Recombinant xanthomonas campestris with xanthan gum hydrolase displayed on surface as well as construction method and application of recombinant xanthomonas campestris
By displaying xanthan gum hydrolase on the surface of Xanthomonas brassicae and utilizing a recombinant vector consisting of a fusion protein and an immobilized carrier, the complex enzymatic hydrolysis process of xanthan gum was solved, achieving efficient production of low molecular weight xanthan gum, reducing the cell encapsulation effect, and improving production efficiency.
Patent Information
- Application Number
- CN202511955360.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-23
- Publication Date
- 2026-03-13
AI Technical Summary
Existing technologies for the enzymatic hydrolysis of xanthan gum production are complex and make it difficult to efficiently produce low molecular weight xanthan gum. Furthermore, Xanthomonas oryzae exhibits a coating effect during the production of high molecular weight xanthan gum, which affects the nutrient acquisition of the bacteria.
Xanthan gum hydrolase was displayed on the cell surface of Xanthomonas oryzae using surface display technology. The ice crystal nucleoprotein and xanthan gum hydrolase genes were introduced into the strain through a recombinant vector of fusion protein to construct a recombinant strain. An immobilized whole-cell catalyst was then formed using an immobilized vector, simplifying the production process.
This method enables efficient hydrolysis of high molecular weight xanthan gum, simplifies the production process, improves the production efficiency of low molecular weight xanthan gum, reduces the cell encapsulation effect, and promotes the continuous acquisition of nutrients by the cells.
Smart Images

Figure CN121653032A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biology and genetic engineering technology, specifically relating to a recombinant Xanthomonas oryzae strain displaying xanthan gum hydrolase on its surface, its construction method, and its application. Background Technology
[0002] Xanthan gum is a high-molecular-weight extracellular polysaccharide produced by fermentation of Xanthomonas campestris. Its main chain structure is identical to cellulose, consisting of a linear backbone of D-glucose linked by β-1,4-glycosidic bonds. At the C-3 position of every glucose unit, a trisaccharide side chain is attached. This trisaccharide side chain contains one molecule of D-mannose, one molecule of D-glucuronic acid, and one molecule of D-mannose. The mannose units on the side chain typically undergo acetylation and pyruvation modifications. Acetylation occurs at the C-6 position of the inner mannose, while pyruvation is achieved by attaching a ketal to the C-4 and C-6 positions of the terminal mannose.
[0003] Xanthan gum has excellent water solubility and stability, and is widely used in many industrial fields such as food, petroleum, medicine and cosmetics.
[0004] Xanthanase is a class of enzymes that specifically degrade xanthan gum by cleaving the xanthan gum backbone into lower molecular weight oligosaccharide fragments. These enzymes are primarily derived from certain bacteria and fungi. Xanthanase shows potential applications in several areas: it can improve the rheological properties of xanthan gum, expanding its application range; it can degrade xanthan gum in industrial wastewater, reducing environmental pollution; furthermore, the enzymatic hydrolysis product, xanthan gum oligosaccharides, possesses various biological activities, such as antioxidant, immunomodulatory, and growth factor release functions.
[0005] Xanthomonas campestris is a natural xanthan gum-producing bacterium, a Gram-negative bacillus that grows aerobicly and possesses a rich extracellular polysaccharide synthesis system. This bacterium has been widely used industrially for xanthan gum production and possesses several advantageous characteristics as a host strain: it is a GRAS-safe strain; its genetic background is clear, facilitating gene manipulation; and it exhibits strong carbon source utilization and efficient protein secretion capabilities. These characteristics make Xanthomonas campestris one of the ideal platforms for industrial microbial applications.
[0006] Surface display technology is a technique that fuses a target protein with an anchoring protein for expression, thereby anchoring the target protein to the outer membrane of microbial cells. This technology integrates the expression, purification, and immobilization steps of the target protein, avoiding the cumbersome separation and purification operations in traditional enzyme preparation processes, while also facilitating catalyst recovery and reuse.
[0007] Currently, there are few reports on surface display studies of xanthan gum hydrolase, and studies using Xanthomonas oryzae as surface display strains are even rarer.
