Application of overexpressed NLRC3 in treatment of right ventricular remodeling caused by pulmonary arterial hypertension

By overexpressing NLRC3 in a pulmonary hypertension model and targeting right ventricular tissue with AAV and lentiviral vectors, the unclear early driving mechanism of right ventricular remodeling was resolved, dynamic regulation of Treg cell function was achieved, RV dysfunction and fibrosis were alleviated, and an effective strategy for treating right ventricular remodeling caused by pulmonary hypertension was provided.

CN121891504APending Publication Date: 2026-04-21SHANGHAI TENTH PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511866728.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-11
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

The driving mechanisms of early decompensated transformation of the right ventricle (RV) are not well understood in the current technology. The specific mechanisms by which Treg cells play a pro-fibrotic role in the RV microenvironment are not understood. The spatiotemporal dynamics and network interactions of key signaling pathways that regulate Treg cell function during RV remodeling are poorly known, making it difficult to effectively treat RV remodeling caused by pulmonary hypertension (PH).

Method used

By studying pulmonary artery ligation and aortic transection ligation models, we screened out the key compensatory target protein NLRC3 and its signaling pathway in the NLR family. Using AAV and lentiviral vectors to overexpress NLRC3, we targeted CD4+ T cells in the right heart tissue to prepare Treg cells overexpressing NLRC3. These Treg cells were then applied to treat PR remodeling caused by PH using in situ myocardial injection and tracheal infusion.

Benefits of technology

Dynamically regulating Treg cell function, alleviating RV dysfunction, reducing myocardial hypertrophy and fibrosis, improving RV contractile function, delaying disease progression, and improving the survival rate of patients with right heart failure provides a precise immune regulatory strategy for RV remodeling induced by PH.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121891504A_ABST
    Figure CN121891504A_ABST
Patent Text Reader

Abstract

The invention relates to an application of overexpressed NLRC3 in treating right ventricular (RV) remodeling caused by pulmonary arterial hypertension (PH), in particular to an AAV vector of overexpressed NLRC3 by adopting myocardial in-situ injection and / or tracheal instillation, or Treg cells of in-vitro overexpressed NLRC3 by adopting adoptive transfer. Verification shows that in the RV reconstruction process, the number of Treg cells is rich, and the Treg cells are crucial to reduction of harmful effects of RV reconstruction; the RV Treg cells show remarkable regional heterogeneity and compensatory characteristics, which are related to the NLRC3 level, mainly because the inactivation of the NLRC3-JAK2 / STAT4 pathway promotes the down-regulation of the Th1-Treg cells and weakens the immunosuppression function of the RV Treg cells; the RV remodeling can be aggravated by NLRC3 defects, RV dysfunction and failure are caused, RV remodeling is remarkably inhibited by the NLRC3 overexpressed Treg cells, and a new treatment strategy is provided for precise immunoregulation of RV remodeling caused by PH.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cardiopulmonary vascular disease treatment technology, and in particular to the application of NLRC3 overexpression in the treatment of right ventricular remodeling caused by pulmonary hypertension. Background Technology

[0002] Right ventricular (RV) adaptation to pulmonary hypertension (PH) is a key determinant of disease progression and patient survival in cardiovascular diseases. Particularly in pulmonary hypertension associated with left ventricular disease (PH-LHD), prolonged pressure load initially triggers compensatory RV hypertrophy to maintain output. However, this adaptation is often transient, eventually leading to RV dilation, systolic dysfunction, and maladaptive hypertrophy and fibrosis as pulmonary vascular remodeling and resistance continue—changes closely associated with poor patient prognosis. Therefore, this remodeling process involves a delicate balance between adaptive compensation and maladaptive decompensation. While clinical attention often focuses on apparent RV failure, the early critical phase of maladaptation remains poorly understood, presenting a potential therapeutic window. Despite significant advances in understanding pulmonary vascular pathology, the molecular and immunological mechanisms controlling the transition from adaptive to maladaptive RV remodeling remain unclear. Importantly, although immune dysregulation is increasingly recognized in the pathogenesis of PH and cardiomyopathy, its specific role and the role of regulatory immune cells (such as regulatory T cells, T cells, etc.) remain unclear. reg The role of cells in regulating RV dysfunction has not yet been systematically studied.

[0003] T reg Cells can eliminate inflammation and inhibit fibrosis, but exhibit the opposite effect in cardiovascular disease. Although they alleviate adverse post-myocardial infarction remodeling and improve cardiac function by eliminating inflammation and inhibiting fibrosis, previous studies have revealed a significant difference: T cells... reg Cells can trigger pathological remodeling of pulmonary blood vessels, collagen deposition, and RV fibrosis, thereby exacerbating the hemodynamic deterioration caused by pulmonary hypertension and worsening left ventricular diastolic dysfunction. It should be noted that T... reg Little is known about the spatial heterogeneity, functional plasticity, and signaling networks exhibited by cells during PH-related RV adaptation, a fundamental deficiency that hinders their potential application in the treatment of RV-centered PH-related left ventricular diastolic dysfunction.

[0004] Increasing evidence suggests that T reg Cells coordinate tissue repair through nucleoside oligomerization domain-like receptors (NLRs) and the JAK-STAT signaling pathway. Previous studies have shown that NLR family member NLRC3 is related to T cells in PH-LHD. regCell-mediated inhibition of venous remodeling is associated with JAK-STAT activation, a dual pathway that simultaneously promotes immune homeostasis and pathological fibrosis. However, no studies have shown whether NLRC3 is involved in regulating the inflammation-fibrosis interaction in venous remodeling. Furthermore, the role of T... reg Whether cell subsets dynamically utilize the aforementioned pathways during the transition from RV compensation to decompensation, or how signals from the tissue microenvironment determine their functional reprogramming, are crucial questions for understanding the mechanisms underlying T cell reprogramming. reg Cellular therapy is of paramount importance.

[0005] In summary, the following shortcomings exist: a lack of understanding of the driving mechanism of early RV decompensation transition; and a lack of understanding of T... reg The specific mechanisms by which cells exert pro-fibrotic effects in the RV microenvironment are poorly understood; the regulation of T cells is also lacking. reg Little is known about the spatiotemporal dynamics and network interactions of key cellular signaling pathways (such as NLRC3 / JAK-STAT) in RV remodeling. Therefore, elucidating the role of T... reg Understanding the core mechanisms of cellular adaptive regulation of renal remodeling (RV) and developing intervention strategies that can specifically regulate its function to delay or reverse RV remodeling has become an urgent technical challenge. Summary of the Invention

[0006] To overcome at least one deficiency in the existing technology, this invention utilizes pulmonary artery ligation (PAB) models and transverse aortic ligation (TAC) models to study the role of regulatory T cells (T cells) in right ventricular (RV) remodeling induced by pulmonary hypertension (PH). reg The infiltration and function of cells (RVs) were investigated, and T cells in RVs were examined. reg Cellular tissue heterogeneity, thereby screening for NLR family members in T reg The key compensatory target protein NLRC3 in cells and its signaling pathway. This invention identifies T reg The role of cells in RV remodeling induced by PH (especially type 2 PH) was investigated, and it was determined that overexpression of NLRC3 can be used to treat PH-induced RV remodeling.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of the present invention is to provide the use of an agent overexpressing NLRC3 in the preparation of a medicament for treating PH-induced RV remodeling.

[0008] Furthermore, the reagents for overexpressing NLRC3 include AAV vectors overexpressing NLRC3, lentiviral vectors overexpressing NLRC3, and regulatory T cells (T cells) overexpressing NLRC3. reg At least one of the following (cells).

[0009] Furthermore, the AAV vector is AAV Ark313, which targets CD4 in the right ventricular tissue. + T cells.

[0010] Further, the NLRC3 gene includes a murine NLRC3 gene and a human NLRC3 gene; wherein the murine NLRC3 gene has a Gene ID of 268857, and the human NLRC3 gene has a Gene ID of 197358. In some specific embodiments, the murine NLRC3 gene is used in the preparation of AAV viruses overexpressing NLRC3, and the human NLRC3 gene is used in the preparation of lentiviral vectors overexpressing NLRC3.

[0011] Furthermore, the human NLRC3 gene (Gene ID: 197358) was amplified.

[0012] Further, the preparation of the AAV vector overexpressing NLRC3: The AAV viral vector was generated by PackGene Biotech (Guangzhou, China), which cloned the mouse NLRC3 gene (Gene ID: 268857) into AAV Ark313. The steps are briefly described as follows: HEK 293T cells were transiently transfected with GOI plasmid (ssAAV.EF1a.3xFlag-Nlrc3.PA48), adenovirus helper plasmid (pHelper), and AAV RC plasmid (pAAV-RC). 72 hours after transfection, recombinant AAV was collected by lysing cells to release viral particles into the supernatant. Subsequently, the crude viral lysate was purified by gradient centrifugation with iodobutanol. Viral titers (genome copies per milliliter, gc / mL) were measured using real-time PCR with primers designed for the inverted terminal repeat (ITR) sequence of the AAV vector using the universal SYBR Green Mix (BIO-RAD, USA). Vectors meeting quality control standards (in the form of AAV vector suspensions overexpressing NLRC3) were aliquoted and stored at -80°C for later use.

