Universal trypanosomes detection primer pair and digital PCR detection method
By designing primer pairs that specifically amplify the 18S rRNA gene of Trypanosoma and optimizing the reaction system, the problems of insufficient sensitivity and false positives in the detection of Trypanosoma in the existing technology have been solved, and a highly sensitive and absolutely quantitative detection of Trypanosoma has been achieved, which is suitable for early diagnosis and epidemiological investigation.
Patent Information
- Application Number
- CN202610328764.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-18
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2046-03-18
AI Technical Summary
Existing molecular diagnostic techniques such as conventional PCR and real-time quantitative PCR are not sensitive enough in trypanosome detection, are easily interfered with by inhibitors in the sample, and lack specially designed primer pairs, leading to false negative or false positive results, which limits the detection limit and reliability of digital PCR.
Two primer pairs were designed to specifically amplify the conserved regions of the Trypanosoma 18S rRNA gene, and the digital PCR reaction system, including annealing temperature and primer concentration, was optimized to establish a highly sensitive and absolutely quantitative detection method.
It achieves highly sensitive detection of trypanosomiasis, can accurately identify it at extremely low copy numbers, is suitable for samples with very early or low parasitemia, reduces the risk of false positives, and is suitable for epidemiological investigations and control of trypanosomiasis transmission.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology and medical detection technology, specifically, it relates to a universal primer pair for detecting trypanosomes and a digital PCR detection method. Background Technology
[0002] Trypanosoma ( Trypanosoma Trypanosoma bryosumi is an important zoonotic parasitic protozoan, among which Trypanosoma bryosumi (… T. brucei rhodesiense ) and Trypanosoma brevicornum ( T. b. gambiense Trypanosomiasis brucei is the main pathogen causing African trypanosomiasis (also known as sleeping sickness) in humans, with an extremely high mortality rate. T. brucei ) and Trypanosoma eeris ( T. evansi Some species, such as [specific species name], primarily cause trypanosomiasis in animals (e.g., nogana disease), resulting in severe economic losses to the livestock industry. Currently, the diagnosis of trypanosomiasis remains challenging; microscopic examination has low sensitivity, and serological methods have a window period and cannot determine current infection. Rapid, sensitive, and specific detection methods are of great importance for the diagnosis, epidemiological investigation, and control of trypanosomiasis.
[0003] Molecular diagnostic techniques, such as conventional PCR and real-time quantitative PCR (qPCR), have been applied to trypanosome detection, but their sensitivity is typically only in the nanogram (ng) to picogram (pg) range, making them prone to missed detection in samples with very early or low parasitemia. Furthermore, these methods are susceptible to interference from inhibitors in the sample, and the quantitative results of qPCR depend on a standard curve, requiring improvements in accuracy and repeatability.
[0004] Digital PCR (dPCR), as a third-generation PCR technology, amplifies "single-molecule templates" by dividing the reaction system into tens of thousands of droplets, offering significant advantages such as absolute quantification, ultra-high sensitivity (down to single copy), and high tolerance. However, the full potential of dPCR performance heavily relies on specific and efficient primer-probe systems and optimized reaction conditions. Currently, there is a lack of primer pairs and reaction systems specifically designed and systematically optimized for trypanosome dPCR detection. This leads to potential false negative or false positive results when existing methods are applied to dPCR due to issues such as mismatched annealing temperatures, low amplification efficiency, or non-specific amplification, thus limiting their detection limits and reliability. Summary of the Invention
[0005] The purpose of this invention is to provide universal primer pairs for detecting Trypanosoma and a digital PCR detection method, specifically involving two pairs for detecting Trypanosoma genus (…). Trypanosoma Specific primer pairs for pathogens (spp.), and highly sensitive, absolute quantitative detection methods based on digital PCR (dPCR) technology.
[0006] To achieve the objectives of this invention, in a first aspect, this invention provides a universal detection primer pair for Trypanosoma, which consists of two pairs of specific primers capable of specifically amplifying conserved regions of the Trypanosoma 18S rRNA gene. The primer pair comprises a forward primer as shown in SEQ ID NO:1 and a reverse primer as shown in SEQ ID NO:2; or... The primer pairs comprise forward primers as shown in SEQ ID NO:1 and SEQ ID NO:12 and reverse primers as shown in SEQ ID NO:2 and SEQ ID NO:13.
[0007] Forward primer 18S rRNA-1F: 5'-CAGAGGTGAAATTCTTAGAC-3' (SEQ ID NO:1); Reverse primer 18S rRNA-1R: 5'-GGTTCTTGATTGAGGAAG-3' (SEQ ID NO:2).
[0008] Forward primer 18S rRNA-6F: 5'-CAGCACGTTTCTTACTTCTTC-3' (SEQ ID NO:12); Reverse primer 18S rRNA-6R: 5'-AGTTCCCCGTGTTGAGTC-3' (SEQ ID NO:13).
[0009] Secondly, the present invention provides the application of the primer pair in the preparation of trypanosome detection reagents or kits.
