Use of IGF2BP2-m6A-VCAN-TLR2 signal axis in preparation of drugs for treating intrahepatic cholangiocarcinoma lymph node metastasis
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV
- Filing Date
- 2026-04-15
- Publication Date
- 2026-07-24
Smart Images

Figure CN122005811B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of tumor treatment technology, and more particularly to the use of the IGF2BP2-m6A-VCAN-TLR2 signal axis in the preparation of drugs for treating intrahepatic cholangiocarcinoma with lymph node metastasis. Background Technology
[0002] Intrahepatic cholangiocarcinoma is a highly lethal primary malignant liver tumor originating from the epithelial cells of the intrahepatic bile ducts. Elucidating the molecular regulatory mechanisms of lymph node metastasis in intrahepatic cholangiocarcinoma and developing specific intervention strategies targeting this metastatic pathway have become urgent clinical needs to improve the overall prognosis of patients with intrahepatic cholangiocarcinoma.
[0003] N6-methyladenosine (NMA) is the most abundant endogenous chemical modification of messenger RNA (MRNA) in eukaryotic cells. Its dynamic and reversible modification process is synergistically regulated by methyltransferase complexes, demethylases, and methylation recognition reading proteins. Insulin-like growth factor 2 (IGF-2) mRNA-binding protein 2 (MBP2) is an important N6-methyladenosine (NMA) reading protein identified in recent years. It can enhance the stability of target gene MRNA and promote its translation efficiency by recognizing and binding to specific N6-methyladenosine (NMA) modification sites on the MRNA molecule. Existing studies have shown that IGF-2 is abnormally highly expressed in various malignant tumors and is closely related to poor patient prognosis; however, its specific biological function and molecular mechanism in the lymph node metastasis of intrahepatic cholangiocarcinoma have not yet been systematically reported.
[0004] Pluripotent proteoglycans are large chondroitin sulfate proteoglycans found in the extracellular matrix. As structural components of the extracellular matrix, they can participate in regulating the recruitment and activation of immune cells in the tumor microenvironment. Previous literature has reported that tumor cell-derived pluripotent proteoglycans can bind to Toll-like receptor 2 on the surface of macrophages and activate downstream inflammatory signaling pathways. However, whether this signaling axis is involved in the functional remodeling and lymphangiogenesis of macrophages associated with intrahepatic cholangiocarcinoma remains unclear. Tumor-associated lymphangiogenesis (TAL) is a key initiation step in tumor lymphatic metastasis. Vascular endothelial growth factor C (VEGF-C) is the most important known pro-lymphangiogenic factor, and macrophages are the main cellular source of VDL-C in the tumor microenvironment. However, the upstream molecular events regulating the phenotypic polarization of TDL-C secretion by tumor-associated macrophages are still far from being elucidated.
[0005] Currently, drug development targeting the N6-methyladenosine modification pathway mainly focuses on methyltransferase and demethylase inhibitors, while research on small-molecule targeted drugs against methylated reading proteins such as insulin-like growth factor 2 mRNA-binding protein 2 is still in its early stages. First-line chemotherapy for intrahepatic cholangiocarcinoma primarily relies on gemcitabine combined with platinum-based drugs, but this regimen is ineffective in blocking lymphatic metastasis and often leads to acquired resistance. Therefore, there is an urgent need to discover novel molecular targets that can specifically intervene in lymphatic metastasis of intrahepatic cholangiocarcinoma and to develop targeted drug candidates and combination therapy strategies with independent intellectual property rights. Summary of the Invention
[0006] Based on the above objectives, this invention provides the use of the IGF2BP2-m6A-VCAN-TLR2 signaling axis in the preparation of a drug for treating lymph node metastasis of intrahepatic cholangiocarcinoma. The drug exerts its therapeutic or preventative effects by inhibiting the activity or expression of the IGF2BP2-m6A-VCAN-TLR2 signaling axis. The IGF2BP2-m6A-VCAN-TLR2 signaling axis refers to the biological functional pathway formed from N6-methyladenosine modification mediated by insulin-like growth factor 2 mRNA-binding protein 2 to the expression of its downstream target, pluripotent proteoglycan, and then through the binding of pluripotent proteoglycan to Toll-like receptor 2. The inhibition includes at least one of inhibiting the function or expression of insulin-like growth factor 2 mRNA-binding protein 2, inhibiting the function or expression of pluripotent proteoglycan, and inhibiting the function or expression of Toll-like receptor 2.