[0013] Further, the preparation of the lentiviral vector overexpressing NLRC3 includes the following steps: plasmid construction: HumanNLRC3 (Gene ID: 197358) was obtained from a cDNA library of Shanghai Gene Chemical Co., Ltd. Lentiviral vector plasmid GV492 (Ubc-MCS-3FLAG-CBh-gcGFP-IRES-puromycin) (purchased from Shanghai GeneChem Chemical Technology Co., Ltd.) and the GV492 vector and NLRC3 gene sequence were digested with BamHI and AgeI restriction endonucleases and cloned using the in-fusion recombination method. The lentiviral recombinant vector overexpressing NLRC3 was detected by DNA sequencing. Lentiviral production used Lipofectamine 2000 (Ingenieur; Thermo Fisher Scientific) to co-transfect the viral vector with two helper plasmids, GeneChem genes psPAX2 and pMD2.G, into HEK 293T cells. Infectious lentivirus was collected 72 hours after transfection, rapidly centrifuged to remove cell debris, and then filtered through a 0.45 μm cellulose acetate membrane. Viral titer was determined by quantitative PCR analysis and was approximately 1 × 10⁻⁶. 9 Transduction units (TU) / mL, and stored at -80°C for later use.

[0014] Furthermore, the T overexpression of NLRC3 reg Cell preparation includes the following steps: primary sorting of mouse T cells. reg Cells (isolated from the right heart of WT mice (C57BL / 6J) T cells) reg Cells (CD4) + CD25 + ), transfected with a lentiviral vector overexpressing NLRC3 (MOI = 20), and cultured at 37°C and 5% CO2 for 72 h.

[0015] Furthermore, primary sorting mice T reg Cell preparation includes the following steps: A right heart tissue sample from a C57BL / 6J mouse is taken and ground into a single-cell suspension; after transferring the single-cell suspension for cell counting, the cells are first negatively selected using magnetic beads (labeling and removing non-CD4+ cells). + Cells collect CD4 + T cells, subsequently from this CD4 + CD25 was positively selected in the T cell population via magnetic beads. + Cells, thereby obtaining CD4 + CD25 + T reg cell.

[0016] Furthermore, the preparation of a lentiviral vector overexpressing NLRC3 includes the following steps: activating CD4+ cells by stimulation with anti-CD3 and anti-CD28 antibodies for 24 hours.+ CD25 + T reg Cells were collected into centrifuge tubes and gently pipetted to disperse cell clumps, avoiding cell damage. Centrifuged at 300 × g for 5 minutes at room temperature, and the supernatant was discarded. Cells were gently resuspended in medium containing fresh IL-2 and the viral infection enhancer HitransGP; an appropriate amount of lentiviral vector overexpressing NLRC3 (MOI = 20) was added and gently mixed. The virus-cell mixture was then added to 6-well plates for culture.

[0017] Understandably, the preparation of AAV vectors overexpressing NLRC3, the preparation of lentiviral vectors overexpressing NLRC3, and the preparation of TAV vectors overexpressing NLRC3 are all related to this process. reg Cells can also be prepared using other methods conventionally used in the field.

[0018] Furthermore, the RV remodeling caused by PH includes at least one of the RV compensation period and the RV decompensation period.

[0019] Furthermore, the RV reconstruction caused by the PH is in the RV compensation period.

[0020] Furthermore, the RV reconstruction is an RV reconstruction induced by TAC and / or PAB.

[0021] Furthermore, the PH is type 2 PH, namely pulmonary hypertension associated with left heart disease (PH-LHD).

[0022] Furthermore, the drug includes drugs that relieve RV dysfunction, reduce myocardial hypertrophy, reduce myocardial fibrosis, and reduce RV capillary density.

[0023] Furthermore, the application involves orthotopic injection of an AAV vector overexpressing NLRC3 into the myocardium and / or intratracheal infusion. Orthotopic injection of an AAV vector overexpressing NLRC3 into the myocardium is preferred.

[0024] Furthermore, the AAV vector overexpressing NLRC3 was injected in situ at two points in the myocardium: 10 μL of AAV virus suspension, with a total viral dose of 1×10¹¹ GC.

[0025] Furthermore, 20 μL of AVV virus suspension overexpressing NLRC3 was administered via endotracheal infusion, with a total viral dose of 1×10¹¹ GC.

[0026] Furthermore, the application involves adoptive transfer of T cells overexpressing NLRC3 in vitro. reg cell.

[0027] Furthermore, the in vitro T cells overexpressing NLRC3 regThe cells were T cells transfected with a lentiviral vector overexpressing NLRC3. reg cell.

[0028] Furthermore, the viral titer of the lentiviral vector overexpressing NLRC3 was approximately 1 × 10⁻⁶. 9 Transduction units (TU) / mL.

[0029] Furthermore, T cells overexpressing NLRC3 reg Cells at 2×10 6 The cells were injected into the mouse via the tail vein.

[0030] Furthermore, NLRC3 overexpression plays a protective role in RV remodeling by reducing myocardial hypertrophy and inhibiting pathological myocardial remodeling, and it can stabilize T... reg Cellular function and delaying decompensation.

[0031] Furthermore, RVT reg Increased cell number was associated with worsening RV remodeling; NLRC3 loss inhibited TAC after TAC. reg Cellular inhibitory effect T (T eff NLRC3 overexpression enhances the ability of T cells to proliferate and exert anti-inflammatory effects. reg Immunosuppressive effects of cells; T cells in RV after NLRC3 deletion reg Reduced cell infiltration, NLRC3-deficient T cells reg Cellular activity accelerated the progression of PH-LHD disease, and the loss of NLRC3 inhibited T cells. reg The ability of cells to prevent RV hypertension and fibrosis, specifically the absence of NLRC3, inhibits RV T. reg The role of cells; T reg Cells exhibit significant regional heterogeneity and compensatory characteristics through NLRC3, which regulates RV remodeling through the NLRC3 / JAK2-STAT4 axis.

[0032] Furthermore, overexpression of NLRC3 can increase the ratio of pulmonary artery acceleration time (PAT) to pulmonary artery ejection time (PET) in vivo; overexpression of NLRC3 can alleviate tricuspid annular systolic displacement (TAPSE) and enhance RV systolic function; overexpression of NLRC3 can increase RVEF% (RV ejection fraction) and LVEF% (left ventricular ejection fraction), which can alleviate disease progression; overexpression of NLRC3 can reduce the cross-sectional area of ​​cardiomyocytes and reduce the degree of myocardial hypertrophy; overexpression of NLRC3 can reduce the mRNA expression levels of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP); overexpression of NLRC3 can reduce collagen deposition and downregulate fibrosis markers. α- Smooth muscle actin ( α-SMA and type III collagen ( Collagen The expression of NLRC3 reduces myocardial fibrosis and decreases RV capillary density; overexpression of NLRC3 improves the survival rate of right heart failure caused by long-term induced RV maladaptation.

[0033] Compared with the prior art, the present invention, by adopting the above technical solution, has the following beneficial effects: This invention verifies that the JAK2-STAT4 axis can be used to control Th1 sample T. reg A molecular switch for cell transdifferentiation, dynamically balancing immune regulation and inflammatory pathogenesis, the interaction between NLR-JAK-STAT plays a spatial and temporal regulatory role in RV adaptation, thereby regulating T... reg The functional state of cells. This invention also identified T... reg Cells regulate RV remodeling in PH-LHD via the NLRC3 / JAK2-STAT4 axis, RV-T reg Cells exhibited significant regional heterogeneity and compensatory features, which were associated with NLRC3 levels. This invention also elucidates the role of T cells in RV adaptation. reg Dynamic functional changes in cells; identifying the regulatory mechanisms of T cells reg The NLRC3 / JAK-STAT4 mechanism of cellular immunosuppression and profibrotic phenotype was investigated; the role of NLRC3 enhancement as a therapeutic strategy to combat adverse remodeling of RV was evaluated. These validation results fill gaps in the understanding of RV-T... reg This fills a key knowledge gap regarding cellular immune interactions and provides new insights into precise immune regulation targeting RV remodeling induced by PH (especially type 2 PH). Attached Figure Description

[0034] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are for illustrative purposes only, and do not constitute an undue limitation of the invention. In the drawings: Figure 1 This is a schematic diagram of the pathological changes in the right ventricle (RV) during the progression of pulmonary hypertension (PH) in one embodiment of the present invention; wherein, A: schematic diagram of different PH models; B: representative wheat germ lectin (WGA) stained sections of RV myocardium in different PH models (n=10), scale bar: 50 micrometers; C: Sirius red staining and quantitative analysis of RV myocardium in different PH models (n=10), scale bar: 100 micrometers; D: cardiac CTA images and quantitative parameters of healthy controls and PH-LHD patients (n=6); E: Foxp3 + T reg Correlation analysis between cell count and peak gradient of tricuspid regurgitation (TRPG) (n=24); F: T in RV of healthy controls and PH-LHD patientsreg Representative images and quantitative statistics of cell immunofluorescence staining, Foxp3 + T reg Cells (green), cell nuclei (blue) (n=12), scale bar: 30 micrometers; G: FoxP3 - DTR / tdTomato Schematic diagram of different pH models in mice; H: T in RV of mice under different pH models. reg Representative flow cytometry plots and quantitative analysis of cell infiltration (n=10); I: For different pH models FoxP3 - DTR / tdTomato T in mouse RV reg Cells were subjected to immunofluorescence staining and quantitative analysis, Foxp3 + Treg cells (red), nuclei (blue) (n=10), scale bar: 30 micrometers.

[0035] Figure 2 In one embodiment of the present invention, single-cell sequencing revealed the left ventricle and RV-T in a failing human heart. reg Changes in CD4 count; where A: CD4 count in each ventricular region (including the free wall of the interventricular septum and the apex, as well as the left ventricle and RV). + B: UMAP distribution of T cells; C: UMAP distribution of Foxp3 and IL-2R; D: CD4+ distribution by region in normal heart, dilated cardiomyopathy heart, and restrictive cardiomyopathy heart. + Composition of T cell subsets.