[0010] Thirdly, the present invention provides detection reagents or kits containing the primer pairs.
[0011] Preferably, the kit further comprises DNA polymerase, deoxyribonucleoside triphosphates (dNTPs), and / or fluorescent dyes for digital PCR.
[0012] Fourthly, the present invention provides the primer pair or the detection reagent or kit for use in trypanosomes (including Trypanosoma brucei). T. b. brucei and Trypanosoma eeris T. evansi Applications in testing (including non-disease diagnostic purposes).
[0013] Fifthly, the present invention provides trypanosomes (including Trypanosoma brevicornu). T. b. brucei and Trypanosoma eeris T. evansi Digital PCR detection method is a highly sensitive, absolutely quantitative method for detecting trypanosomes based on dPCR technology (including non-disease diagnostic purposes).
[0014] The method includes: performing PCR amplification of nucleic acids in the sample to be tested in a reaction system containing the primer pair (SEQ ID NO:1-2 or SEQ ID NO:12-13); The amplification reaction is carried out in one or more thermal cycles, each thermal cycle including: a) Transformation steps; b) An annealing step performed at 58°C; and, c) Extended steps.
[0015] Preferably, the reaction conditions for each thermal cycle are: denaturation at 95°C for 30 seconds, denaturation at 58°C for 30 seconds, and extension at 72°C for 30 seconds; a total of 45 thermal cycles are performed.
[0016] Preferably, the final concentrations of both the forward and reverse primers in the reaction system are 0.4 μM.
[0017] Furthermore, the sample to be tested is a whole blood sample, plasma sample, serum sample, or purified DNA sample.
[0018] When the sample to be tested is a whole blood sample, the detection limit of the method is ≤5 trypanosomes / mL.
[0019] When the sample to be tested is a purified DNA sample, the detection limit of the method is ≤0.01 pg / reaction system.
[0020] This invention designs two pairs of highly specific universal primers based on the highly conserved 18S rRNA sequence of Trypanosoma species, and significantly improves the detection sensitivity by optimizing the dPCR reaction system (annealing temperature, cycling steps). It can detect simulated infected blood samples with a Trypanosoma content of ≤5 cells / mL, or purified Trypanosoma DNA samples with a DNA content of ≤0.01 pg in a single reaction system. This is 100 times higher than qPCR (0.01 pg vs 1 pg). The detection method is simple and convenient, which is beneficial for conducting epidemiological surveys and preventing and controlling the spread of Trypanosoma.
[0021] Specifically, the objective of this invention is achieved through the following technical solutions: 1. Primer pair design and screening 1.1 Through the analysis of various trypanosomiasis species (especially those genera and species that can cause trypanosomiasis in humans and animals, including...) T. b. gambiense , T. b. rhodesiense , T. b.brucei and T.evansi The 18S rRNA gene sequence was compared, and highly conserved regions were selected as targets to design specific primers. In vitro experiments verified that the primer pair could effectively amplify Trypanosoma brevicornu (…). T. b. brucei, such as strain T.b427) and Trypanosoma eiri ( T. evansi The target sequence, such as that of strain T.e805, is shown. This target region is 100% conserved within the Trypanosoma genus (see...). Figure 11 Therefore, this primer pair is capable of detecting other important trypanosomes (including but not limited to Trypanosoma bryophyllum, which can infect humans). T. b. rhodesiense and trypanosoma gambiae T. b. gambiense The potential of ).
[0022] 1.2 Primer pairs 18S rRNA-1F and 18S rRNA-1R (primer pair 1, sequences shown in SEQ ID NO:1-2) were used to detect Trypanosoma brucellae and Trypanosoma eiri. The primer Tm difference was ≤1℃, the product length was 80bp, and it was adapted for digital PCR droplet segmentation. The amplified fragment is shown in SEQ ID NO:3. Amplified fragment (SEQ ID NO:3): 5'-CAGAGGTGAAATTCTTAGACCGCACCAAGACGAACTACAGCGAAGGCATTCTTCAAGGATAACCTTTCCTCAATCAAGAACC-3' 1.3 Primer pairs 18S rRNA-6F and 18S rRNA-6R (primer pair 6, sequences shown in SEQ ID NO:12-13) were used to detect Trypanosoma brucellae and Trypanosoma eiri. The primer Tm difference was ≤1℃, the product length was 148bp, and it was adapted for digital PCR droplet segmentation. The amplified fragment is shown in SEQ ID NO:14. Amplified fragment (SEQ ID NO:14): 5'-CAGCACGTTTCTTACTTCTTCACGCGAAAGCTTGGAGGTTACAGTCTCAGGGGGGAGTACGTTCGCAAGAGTGAAACTTAAAGAAATTGACGGAATGGCACCACAAGACGTGGAGCGTGCGGTTTAATTTGACTCAACACGGGGAACT-3' 2. Optimization of the dPCR reaction system: Key parameters such as annealing temperature, primer concentration, and droplet generation conditions of the primer pairs were systematically optimized, establishing a stable and efficient dPCR reaction system. The optimized annealing temperature was 58℃, and the optimized primer concentration was 0.4μM.