[0008] By displaying xanthan gum hydrolysates on the surface of *Xanthomonas spp.* cells using surface display technology, not only can the enzyme be directly immobilized, but the hydrolytic properties of the surface hydrolysates also create a favorable microenvironment for *Xanthomonas spp.*, reducing the encapsulation effect of xanthan gum on the cells during xanthan gum production. This facilitates continuous access to nutrients from the culture medium by the cells, resulting in continuous and efficient xanthan gum production, thus constructing a highly efficient xanthan gum production platform. This strategy provides a new technological path for the green, sustainable, and efficient production of xanthan gum. Summary of the Invention
[0009] To avoid the complex purification process in traditional xanthan gum enzymatic hydrolysis production, improve xanthan gum production efficiency, and simplify the xanthan gum production process, this invention provides the following technical solution.
[0010] In a first aspect, the present invention provides a recombinant Xanthomonas brasiliensis strain displaying xanthan gum hydrolase on its surface, wherein the recombinant Xanthomonas brasiliensis strain has a gene encoding a fusion protein, the fusion protein comprising an anchoring protein and xanthan gum hydrolase.
[0011] Preferably, the coding sequence of the xanthan gum hydrolase is as shown in SEQ ID NO.2 or has more than 85% identity with it.
[0012] Furthermore, the specific sequence of SEQ ID NO.2 is as follows:
[0013] Preferably, the anchoring protein is an ice crystal nucleoprotein (INP).
[0014] Furthermore, the coding sequence of the anchoring protein is as shown in SEQ ID NO.1 or has more than 85% identity with it.
[0015] Furthermore, the specific sequence of SEQ ID NO.1 is as follows: .
[0016] Preferably, the aforementioned 85% or more of identity refers to at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.
[0017] In a second aspect, the present invention provides a recombinant vector containing a coding sequence for a fusion protein, the fusion protein comprising an anchoring protein and xanthan gum hydrolase.
[0018] Preferably, the anchoring protein is an ice crystal nucleoprotein (INP).
[0019] Furthermore, the coding sequence of the anchoring protein is as shown in SEQ ID NO.1 or has more than 85% identity with it.
[0020] Preferably, the coding sequence of the xanthan gum hydrolase is as shown in SEQ ID NO.2 or has more than 85% identity with it.
[0021] Preferably, the recombinant vector is a plasmid, such as pBBR1MCS-4.
[0022] Preferably, the fusion expression of the anchoring protein coding sequence and the xanthan gum hydrolase coding sequence is performed using seamless cloning technology.
[0023] Furthermore, the primers used in the seamless cloning are as follows: inp-F:ATGACCCTGGATAAAGCACTGGTT inp-R: CAGCTGCAGCTTTCTTCCATTGTTTGCAGATTTTGCGGGGT Xanthanas-F:ATGGAAGAAGCTGCAGCTGAC Xanthanas-R:TTACAGGTCCCTCTCTGAGATCAG.
[0024] Thirdly, the present invention provides an immobilized whole-cell catalyst, the immobilized whole-cell catalyst comprising the recombinant Xanthomonas campestris described in the first aspect and an immobilized carrier.
[0025] Preferably, the immobilization carrier includes, but is not limited to, activated carbon, mesoporous silica, iron oxide nanoparticles, alginate, chitosan, gum arabic, polyamino acids, polyamide, and polyvinyl alcohol gel.
[0026] Furthermore, the alginate is sodium alginate or calcium alginate.
[0027] Fourthly, the present invention provides a method for displaying xanthan gum hydrolase on the surface of Xanthomonas campestris, comprising the following steps: (1) The xanthan gum hydrolase gene and the anchoring protein gene were fused and expressed to construct a recombinant vector; (2) The recombinant vector was transformed into competent Xanthomonas spp. to induce Xanthomonas spp. to express the fusion protein.
[0028] Preferably, in step (1), the nucleic acid sequence of the xanthan gum hydrolase gene is as shown in SEQ ID NO.2 or has more than 85% identity with it.
[0029] Preferably, in step (1), the nucleic acid sequence of the anchoring protein gene is as shown in SEQ ID NO.1 or has more than 85% identity with it.
[0030] Preferably, in step (1), the recombinant vector is the recombinant vector described in the second aspect.
[0031] Preferably, the inducing agent in step (2) is isopropyl thiogalactoside (IPTG).
[0032] Fifthly, the present invention provides a method for hydrolyzing xanthan gum, the method comprising the steps of mixing the recombinant Xanthomonas campestris described in the first aspect or the immobilized whole-cell catalyst described in the third aspect with xanthan gum and carrying out an enzymatic hydrolysis reaction.
[0033] Preferably, the temperature of the enzymatic hydrolysis reaction is 30~40℃, for example: 30℃, 33℃, 35℃, 37℃, 40℃.