[0036] Figure 3 This is a schematic diagram illustrating the compensatory and functional progression stages of RV pathological remodeling in TAC mice according to an embodiment of the present invention; wherein, A: schematic diagram of analysis after TAC at different time points; B: representative H&E staining of cardiac cross sections after TAC at different time points (n=10), scale bar: 50 micrometers; C: RV ejection fraction (RVEF), tricuspid annular systolic displacement (TAPSE), and cardiac output (CO) after TAC at different time points (n=10); D: Masson staining of RV after TAC at different time points and Anp and Bnp mRNA expression levels (n=10); E: CD4 in RV after TAC + CD25 + FoxP3 + T reg Percentage and number of cells (n=10).

[0037] Figure 4 T is an embodiment of the present invention regSchematic diagram of the results of cells exhibiting tissue-specific functions in RV dysfunction; where A and B represent T cells in the RV and lungs of mice manipulated by PAB or TAC. reg cells Ccr4 and Il-10 mRNA levels (n=6); C: effector T cells (T cells) under different treatments eff Ki67 + and Tnf-α Representative flow cytometry and quantitative analysis of mRNA levels (n=6); D: T cell RNA sequencing of RV from human controls and DCM patients using single-cell RNA sequencing. reg Cells and T cells from mouse control and TAC-induced heart models reg Cells were subjected to GO enrichment analysis; E: sham-operated and TAC mouse RVT. reg cells Ifn-γ , Il-17a and Il-4 Relative mRNA expression levels (n=6); F, G: Pseudo-temporal analysis and developmental trajectory visualization of RV cells from human controls and DCM patients, and T cells from mouse controls and TAC model hearts; H: RV-T cells from sham-operated and TAC mice. reg Flow cytometry quantitative analysis of intracellular helper T cells (Th) (n=10); I: RV-T cells in sham-operated and TAC mice reg cells T-bet The relative mRNA expression levels (n=6).

[0038] Figure 5 This is an embodiment of the present invention, RVT. reg A schematic diagram showing the tissue-specific function of cells via NLRC3; where A: mRNA expression of NOD-like receptor (NLR) family members in RV (n=6); B: Venn diagram showing the overlap of NLR family gene expression in heart and lung tissues; C: RV and lung tissues of mice in the control, TAC-treated, and PAB-treated groups. Nlrc3 mRNA expression levels (n=6); D: WT and KO mice (NLRC3) 6 weeks after TAC surgery. - / - ) of RVT reg cells Ccr4 and Il-10 Relative mRNA expression levels (n=6); E: infection with NC or NLRC3 overexpression (NLRC3) OE ) TACRV T after lentivirus reg middle Il-10 and Ctcl4 mRNA expression levels (n=6); F: RV tissue of TAC mice Nlrc3mRNA expression changed dynamically over time (n=6); G: Ki67 expression under different treatment conditions + Quantitative analysis of T cells was performed, and representative flow cytometry images are attached. Il-2 and Tnf-α mRNA expression levels (n=6); H: Foxp3 in WT and KO mice 6 weeks after TAC surgery + T-bet + Representative quantitative analysis of T cells (n=10); I: TACRV-T cells infected with control (NC), NLRC3 overexpression (OE-NLRC3), or NLRC3 depletion (sh-NLRC3) lentiviruses. reg In cells, the mRNA levels of T-bet and IFN-γ were detected (n=6); J: In Jurkat cells infected with NC, OE-NLRC3, or sh-NLRC3 lentiviruses, the levels of T-bet and IFN-γ were detected. T-bet and Nlrc3 mRNA levels (n=6); K: Protein expression of JAK2 and STAT4 in Jurkat cells infected with NC, OE-NLRC3 or sh-NLRC3 lentiviruses was analyzed (n=6).

[0039] Figure 6 This is a schematic diagram illustrating the results of RV dysfunction induced by stress load due to NLRC3 deficiency in one embodiment of the present invention; wherein, A: wild type (WT) and gene knockout type (KO, NLRC3) - / - A: Schematic diagram of the experimental procedure for mice 6 weeks after TAC surgery; B: PAT / PET ratio and RVEF and TAPSE of wild-type (WT) and knockout (KO) mice 6 weeks after TAC surgery (sample size n=10); C to F: Representative images and quantitative analysis of WGA staining, Procymbidium staining and Isolectin B4 (IB4) labeling in wild-type (WT) and knockout (KO) mice 6 weeks after TAC surgery, scale bar: 50 micrometers (n=10); G: Quantitative analysis showing CD4 + CD25 + FoxP3 + T reg Quantity and percentage (n=10); H: Under TAC conditions, use wild-type or mutant T reg Reconstructing T cells in immunodeficient athymic or wild-type mice reg Schematic diagram of cells; I, J: after ischemia-reperfusion (IR) (I) and T reg Representative images and quantitative data of Masson staining and HE staining of RV in TAC mice after transfer (J) (n=6).

[0040] Figure 7 In one embodiment of the present invention, the AAV virus targets CD4. + A schematic diagram of T cell results; where A: Ark313 serotype empty adeno-associated virus and CD4 in the right ventricle. + Representative immunofluorescence image of T cell colocalization, AAV (green), CD4 + T cells (red), nuclei (blue) (scale bar = 30 μm); B: Ark313 serotype empty adeno-associated virus and CD4 in the right ventricle. + Representative immunofluorescence image of T cell colocalization, AAV (green), CD4 + T cells (red), cell nuclei (blue) (scale bar = 30 μm).

[0041] Figure 8 In one embodiment of the present invention, NLRC3 overexpression (AVV virus overexpressing NLRC3) can improve TAC-induced right ventricular dysfunction; wherein, A: PAT / PET (N=8) after NLRC3 overexpression in the TAC model, the injection methods include: orthotopic injection of myocardium and endotracheal infusion; B: TAPSE (N=8) after NLRC3 overexpression in the TAC model; C: RVEF% (N=8) after NLRC3 overexpression in the TAC model; D: LVEF% (N=8) after NLRC3 overexpression in the TAC model; E: Representative WGA stained images and quantitative analysis of right ventricular tissue after NLRC3 overexpression in the TAC model (average of 100 cardiomyocyte cross-sections per sample) (scale bar = 50 μm) (N=8); F: Right ventricular tissue after NLRC3 overexpression in the TAC model. Anp and Bnp Expression levels (N=8); G: Representative images of Sirius red staining in right ventricular tissue after NLRC3 overexpression in the TAC model and quantitative analysis of fibrosis (scale bar = 50 μm) (N=8); H: Right ventricular tissue after NLRC3 overexpression in the TAC model α-SMA and Collagen III Expression level (N=8); I: Representative image of BI4 staining in right heart tissue after NLRC3 overexpression in TAC model (scale bar = 30 μm).

[0042] Figure 9 This is a schematic diagram illustrating the effect of NLRC3 overexpression improving PAB-induced right ventricular dysfunction in one embodiment of the present invention; wherein, A: PAT / PET (N=5) after NLRC3 overexpression in the PAB model, the injection method includes: orthotopic myocardial injection; B: TAPSE (N=5) after NLRC3 overexpression in the PAB model; C: Right ventricular tissue after NLRC3 overexpression in the PAB model. Anp and BnpExpression levels (N=8); D: Representative images of Sirius red staining in right ventricular tissue after NLRC3 overexpression in the PAB model and quantitative analysis of fibrosis (scale bar = 50 μm) (N=8); E: RV tissue after NLRC3 overexpression in the PAB model α-SMA Expression level (N=8).

[0043] Figure 10 In one embodiment of the present invention, NLRC3 overexpression (NLRC3 overexpression of RVT) is described. reg A schematic diagram illustrating the results of slowing down the RV remodeling process in cells; where A: cells transfected with NC or NLRC3 overexpression (NLRC3) OE ) Lentiviral RVT reg Cells (2×10) 6 A: Schematic diagram of cells transplanted into TAC mice via tail vein injection; B: Hematoxylin-eosin staining and RVFWT of tail vein-injected TAC mice (scale bar: 100 micrometers) (n=6); C: Injection of WTT into TAC mice reg Cells or NLRC3⁺T reg After cell division, PAT / PET, TAPSE, RVFWT, RVEF% and CO were measured (n=6); D: after injecting WTT into TAC mice reg Cells or NLRC3⁺ T reg After cell division, representative sections stained with WGA were measured and their RV was quantitatively analyzed (n=6), scale bar: 50 μm; E: after injection of WTT into TAC mice. reg Cells or NLRC3⁺ T reg After the cells were processed, their measurements were taken. Anp and Bnp mRNA expression levels (n=6); F: after injecting WTT into TAC mice reg Cells or NLRC3⁺ T reg After the cells were processed, their measurements were taken. α-SMA and Collagen mRNA expression level of Ⅲ (n=6).

[0044] Figure 11This is a schematic diagram illustrating the effect of the timing of intervention on the progression of right heart failure in one embodiment of the present invention; wherein, A: Schematic diagram of experimental timeline: AAV-NLRC3 was administered at weeks 6 and 10 after TAC surgery, and the intervention continued until week 12 after TAC surgery; B: WGA staining and quantitative analysis of TAC RV overexpressing AAV-NLRC3 (scale bar: 50 micrometers) (n=6); C: Echocardiographic parameters of TAC models after administration of AAV-NC or AAV-NLRC3 at different time points (n=6); D: Representative hematoxylin-eosin stained sections and quantitative analysis of RV in TAC mice after administration of AAV-NC or AAV-NLRC3 at different time points (scale bar: 100 micrometers) (n=6).