[0007] Preferably, the drug comprises an IGF2BP2 inhibitor, which is a substance capable of specifically inhibiting the biological function of insulin-like growth factor 2 mRNA-binding protein 2 or reducing its expression level.
[0008] Preferably, the IGF2BP2 inhibitor is a small molecule compound, which is selected from compounds 8010-8498 having the structure shown in Formula I, or pharmaceutically acceptable salts, solvates, or prodrugs thereof. Compounds 8010-8498 were obtained by using the Schrödinger software to virtually screen and dock over 1.62 million compounds, including those from the Chemdiv and TargetMol libraries, with the protein crystal structure of insulin-like growth factor 2 mRNA-binding protein 2 as the target. The screening was conducted based on binding affinity scores, the five principles of drug-likeness, polar surface area, lipid-water partition coefficient, cardiotoxicity risk, drug-metabolizing enzyme inhibition risk, and the interaction patterns with key amino acid residues Asn215, Gly202, and Thr176 in the active pocket of insulin-like growth factor 2 mRNA-binding protein 2.
[0009] Preferably, the drug further comprises at least one other active ingredient selected from chemotherapy drugs, immunotherapy drugs, or targeted therapy drugs; the chemotherapy drug is preferably one or a combination of gemcitabine, cisplatin, oxaliplatin, 5-fluorouracil, capecitabine, irinotecan, docetaxel, paclitaxel, albumin-bound paclitaxel, and tegafur; the immunotherapy drug is preferably an inhibitor of programmed death receptor 1, programmed death ligand 1, and cytotoxic T-lymphocyte-associated protein 4; the targeted therapy drug is preferably an inhibitor of fibroblast growth factor receptor, isocitrate dehydrogenase 1, isocitrate dehydrogenase 2, epidermal growth factor receptor, vascular endothelial growth factor receptor, and MET proto-oncogene receptor tyrosine kinase.
[0010] Preferably, the drug blocks the chemotactic and recruitment effects of the pluripotent proteoglycan-dependent CCL2 concentration gradient on tumor-associated macrophages by inhibiting the binding of the pluripotent proteoglycan to the chemokine CCL2.
[0011] Preferably, the drug blocks intracellular signal transduction in tumor-associated macrophages activated by inhibiting the binding of the pluripotent proteoglycan to the Toll-like receptor 2, thereby reducing the secretion levels of tumor necrosis factor-α and interleukin-6, and further reducing the expression and secretion of vascular endothelial growth factor C induced by tumor necrosis factor-α and interleukin-6, ultimately inhibiting tumor-associated lymphangiogenesis.
[0012] Preferably, the drug downregulates the protein expression level of the pluripotent proteoglycan by inhibiting the stability regulation of the pluripotent proteoglycan mRNA by N6-methyladenosine modification mediated by insulin-like growth factor 2 mRNA-binding protein 2. Specifically, insulin-like growth factor 2 mRNA-binding protein 2 recognizes and binds to the N6-methyladenosine modification site at a specific location in the 3' untranslated region of the pluripotent proteoglycan mRNA. This binding is verified by MeRIP-seq combined with transcriptome sequencing, RNA immunoprecipitation assay, and dual-luciferase reporter gene assay. The reporter plasmid used in the dual-luciferase reporter gene assay contains a wild-type sequence or a sequence with a mutated N6-methyladenosine modification site in the 3' untranslated region of the pluripotent proteoglycan mRNA.
[0013] Preferably, the drug further inhibits the epithelial-mesenchymal transition (EMT) process of intrahepatic cholangiocarcinoma cells by inhibiting the phosphatidylinositol 3-kinase / protein kinase B signaling pathway activated by the upregulation of insulin-like growth factor 2 mRNA-binding protein 2 expression, thereby reducing the migration and invasion capabilities of tumor cells. The inhibition of the EMT process is manifested by the upregulation of the epithelial marker E-cadherin and the downregulation of the mesenchymal markers N-cadherin and vimentin.