[0034] Preferably, the xanthan gum has a molecular weight >100 wDa, for example: 100 wDa, 200 wDa, 300 wDa, 388 wDa, 500 wDa.
[0035] In a sixth aspect, the present invention provides the application of the recombinant Xanthomonas brassicae described in the first aspect, the recombinant carrier described in the second aspect, or the immobilized whole-cell catalyst described in the third aspect in the production of xanthan gum.
[0036] Preferably, the molecular weight of the xanthan gum product is ≤100 wDa.
[0037] The beneficial effects of this invention are: This invention introduces a recombinant vector expressing the ice crystal nucleoprotein (INP) gene and the xanthan gum hydrolase gene into *Xanthomonas spp.*, constructing a recombinant *Xanthomonas spp.* strain for surface display of xanthan gum hydrolase. This strain can efficiently hydrolyze high molecular weight (e.g., >100 wDa) xanthan gum, simplifying the production process compared to traditional methods and providing a new method for the large-scale production of low molecular weight xanthan gum. Attached Figure Description
[0038] Figure 1 The figure shows the results of TLC characterization of the xanthan gum hydrolase activity on the surface. In the figure, 1 is the blank control and 2 is the reaction solution. Figure 2 The results of mass spectrometry characterization show the xanthan gum hydrolase activity on the surface. Figure 3 The results show a comparison of gum production between recombinant Xanthomonas brassicae and wild-type strains; Figure 4 The image shows a comparison of the microenvironment of recombinant Xanthomonas brasiliensis and wild-type strains. Detailed Implementation
[0039] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. The described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0040] It should be noted that, unless otherwise specified, the experimental methods and reagents used in the embodiments of the present invention are all conventional experimental methods and reagents in the art.
[0041] Example 1: Preparation of recombinant Xanthomonas brasiliensis 1.1 Obtaining the anchoring protein gene Through literature search (Fu Wei. Establishment and Preliminary Application Study of Xanthomonas ice nucleoprotein end-surface display system [D]. Wuhan: Huazhong Agricultural University, 2009.), INP (ice nucleoprotein) was selected as the anchoring protein. The gene fragment of the anchoring protein was obtained by PCR reaction.
[0042] The specific INP gene sequence is as follows: (SEQ ID NO.1) 1.2 Obtaining the xanthan gum hydrolase gene 1.2.1 Design the protein sequence of xylanase, and the specific amino acid sequence is as follows: MEEAAADAQNAEINYNRSVPLEVKGNKIVKQGTDEMVVLRGVNVPSMDWGMAEHLFESMTMVYDSWGANLIRLPINPKYWKNGSVWDEKNLTKEQYQKYIDDMVKAAQARGKYIILDCHRYVMPQQDDLDMWKELAVKYGNNSAVLFGLLNEPHDIKPVGVEKPTTVEQWDVWYNGGQIIVGGEEVTAIGHQQLLNEIRKQGANNICIAGGLNWAFDISGFADGYNERPNGYRLIDTAEGHGVMYDSHAYPVKGAKTAWDTIIGPVRRVAPVIIGEWGWDSSDKNISGGDCTSDIWMNQIMNWMDDTDNQYDGIPVNWTAWNLHMSSSPKMLYSWDYKTTAYNGTHIKNRLLSYNTAPEKLDGVYSTDFSTDDVFRSYTAPSGKASIKYSDESGNVAITPAAANWYATLNFPFDWDLNGIQTITMDISAATAGSVNIGLYGSDMEVWTKAVDVNTEVQTVTIGINELVKQGNPQTDGKLDAALSGIYFGAATADTGSITIDNVKIVKLATPVYTANTYPHKDMGEESYIDIDTTGFKKQTTAWNSKFTGTTMQITDANVLNINGETTKTKCVTYTRDATDTEGCRAKFDLNTVPSMDAKYFTIDIKGNGIAQKLTVSLSGLAYITVNMAEGDTDWHQYIYSLEGNVEYPEDITYVQISADTRTTAEFYIDNIGFSNTKSERLIPYPEKTFVYDFATYNKNTTKYEAAISTESGSEGDTIVATKEEGGLGFDSKALEVKYSRNGNTPSKAKVVYSPNDFFKGNVNDDERTANRATLKADMEYMTDFVFYGKSTSGKNEKINVGVIDTASAMTTYTDTKEFTLTTEWKQFRVPFDEFKILDGGSNLDCARVRGFIFSSAENSGEGSFMIDNITHTSIKGDIEWGLPGGGGSFEEQKLISEEDL (SEQ ID NO.3).