[0045] Figure 12 This invention employs overexpression of NLRC3 or adoptive transfer of NLRC3. + T reg A schematic diagram of the mechanism by which cells prevent RV remodeling. Detailed Implementation

[0046] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental materials in the following embodiments that do not specify their source are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise stated, all parts are parts by weight, and all percentages are percentages by mass. Unless otherwise defined or stated, all professional and scientific terms used in the present invention have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention.

[0047] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.

[0048] In the following examples, C57BL / 6J mice were purchased from Jicui Pharmaceutical Co., Ltd.; Nlrc3 gene knockout (KO, Nlrc 3 - / - Mice (C57BL / 6 strain) were purchased from German pharmaceutical company AG (Nanjing, China). FoxP3 - DTR / tdTomato Mice were purchased from Shanghai Model Organisms Center Co., Ltd., and athymic nude mice (nu / nu) were provided by Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. (Nanjing, China). Pressure overload-induced cardiac remodeling was artificially constructed in 8-week-old male mice using transaortic coarctation (TAC) or pulmonary artery ligation (PAB). The treated tissues were rapidly frozen in liquid nitrogen and stored at -80°C for subsequent analysis.

[0049] In the following examples, transverse aortic coarctation (TAC) modeling was performed as follows: Healthy adult C57BL / 6J mice (weighing 20-25 g, without abnormal behavior or health problems) were selected and randomly divided into control and experimental groups after one week of acclimatization to the laboratory environment. The surgery was performed under sterile conditions. Anesthesia was administered via intraperitoneal injection of sodium pentobarbital (50 mg / kg), and analgesics were injected subcutaneously. After checking reflexes, the mice were immobilized. The neck and chest hair were shaved and disinfected. An incision of approximately 1 cm was made along the midline of the sternum. The muscles were bluntly dissected to expose the sternum, and the sternum was cut open to expose the heart and aortic arch. A 7-0 suture was inserted between the aortic arch and the brachiocephalic trunk. A 27G needle was placed parallel to the aortic arch and ligated. After ensuring moderate narrowing to 70% of the original diameter, the needle was withdrawn, and the incision was sutured layer by layer. The sham-operated group underwent parallel surgical procedures but without aortic ligation. At 6 or 10 weeks, surviving experimental animals were evaluated by echocardiography and hemodynamic measurements were performed.

[0050] In the following examples, pulmonary artery banding (PAB) modeling was performed as follows: Healthy adult C57BL / 6 mice (weighing 20-25g, without abnormal behavior or health problems) were selected and randomly divided into control and experimental groups after one week of acclimatization to the laboratory environment. The surgery was performed under sterile conditions. Mice were anesthetized with intraperitoneal injection of sodium pentobarbital (50 mg / kg) and subcutaneously injected with analgesics. After checking reflexes, endotracheal intubation was performed via a 20-gauge endotracheal tube, and mechanical ventilation was initiated using an animal ventilator (respiratory rate 120-140 breaths / min, tidal volume 10 μL / g body weight). The mice were immobilized, the neck and chest hair were shaved and disinfected, and a right lateral thoracotomy was performed. The left chest was opened in the third intercostal space, the main pulmonary artery was separated, a 7-0 suture was inserted, and a 25G needle was placed. After tightening, the needle was withdrawn, ensuring moderate narrowing to 70% of the original diameter. The incision was sutured layer by layer. Mice in the sham-operated group underwent the same surgical exposure, but without sutures. Survival was monitored for 3 weeks post-surgery, followed by echocardiography and hemodynamic assessment to evaluate RV function and pulmonary vascular resistance. Tissue samples were collected and immediately cryopreserved in liquid nitrogen at -80°C for molecular analysis.

[0051] In the following examples, a hypoxia model combining simple hypoxia and SU5416 was established: C57 / BL6J mice were housed at 24°C with a 12-hour light cycle and free access to food and water. The normoxic control group was exposed to natural air, while the hypoxia group was subjected to continuous normobaric hypoxia (oxygen concentration 9-11%) treatment in a sealed chamber for 4 weeks. A nitrogen-balanced air mixture (50% humidity, 5-6% carbon dioxide, 24°C) was continuously injected into the chamber. The SU5416 combined hypoxia model was established by administering a single subcutaneous injection of either the solvent or SU5416 (APE×BIO, #A3847, 20 mg / kg) to the mice, followed by prolonged hypoxic treatment. After the 4-week intervention period, terminal anesthesia was performed for hemodynamic analysis and histopathological assessment of cardiopulmonary remodeling.

[0052] In the following examples, the AAV virus overexpressing NLRC3 was constructed as follows: The NLRC3 gene was overexpressed in the right heart and lung tissues of C57BL / 6N mice. The mouse-derived NLRC3 gene (Gene ID: 268857) was cloned into AAV Ark313 by PackGene Biotech (Guangzhou, China). The procedure is briefly described below: HEK 293T cells were transiently transfected with the GOI plasmid (ssAAV.EF1a.3xFlag-NLRC3.PA48), the adenovirus helper plasmid (pHelper), and the AAV RC plasmid (pAAV-RC). 72 hours after transfection, recombinant AAV was collected by lysing cells to release viral particles into the supernatant. Subsequently, the crude viral lysate was purified by gradient centrifugation with iodobutanol. Viral titer (genome copies per milliliter, gc / mL) was measured using real-time PCR with universal SYBR Green Mix (BIO-RAD, USA) and primers designed for the inverted terminal repeat (ITR) sequence of the AAV vector. Vectors meeting quality control standards (in the form of AAV virus suspensions overexpressing NLRC3) were aliquoted and stored at -80°C for later use. In the experiment, mice were infected with AAV Ark313 encoding NLRC3 (AAV-NLRC3) or the empty vector (AAV-NC), following the procedures for in situ myocardial injection and endotracheal instillation.

[0053] In the following examples, in situ injection of AAV virus into the myocardium was performed: After modeling in mice, a 1.5 cm incision was made in the skin. A small hole was made in the third intercostal muscle using micro-scissors, the chest was opened with a pectoral splint, and the pleura was exposed. The pericardium was pulled away from the heart with micro-forceps and gently torn open with toothed forceps to expose the heart. 10 μL of AAV virus solution containing a total viral dose of 1×10¹¹ GC was slowly and steadily injected into the free wall of the RV using a fine insulin needle. The needle was briefly fixed after injection to prevent backflow, and then the pleural cavity was sutured in layers. If the injection was successful, the local tissue color would change from red to white. Multiple injection points are generally preferred for better viral spread. After viral injection, the chest was closed after confirming no bleeding. Postoperative care: The mice were placed on a heating pad until they regained consciousness. Their condition was then closely monitored for several days, and analgesics were administered. Control mice were injected with the corresponding volume of Hank's fluid.

[0054] In the following examples, AAV virus was administered via tracheal instillation: 20 μL of AAV virus suspension (equivalent to a total viral dose of 1 × 10¹¹ GC) was injected, and the mouse was immediately rotated vertically to ensure uniform distribution of the viral solution in the lungs. The specific procedure was as follows: Mice were anesthetized: The mice receiving tracheal instillation were deeply anesthetized to ensure sufficient depth of anesthesia, otherwise the procedure would be affected; The mice were secured: The anesthetized mice were placed on a vertical mouse board, and the incisors were secured to the board with thick thread and tape, with the mouse's abdomen facing the operator. The mouth was then exposed, and the mouse's tongue was gently pulled out. Under direct observation with a laryngoscope (using specialized lighting equipment), a blunt-tipped gavage needle or catheter was inserted through the glottis into the trachea. After confirming the catheter was correctly positioned, the catheter was not moved, and the optical fiber was carefully removed; AAV virus instillation: 20 μL of AAV virus suspension (equivalent to a total viral dose of 1 × 10¹¹ GC) was slowly injected through the catheter using a syringe, and the mouse was immediately rotated vertically to ensure uniform distribution of the viral solution in the lungs. A blank control group was administered as a control group.

[0055] In the following embodiments, T reg Cell isolation and purification: from wild-type (WT, C57BL / 6J) or Nlrc CD4 was obtained from the right heart of 3-gene knockout (KO) mice. + CD25 + Regulation T (T) reg ) cells. T reg Cell isolation was performed using EasySep™ mouse CD4. + CD25 + T reg Isolation Kit II (product number 18783, STEMCELL Technologies) was used, following the manufacturer's instructions: First, via EasySep™ mouse CD4...+ T-cell separation mixture (19852) for the separation of CD4 + T lymphocytes were then enriched with CD25 using EasySep™ CD25 positive selection mixture (18782). + Subpopulations were then finally purified using EasySep™ magnetic separation. Non-regulated CD4 groups were removed in successive negative / positive selection steps. + CD25 - Cell populations to obtain high-purity T cells reg Suspension.

[0056] In the following examples, cardiomyocytes were isolated and purified as follows: To obtain a single-cell suspension from mouse RV, mice were first euthanized by cervical spine, followed by rapid thoracotomy to remove right ventricular tissue, and then the tissue was washed with ice-cold PBS. The tissue was then transferred to a solution containing heart-specific digestive enzymes (such as collagenase II and trypsin) and enzymatically digested at 37°C with gentle agitation every 10 minutes to promote tissue dissociation for 30 minutes. The digestion process was terminated by adding serum-containing culture medium, and the suspension was then filtered through a 70 μm cell filter to remove undigested tissue fragments. The filtrate was centrifuged at 300 × g for 10 minutes to precipitate the cells, thus obtaining a single-cell suspension of RV. Cardiac cell enrichment suspensions from sham-operated and TAC mice were seeded at appropriate densities into culture dishes coated with laminin or gelatin and cultured in DMEM medium containing 10% fetal bovine serum, 1% penicillin-streptomycin and 0.1 mMol bromodeoxyuridine (to inhibit the proliferation of non-cardiac cells) in an incubator at 37°C and 5% CO2.