[0014] Preferably, when the drug is used to treat or prevent lymph node metastasis of intrahepatic cholangiocarcinoma, the administration method is selected from intravenous injection, arterial infusion, oral administration, subcutaneous implantation, intratumoral injection, or local sustained-release administration; the dosage form of the drug is selected from tablets, capsules, granules, injections, liposomes, nanoparticles, microspheres, or implants.
[0015] Preferably, the use also includes its application in the preparation of medicaments for the treatment or prevention of other malignant tumors with abnormal activation of the IGF2BP2-m6A-VCAN-TLR2 signaling axis and a tendency for lymphatic metastasis, including but not limited to gastric cancer, colorectal cancer, pancreatic cancer, esophageal cancer, head and neck squamous cell carcinoma, lung cancer, breast cancer, ovarian cancer, prostate cancer, bladder cancer, and melanoma; when the medicament is applied to the other malignant tumors, its efficacy and mechanism of action are determined by verifying the inhibitory effect of the medicament on the expression or activity of insulin-like growth factor 2 mRNA-binding protein 2, multipotent proteoglycans, and Toll-like receptor 2 in cell lines or animal models of such malignant tumors, as well as its effects on tumor cell proliferation, migration, invasion, epithelial-mesenchymal transition, macrophage recruitment, vascular endothelial growth factor C secretion, and lymphangiogenesis.
[0016] The beneficial effects of this invention are: 1. This invention is the first to systematically propose and validate the core role of the complete signaling axis "insulin-like growth factor 2 mRNA-binding protein 2-N6-methyladenosine-multipotent proteoglycan-Toll-like receptor 2" in driving lymphatic metastasis in intrahepatic cholangiocarcinoma. This discovery transcends previous studies that focused solely on single molecules, revealing a coherent mechanism from RNA epigenetic modification to extracellular matrix proteins, then to innate immune receptors, ultimately regulating macrophage function and lymphangiogenesis in the tumor microenvironment. This provides a novel, multi-faceted set of actionable targets for intervention in intrahepatic cholangiocarcinoma, a highly metastatic and poorly prognostic malignant tumor, and possesses significant theoretical innovation value. 2. This invention is the first to successfully design and validate a small molecule inhibitor (compounds 8010-8498) targeting the key "reader" protein of m6A modification—insulin-like growth factor 2 mRNA-binding protein 2. Unlike current mainstream research strategies targeting m6A "writers" or "erasers," this inhibitor directly blocks the biological function of insulin-like growth factor 2 mRNA-binding protein 2, effectively inhibiting downstream oncogenic signals. Preclinical studies have confirmed that this inhibitor can effectively block tumor cell epithelial-mesenchymal transition, inhibit macrophage recruitment and the secretion of lymphangiogenic factors, thereby significantly inhibiting tumor growth and lymphatic metastasis in in vitro and in vivo models, providing a novel drug development direction and candidate compounds for the treatment of intrahepatic cholangiocarcinoma. 3. The inhibitors provided by this invention can not only be used as monotherapy, but also produce synergistic effects with first-line chemotherapy regimens for intrahepatic cholangiocarcinoma (gemcitabine combined with cisplatin). When used in combination, the anti-tumor and anti-lymph node metastasis effects are significantly enhanced, providing experimental evidence for clinical combination therapy. This treatment regimen simultaneously targets the malignant behavior of tumor cells and their immune microenvironment, achieving a multi-layered synergistic intervention. Furthermore, the complete R&D system established by this invention, from virtual screening and in vitro validation to evaluation in complex animal models, along with clear synergistic drug use data, greatly accelerates the translation of this targeted therapy strategy from basic research to clinical application, demonstrating clear clinical application prospects and development value. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, those skilled in the art can obtain other drawings based on these drawings without creative effort.
[0018] Figure 1This is a scatter plot showing the expression levels of insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) messenger ribonucleic acid (mRNA) in normal and tumor tissues. The labels in the plot are explained as follows: the horizontal axis label "Normal" represents the normal tissue sample group, and "Tumour" represents the tumor tissue sample group; the vertical axis label "IGF2BP2 mRNA expression" represents the expression level of IGF2BP2 mRNA; gray dots represent data points in normal tissue samples, and red dots represent data points in tumor tissue samples.