[0043] 1.2.2 Based on the amino acid sequence designed in 1.2.1, obtain the sequence of the target gene, and then synthesize its sequence (SEQ ID NO.2).
[0044]
[0045] 1.3 The xanthan gum hydrolase gene and the anchoring protein gene were fused and expressed to construct a recombinant plasmid.
[0046] 1.3.1 Using pBBR1MCS-4 as the backbone, the xanthanas gene synthesized in INP and 1.2.2 was inserted into the multiple cloning site of this plasmid to obtain the recombinant plasmid.
[0047] 1.3.2 The anchoring protein gene and xanthan gum hydrolase gene were fused and expressed using seamless cloning technology. Specific PCR conditions were: 98℃ pre-denaturation for 30 sec, 98℃ denaturation for 10 sec, 56℃ annealing for 6 sec, 72℃ extension for 1 kb / 5 sec, 30 cycles, 72℃ extension for 5 min, and storage at 12℃. The PCR reaction system (see Table 1) and primers (see Table 2) are also described.
[0048] Table 1 PCR reaction system
[0049] Table 2 PCR reaction primers
[0050] 1.4 Transformation of recombinant plasmids The recombinant plasmid with correct sequencing at 1.4 kV was introduced into competent cells of Xanthomonas oryzae by electroporation (1.8 kV, 5 ms).
[0051] 1.5 Expression of fusion protein Add 2.5 μL of 100 μg / mL kanamycin (Amp) to 5 mL LB medium (10 g / L trypsin, 5 g / L yeast extract, 10 g / L sodium chloride), and inoculate with a bacterial suspension of *Xanthomonas laurentii* containing the recombinant plasmid. Incubate at 28°C with vigorous shaking at 220 rpm for 24 h. Transfer the overnight culture to 100 mL LB liquid medium containing 30 μg / mL Amp and incubate at 28°C with 220 rpm until OD (dose retardation) is reached. 600 The value reached 0.6-0.8. Then, IPTG (2 mM) was added to induce protein expression, and the cells were cultured at 28°C and 220 rpm for 20 h. The bacteria were collected by centrifugation at 4°C and 6000 ×g for 10 min.
[0052] Example 2: Determination of xanthan gum hydrolase activity on the cell surface of recombinant Xanthomonas brassicae The activity of xanthan gum hydrolase displayed on the bacterial cell surface was characterized by TLC and mass spectrometry using the cell opening reaction. The specific procedure is as follows: 2.1 Washing the bacterial cells Take 1 mL of the induced bacterial culture and place it in a 1.5 mL centrifuge tube. Centrifuge the bacterial culture (6000 rpm, 3 min) and discard the supernatant. Wash the bacterial cells with 1×PBS, centrifuge again (6000 rpm, 3 min), discard the supernatant, and repeat the washing step 2-3 times.
[0053] 2.2 Cell opening reaction Take 500 μL of a 5 mg / mL xanthan gum solution (molecular weight 388 wDa, purchased from Fufeng Biotechnology) and mix it with the washed bacterial cells in a 1.5 mL centrifuge. Place the mixture in a metal bath at 37℃ and react for 24 h.
[0054] 2.3 TLC and mass spectrometry characterization Take the bacterial cell reaction solution, centrifuge at 12000 rpm for 10 min, and take the supernatant for TLC and mass spectrometry characterization.
[0055] like Figure 1-2 As shown, the xanthan gum hydrolase displayed on the surface of recombinant rapeseed xanthan cells can degrade macromolecular xanthan gum into xanthan gum pentasaccharides and decasaccharides, and the xanthan gum hydrolase displayed on the surface indicates that it has hydrolytic activity.
[0056] Example 3: Comparative Experiment of Fermentation Gum Production between Recombinant Xanthomonas brassicae and Wild-type Strains 3.1 Preparation of Seed Liquid Wild-type strains were streaked onto LB agar plates, while surface-display strains (recombinant Xanthomonas brassicae) were streaked onto LB agar plates resistant to Amp. The streaked plates were then incubated at 28°C for 20–30 h. Single colonies were picked and inoculated into vials of NB liquid medium (10 g / L peptone, 3 g / L beef extract, 5 g / L sodium chloride). The culture was incubated at 220 rpm for 24 h at 28°C to obtain a seed culture.