[0057] In the following embodiments, T reg Cell preparation and immunomodulatory effects: using EasySep™ mouse CD4 + CD25 + T reg Cell Isolation Kit II (product number 18783, from STEMCELL Technologies) purified CD4 from pre-sorted cell components. + CD25 + Lymphocyte subsets. Analysis after purification showed that the target population had a cell purity exceeding 98%. In the experimental group, 2 × 10⁶ cells were intravenously infused into immunocompromised mice via tail vein injection. 6 CD4 + CD25 + T reg Cells (denoted as WTT) reg (Cells). This cellular intervention was performed on the first day after the TAC procedure.

[0058] In the following examples, T cells were reconstructed in immunodeficient athymic or wild-type mice. reg cell( Figure 6 The steps include: (1) Immune reconstitution step: sorting primary T cells reg Cellular components are partially controlled via EasySep™ Mouse CD4 + CD25 + The Regulatory Tcell Isolation Kit II (Cat#18783, STEMCELL Technologies, Vancouver, Canada) further separated the CD4. + CD25 + Treg cell population purity reached 98%. Immunodeficient mice were injected via tail vein 7 days prior to TAC surgery with purified mouse Treg cells. reg (CD4) + CD25 + ) cells (2 × 10 6 (2) T reg Adoptive cell infusion procedure: Mouse T reg Cell sorting; cell fractionation via EasySep™ Mouse CD4 + CD25 + The Regulatory Tcell Isolation Kit II (Cat#18783, STEMCELL Technologies, Vancouver, Canada) further separated the CD4. + CD25 + T reg Cell population purity reached 98%. C57BL / 6J mice were injected via tail vein 1 day after TAC surgery with purified T cells. reg (CD4) + CD25 + ) cells (2 × 10 6 (Number of cells), flow cytometry was used to detect the arrival of Treg cells in the lungs. Treg cells overexpressing NLRC3 were... reg The adoptive infusion procedure for cells is the same.

[0059] In the following examples, cell culture: Jurkat cells were obtained from the American Type Culture Collection (ATCC) and cultured in RPMI-1640 medium. The medium was supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin-streptomycin solution. These cells were typically passaged every 2 to 3 days. When used in experiments, cells were cultured at 1 × 10⁶ cells per well. 6Seed at a density of 10 cells per well in 6-well plates, or per 10 cm². 2 Inoculate 5×10 6 Cells. All cell cultures were incubated in a humidified incubator at 37°C with a 5% carbon dioxide environment.

[0060] In the following examples, the steps for infecting Jurkat cells with lentiviruses of control (NC), NLRC3 overexpression (OE-NLRC3), or NLRC3 removal (sh-NLRC3) are briefly described as follows: Jurkat cells were purchased from Shanghai Jinyuan Biotechnology Co., Ltd., and transfected at a density of approximately 50% adherence using a fold increase in infection (MOI) of 20. After viral transduction, the cells were maintained under standard conditions (37°C, 5% CO2) for 72 hours to allow transgene expression. Transfection efficiency was subsequently verified by Western blot analysis. The experimental groups included cells transfected with OE-NLRC3 and cells transfected with sh-NLRC3, while cells receiving the non-targeted construct were defined as the negative control (NC) group.

[0061] In the following embodiments, T reg Immunosuppression assay of cells: CD4 was isolated from wild-type (WT, C57BL / 6J) and gene knockout (KO) mice. + CD25 – effector T cells (T cells) eff ) and CD4 + CD25 + T reg Cells. The isolation process follows a predetermined procedure. T cells... eff Cells were distributed at a rate of 2 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells per 12-well plate and seeded at a specified ratio with T [cells]. reg Cells were cultured together (independent or combined). To activate these T cell populations, cultures were treated with recombinant human IL-2 (5 ng / mL; PeproTech, #212-12-20UG) and antibodies against mouse CD3ε (2 μg / mL; Biolegend, #100303) and mouse CD28 (1 μg / mL; Biolegend, #102115). After 24 hours of culture, cells were harvested to assess proliferative activity. In parallel inhibition assays, T cells were... eff Cells were stained with anti-Ki67 antibody. Data obtained from flow cytometry were processed and interpreted using FlowJo software (FlowJo LLC).

[0062] In the following examples, NLRC3-removed (sh-NLRC3) lentiviral vectors and negative control lentiviral vectors were constructed: The short lead RNA (sgRNA) for expressing the NLRC3 gene sequence (GGCGGAGAACCAGATCAGTAA) and the negative control (CGCTTCCGCGGCCCGTTCAA) lentiviral vectors were both provided by Shanghai Jikai Gene Medical Technology Co., Ltd. The steps are briefly described as follows: The lentiviral vector was synthesized and cloned into a GV493 (hU6-MCS-CBh-gcGFP-IRES-puromycin) vector (purchased from Shanghai Jikai Gene Medical Technology Co., Ltd.) containing AgeI and EcoRI sites. The recombinant vector was detected by DNA sequencing. Lentiviral production used Lipofectamine 2000 (Ingenieur; Thermo Fisher Scientific) to co-transfect the viral vector with two helper plasmids, psPAX2 and pMD2, into 293T cells. Infectious lentiviruses were collected 72 hours post-transfection, rapidly centrifuged to remove cell debris, and then filtered through a 0.45 μm cellulose acetate membrane. Viral titers were determined by quantitative PCR and were approximately 1 × 10⁻⁶. 9 Transduction units (TU) / mL, and stored at -80°C for later use.

[0063] In the following examples, the construction of the lentiviral vector overexpressing NLRC3 (OE-NLRC3) included the following steps: HumanNLRC3 (Gene ID: 197358) was obtained from a cDNA library of Shanghai Jikai Gene Medical Technology Co., Ltd., using the following primers: NLRC3(68210-1)-p1: AGGTCGACTCTAGAGGATCCCGCCACCATGAGGAAGCAAGAGGTGCGGACGGGC; NLRC3(68210-1)-p2: TCCTTGTAGTCCATACCCATTTCAACAGTGCACGTGGGAGCATTTG. The lentiviral vector plasmid GV492 (Ubc-MCS-3FLAG-CBh-gcGFP-IRES-puromycin) (purchased from Shanghai Jikai Gene Medical Technology Co., Ltd.) and the NLRC3 gene sequence were digested with BamHI and AgeI restriction endonucleases and cloned using the in-fusion recombination method. The NLRC3 overexpression lentiviral recombinant vector was detected by DNA sequencing. Lentiviral production was performed using Lipofectamine 2000 (Ingenieur; Thermo Fisher Scientific). The viral vector, along with two helper plasmids, psPAX2 and pMD2.G, was co-transfected into HEK 293T cells. Infectious lentivirus was collected 72 hours after transfection, rapidly centrifuged to remove cell debris, and then filtered through a 0.45 μm cellulose acetate membrane. Viral titer was determined by quantitative PCR and was approximately 1 × 10⁻⁶. 9 Transduction units (TU) / mL, and stored at -80°C for later use.

[0064] In the following examples, T overexpressing NLRC3 reg Cell preparation method (transfection of primary sorted mouse T cells with recombinant lentiviral vector) reg Cells): T cells isolated from the spleen of C57BL / 6J mice reg Cells (CD4) + CD25 +CD4+CD25+ Treg cells activated for 24 hours by stimulation with anti-CD3 and anti-CD28 antibodies were transfected with a lentiviral vector overexpressing NLRC3 (MOI = 20). Cells were collected into centrifuge tubes and gently pipetted to disperse cell clumps, avoiding cell damage. The cells were centrifuged at 300 × g for 5 minutes at room temperature, and the supernatant was discarded. The cells were gently resuspended in medium containing fresh IL-2 and the viral infection enhancer HitransGP; an appropriate amount of lentiviral vector overexpressing NLRC3 (MOI = 20) was added and gently mixed; the virus-cell mixture was added to 6-well plates and cultured at 37°C and 5% CO2 for 72 h. T cells transfected with sh-NLRC3 were then... reg Cells, T cells transfected with negative control virus reg The cellular methods follow the same steps.