[0023] 3. Sensitivity and Specificity Validation: Using the optimized system, the detection was performed on simulated clinical samples (prepared by incorporating Trypanosoma brevicornuate T.b427 and Trypanosoma eerilysate T.e805 into whole blood from healthy individuals) and serially diluted Trypanosoma genomic DNA. The results showed that the detection limit (LoD) of this invention is as follows: For simulated whole blood samples: ≤ 5 Trypanosoma cells / mL. For purified DNA samples: DNA content in a single reaction system ≤ 0.01 pg (equivalent to approximately 1 copy / μL).
[0024] The primer pairs and optimized dPCR conditions provided by this invention were used for detection. Each concentration level was tested at least three times. Results showed a 100% (3 / 3) detection rate at a level of 5 trypanosomiasis / mL, and intermittent detection was still possible at a level of 1 trypanosomiasis / mL, demonstrating that this invention has extremely high sensitivity and fully meets the needs of early diagnosis.
[0025] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention utilizes the conserved 18S rRNA gene of Trypanosoma to screen two primer pairs that can specifically detect various Trypanosoma species. These primer pairs are highly specific, do not easily form primer dimers, and show no false-positive amplification in the optimized blank control dPCR reaction, resulting in a low risk of false positives, making them particularly suitable for samples with low template amounts. They are also highly sensitive, capable of detecting DNA samples as small as 0.01 pg or blood DNA samples containing 5 Trypanosomas per milliliter. The detection is rapid and convenient, and can be used to conduct epidemiological surveys of Trypanosoma infection and to prevent and control the spread of Trypanosomiasis.
[0026] This invention enables the detection of Trypanosoma nucleic acid at extremely low copy numbers (<2 copies / μL), making it particularly suitable for the diagnosis of very low Trypanosoma infection or early Trypanosoma infection. This invention provides a powerful technical tool for the early diagnosis, precise medication guidance, and epidemiological surveillance of Trypanosomiasis. Attached Figure Description
[0027] Figure 1 The following is a preferred embodiment of the present invention showing the results of conventional PCR detection of two Trypanosoma nucleic acids using five pairs of primers; in the figure: lane M: DL2000 marker, lane 1 is primer 18S rRNA-1, lane 2 is primer 18S rRNA-2, lane 3 is primer 18S rRNA-3, lane 4 is primer 18S rRNA-4, and lane 5 is primer 18S rRNA-5.
[0028] Figure 2 In a preferred embodiment of the present invention, the digital PCR detection of FAM fluorescence signal and quantitative value of primer pair 1 and primer pair 5 before and after optimization of the detection method are shown.
[0029] Figure 3The primer pair specificity detection results are shown in the preferred embodiment of the present invention. The template DNA used is 100 pg. In the figure, lane M: DL2000 marker, lane 1 is T.b427, lane 2 is T.e805, lane 3 is Plasmodium falciparum PF3D7, lane 4 is Plasmodium berghei ANKA, lane 5 is Plasmodium berghei NK65, lane 6 is Plasmodium johnsonii Ym, lane 7 is Babesia, and lane 8 is the negative control.
[0030] Figure 4 The sensitivity results of primer pair 1 in digital PCR detection of T.b427 and T.e805 DNA in a preferred embodiment of the present invention are shown below. From left to right, the DNA values are 1000 pg, 100 pg, 10 pg, 1 pg, 0.1 pg, 0.01 pg, 0.001 pg, and 0 pg (NC).
[0031] Figure 5 The results of primer pair 5 in the preferred embodiment of the present invention for detecting pure insect samples by digital PCR of T.b427 and T.e805 DNA are as follows: DNA from left to right: 1000 pg, 100 pg, 10 pg, 1 pg, 0.1 pg, 0.01 pg, 0.001 pg, 0 pg (NC).
[0032] Figure 6 The results of primer pair 6 in the preferred embodiment of the present invention for detecting pure insect samples by digital PCR of T.b427 and T.e805 DNA are as follows: DNA from left to right: 1000 pg, 100 pg, 10 pg, 1 pg, 0.1 pg, 0.01 pg, 0.001 pg, 0 pg (NC).
[0033] Figure 7 The standard curves for detecting pure T.b427 and T.e805 samples using the digital PCR detection method with primer pair 1 and primer pair 6 provided in the preferred embodiment of the present invention are shown.
[0034] Figure 8 The following are the sensitivity results of primer pair 1 in detecting blood samples using digital PCR for T.b427 and T.e805 DNA in a preferred embodiment of the present invention. The trypanosome concentrations from left to right are 1000 / mL, 500 / mL, 100 / mL, 20 / mL, 10 / mL, 5 / mL, 2 / mL, 1 / mL, 0 / mL, and no DNA (NC).
[0035] Figure 9The results of primer pair 6 in the preferred embodiment of the present invention for detecting blood samples by digital PCR of T.b427 and T.e805 DNA are as follows: from left to right, the concentrations of trypanosomes are 1000 / mL, 500 / mL, 100 / mL, 20 / mL, 10 / mL, 5 / mL, 2 / mL, 1 / mL, 0 / mL, and no DNA (NC).