[0019] Figure 2 and Figure 3 This is a bar chart illustrating the expression levels of IGF2BP2 mRNA in normal and tumor tissues. The labels are explained as follows: the horizontal axis “Normal” represents normal tissue, and “Tumour” represents tumor tissue; the vertical axis “IGF2BP2 mRNA expression” and its scale represent the expression level of IGF2BP2 mRNA. Figure 2 The exhibition showcases the differences between cancer patients and healthy individuals, emphasizing the pervasiveness and severity of the problem. Figure 3 It showcases the differences between each patient's tumor and their own normal tissue, emphasizing the specificity and precision of the changes.
[0020] Figure 4 This image compares immunohistochemical (IHC) staining images to demonstrate the expression of IGF2BP2 protein in normal and tumor tissues. The labels in the image are as follows: The top three images, labeled "Sample1," "Sample2," and "Sample3," represent the "Normal" group, showing the staining results of normal tissue from different samples; the bottom three images, also labeled "Sample1," "Sample2," and "Sample3," represent the staining results of tumor tissue from the corresponding samples. The differences in IGF2BP2 protein expression are shown by comparing the intensity of the colors (e.g., purple and brown areas in tumor tissue).
[0021] Figure 5 This image shows the results of Western blotting of IGF2BP2 protein expression in paired tumor and normal tissues. The labels in the image are explained as follows: the band labeled "IGF2BP2" at the top corresponds to the target protein, and the band labeled "ACTIN" at the bottom corresponds to the internal control protein; "P1" to "P10" above the bands represent 10 different patient samples; "T" below each sample represents the patient's tumor tissue, and "N" represents the patient's paired normal tissue; "65 kDa" and "42 kDa" on the right are the estimated molecular weights of IGF2BP2 and ACTIN proteins, respectively.
[0022] Figure 6 and Figure 7 This is a scatter plot showing the expression levels of IGF2BP2 protein in normal and tumor tissues of paired samples. The labels in the plot are explained as follows: the horizontal axis label "Normal" represents paired normal tissue, and "Tumor" represents paired tumor tissue; the vertical axis label "IGF2BP2 protein expression" represents the expression level of IGF2BP2 protein, and the vertical axis label "IHC Score" represents the immunohistochemical score.
[0023] Figure 8 and Figure 9 This is a Kaplan-Meier curve plot showing the survival analysis of patients grouped by IGF2BP2 mRNA expression level. The labels in the figure are explained as follows: the horizontal axis label "Time (months)" represents the follow-up time; the vertical axis label "IGF2BP2 mRNA expression" represents the survival probability; the gray curve represents the survival curve of patients in the "High" IGF2BP2 mRNA expression group, and the red curve represents the survival curve of patients in the "Low" expression group; "HR=0.17 (0.05-0.50), P=0.001" represents the hazard ratio (HR), its 95% confidence interval, and the statistical p-value, indicating the association between expression level and prognosis; the caption "HR=0.19 (0.05-0.70), P=0.013" represents the hazard ratio, confidence interval, and p-value, further validating the impact of expression level on patient survival. Figure 9 The key difference lies in the fact that they are two independent analyses based on different datasets. Their conclusions corroborate each other.
[0024] Figure 10 This is a scatter plot illustrating the correlation between IGF2BP2 expression and the expression of the lymphatic endothelial marker flatfoot protein (PDPN). The labels in the plot are explained as follows: the horizontal axis label "IGF2BP2" represents the expression value of IGF2BP2; the vertical axis label "PDPN" represents the expression value of the lymphatic marker PDPN; the blue scatter dots represent the data points of each sample; the red line is the fitted trend line, indicating a positive correlation; "Spearman R=0.211, P=0.046" indicates that Spearman correlation analysis was used, and the correlation coefficient R value was 0.211 and the P value was 0.046, indicating a statistically significant positive correlation between the two.
[0025] Figure 11This table presents a statistical analysis of the relationship between insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) expression levels and clinicopathological features of lymph node metastasis in 70 patients with intrahepatic cholangiocarcinoma (ICC). The table heading, "IGF2BP2 Levels and Clinicopathological Features in 70 ICC Patients," highlights the main subject of the study. The "Variable" indicates the clinical feature analyzed, in this case, "lymph node metastasis." The "IGF2BP2" column is divided into "Total (n=70)," "Low Expression (n=38)," and "High Expression (n=32)," representing the total number of cases and the grouping by IGF2BP2 expression level, respectively. The "P-value" indicates statistical significance. "N (%)" represents the count and percentage. "No" indicates no lymph node metastasis, and "Yes" indicates lymph node metastasis. The table data specifically shows the number of cases and percentages in each group, with a P-value of 0.008.