[0065] In the following examples, T overexpressing NLRC3 reg In the cell preparation methods, primary sorting of mouse T cells... reg The cell preparation steps included: 1) Single-cell suspension preparation: C57BL / 6J mice were euthanized by cervical dislocation, immersed in 75% alcohol for a few seconds, and fixed on a sterile operating table. The abdominal skin of the mice was cut open, spleen tissue samples were taken, transferred to a sterile culture dish containing pre-cooled PBS, washed, placed on a 70 μm cell filter, and the spleen was gently ground with the plunger of a syringe until the entire spleen was ground into a single-cell suspension. The preparation method for single-cell suspension of lung tissue was the same as that of flow cytometry. The single-cell suspension was transferred to a 50 mL sterile centrifuge tube. 2) Cell counting: The collected suspension was centrifuged at 1500 rpm for 10 min, resuspended in FACS, and the cell count was 1 x 10⁻⁶. 8 cells / ml. 3) Magnetic bead-labeled non-CD4 + T cells, removing non-CD4 + T cells: a. Add 50 μL / mL serum to each sample and mix well; then add 20 μL CD4 T cell isolation antibody to each sample and incubate at room temperature for 10 min. b. Add 40 μL Streptavidin Rapidspheres magnetic beads to each tube (mix well before use) and incubate at room temperature for 2.5 min. c. Add 1.5 mL FACS, place in the magnetic bead absorber, and incubate at room temperature for 2.5 min. Collect unadsorbed cells into a new 5 mL sterile tube. (Use EasySep™ mouse CD4...) + T-cell separation reagent (19852C.1) was used to obtain CD4. + T cells. d. Centrifuge at 200 xg, incubate at room temperature for 10 min, discard the supernatant, and collect CD4+. +T cells. 4) Magnetic beads labeled with CD25 + T cells, CD4 + CD25 + Positive selection for T cells: a. Resuspend cells in 500 μL, add 20 μL blocker per sample, and incubate at room temperature for 3 min. b. Add CD25. + c. Add 20 μL of Treg isolation antibody and incubate at room temperature for 10 min. c. Add 20 μL of PE and incubate at room temperature for 5 min, then add 40 μL of Dextran RapidSperes magnetic beads and incubate at room temperature for 5 min. Select CD25 Treg cells using EasySep™ mouse CD25 Treg cell positive selection reagent (18782C). + T cells. d. Add 2 mL FACS, place in a magnetic bead separator, incubate at room temperature for 5 min, and discard the supernatant. e. Repeat the previous step 3 times, washing a total of 4 times. That is, obtain CD4 using the EasySep™ magnetic separator. + CD25 + T reg Cells were cultured at 37°C and 5% CO2 for 24–48 h. The cell culture medium was prepared as follows: 1640 (40 ml) + IMDM (10 ml) + 10% FBS (5 ml) + PS (500 μl). In the examples below, TAC RV T cells were infected with control (NC), NLRC3 overexpression (OE-NLRC3), or NLRC3 removal (sh-NLRC3) lentiviruses. reg Cellular steps ( Figure 5 All can refer to the following brief steps: (1) TAC CD4 + CD25 + T reg Cell acquisition; 1) Single-cell suspension preparation: The right heart was taken from the heart of a TAC 6W mouse after modeling, and Treg cells were isolated from the right heart. Two mice were combined (CD4+). + CD25 + After euthanasia, mice were immersed in 75% alcohol for several seconds and fixed on a sterile operating table. The abdominal skin of the mice was cut open, and right heart tissue samples were collected and transferred to a sterile culture dish containing pre-chilled PBS. The samples were washed three times, placed in a 15 mL centrifuge tube, minced, and digested with cardiac digestive enzymes for 30 min. The resulting single-cell suspension was obtained by filtering through a 70 μm filter. The preparation of single-cell suspensions from lung tissue followed the method described in flow cytometry. The single-cell suspensions were transferred to 50 mL sterile centrifuge tubes. Cell counting and magnetic bead labeling of non-CD4 were performed. + T cells and removal of non-CD4 + T cells, magnetic bead-labeled CD25 + T cells and CD4+ CD25 + The positive selection procedure for T is the same as above. (2) Using CD4 + CD25 + T reg Cells are infected with NC, OE-NLRC3, or sh-NLRC3 lentiviruses.

[0066] In the following embodiments, the detection methods, such as computed tomography angiography (CTA) acquisition, echocardiography and hemodynamic measurement, flow cytometry analysis, pseudo-time analysis, histological examination and immunohistochemical staining, immunofluorescence staining and confocal microscopy, enzyme-linked immunosorbent assay (ELISA), RNA extraction and quantitative real-time PCR detection, protein extraction and Western blotting, all adopt conventional methods and detection steps in the art.

[0067] In the following examples, statistical analysis was performed as follows: In independent experiments, all values ​​are expressed as mean ± standard error. For comparing differences between two groups, the independent samples t-test (Student's t-test) (for normally distributed data) and the Mann-Whitney test (for non-normally distributed data) were used; for comparing differences between multiple groups, one-way (two-way) ANOVA was used, with Tukey's method employed for time analysis. Statistical analysis was performed using GraphPad Prism 9.0. A p-value < 0.05 was considered statistically significant, and *P < 0.05, **P < 0.01, and ***P < 0.001. All analyses were performed using SPSS 14.0 (SPSS Inc., USA) and Prism 7.0 (GraphPad Software Inc., USA).

[0068] The technical solution of the present invention will be illustrated by way of example in the following embodiments.

[0069] Example 1 – Validation of Right Ventricular Remodeling (RV) T reg The relationship between cells and RV This embodiment studies RV T in TAC and PAB mice. reg The relationship between cells and RV, and the specific experimental steps include: (1) In order to observe the pathological changes of RV during the progression of PH, different types of PH were simulated, including type 1 PH induced by hypoxia (Hx), type 2 PH induced by transverse aortic coarctation (TAC), type 3 PH induced by SU5416 combined with hypoxia (SuHx), and RV remodeling models of PH induced by pulmonary artery ligation (PAB). Figure 1Part A of the experiment (specific steps as described above). The experimental groups were divided into the Sham group, the type 1 PH model (Hypoxia) group, the type 2 PH model (TAC) group, the type 3 PH model (Sugen5416+hypoxia) group, and the RV remodeling model group induced by pulmonary artery ligation (PAB). Hemodynamic and echocardiographic assessments confirmed that in the PH model, right ventricular systolic pressure (RVSP) was increased, the ratio of pulmonary artery acceleration time to ejection time (PAT / PET) was decreased, tricuspid annular systolic displacement (TAPSE) was decreased, and right ventricular ejection fraction (RVEF) and cardiac output (CO) were decreased. The results are shown in the table below.

[0070] Hemodynamic characteristics of the pulmonary hypertension (PH) model Among the above-mentioned PH models, the changes induced by TAC were the most significant compared to the control group, especially in terms of RV hypertrophy, fibrosis / collagen deposition, and certain cardiac function parameters (TAPSE and RVEF). The PH model induced by TAC showed significant abnormalities compared to other PH model groups. Figure 1 (Parts B-C). Furthermore, CT angiography (CTA) images showed increased RV wall thickness and diameter in the type 2 PH (PH-LHD) model. Figure 1 (Part D).

[0071] (2) Single-cell sequencing data (GSE145154) from right / left ventricular tissue of human failing hearts were further analyzed, with the experimental groups set as control and disease group (DCM). T cells were found in the RV of DCM patients (dilated cardiomyopathy). reg / CD4 + The percentage of T cells was significantly higher than in the control group, and surprisingly, it was also higher than in the left ventricle. Figure 2 (from A to C), which indicates that T reg Cells may play a key regulatory role in RV remodeling induced by PH-LHD.

[0072] (3) The peak pressure gradient of the RV functional parameter - tricuspid regurgitation (TRPG) and Foxp3 were also analyzed. + T reg There is a significant negative correlation between the number of cells. Figure 1 (E part), and T in RV tissue of PH-LHD patients reg Local cell infiltration also increased significantly. Figure 1(F part). The experimental groups were set as Sham group, type 1 PH model (Hypoxia) group, type 2 PH model (TAC) group, type 3 PH model (Sugen+hypoxia) group, and RV remodeling model group of PH induced by pulmonary artery ligation (PAB). In order to study T in PH reg The interaction between cells and RV remodeling was studied using Foxp3. - DTR / tdTomato mice were used in experiments in various PH-induced RV remodeling models. Figure 1 (of the G part), and observed in these models, CD4 + CD25 + FoxP3 + The number / proportion of infiltrating regulatory T cells increased in both the TAC and PAB models. reg The cell ratio is more significant ( Figure 1 (H portion). Similar results were also observed in RV histopathological sections, T in TAC mice. reg Cell aggregation was greater than in the type 1 and type 3 PH model groups ( Figure 1 (Part I). Furthermore, 6 weeks after TAC, RV dysfunction (RVEF) and T... reg A significant negative correlation also existed between cell numbers (Figure 1J). These findings highlight the importance of T... reg Cells may play a key role in RV remodeling and dysfunction induced by type 2 PH, RV T reg Increased cell number is associated with worsening RV remodeling.

[0073] (4) In order to clarify RVT reg The role of cells in pH-induced RV remodeling was investigated, and the compensatory and functional progression stages of RV pathological remodeling in TAC mice were systematically evaluated. Figure 3 (Parts A-E). The experimental groups were set as the Sham group, the TAC compensation period group (TAC 6w), and the heart failure group (TAC 10w). Specifically, at 6 weeks after TAC, the compensatory phenotype was characterized by a significant increase in RV free wall thickness (RVFWT), while systolic function (RVEF, TAPSE) was slightly reduced. Figure 3 (Parts B-C). At 10 weeks post-TAC, when significant right ventricular failure occurred, fibrosis and heart failure markers (Anp and Bnp) significantly increased compared to 6 weeks, while RV free wall thickness, systolic function, and cardiac function all decreased. Output decreased ( Figure 3 (Part D of the study). Notably, T was observed 10 weeks after TAC progressed to significant right heart failure. reg The number of cells was significantly reduced ( Figure 3 (part E), which indicates that Treg Cells may exhibit time-dependent dynamic functional changes during disease progression.

[0074] Example 2 - RV and T lung reg Regional heterogeneity of cells This embodiment aims to study the T cells in the right ventricle (RV) and lungs. reg Regional heterogeneity of cells, and specific experimental procedures include: (1) In order to determine T reg Regional heterogeneity of cells and specific T cells targeting RV reg Phenotypic analysis was performed on the heart and lung T cells in both TAC and PAB models. reg Cells were divided into three experimental groups: Sham group, TAC group (6 weeks), and Sham group and PAB group. After 6 weeks of TAC treatment, T cells in the lungs... reg The cells exhibit impaired function ( Figure 4 (Parts A to B). And RV's T... reg The cells exhibit a unique protective triad of characteristics: enhanced chemotaxis, anti-inflammatory specificity, and maintained function. Figure 4 (Parts A-B). The above results indicate that despite the presence of early compensatory phenotypes, RV-T reg The cells' protective capacity is insufficient to prevent the disease from progressing to a decompensated state. Furthermore, it was demonstrated in the TAC model that RV-T... reg The immunosuppressive function of effector T cells is significantly impaired. Figure 4 The C part suggests that this dysfunction may not be entirely attributable to previously identified cytokines ( Figure 4 Part B of the report. These results indicate that RV-T reg The immunosuppressive effect is insufficient to maintain its normal function in the TAC model.