[0057] 3.2 Fermentation of the strain to produce gum Take 3.1g of seed culture and inoculate it at a 3% inoculation rate into 60mL of fermentation broth (4% sucrose, 0.4% peptone, 0.2% calcium carbonate, 0.3% dipotassium hydrogen phosphate, 0.05% magnesium sulfate heptahydrate, 0.025% ferrous sulfate, 0.025% citric acid). Incubate until OD... 600 When the pH is 0.6-0.8, 2 mM IPTG is added for induction. After induction, the culture is carried out for 3 days, and samples are taken every 24 hours to measure the OD of the fermentation broth cells. 600 Meanwhile, xanthan gum was obtained by alcohol precipitation and freeze-drying, and the xanthan gum yield was calculated.
[0058] like Figure 3 As shown, after 72 h of fermentation, the surface-display strain produced 6.7 g / L of gum, which is about twice that of the wild-type strain (3.3 g / L).
[0059] Example 4: Observation of the microenvironment on the cell surface during fermentation. During the fermentation process in section 3.2, a sample of the fermentation broth was taken and mixed with a 100 mg / mL melanin solution at a ratio of 1:1 (v / v). Then, 10-20 μL of the mixture was transferred onto a glass slide, covered with a coverslip, and left to stand under natural conditions for about 1 hour. The mixture was then observed using an oil immersion microscope.
[0060] like Figure 4 As shown, at 48 h of fermentation, wild-type cells were encapsulated by xanthan gum produced by the cells themselves, and the encapsulation effect intensified at 72 h; while the encapsulation effect of surface-displayed cells only appeared at 72 h of fermentation. This indicates that the xanthan gum hydrolase displayed on the cell surface can create a favorable microenvironment for Xanthomonas brassicae, facilitating the continuous uptake of nutrients from the culture medium by the cells.
[0061] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural transformations made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.
Claims
1. A recombinant Xanthomonas brasiliensis strain displaying xanthan gum hydrolase on its surface, characterized in that, The recombinant Xanthomonas brasiliensis strain is infused with a gene encoding a fusion protein, the fusion protein comprising an anchoring protein and xanthan gum hydrolase, the coding sequence of which is shown in SEQ ID NO.2 or has more than 85% identity with it.
2. The recombinant Xanthomonas brassicae according to claim 1, characterized in that, The coding sequence of the anchoring protein is as shown in SEQ ID NO.1 or has more than 85% identity with it.
3. A recombinant vector, characterized in that, The recombinant vector contains the coding sequence of a fusion protein, which includes an anchoring protein and xanthan gum hydrolase, the coding sequence of which is as shown in SEQ ID NO.2 or has more than 85% identity with it.
4. The recombinant vector according to claim 3, characterized in that, The coding sequence of the anchoring protein is as shown in SEQ ID NO.1 or has more than 85% identity with it.
5. An immobilized whole-cell catalyst, characterized in that, The immobilized whole-cell catalyst comprises the recombinant Xanthomonas brassicae according to any one of claims 1-2 and the immobilized carrier.
6. A method for displaying xanthan gum hydrolase on the surface of Xanthomonas campestris, characterized in that, The method includes the following steps: (1) The xanthan gum hydrolase gene and the anchoring protein gene were fused and expressed to construct a recombinant vector; (2) The recombinant vector was transformed into competent Xanthomonas spp. to induce Xanthomonas spp. to express the fusion protein.
7. The method according to claim 6, characterized in that, The coding sequence of the anchored protein is as shown in SEQ ID NO.1 or has more than 85% identity with it, and / or The coding sequence of the xanthan gum hydrolase is as shown in SEQ ID NO.2 or has more than 85% identity with it.
8. A method for hydrolyzing xanthan gum, characterized in that, The hydrolysis method includes the steps of mixing the recombinant Xanthomonas brassicae according to any one of claims 1-2 or the immobilized whole-cell catalyst according to claim 5 with xanthan gum and carrying out an enzymatic hydrolysis reaction.
9. The hydrolysis method according to claim 7, characterized in that, The enzymatic hydrolysis reaction is carried out at a temperature of 30-40°C, and / or The xanthan gum has a molecular weight >100 wDa.
10. The use of the recombinant Xanthomonas brassicae according to any one of claims 1-2, the recombinant vector according to any one of claims 3-4, or the immobilized whole-cell catalyst according to claim 5 in the production of xanthan gum.