[0026] Figure 12 Immunohistochemical (IHC) staining images were used to compare the expression of PDPN and IGF2BP2 proteins in paired adjacent normal tissue (NAT), intrahepatic cholangiocarcinoma tissue without lymph node metastasis (LN(-)ICC), and intrahepatic cholangiocarcinoma tissue with lymph node metastasis (LN(+)ICC). The labels at the top of the images are explained as follows: "NAT", "LN(-)ICC", and "LN(+)ICC" represent three different tissue types; the left vertical axis shows PDPN staining results, and the right vertical axis shows IGF2BP2 staining results. PDPN (flatfoot protein) is a marker of lymphatic endothelial cells; IGF2BP2 (insulin-like growth factor 2 mRNA-binding protein 2) is the core protein of this study.
[0027] Figure 13 This is a Venn diagram used for screening potential downstream target genes of IGF2BP2. Explanation of labels: Blue ellipses represent the "significant genes" group; red ellipses represent the "RBP" group (RNA-binding protein group).
[0028] Figure 14 This is a heatmap illustrating differentially expressed genes after IGF2BP2 knockdown. The labels in the heatmap are explained as follows: The Y-axis lists the names of the differentially expressed genes; the X-axis labels the sample groups. The blue section "shIGF2BP2" represents the knockdown group transfected with short hairpin RNA (shRNA) targeting IGF2BP2, containing three replicates (shIGF2BP23, shIGF2BP21, shIGF2BP22); the red section "VEC" represents the negative control group transfected with an empty vector, containing three replicates (VEC3, VEC1, VEC2). The color bars on the right (-1 to 1.5) represent the standardized Z-score of gene expression levels relative to the mean.
[0029] Figure 15 This figure shows the experimental results of verifying the interaction between IGF2BP2 protein and VCAN mRNA using RNA immunoprecipitation (RIP) combined with Western blotting. The symbols in the figure are explained as follows: "Anti-IgG" represents the negative control group using non-specific immunoglobulin G antibody; "Anti-VCAN" represents the experimental group using anti-VCAN antibody for immunoprecipitation; "p-cDNA3.1" represents the control group transfected with an empty vector plasmid; "p-VCAN" represents the experimental group transfected with a VCAN overexpression plasmid. "IP" represents the immunoprecipitation product; "Input" represents the total protein sample input; "IB:IGF2BP2" indicates detection using anti-IGF2BP2 antibody via Western blotting; "IB:GAPDH" indicates detection of the internal control protein using anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibody.
[0030] Figure 16 This is a scatter plot bar chart illustrating the differences in VCAN gene mRNA expression between normal and tumor tissues from multiple public databases. The labels in the chart are explained as follows: the horizontal axis "normal" represents the normal tissue group, and "Tumor" represents the tumor tissue group; the vertical axis "VCAN mRNA expression" represents the expression level of VCAN messenger ribonucleic acid.
[0031] Figure 17 To illustrate the effect of IGF2BP2 knockdown or overexpression on the mRNA expression level of the downstream gene VCAN using bar charts. The labels in the charts are explained as follows: In the left subplot, the X-axis "NC" represents the negative control group, and "shIGF2BP2" represents the IGF2BP2 knockdown group; in the right subplot, the X-axis "NC" represents the negative control group, and "oeIGF2BP2" represents the IGF2BP2 overexpression group. Both charts have "VCAN mRNA expression" on the Y-axis, and each subplot represents an independent public gene expression database.
[0032] Figure 18 To demonstrate the effect of IGF2BP2 knockdown on VCAN mRNA stability using a CHX (actinomycin C) tracking experiment. Figure labels are explained as follows: X-axis "Time (hours)" represents the treatment time after adding the protein synthesis inhibitor CHX; Y-axis "VCAN mRNA percentage (%)" represents the relative VCAN mRNA content relative to time 0. "Vector" represents the control group transfected with an empty vector, and "shIGF2BP2" represents the IGF2BP2 knockdown group.