[0075] (2) In order to further explore the main reasons, the human RVT was analyzed. reg Single-cell sequencing results of cells (e.g.) Figure 2 (as shown) and cardiac immune cell status in TAC mice (GSE122930). Experimental groups were set as control group and disease group (DCMRV T). reg Both GO analyses indicated that abnormal T cell differentiation is a key factor in DCM heart RV-T cell differentiation. reg Cells and TAC heart T reg Key cellular phenotypes within the cell. In addition, features such as abnormal cytokines, adhesion, proliferation, and functional metabolic changes are also present. Figure 4Therefore, key cytokines of helper T cells (IFN-γ, IL-4, and IL-17a) were examined and found to be present in RV-T cells in the TAC model. reg Significant changes in cells ( Figure 4 Part E). DCM's RV CD4 + Pseudo-temporal trajectory analysis of the T-cluster shows that CD4 + T cells differentiate into T cells. reg Cells, and T reg Cells can differentiate into other CD4 cells. + T cells, against T reg Further analysis of the subsets showed that they differentiated into Th1 cells ( Figure 4 (F part). TAC mouse heart T reg Pseudo-time trajectory analysis of cells further confirmed the presence of human RV-T reg The cell results showed T reg Cells differentiate into Th1 and Th17 ( Figure 4 (G portion). Subsequently, the RV-T in TAC mice was quantitatively analyzed by flow cytometry. reg The differentiation and metastasis of Th1 and Th17 cells were observed. The results confirmed that helper T cell 1 polarization... reg Cells (Th1-T) reg Differentiation and metastasis occurred, and Th1-T cells were present in the RV tissue of TAC mice. reg The percentage of cells decreased significantly ( Figure 4 (The H part). Further analysis of the separated RV-T reg Cellular analysis also confirmed a significant decrease in T-bet mRNA levels in vitro. Figure 4 Part I).

[0076] Example 3 - Compensatory RVT reg Cellular heterogeneity is associated with NLRC3 This embodiment is intended to illustrate the compensatory RVT. reg The mechanism of cellular heterogeneity was investigated using the following experimental steps: (1) NLRs families (related to cardiac remodeling and PH disease) were screened, and the experimental groups were set as Sham group, TAC group (6w), and PAB group. It was found that the levels of multiple NLRs members were elevated in the RV tissue of TAC mice ( Figure 5 Part A). Further, it was combined with candidate NLRs that were significantly reduced in lung tissue, thereby screening NLRC3 as the dominant candidate gene with RV-specific induction (part A). Figure 5 Part B). (With lung T) reg The downregulation of NLRC3 in cells differs, with NLRC3 showing different levels of downregulation after TAC and PAB in RVT.reg Significantly upregulated in cells ( Figure 5 Part C).

[0077] (2) The effects of NLRC3 on RV T in vitro were studied. reg Effects on cells: Effects of TAC on NLRC3-deficient T cells reg Cell sorting revealed decreased expression of IL-10 and recruitment-related genes (Ccr4), while NLRC3 overexpression was observed in RVT cells. reg Increased expression of IL-10 and Ctla-4 in cells ( Figure 5 (Parts D-E). NLRC3 expression also changes with the transition from compensated to decompensated RV remodeling. NLRC3 peaks 2 weeks after TAC, then gradually declines to below control levels, and is even lower at 10 weeks ( Figure 5 (F part). Subsequent immunosuppressive experiments showed that NLRC3 deficiency inhibited TAC after TAC. reg Cellular inhibitory effect T (T eff NLRC3 overexpression enhances the ability of T cells to proliferate and exert anti-inflammatory effects. reg Cellular immunosuppression ( Figure 5 (G portion). Importantly, in vivo flow cytometry analysis confirmed the role of NLRC3 in Th1-T... reg Effects on cell differentiation Figure 5 (of the H part), and in the sorting RVT reg Overexpression of NLRC3 in cells promotes the level of T-bet ( Figure 5 (Part I). Similarly, overexpression of NLRC3 promoted an increase in Th1-related cytokines and transcription factors in Jurkat cells, while downregulation of NLRC3 had the opposite effect. Figure 5 (J part). Studies have confirmed that in NLRC3 against T reg During the differentiation process, JAK-STAT4 signaling is activated, while this signal is suppressed by downregulating NLRC3. Figure 5 (K part). These results indicate that NLRC3 finely modulates immune adaptation through STAT4-mediated Treg reprogramming.

[0078] Example 4 - NLRC3 deficiency exacerbates RV remodeling, dysfunction, and failure caused by TAC and PAB. To clarify the role of NLRC3 in PH-induced RV remodeling, the following experimental steps were used in this embodiment: (1) A knockout (KO) model of the NLRC3 gene was constructed. - / - ) mice ( Figure 6Part A). Compared with wild-type C57BL / 6J mice (WT), NLRC3 - / - Mice exhibited significant RV dysfunction (decreased RVSP and decreased forward ejection / forward pressure ratio). Figure 6 Part B), increased RV thickening, fibrosis, and increased capillary density ( Figure 6 The C-F portion of the heart was affected, and even right heart failure occurred. These results indicate that NLRC3 deficiency exacerbates RV failure induced by PH-LHD. Flow cytometry analysis showed that T cells in the RV after NLRC3 deficiency... reg Reduced infiltration, which is consistent with T10 weeks post-TAC. reg The changes in quantity are consistent ( Figure 6 (part G).

[0079] (2) In order to further clarify NLRC3 + T reg The specific role of cells in RV remodeling was demonstrated in immune reconstitution in athymic mice and in the transfer of T cells in immunocompetent mice. reg cell( Figure 6 (H part). On the one hand, wild type and NLRC3 - / - mouse CD4 + CD25 + T reg Cells were injected into immunodeficient mice without a thymus one week prior to TAC surgery. Flow cytometry confirmed successful infusion, and NLRC3-deficient T cells showed increased activity compared to the wild-type group. reg Cellular activity accelerated the progression of PH-LHD. Furthermore, NLRC3 deficiency suppressed T cells. reg The ability of cells to prevent RV hypertension and fibrosis ( Figure 6 (Part I). On the other hand, using T from immunocompetent mice... reg Subgroup transplantation was used to verify the above results. Figure 6 (J part). These results indicate that the absence of NLRC3 inhibits RVT. reg The role of cells.

[0080] Example 5 - NLRC3 overexpression improves PH-LHD-induced right ventricular remodeling Based on the experimental results of the previous embodiment, it was observed that NLRC3 deficiency significantly exacerbated the development of PH and RV dysfunction. To further verify the specific role of NLRC3 in right ventricular function and to further elucidate the protective effect and potential therapeutic value of NLRC3 in right ventricular dysfunction, this embodiment investigated the effect of NLRC3 overexpression on right ventricular remodeling induced by PH-LHD. Specific experimental steps included: (1) Oral injection of AVV virus overexpressing NLRC3 into the myocardium and intratracheal infusion; 1) Construction of AVV virus overexpressing NLRC3; Adeno-associated virus (AAV) is a highly efficient and safe gene delivery tool widely used in gene therapy and functional research. AAV's low immunogenicity, long-term stable expression, and broad tissue specificity make it an important vector for studying gene function and therapeutic potential. Particularly in cardiovascular disease research, AAV can efficiently infect cardiomyocytes and vascular endothelial cells, providing strong technical support for exploring the role of specific genes in cardiac function. AAV is characterized by high transduction efficiency, low immunogenicity, and long-term expression. It can selectively target CD4 in cardiac tissue through different serotypes. + T cells ensure the specificity and safety of gene manipulation.

[0081] In this embodiment, AAV Ark313 was used for targeted knock-in and the transduction efficiency of mouse T cells was improved to construct adeno-associated virus (AAV)-targeted T cells. These cells were able to overexpress NLRC3 to investigate whether targeting NLRC3-overexpressing T cells by intracardiac and intratracheal injection could slow the progression of maladaptive remodeling caused by NLRC3 compensatory loss.

[0082] 2) To verify CD4 + The specific targeting of T cells in right ventricular tissue was demonstrated by injecting mice with an empty adeno-associated virus of serotype Ark313 via orthotopic myocardial injection. This virus carried green fluorescent protein (GFP) and targeted CD4. + Cells. Six weeks after injection, right heart tissue was analyzed by immunofluorescence staining. The results showed that GFP fluorescence signal was correlated with CD4+. + T cells exhibit significant colocalization ( Figure 7 Part A of the study indicates that AAV successfully targeted and labeled CD4 in the right ventricular tissue. + T cells. To rule out the accuracy of AAV orthotopic injection, further fluorescence detection was performed on the left ventricular tissue. The results showed that no GFP fluorescence signal was observed in the left ventricular tissue. Figure 7 (Part B of the heart), the AAV virus was mainly concentrated in the RV and did not spread to other areas of the heart. This confirmed the right ventricular specificity of AAV targeting, ensuring the accuracy of subsequent experiments.