[0036] Figure 10 The standard curves for detecting T.b427 and T.e805 blood samples using the digital PCR detection method with primer pair 1 and primer pair 6 provided in the preferred embodiment of the present invention are shown.
[0037] Figure 11The figures show the alignment results of the 18S rRNA sequences of Trypanosoma evansi and Trypanosoma evansi with other Trypanosoma species, as well as the positions of primer pair 1 and primer pair 6, in a preferred embodiment of the present invention. In the figures: Te: Trypanosoma evansi 18S ribosomal RNA gene, complete sequence, GenBank ID: AY904050.1; Tbb 427: Trypanosoma brucei Lister strain 427 18S ribosomal RNA gene, Gene ID: Tb427.02.1931; Tbb1125: Trypanosoma brucei EATRO1125 18S ribosomal RNA gene, Gene ID: Tb1125.2.1452; Tbb 927: Trypanosoma brucei brucei TREU927 rRNA small subunit, rRNA, GenBank ID: XR_002989946.1; Tbg Tsuaa: Trypanosoma brucei gambiense 18SrRNA gene, isolate Tsuaa (clone G), GenBank ID: AJ009141.1, Tbg Tgb1: Trypanosoma brucei gambiense isolate Tgb1 18S ribosomal RNA gene, partialsequence, GenBank ID: KX007996.1, Tbr UTRO: Trypanosoma brucei rhodesiense 18SrRNA gene, isolate UTRO 2509, GenBank ID: AJ009142.1, Tbr Tbr: Trypanosomabrucei rhodesiense isolate Tbr 18S ribosomal RNA gene, partial sequence, GenBank ID: KX007997.1. Detailed Implementation
[0038] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0039] The Trypanosoma Brückie T.b427 (Reference 1) and Trypanosoma eerilys T.e805 (Reference 2) used in the following examples were obtained from Professor Lun Zhaorong of Sun Yat-sen University; Plasmodium falciparum (PF3D7) was preserved and cultured by the Parasitology Research Group of the Institute of Pathogenic Biology, Chinese Academy of Medical Sciences (Reference 3); Plasmodium berghei (ANKA, NK65) and Plasmodium johnsonii (Ym) were obtained from Professor Cao Yaming of China Medical University (Reference 4); and Babesia was purchased from ATCC. ® (ATCC) ® Number: PRA-99™.
[0040] Example 1: Preparation of corresponding DNA from simulated clinical infection samples and purified trypanosome samples 1.1 Routine culture of Trypanosoma brevicornu T.b427 and Trypanosoma eerilys T.e805 Preparation of complete trypanosome culture medium: Weigh 17.66g of Gibco Iscove's Modified Dulbecco's Meduim powder (catalog number 12200-036), 3.024g of sodium bicarbonate, 0.136g of hypoxanthine, 0.11g of sodium pyruvate, 0.039g of thymidine, 0.028g of copper sulfate, and 0.182g of L-cysteine. Dissolve in 800mL of ultrapure water. Add 14μL of β-mercaptoethanol solution and stir thoroughly for 1 hour. Then add 10mL of penicillin-streptomycin solution to adjust the pH to 7.3-7.4. Make up to 900mL with ultrapure water. Filter through a 0.22μm filter membrane, aliquot, and store at -20℃. Add 100mL of inactivated fetal bovine serum immediately before use.
[0041] Resuscitation and culture of Trypanosoma: Remove *T. b427* and *T. e805* worms from liquid nitrogen cryopreservation and immediately place them in a 37 ℃ water bath until completely thawed. Transfer the cryopreservation solution to 25 mL culture flasks and add 4 mL of trypanosoma culture medium. Incubate at 37 ℃ in a 5% CO2 incubator. Observe the worm condition and density daily. When the worm density reaches 3-4 × 10⁻⁴ mcg / m², continue incubation. 6 When the concentration is 4-5 mL, subculture the trypanosome mixture with the new culture medium at a ratio of 1:4 and transfer it to a new culture bottle. Continue culturing at 4-5 mL per bottle.
[0042] 1.2 Preparation of purified trypanosome samples: corresponding to subsequent specificity and sensitivity analysis of purified DNA samples. Trypanosoma density reached 3~4×10 6 When the concentration reaches 1 / mL, collect the trypanosome culture medium, centrifuge at 1500 rpm and 4℃ for 5 min, discard the supernatant, wash twice with PBS, and use the worm body precipitate for DNA extraction.
[0043] 1.3 Preparation of simulated clinical infection samples To simulate the hypoparasitemia state of human trypanosomiasis infection, a serial dilution method was used to separately incorporate cultured and counted Trypanosoma brunelli (T.b427) and Trypanosoma eeris (T.e805) into whole blood from healthy individuals to prepare simulated positive samples covering different parasite loads. The entire process was based on cell counting and precise serial dilution techniques to ensure the accuracy and traceability of trypanosomiasis content in the samples. Whole blood was collected from three healthy volunteers, and three sets of clinical infection samples were prepared. The specific preparation procedure is as follows: 1.3.1 Preparation and Standardization of Trypanosoma Suspension: Trypanosoma cultures in the logarithmic growth phase were collected and accurately counted using a hemocytometer. Subsequently, the standard concentration of the trypanosoma suspension was adjusted to 1000 cells / mL using complete culture medium.
