Primers, kits, and methods for rapid sex identification of peach fruit borer based on specific molecular markers.

By designing molecular markers and primer pairs based on male-specific expression genes of the peach fruit borer, and combining PCR amplification and electrophoresis identification methods, the problem of low efficiency in traditional morphological identification has been solved, achieving efficient and accurate sex identification, and supporting scientific research and the development of control technologies.

CN121826186BActive Publication Date: 2026-05-26PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
Filing Date
2026-03-13
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient for accurately and quickly identifying the sex of the peach fruit borer. Traditional morphological methods are inefficient and cannot meet the needs of population monitoring and sex-specific control technologies.

Method used

Molecular markers based on male-specific expression genes of the peach fruit borer were designed, and PCR amplification was performed using specific primer pairs. Sex was then identified by agarose gel electrophoresis. Specific primer pairs and kits are provided to achieve efficient and accurate sex identification.

Benefits of technology

It enables efficient and accurate sex identification of peach fruit borer at various developmental stages, supports sex ratio monitoring and mating behavior research, and provides a basis for the implementation of sex-specific control technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121826186B_ABST
    Figure CN121826186B_ABST
Patent Text Reader

Abstract

This invention discloses primers, kits, and methods for rapid sex identification of the peach fruit borer based on specific molecular markers. The primer pairs are based on male-specific genes of the peach fruit borer. CpunM The design incorporates the following primer sequences: 5'-AGGCTTTCGACAAGCTTCTCTA-3' and 5'-CCTGATTTGCGTGATAAGTGGT-3'. Specific PCR detection enables reliable sex identification of peach fruit borer larvae, pupae, and adults. This invention provides efficient and reliable technical support for implementing sex-specific control strategies for peach fruit borer, including sex ratio monitoring, mating behavior research, and sterile insect technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of insect control, specifically relating to a molecular marker based on a male-specific gene expressed by the peach fruit borer, a specific primer pair for sex identification, and a method for sex identification. Background Technology

[0002] The peach fruit borer is an important polyphagous agricultural pest that mainly damages more than 100 kinds of plants, including fruit trees, corn, and sunflowers, and is widely distributed in many production areas across the country.

[0003] The peach fruit borer is characterized by its wide host range, multiple generations, and concealed borer behavior, making it difficult to control. Current control relies mainly on chemical methods, requiring frequent pesticide applications annually, which not only increases production costs but also easily leads to pesticide residues, the development of pesticide resistance, and ecological damage. Current research largely focuses on its occurrence patterns, monitoring techniques, and integrated pest management, while reports on basic biological research regarding sex identification are scarce. However, sex identification is crucial for studying its population dynamics, mating behavior, pheromone regulation, and developing sex-specific control technologies (such as sterile insect technology and sex pheromone interference).

[0004] Currently, sex identification of the peach fruit borer mainly relies on the external morphological characteristics of the late pupal stage or adult stage. However, the morphological differences between males and females are extremely small during the pupal and larval stages, making accurate identification difficult. Field samples are mostly from the juvenile or pupal stages. Traditional morphological methods rely on experience, have large errors, and are inefficient, failing to meet the needs of population monitoring and the development of sex-specific control technologies. Therefore, based on morphological identification, there is an urgent need to establish an accurate, rapid, and applicable molecular sex identification technique for the peach fruit borer applicable to all developmental stages, providing technical support for the biological research and green control of this insect. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker based on a male-specific expression gene of the peach fruit borer, a specific primer pair for sex identification, a kit, and an identification method thereof.

[0006] The first objective of this invention is to provide a specific molecular marker for sexing peach borer, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The second objective of this invention is to provide a pair of primers for sex identification of the peach fruit borer, comprising a forward primer: 5'-AGGCTTTCGACAAGCTTCTCTA-3' and a reverse primer: 5'-CCTGATTTGCGTGATAAGTGGT-3'.

[0008] A third objective of this invention is to provide a kit for sexing peach fruit borers, which contains the aforementioned primer pairs.

[0009] The fourth objective of this invention is to provide a method for sexing peach fruit borers, comprising the following steps:

[0010] RNA was extracted from the peach fruit borer and then reverse transcribed into cDNA. PCR amplification was then performed using the primer pairs described above, followed by agarose gel electrophoresis. A band at the 254 bp position indicated a male peach fruit borer, while no band indicated a female peach fruit borer.