[0083] 3) After verifying the specificity of AAV, we further verified whether NLRC3 overexpression could have an effect on right heart failure in PH-LHD. TAC-induced model mice were divided into three groups: the model group (TAC), TAC plus myocardial injection of NLRC3-overexpressing AAV (TAC+AAV-Myocardial), and TAC plus tracheal infusion of NLRC3-overexpressing AAV (TAC+AAV-Tracheal). Echocardiography was used to assess cardiac function. The results showed that compared with the TAC group alone, both the myocardial injection group and the tracheal infusion group had significantly increased PAT / PET, with the tracheal infusion group showing better results. Figure 8 (Part A)); TAPSE was significantly relieved after overexpression of NLRC3, indicating enhanced RV contractile function, with orthotopic myocardial injection being more significant ( Figure 8 Part B); echocardiography also showed a significant increase in both RVEF% and LVEF%, indicating that overexpression of NLRC3 can alleviate disease progression (Part B). Figure 8 (CD section).

[0084] 4) Based on the above experimental results, further analysis of myocardial tissue pathology and molecular markers was conducted. WGA staining was used to assess the cross-sectional area of ​​cardiomyocytes. The results showed that compared with the TAC-only group, the cross-sectional area of ​​cardiomyocytes injected in situ and administered via endotracheal infusion were significantly reduced, suggesting a reduction in myocardial hypertrophy. Figure 8 The E portion). Furthermore, the mRNA expression levels of both ANP and BNP were significantly decreased in the intervention group (part E). Figure 8 (F part); among them, the myocardial in situ injection group showed more significant improvement, which may be directly related to the high-efficiency expression of local NLRC3. Further analysis of the pathological changes of myocardial fibrosis showed that Sirius red staining showed reduced collagen deposition, and at the same time, fibrosis markers were downregulated, indicating that myocardial fibrosis was alleviated ( Figure 8 The GH portion). Furthermore, RV capillary density is reduced ( Figure 8 (Part I of the study). These results collectively demonstrate that NLRC3 overexpression plays a protective role in right ventricular remodeling by alleviating myocardial hypertrophy and inhibiting pathological myocardial remodeling, thereby improving TAC-induced right ventricular dysfunction.

[0085] 5) Further overexpression of NLRC3 in the PAB-induced right ventricular remodeling model yielded results consistent with those in the TAC model (e.g., Figure 9(As shown in Figures A-E). Similarly, after AAV overexpression of NLRC3, the progression of PAB-induced right ventricular remodeling was alleviated, and right ventricular function improved, including a decrease in PAT / PET and TAPSE. Simultaneously, the expression of ANP and BNP, indicators of myocardial hypertrophy, decreased, suggesting a reduction in myocardial hypertrophy. Histopathological analysis showed a significant decrease in collagen deposition and α-SMA expression as indicated by Sirius red staining, confirming the alleviation of fibrosis. These results consistently demonstrate in both TAC and PAB models that NLRC3 improves right ventricular function by reducing myocardial remodeling and fibrosis, providing experimental evidence for its potential therapeutic target for PH-induced right ventricular remodeling.

[0086] The experimental results above demonstrate that this embodiment utilizes AAV-mediated gene overexpression technology to specifically overexpress NLRC3 in a mouse model. The NLRC3 gene was directly injected into the myocardium or administered via endotracheal infusion using an AAV vector. By overexpressing NLRC3 via AAV, the effects of NLRC3 on right ventricular function, myocardial hypertrophy, fibrosis, and vascular remodeling were systematically evaluated. Intramyocardial and intratracheal injection of AAV expressing NLRC3 reduced RV dysfunction, hypertrophy, fibrosis, and capillary density in TAC mice after 6 weeks, with slightly better results observed in intramyocardial intervention. NLRC3 overexpression significantly improved the survival rate of right ventricular failure caused by long-term induced RV maladaptation. Simultaneously, overexpression of NLRC3 in targeted T cells also had a similar effect on PAB-induced RV remodeling in mice. These findings not only provide new experimental evidence for the function of NLRC3 in right ventricular dysfunction but also provide a theoretical basis for the application of AAV-based gene therapy strategies in cardiovascular diseases.

[0087] (2) In order to further clarify NLRC3 + T reg The therapeutic effect was demonstrated by in vitro use of lentivirus overexpression of NLRC3 (NLRC3). OE ) and in 2×10 6 NLRC3 + T reg Cells were injected into TAC mice via tail vein injection. Figure 10 (Parts A to B), NLRC3 was found + T reg (NLRC3) OE T reg Cells can significantly improve RV remodeling and RV dysfunction in TAC mice. Figure 10 (C~F portion). The above results indicate that NLRC3⁺ T reg It has a protective effect on RV, can alleviate remodeling and delay functional decline, and targeted therapy on NLRC3 on T cells has potential therapeutic significance for RV remodeling diseases.

[0088] (3) In addition, the effect of the timing of NLRC3 overexpression intervention on the progression of right heart failure was investigated. NLRC3 overexpression therapy was initiated during the compensated and decompensated phases, corresponding to 6 weeks and 10 weeks after TAC, respectively. Figure 11 Part A of the study showed that intervention 6 weeks after TAC was significantly more effective than treatment during the decompensated RV remodeling phase in alleviating RV dysfunction, RV thickening, and fibrosis. Figure 11 (Parts B-D). The above results indicate that NLRC3 overexpression intervention was more effective in alleviating RV dysfunction, hypertrophy, and fibrosis 6 weeks after TAC surgery. This suggests that paying attention to and taking appropriate intervention measures during the RV compensation stage may be an important opportunity to restore RV remodeling.

[0089] As can be seen from the above examples, during the RV compensation period, high levels of NLRC3 expression can maintain T reg The cell's immunosuppressive capacity effectively inhibits Th1-mediated inflammation (e.g., IFN-γ, TNF-α) and protects myocardial integrity. However, during decompensation, decreased NLRC3 expression disrupts T cells. reg Cellular functional stability is manifested by reduced CXCR3-mediated homing to inflammatory sites and weakened control over Th1 / Th17 effector responses. This loss of immunosuppressive capacity is associated with increased markers of myocardial injury and accelerated fibrosis, both characteristic of decompensated RV failure. The results indicate that NLRC3 can maintain T... reg Normal cellular immunosuppressive function. The NLRC3-JAK2 / STAT4 axis is essential for maintaining T cells' normal immunosuppressive function. reg A key regulatory element in mediated adaptive remodeling of RV cells. By activating the STAT4 signaling pathway, NLRC3 regulates T cells by promoting T-bet⁺Foxp3⁺ cells. reg The plasticity of the NLRC3-Treg axis. The NLRC3-Treg axis emerges as a regulator of immune tolerance and inflammatory escalation during RV adaptation, contributing to the stabilization of T cells. reg Functional improvement and delaying decompensation provide a therapeutic target.

[0090] During the PAB / TAC-induced RV reconstruction process, T reg Cells are abundant and crucial for mitigating the detrimental effects of RV remodeling. Six weeks after TAC, RV T... reg Cells exhibited significant regional heterogeneity and compensatory features, which were associated with NLRC3 levels. Furthermore, NLRC3 deficiency exacerbated TAC and PAB-induced RV remodeling, leading to RV dysfunction and exhaustion. Conversely, NLRC3 overexpression in T cells... regCellular remodeling was significantly inhibited. Mechanistically, NLRC3 promotes RV T... reg Cellular immune homeostasis is maintained primarily through immunosuppression and Th1-Treg differentiation, and the progression of RV remodeling is inhibited via the JAK-STAT4 signaling pathway. In summary, in the TAC / PAB model, RV T... reg Cells exhibited significant heterogeneity and a trend of gradual failure of compensatory functions, mainly because the inactivation of the NLRC3-JAK / STAT4 pathway promoted Th1-T cells. reg Downregulation of cells weakens RVT reg Cellular immunosuppression is insufficient to halt the progression of RV remodeling. Injection of T cells carrying the NLRC3 gene... reg Treatment with cells, and with adeno-associated viruses overexpressing NLRC3, can reverse this effect and alleviate PH-induced RV remodeling. The mechanism of action described above is as follows: Figure 12 As shown.

[0091] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. The application of an agent that overexpresses NLRC3 in the preparation of a drug for treating right ventricular remodeling caused by PH.

2. The application according to claim 1, characterized in that, The reagent for overexpressing NLRC3 includes at least one of an AAV vector overexpressing NLRC3, a lentiviral vector overexpressing NLRC3, and regulatory T cells overexpressing NLRC3.

3. The application according to claim 2, characterized in that, The AAV vector is AAV Ark313, which is injected orally into the myocardium targeting CD4 in the right ventricular tissue. + T cells.

4. The application according to claim 2, characterized in that, The sequence of the NLRC3 gene includes the NLRC3 mouse gene and the NLRC3 human gene; wherein the NLRC3 mouse gene has a Gene ID of 268857 and the NLRC3 human gene has a Gene ID of 197358.

5. The application according to claim 1, characterized in that, The right ventricular remodeling caused by PH includes at least one of the RV compensatory phase and the RV decompensatory phase.

6. The application according to claim 5, characterized in that, The right ventricular remodeling caused by PH is in the RV compensation phase.

7. The application according to claim 1, characterized in that, The right ventricular remodeling is right ventricular remodeling induced by TAC and / or PAB.

8. The application according to claim 1, characterized in that, The drugs include those used to relieve right ventricular dysfunction, reduce myocardial hypertrophy, reduce myocardial fibrosis, and decrease right ventricular capillary density.

9. The application according to claim 1, characterized in that, The application involves injecting an AAV vector overexpressing NLRC3 into the myocardium in situ and / or administering it via tracheal infusion; or, adoptively transferring regulatory T cells overexpressing NLRC3 in vitro.

10. The application according to claim 9, characterized in that, The in vitro overexpressing NLRC3 regulatory T cells are regulatory T cells transfected with a lentiviral vector overexpressing NLRC3.