[0033] Figure 19To demonstrate the effect of IGF2BP2 overexpression on VCAN mRNA stability using a CHX (actinomycin C) tracking assay. Figure labels are explained as follows: X-axis "Time (hours)" represents CHX treatment time; Y-axis "VCAN mRNA percentage (%)" represents the relative content of VCAN mRNA. "NC" represents the negative control group, and "oeIGF2BP2" represents the IGF2BP2 overexpression group.
[0034] Figure 20 This diagram illustrates the predicted m6A modification sites on the VCAN mRNA sequence. The labels in the diagram are explained as follows: "Predicted modification site" means "predicted modification site." "UUUACUGAAACUGAACUCAAAAACCACAGAU" is a nucleotide sequence of the VCAN mRNA. The numbers "6719," "6733," and "6748" below the sequence indicate the reference position of this sequence in the transcript.
[0035] Figure 21 This diagram illustrates the effects of different conditioned medium (CM) and co-culture with macrophages (Mø) on the morphology and number of human umbilical vein endothelial cells. The labels in the diagram are explained as follows: "Vector-CM" represents conditioned medium prepared using tumor cells transfected with an empty vector (Vector); "IGF2BP2-CM" represents conditioned medium prepared using tumor cells overexpressing IGF2BP2; and "Mø" represents macrophages.
[0036] Figure 22 A bar chart quantifying the ability of HUVEC cells to form tubular structures under different treatment conditions. The labels in the chart are explained as follows: "Vector-CM" represents conditioned medium prepared using tumor cells transfected with an empty vector (Vector); "IGF2BP2-CM" represents conditioned medium prepared using tumor cells overexpressing IGF2BP2; and "Mø" represents macrophages.
[0037] Figure 23 This is a bar chart quantifying the number of cells migrating under different treatment conditions. The labels in the chart are explained as follows: "Vector-CM" represents conditioned medium prepared using tumor cells transfected with an empty vector (Vector); "IGF2BP2-CM" represents conditioned medium prepared using tumor cells overexpressing IGF2BP2; and "Mø" represents macrophages.
[0038] Figure 24This scatter plot illustrates the correlation between Toll-like receptor 2 (TLR2) and multipotent proteoglycan (VCAN) expression levels in intrahepatic cholangiocarcinoma tissue. The figure's labels, "Spearman R = 0.359 P < 0.001," indicate that Spearman rank correlation analysis yielded a correlation coefficient R of 0.359 and a P value less than 0.001, demonstrating a significant positive correlation between TLR2 and VCAN.
[0039] Figure 25 A scatter plot was used to show the correlation between the expression levels of VCAN and the lymphatic endothelial marker flatfoot protein (PDPN) in intrahepatic cholangiocarcinoma tissue. "Spearman R=0.567 P<0.001" indicates a significant and strong positive correlation between VCAN and PDPN expression.
[0040] Figure 26 A scatter plot was used to illustrate the correlation between TLR2 and the expression levels of the lymphatic endothelial marker PDPN in intrahepatic cholangiocarcinoma tissue. The figure's labels are explained as follows: "Spearman R = 0.521 P < 0.001", indicating a significant positive correlation between TLR2 and PDPN expression.
[0041] Figure 27 This is a scatter plot showing the relationship between the molecular weight (MW) of a compound and its docking score with the target protein during the virtual screening process. The labels in the plot are explained as follows: The horizontal axis is labeled "MW," representing molecular weight in Daltons (Da). The vertical axis is labeled "docking_score," representing the binding score calculated by the molecular docking simulation (a larger negative value indicates a theoretically stronger binding affinity).
[0042] Figure 28 Here is another scatter plot showing the relationship between the compound's molecular weight (MW) and docking score. The labels in the plot are explained as follows: the horizontal axis represents "MW" (molecular weight), and the vertical axis represents "docking score".
[0043] Figure 29 This is a bar chart showing the frequency distribution of predicted inhibitory activity (pIC50) of compounds obtained from virtual screening against the cytochrome P450 2C9 isoenzyme (2C9). The labels in the chart are explained as follows: The horizontal axis is labeled "2C9 pIC50," where "pIC50" is the negative logarithm of the IC50 value (-log10(IC50)), with a larger value indicating stronger predicted inhibitory activity. The vertical axis is labeled "Count," representing the number of compounds falling within each pIC50 value range.
