usually composed of reporter groups (such as FAM) and quenching groups (such as BHQ1). When the probe is intact, the two groups undergo energy transfer or quenching due to their spatial proximity, and the fluorescence signal is suppressed. However, when the probe hybridizes with the target sequence or undergoes denaturation due to increased temperature, the distance between the two groups changes, resulting in a change or recovery of the fluorescence signal.

[0040] H. In the experiment, the target DNA was first amplified by PCR, followed by melting curve analysis: the reaction system was slowly heated (usually at a rate of 0.1°C / second). As the temperature increased, the probe-target sequence hybrid gradually dissociated, and the fluorescence signal changed dynamically accordingly. When the temperature reached the melting temperature of the probe and target sequence (Tm, i.e., the temperature at which 50% of the probe dissociates), the probe separated from the target sequence, the reporter group and the quencher group moved closer together again, and the fluorescence signal dropped sharply. The change in fluorescence intensity during this process was detected by the instrument, and a melting curve (the first derivative curve of fluorescence value with temperature, i.e., -dF / dTvsT) was plotted. The Tm value of the probe is determined by the matching degree between the probe and the target sequence. A high Tm is achieved when the sequence is perfectly matched, while a single base mismatch will cause a significant decrease in Tm. Therefore, by comparing the differences in Tm values, single nucleotide polymorphism (SNP) detection or mutation analysis can be achieved.

Claims

1. A macrolide-resistant Bordetella pertussis detection kit, characterized by, The kit comprises: a reaction solution, a detection solution, a sensitive positive control, a drug-resistant positive control, a blank control, wherein the reaction solution comprises: 5x PCR buffer, 50mM MgCl2, 0.5mM dNTP, 5U / μl hot start Taq enzyme, 5U / μl UDG enzyme; the detection solution comprises: primers F, R and probe P, with concentrations of 1μM, 5μM and 5μM respectively, further, the 5' end of the probe is labeled with a reporter fluorescent dye FAM, and the 3' end is labeled with a quenching group BHQ1; the sensitive positive control is: the amplification product fragment of the sensitive B. pertussis is connected to a pUC57 plasmid vector, and is diluted to 10 6 copies / ml with sterile purified water respectively; the drug-resistant positive control is: the amplification product fragment of the drug-resistant B. pertussis is connected to a pUC57 plasmid vector, and is diluted to 10 6 copies / ml with sterile purified water respectively; and the blank control is sterile purified water.

2. The test kit for detecting macrolide-resistant Bordetella pertussis according to claim 1, characterized in that: The primer probe specific sequence and serial number are as follows: F： TAACGATGGCCACACTGTCT SEQ ID NO. 1 R： GCCTCCCACCTATCCTACAC SEQ ID NO. 2 P： 5'-fluorescent reporter group-CGGCTAGACGGGAAGACCCCATGAACC-fluorescent quenching group-3' SEQ ID NO.

3.

3. The test kit for detecting macrolide-resistant Bordetella pertussis according to claim 1, characterized in that: The 5' end of the probe P is labeled with FAM fluorescent reporter group, and the 3' end is labeled with quenching group BHQ1.

4. The test kit for detecting macrolide-resistant Bordetella pertussis according to claim 1, characterized by: The final concentration ratio of the primer probe is: SEQ ID NO. 1: SEQ ID NO. 2: SEQ ID NO. 3 is 100 nM: 500 nM: 500 nM.

5. The test kit for detecting macrolide-resistant Bordetella pertussis according to claim 1, characterized by: The macrolide antibiotic-resistant Bordetella pertussis gene fragment sequence is: TAACGATGGCCACACTGTCTCCTCCTGAGACTCAGCGAAGTTGAAGTGTTTGTGA [TGATGCAATCTACCCGCGGCTAGACGGGAAGACCCCATGAACCTTTACTGTAGCTTTGCA] TTGGACTGTGAACCGGCCTGTGTAGGATAGGTGGGAGGC SEQ ID NO. 4 The macrolide antibiotic-sensitive Bordetella pertussis gene fragment sequence is: TAACGATGGCCACACTGTCTCCTCCTGAGACTCAGCGAAGTTGAAGTGTTTGTGA [TGATGCAATCTACCCGCGGCTAGACGGAAAGACCCCATGAACCTTTACTGTAGCTTTGCA] TTGGACTGTGAACCGGCCTGTGTAGGATAGGTGGGAGGC SEQ ID NO.

5.

6. A detection method for the DNA of Bordetella pertussis to be tested by using the macrolide-resistant Bordetella pertussis detection kit according to any one of claims 1-5, characterized in that, (1) Preparation of reaction system and sample addition: 17.5 μl of reaction solution, 2.5 μl of detection solution, and 5 μl of DNA sample are added to a total volume of 25 μl of amplification system; (2) Place the PCR reaction tube into a fluorescent PCR amplifier for amplification detection, and the reaction conditions are as follows: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 15 s, 60℃ annealing and extension for 45 s, 50 cycles; 95℃ denaturation for 1 min, 60℃ annealing for 3 min, and 60℃-75℃ melting curve scanning.

Images