[0011] Preferably, the peach borer can be any stage of the peach borer, such as pupa, adult or larva.

[0012] Preferably, the PCR amplification reaction system is as follows: 5 μL of 2× Taq HiFi PCR mix, 0.2 μL of 10 μM forward primer, 0.2 μL of 10 μM reverse primer, 0.2 μL of cDNA template, and RNase-free water added to 10 μL.

[0013] Preferably, the PCR amplification reaction program is as follows: 95 °C pre-denaturation for 3 min; 94 °C denaturation for 25 s; 58 °C annealing for 25 s; 72 °C extension for 8 s; repeat denaturation-annealing-extension for 35 cycles; 72 °C extension for 5 min.

[0014] A fifth objective of this invention is to provide the application of the aforementioned specific molecular markers, primer pairs, or kits in the sex identification of peach fruit borers.

[0015] This invention utilizes molecular biology techniques to achieve efficient and accurate sex identification of the peach fruit borer, enabling reliable sex identification of larvae, pupae, and adults. This invention provides efficient and reliable technical support for the implementation of sex-specific control strategies for the peach fruit borer, including sex ratio monitoring, mating behavior research, and sterile insect technology. It also provides a reliable reference for scientific research and control technology development related to this insect. Attached Figure Description

[0016] Figure 1 Transcriptome of male and female peach borer adults CpunM Gene expression levels.

[0017] Figure 2 This diagram illustrates the sex identification of peach borer larvae, pupae, and adults. M: DNA Marker; lanes 1-4: larvae; lanes 5-8: pupae; lanes 9-12: adults. Detailed Implementation

[0018] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0019] Example 1:

[0020] I. Experimental Methods

[0021] 1. Primer design and specific detection

[0022] Using male and female transcriptome data of the peach fruit borer, a gene 028895 (named...) that is expressed specifically in the male was identified. CpunM () Figure 1 ), and obtained its coding sequence as: 5'-ATGTCCATGCCTTGTCTGACCAGGCTTTCGACAAGCTTCTCTACGTTGACATTCTGCGGGACCGGAGACGCCAACTCAGCGTACTTGCTGGTGAAATCTTGGGCAGATTTTAAGCCTTCCTCCAGGACAGACGCCATTACAGCGCTGAAGAAGGCT ACGACTAGGCACAAGACTGAGGCCCACTTCATTTTGGCGACTATAATGGATACCAAACGTCGGAATGGTTATTTATTTGCCGTCCGATTTCACGGTTACCACTTATCACGCAAATCAGGTATAATATATCAGTGCGGCGAATTGATTCAGAGTGAACTTAATTAA-3' (SEQ ID NO.1).

[0023] Primers were designed using Snap gene software, and after screening, a pair of highly specific primers were obtained and sent to Guangzhou Tianyi Huayu Biotechnology Co., Ltd. for synthesis. The forward primer sequence is: 5'-AGGCTTTCGACAAGCTTCTCTA-3' (SEQ ID NO.3); the reverse primer sequence is: 5'-CCTGATTTGCGTGATAAGTGGT-3' (SEQ ID NO.4).

[0024] The nucleotide sequence of the amplified product is: 5'-AGGCTTTCGACAAGCTTCTCTACGTTGACATTCTGCGGGACCGGAGACGCCAACTCAGCGTACTTGCTGGTGAAATCTTGGGCAGATTTTAAGCCTTCCTCCAGGACAGACGCCATTACAGCG CTGAAGAAGGCTACGACTAGGCACAAGACTGAGGCCCACTTCATTTTGGCGACTATAATGGATACCAAACGTCGGAATGGTTATTTATTTGCCGTCCGATTTCACGGTTACCACTTATCACGCAAATCAGG-3' (SEQ ID NO.2).

[0025] 2. RNA extraction from peach fruit borer samples

[0026] Larvae reared in the laboratory were collected. Pupae were collected on the 4th day after pupation. After the pupae emerged as adults, the sex of the adults was identified by their external genitalia. The collected larvae, pupae and adults were washed twice with 1×PBS buffer and placed into 1.5mL centrifuge tubes. Total RNA was extracted using the TRIzol method (MIKX, Guangzhou). The integrity and purity of the extracted RNA were detected by 1% agarose gel electrophoresis and microplate reader, respectively, and stored at -80℃ for later use.