[0044] Figure 30 This is a bar chart illustrating the classification of compounds obtained from virtual screening in a human intestinal absorption (HIA) prediction model. The labels in the chart are explained as follows: The horizontal axis is labeled "HIA category," where "HIA" represents Human Intestinal Absorption. A "+" category predicts readily absorbed compounds, and a "-" category predicts poorly absorbed compounds. The vertical axis is labeled "Count," representing the number of compounds, with a scale range of 0-400. The red bars correspond to the "+" category, with a height of approximately 360, indicating the number of compounds predicted as readily absorbed; the blue bars correspond to the "-" category, with a height of approximately 80, indicating the number of compounds predicted as poorly absorbed compounds.
[0045] Figure 31 This is a combined bar chart to display the distribution of predicted lipid-water partition coefficients (logP) and solubilities (logS) of compounds obtained from virtual screening. The labels in the chart are explained as follows: The left subplot's horizontal axis is labeled "logP," representing the logarithmic value of the partition coefficient of the compound in both n-octanol and water; the vertical axis is labeled "Count," representing the number of compounds within each logP value range, with a maximum scale of 100. The right subplot's horizontal axis is labeled "logS," representing the logarithmic value of the compound's solubility in water; the vertical axis is also labeled "Count."
[0046] Figure 32 This bar chart illustrates the predicted affinity classification of compounds obtained from virtual screening for cytochrome P450 2D6 isoenzyme (CYP2D6). The labels in the chart are explained as follows: The horizontal axis is labeled "2D6 affinity category," where "2D6" refers to cytochrome P450 2D6 enzyme, an important drug-metabolizing enzyme; "affinity category" indicates the predicted affinity level, categorized into four levels: "low," "medium," "high," and "very high." The vertical axis is labeled "Count," representing the number of compounds.
[0047] Figure 33 This is a bar chart showing the frequency distribution of predicted inhibitory activity (pIC50) of compounds obtained from virtual screening for potassium channels in the human ether-à-go-go related gene (hERG). The labels in the chart are explained as follows: the horizontal axis is labeled "hERG pIC50," where "hERG" refers to the potassium channel encoded by the human ether-à-go-go related gene, a key target for assessing drug cardiac safety; and "pIC50" is the negative logarithm of the half-maximal inhibitory concentration (IC50) value (-log10(IC50)), with a higher value indicating stronger predicted inhibitory activity.
[0048] Figure 34 This is another set of bar charts showing the distribution of predicted logP and logS values for the virtual screened compounds. The labels in the charts are explained as follows: The left subplot's horizontal axis is "logP"; the vertical axis is "Count". The right subplot's horizontal axis is "logS"; the vertical axis is "Count".
[0049] Figure 35 This diagram illustrates the coverage analysis of the frequency or intensity of interactions between residues in different regions of the protein sequence and the ligands in the molecular docking results between the candidate compound (8010-8498) and the target protein (IGF2BP2).
[0050] Figure 36 This is a protein-ligand interaction site coverage analysis map from another perspective, focusing on different sets of key residues. This map is related to... Figure 35 They complement each other, jointly defining the binding pocket of the ligand.
[0051] Figure 37 This diagram illustrates the three-dimensional and two-dimensional interactions between candidate compound 8010-8498 and the active pocket binding mode of target protein IGF2BP2.
[0052] Figure 38 This diagram illustrates the effects of different compound treatments on the proliferation kinetics of two types of intrahepatic cholangiocarcinoma cells (RBE and HuccT1) using real-time label-free cell analysis (RTCA). The diagram contains two sub-plots, corresponding to RBE cells (left) and HuccT1 cells (right), respectively. Both plots use time (hours) as the horizontal axis and cell index as the vertical axis, reflecting the number, morphology, and adhesion strength of adherent cells.
[0053] Figure 39 This bar chart quantitatively illustrates the inhibitory effects of different compound treatments on the migration ability of RBE and HuccT1 intrahepatic cholangiocarcinoma cells using a transwell assay. The chart contains two sub-charts, showing the experimental results for RBE cells (left) and HuccT1 cells (right), respectively. Detailed Implementation
[0054] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. It should also be noted that, to make the embodiments more comprehensive, the following embodiments are the best and preferred embodiments, and those skilled in the art can use other alternative methods to implement some well-known technologies; moreover, the accompanying drawings are only for more specific description of the embodiments and are not intended to specifically limit the present invention.