[0044] 1.3.2 Establishment of a serial dilution series: Using the suspension standardized in step 1.3.1 as the starting material, a series of trypanosome suspensions with concentration gradients of 1000, 500, 100, 20, 10, 5, 2, and 1 trypanosomes / mL were prepared using the serial dilution method. Meanwhile, complete culture medium without trypanosomes served as a negative control (0 trypanosomes / mL).
[0045] 1.3.3 Construction of Simulated Clinical Infection Samples: The trypanosome suspensions of various concentration gradients obtained in step 1.3.2 were centrifuged at 1500 rpm and 4℃ for 5 min, and the supernatant was discarded. The precipitates were thoroughly mixed with 1 mL of heparin-anticoagulated whole blood from healthy volunteers to obtain simulated clinical samples with final target concentrations of 1000, 500, 100, 20, 10, 5, 2, and 1 trypanosome / mL, respectively, to cover various scenarios from severe infection to very low-level infection.
[0046] 1.4 Extraction of total DNA from Trypanosoma japonicum: Total DNA was extracted from the purified trypanosome samples using the QIAamp DNA Bloodmini Kits (catalog number: 51104) from QIAGEN, strictly following the manufacturer's operating procedures. A brief summary of the steps is as follows: 1.4.1 Cell lysis and digestion: Collect trypanosomes by centrifuging 1 mL of trypanosome culture at 1500 rpm (4℃) for 5 minutes. Discard the supernatant, wash with PBS, resuspend the pellet in 200 μL PBS, add 20 μL proteinase K and 200 μL buffer AL, vortex to mix, and incubate in a 56℃ metal bath for 10 minutes to fully lyse the cells and digest proteins.
[0047] 1.4.2 DNA binding: Add 200 μL of anhydrous ethanol to the lysis buffer from step 1.4.1, mix well, and transfer the entire mixture to a QIAampmini centrifuge column. Centrifuge at 6000g (approximately 8000 rpm) for 1 minute to allow the DNA to specifically bind to the silica membrane.
[0048] 1.4.3 Rinsing: Transfer the centrifuge column to a new 2mL collection tube and rinse twice: First, add 500μL of buffer AW1 and centrifuge at 6000g for 1 minute; then add 500μL of buffer AW2 and centrifuge at full speed (20000g) for 3 minutes to completely remove impurities.
[0049] 1.4.4 DNA Elution: Place the centrifuge column into a new 1.5 mL centrifuge tube, add 150 μL of buffer AE or sterile distilled water to the center of the silica gel membrane, and incubate at room temperature for 5 minutes to allow the DNA to fully hydrate. Finally, centrifuge at 6000g for 1 minute, and collect the liquid in the tube; this is the purified total DNA.
[0050] 1.4.5 Quality control: The concentration and purity of the obtained DNA solution were determined using a micro spectrophotometer and stored at -20℃ for later use.
[0051] 1.5 Extraction of total DNA from simulated clinical infection samples: Total DNA was extracted from the simulated clinical infection samples using the QIAamp DNA Blood Midi Kits (catalog number: 51183) from QIAGEN, strictly following the manufacturer's operating procedures. A brief summary of the steps is as follows: 1.5.1 Cell lysis and digestion: Take 1 mL of simulated blood sample, add 100 μL of proteinase K and 1.2 mL of buffer AL, vortex to mix, and incubate in a 70℃ metal bath for 10 minutes to fully lyse the cells and digest the proteins.
[0052] 1.5.2 DNA binding: Add 1 mL of anhydrous ethanol to the lysis buffer from step 1.5.1, mix well, and transfer the entire mixture to a QIAamp Midi centrifuge column. Centrifuge at 1850 g (approximately 3000 rpm) for 3 minutes to allow the DNA to specifically bind to the silica membrane.
[0053] 1.5.3 Rinsing: Transfer the centrifuge column to a new 15 mL collection tube and rinse twice: First, add 2 mL of buffer AW1 and centrifuge at 4500 g for 1 minute; then add 2 mL of buffer AW2 and centrifuge at 4500 g for 15 minutes to thoroughly remove impurities.
[0054] 1.5.4 DNA Elution: Place the centrifuge column into a new 15mL centrifuge tube, add 300μL of buffer AE or sterile distilled water to the center of the silica gel membrane, and incubate at room temperature for 5 minutes to allow the DNA to fully hydrate. Finally, centrifuge at 4500g for 2 minutes, and collect the liquid in the tube; this is the total DNA from the blood sample.
[0055] 1.5.5 Quality control: The concentration and purity of the obtained DNA solution were determined using a micro spectrophotometer and stored at -20℃ for later use.