[0027] 3. Synthesis of cDNA library from peach fruit borer samples

[0028] Using 1 μg RNA as a template, the reverse transcription reaction system was prepared using cDNA prepared with the Evo M-MLV reverse transcription kit:

[0029] ;

[0030] The reaction conditions were: 37 °C for 15 min; 85 °C for 5 s; 4 °C, Hold.

[0031] 4. PCR amplification of peach fruit borer samples

[0032] Specific primers were designed based on the screened male-specific gene sequences. The obtained cDNA was diluted 10-fold as a template for PCR amplification. The amplification system was as follows:

[0033] ;

[0034] The reaction conditions were as follows: 95 °C pre-denaturation for 3 min; 94 °C denaturation for 25 s; 58 °C annealing for 25 s; 72 °C extension for 8 s; denaturation-annealing-extension repeated for 35 cycles; 72 °C extension for 5 min; storage at 4 °C to obtain PCR products.

[0035] 5. Agarose gel assay of PCR products

[0036] Prepare a 1% agarose gel and perform electrophoresis on 3 μL of the PCR product from the previous step. The electrophoresis is stopped when the bromophenol blue dye migrates to the lower 1 / 3 of the gel. The sex of the peach fruit borer is identified by the gel imaging results. The primer pair is around 250 bp (specifically 254 bp). The one that can amplify the band is the male peach fruit borer, and the one that cannot amplify the band is the female peach fruit borer.

[0037] II. Experimental Results

[0038] Depend on Figure 1 It can be seen that in the male and female transcriptomes, CpunMThe gene is specifically expressed in females.

[0039] Depend on Figure 2 It can be seen that 254 bp specific bands were amplified in larval samples 3-4, pupa samples 7-8, and adult samples 11-12, therefore 3-4, 7-8, and 11-12 are male peach fruit borers; no specific bands were amplified in larval samples 1-2, pupa samples 5-6, and adult samples 9-10, therefore 1-2, 5-6, and 9-10 are female peach fruit borers, which is consistent with the actual situation.

[0040] This detection method has excellent sensitivity.

Claims

1. A pair of primers for sex identification of the peach fruit borer, characterized in that, It includes the forward primer: 5'-AGGCTTTCGACAAGCTTCTCTA-3' and the reverse primer: 5'-CCTGATTTGCGTGATAAGTGGT-3'.

2. A kit for sexing peach fruit borers, characterized in that, Contains the primer pair as described in claim 1.

3. A method for identifying the sex of the peach fruit borer, characterized in that, Includes the following steps: RNA was extracted from the peach fruit borer and then reverse transcribed into cDNA. PCR amplification was then performed using the primer pair described in claim 1, followed by agarose gel electrophoresis. A band at the 254 bp position indicated a male peach fruit borer, while no band indicated a female peach fruit borer.

4. The identification method according to claim 3, characterized in that, The peach borer mentioned refers to peach borers in various stages of development.

5. The identification method according to claim 4, characterized in that, The peach borer mentioned refers to the pupa, adult, or larva.

6. The identification method according to claim 3, characterized in that, The PCR amplification reaction system is as follows: 5 μL of 2×Taq HiFi PCR mix, 0.2 μL of 10 μM forward primer, 0.2 μL of 10 μM reverse primer, 0.2 μL of cDNA template, and RNase-free water added to 10 μL.

7. The identification method according to claim 3, characterized in that, The PCR amplification procedure is as follows: 95 °C pre-denaturation for 3 min; 94 °C denaturation for 25 s; 58 °C annealing for 25 s; 72 °C extension for 8 s; repeat denaturation-annealing-extension for 35 cycles; 72 °C extension for 5 min.

8. The application of the primer pair of claim 1 or the kit of claim 2 in the sex identification of the peach fruit borer, characterized in that, The application involves extracting RNA from the peach fruit borer, reverse transcribing it into cDNA, then performing PCR amplification using the primer pair described in claim 1, followed by agarose gel electrophoresis. The presence of a band at the 254 bp position indicates a male peach fruit borer, while the absence of a band indicates a female peach fruit borer.

Citation Information

Patent Citations

  • Primer group, kit and method for detecting tomato leaf miner

    CN118581229A

  • Maize plant DBN9927 and method for use in detecting nucleic acid sequence thereof

    WO2016173360A1