[0056] Example 2: Design and Screening of Specific Primer Pairs To obtain highly specific primers for tryingpanosome detection, the present invention conducted the following design and screening work: 2.1 Identification of target genes and conserved regions: 18S rRNA gene sequences of various trypanosomes were retrieved from the NCBI (https: / / www.ncbi.nlm.nih.gov / ) and TriTrypDB (https: / / tritrypdb.org / ) databases. NCBI-sourced sequences included Tb gambiense, isolate Tsuaa (GenBank ID: AJ009141.1), T. b. gambiense, isolate Tgb1 (GenBank ID: KX007996.1), T. b. rhodesiense, isolate UTRO 2509 (GenBank ID: AJ009142.1), T. b. rhodesiense, isolate Tbr (GenBank ID: KX007997.1), T. b. brucei (Tb927.2.1452, GenBank ID: XR_002989946.1), and T. evansi (GenBank ID: AY904050.1). The TriTrypDB source sequences include *T. b. brucei* (Gene ID: Tb1125.2.1452 and Tb427.02.1931). These sequences were aligned, and highly conserved regions were selected as targets. Primers were designed using the reference gene sequence of *Treatisea rhodesianis* (GenBank ID: AJ009142.1) as a template. The sequence alignment results and the positions of primer pair 1 (18S-1) and primer pair 6 (18S-6) are shown below. Figure 11 .
[0057] 2.2 Primer design and preliminary screening: Five candidate primer pairs were designed within the conserved regions mentioned above using Beacon Designer 8 software (Table 1). Genomic DNA from these two Trypanosoma strains was initially amplified using conventional PCR. The PCR reaction mixture (25 μL) consisted of: 12.5 μL TTB Green® Premix Ex Taq™ II (2×), forward and reverse primers (both at a final concentration of 0.4 μM), 2 μL DNA template (50 ng / μL), and sterile double-distilled water to the final volume. The reaction program was: 95°C pre-denaturation for 30 seconds; followed by 40 cycles of amplification (95°C for 5 seconds, 60°C for 30 seconds).
[0058] Table 1
[0059] 2.3 Results and Determination: Agarose gel electrophoresis results ( Figure 1 The results showed that, among the five candidate primer pairs, primer pairs 1 and 5 could effectively amplify the target sequences of *Trypanosoma brevicornu* and *Trypanosoma eerilys*, while the other primer pairs showed positive results for a single species or no amplification product. Given their superior broad-spectrum detection capability, primer pairs 1 and 5 were ultimately selected for the establishment and optimization of the subsequent dPCR method.
[0060] Example 3: Establishment and optimization of dPCR detection method 3.1 Preliminary Method Establishment Based on qPCR To establish the basis for detection, a qPCR-based detection method was first developed. The reaction was performed using a Bio-Rad CFX96 real-time fluorescence PCR system, and the main reagents were purchased from TaKaRa. Specific reaction systems and procedures are shown in Tables 2 and 3, respectively. This step validated the amplification effectiveness of the selected primer pairs, providing fundamental parameters for the subsequent development of dPCR methods.
[0061] Table 2 qPCR reaction system
[0062] Note: Mix (2×) is equivalent to TB Green® Premix Ex Taq™ II (2×). The same applies below.
[0063] Table 3 qPCR reaction conditions
[0064] 3.2 Preliminary Attempts and Problem Identification of the dPCR Method The above qPCR system and procedure were directly transferred to the Mike D600 digital PCR instrument for testing. The preliminary reaction system is shown in Table 4. The results are as follows: Figure 2As shown, the FAM fluorescence signal could not be detected before optimization, and neither the positive control (PC: trypanosome DNA sample) nor the negative control (NC: trypanosome-free DNA sample) generated valid copy number data, indicating that the reaction conditions were not suitable for the dPCR platform and could not achieve effective detection.
[0065] Table 4 dPCR reaction system
[0066] Note: The gDNA loading volume for purified trypanosome DNA was 2 μL, and the DNA volume for simulated clinical infection samples was 5 μL. The corresponding ddH2O loading volumes were 7.5 μL and 4.5 μL, respectively. Eva Green: digital PCR fluorescent dye.
[0067] 3.3 Optimization of digital PCR reaction system To address the aforementioned issues, key optimizations were made to the reaction system and procedure. The optimized dPCR reaction system, based on Table 2, was fine-tuned by adjusting the template and water amounts. The core improvement lies in the reaction procedure (Table 5), particularly the optimization of the annealing temperature from 60℃ to 58℃ and the addition of an extension step to ensure specificity and efficiency of amplification under digital PCR partitioning conditions.
[0068] Table 5 Digital PCR Reaction Conditions
[0069] 3.4 Optimization Effect Verification The optimized system was used for testing, and the results are as follows: Figure 2 As shown, the positive control group successfully detected significant FAM fluorescence signals and obtained accurate copy number data, while the negative control group showed no fluorescence signal. This indicates that the optimized method effectively eliminated non-specific amplification and achieved high-sensitivity, high-specificity absolute quantification of target DNA.
[0070] Example 4: Specificity and sensitivity analysis of purified DNA samples This embodiment uses both qPCR and digital PCR (dPCR) techniques to detect serially diluted purified trypanosome DNA samples in order to systematically evaluate the specificity, sensitivity, and reproducibility of the selected primer pairs.
[0071] 4.1 qPCR sensitivity detection Following the qPCR system and procedure established in Example 3, serially diluted genomic DNA from Trypanosoma brevicornu (T.b427) and Trypanosoma eerilys (T.e805) was amplified. The DNA concentration gradients were set as follows: 0.5 ng / μL, 0.05 ng / μL, 0.005 ng / μL, 0.5 pg / μL, 0.05 pg / μL, 0.005 pg / μL, and 0.5 fg / μL, with template-free water (0 fg / μL) used as a negative control. The criteria for determination were: a Ct value ≤ 35 accompanied by a typical S-shaped amplification curve, indicating a positive result; otherwise, a negative result was determined. Representative results are shown in Table 6: Primer pair 1 could stably detect DNA from both Trypanosoma species down to 1 pg in a single reaction system, and no amplification was observed in any negative controls, demonstrating good sensitivity and specificity. The coefficient of variation (CV) for three replicates ranged from 0.34% to 3.85%. Primer pair 5 showed nonspecific amplification in the negative controls, so it was optimized to obtain primer pair 6 (SEQ ID NO: 12-13). The optimized primer pair 6 showed good sensitivity and specificity, with no nonspecific amplification in the negative controls and a CV for three replicates ranging from 0.72% to 4.44%, demonstrating that the method has excellent intraplate repeatability and precision.
[0072] Table 6. Experimental results of sensitivity and specificity of qPCR detection method
[0073] 4.2 Specificity assessment Following the qPCR system and procedure established in Example 3, primer pairs 1 and 6 were used to amplify genomic DNA from Trypanosoma brucellae (T.b427), Trypanosoma eerilys (T.e805), Plasmodium falciparum (PF3D7), Plasmodium berghei (ANKA, NK65), Plasmodium yoelii (Ym), and Babesia. The DNA concentration was 0.05 ng / μL, with template-free water (0 fg / μL) used as a negative control. Agarose gel electrophoresis was performed on the PCR products to observe the presence of nonspecific bands. The results are shown below. Figure 3 As shown, in the amplification products of primer pair 1 and primer pair 6, both Trypanosoma brygii (T.b427) and Trypanosoma eeris (T.e805) samples showed very obvious specific bands at the expected target of 148bp, with no non-specific bands.
[0074] 4.3 Sensitivity and Repeatability Detection of dPCR An optimized dPCR system and procedure were used to perform absolute quantification of the same DNA concentration gradient described above. The judgment criteria were: a sample was considered positive when positive droplets were detected and the quantification result was >0 copies / μL; otherwise, it was considered negative.
[0075] Three independent replicates were performed on T. b427 and T. e805 DNA samples. Representative results are shown in Table 7: the detection sensitivity of primer pairs 1 and 6 for both trypanosome DNA samples reached 0.01 pg, which is 100-fold higher than that of qPCR. Furthermore, the coefficients of variation (CV) for the three replicates ranged from 0.98% to 4.3% and from 0.68% to 4.8%, demonstrating excellent intraplate repeatability and precision. Representative FAM fluorescence signals and droplet scatter plots are shown in Table 7. Figure 4 to Figure 6 .
[0076] 4.4 Standard Curve and Linear Range Based on the dPCR quantitative data of primer pair 1 and primer pair 6, standard curves for template amount and quantitative value of T.b427 and T.e805 were plotted. Figure 7 The correlation coefficient (R) of the standard curve 2 The values were all close to 1.000, indicating that there was an excellent linear relationship between the template input amount and the dPCR quantification results over a wide range of concentration dilutions, meeting the requirements for accurate quantification analysis (Table 7).
[0077] Table 7. Quantitative values (copy / μL) of Trypanosoma DNA samples detected by digital PCR using primer pairs 1, 5, and 6 designed based on the 18S rRNA gene.
[0078] Example 5: Validation of detection capabilities for simulated infected blood samples This embodiment aims to verify the actual detection performance of the established dPCR method in simulated clinical blood samples.
[0079] 5.1 Sample Detection and Judgment Total DNA was extracted from simulated infected blood samples prepared in Example 1, containing different numbers of trypanosomes (1000, 500, 100, 20, 10, 5, 2, 1 / mL). Subsequently, detection was performed using an optimized digital PCR system (reaction system same as in Example 3, template addition adjusted to 5 μL). The positive criterion was the same as in Example 4.
[0080] 5.2 Detection Limit and Repeatability Three sets of simulated blood samples of T. b427 and T. e805 were tested, with three technical replicates for each sample. The results are shown in Tables 8 and 9: the dPCR method based on primer pair 1 and primer pair 6 can reliably detect blood samples with trypanosome content as low as 5 cells / mL with 100% detection rate. Representative FAM fluorescence signals are shown below. Figure 8 and Figure 9 .
[0081] 5.3 Standard Curve and Linearity A standard curve was plotted based on the quantitative results of the simulated blood samples. Figure 10 The curve correlation coefficient R between primer pair 1's T.b427 and T.e805 is shown. 2 The correlation coefficients Ri for primer pair 6, specifically for T.b427 and T.e805, were as high as 0.9978 and 0.9964, respectively. 2 The results, which are as high as 0.9988 and 0.9858 respectively, indicate that even in complex blood matrix backgrounds, this method maintains excellent quantitative linearity and reliability, making it fully suitable for the accurate detection of low-level clinical infections.
[0082] Table 8. Quantitative values (copy / μL) of blood samples detected by digital PCR using primer pairs designed based on the 18S rRNA gene.
[0083] Table 9. Quantitative values (copy / μL) of blood samples detected by digital PCR using primer pairs designed based on the 18S rRNA gene.
[0084] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
[0085] References: [1] Yize Liu, Ning Jiang, Si Zuo, Ying Feng, Ran Chen, Yiwei Zhang, Naiwen Zhang, Xiaoyu Sang, Qijun Chen. Graphene quantum dots disrupt themitochondrial potential of Trypanosoma brucei by interacting with the p18subunit of ATP synthase F1 after endocytosis via the VSG recycling pathway. JColloid Interface Sci. 2025 Feb;679(Pt A):975-986. doi: 10.1016 / j.jcis.2024.10.054. [2] De-Hua Lai, Qiao-Ping Wang, Zhi Li, Antony G Luckins, Simon AReid, Zhao-Rong Lun. Investigations into human serum sensitivity expressed bystocks of Trypanosoma brucei evansi. Int J Parasitol. 2010 May;40(6):705-10.doi: 10.1016 / j.ijpara.2009.11.009. [3] Nan Hou, Shanshan Li, Ning Jiang, Xianyu Piao, Yu Ma, Shuai Liu,Qijun Chen. Merozoite Proteins Discovered by qRT-PCR-Based TranscriptomeScreening of Plasmodium falciparum. Front Cell Infect Microbiol. 2021 Dec 9:11:777955. doi: 10.3389 / fcimb.2021.777955. [4] Qilong Li, Kunying Lv, Ning Jiang, Tong Liu, Nan Hou, Liying Yu, Yixin Yang, Anni Feng, Yiwei Zhang, Ziwei Su, Xiaoyu Sang, Ying Feng, RanChen, Wenyue Xu, Liwang Cui, Yaming Cao, Qijun Chen. SOD3 suppresses early cellular immune responses to parasite infection. Nat Commun. 2024 Jun 8;15(1):4913. doi: 10.1038 / s41467-024-49348-0.
Claims
1. A universal primer pair for detecting trypanosomes, characterized in that, The primer pair comprises a forward primer as shown in SEQ ID NO:1 and a reverse primer as shown in SEQ ID NO:2; or, The primer pair comprises a forward primer as shown in SEQ ID NO:12 and a reverse primer as shown in SEQ ID NO:
13.
2. The use of the primer pair of claim 1 in the preparation of trypanosome detection reagents or kits.
3. A detection reagent or kit containing the primer pair of claim 1.
4. The reagent kit according to claim 3, characterized in that, The kit also contains DNA polymerase, dNTPs, and / or fluorescent dyes for digital PCR.
5. The application of the primer pair of claim 1 or the detection reagent or kit of claim 3 or 4 in the detection of trypanosomes; the application is for non-disease diagnostic purposes.
6. A digital PCR detection method for trypanosomes, characterized in that, The method includes: performing a PCR amplification reaction on the nucleic acid in the sample to be tested in a reaction system containing the primer pair of claim 1; The amplification reaction is carried out in one or more thermal cycles, each thermal cycle including: a) Transformation steps; b) An annealing step performed at 58°C; and, c) Extended steps; The method described is not for disease diagnosis purposes.
7. The method according to claim 6, characterized in that, The reaction conditions for each thermal cycle were: denaturation at 95°C for 30 seconds, denaturation at 58°C for 30 seconds, and extension at 72°C for 30 seconds; a total of 45 thermal cycles were performed.
8. The method according to claim 6, characterized in that, The final concentrations of both the forward and reverse primers in the reaction system were 0.4 μM.
9. The method according to any one of claims 6-8, characterized in that, The sample to be tested can be a whole blood sample, plasma sample, serum sample, or purified DNA sample.
10. The method according to claim 9, characterized in that, When the sample to be tested is a whole blood sample, the detection limit of the method is ≤5 trypanosomes / mL; When the sample to be tested is a purified DNA sample, the detection limit of the method is ≤0.01 pg / reaction system.
Citation Information
Patent Citations
Kit for detecting African trypanosoma brucei, and application of kit
CN110541043A
SYBR Green I real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer for trypanosoma and kit of SYBR Green I real-time fluorescent quantitative PCR detection primer
CN119464511A
Removing interfering host nucleic acids for molecular parasite detection
WO2019060840A1