[0055] Before detailing the specific embodiments of the present invention, we first systematically describe the preliminary experimental evidence supporting the technical solution of the present invention—namely, the "IGF2BP2-m6A-VCAN-TLR2 signal axis" as a therapeutic target and the effectiveness of the small molecule inhibitor 8010-8498. This evidence has been obtained through... Figures 1-12 , Figures 13-20 , Figures 21-26 , Figures 27-39 This complete presentation forms the core theoretical basis and preliminary evidence for the effects proposed in this invention.
[0056] Please see Figure 1-39 , Figures 1-12 The study demonstrates the dual value of IGF2BP2 as a therapeutic target for intrahepatic cholangiocarcinoma (ICC). Specific data show that: (a) IGF2BP2 mRNA was significantly upregulated in ICC tissues in TCGA, GEO, and our team's WMU databases; (b) at the protein level, Western blot and immunohistochemistry (IHC) confirmed that IGF2BP2 expression in ICC tissues was significantly higher than in adjacent normal tissues; (c) survival analysis showed that ICC patients with high IGF2BP2 expression had significantly shorter overall survival, an independent adverse prognostic factor; (d) crucially, clinicopathological analysis showed that high IGF2BP2 expression was significantly associated with lymph node metastasis, and IHC confirmed that IGF2BP2 expression was even higher in cancer tissues with lymph node metastasis. Furthermore, IGF2BP2 expression was positively correlated with the expression of the lymphatic marker PDPN. These data collectively confirm that IGF2BP2 is a key molecule driving ICC progression and lymph node metastasis, providing sufficient evidence for its potential as a therapeutic target.
[0057] Figures 13-20This study revealed the specific molecular mechanism by which IGF2BP2 regulates downstream targets through m6A modification. The results showed that: (a) multipotent proteoglycans (VCANs) were identified as potential downstream targets of IGF2BP2 through transcriptome sequencing combined with the POSTAR2 and m6A2target databases; (b) RNA immunoprecipitation (RIP) directly confirmed the binding of IGF2BP2 protein to VCAN mRNA in 293T cells; (c) knockdown or overexpression of IGF2BP2 in ICC cell lines downregulated or upregulated VCAN protein and mRNA levels accordingly; (d) CHX (a cyclohexane-D) tracking experiments demonstrated that knockdown of IGF2BP2 reduced the stability of VCAN mRNA, while overexpression increased its stability, suggesting that IGF2BP2 maintains VCAN expression as an RNA-binding protein; and (e) bioinformatics predicted potential m6A modification sites on VCAN mRNA. This evidence fully confirms the upstream signaling step that "IGF2BP2 stabilizes and upregulates VCAN mRNA by recognizing m6A modifications".
[0058] Figures 21-26 This study elucidates how this signaling axis influences the tumor microenvironment and promotes lymphangiogenesis. Key findings include: (a) Functional experiments showed that conditioned medium overexpressing IGF2BP2 did not directly promote lymphatic endothelial cell tube formation, but the lymphangiogenic effect was significantly enhanced upon the addition of macrophages, indicating that its action depends on tumor-associated macrophages; (b) Tissue staining using the macrophage marker F4 / 80 revealed a positive correlation between IGF2BP2 high expression regions and macrophage infiltration intensity; (c) Bioinformatics analysis showed a significant positive correlation between VCAN expression and its receptor TLR2 expression in ICC tissues; (d) Further analysis confirmed that both VCAN and TLR2 expression were significantly positively correlated with the lymphangiogenic marker PDPN expression. These results closely link the "VCAN-TLR2" axis to macrophage recruitment, activation, and subsequent lymphangiogenesis, revealing a complete downstream pathway from tumor cells to the immune microenvironment, ultimately driving lymphatic metastasis.
[0059] Figures 27-39This study demonstrates the process of developing specific therapeutic drugs based on the aforementioned targets. Through computer-aided drug design, lead compounds were successfully obtained: (a) Virtual screening and molecular docking were performed on 1.62 million compounds, including those from the Chemdiv and TargetMol libraries, targeting the IGF2BP2 protein structure; (b) After multiple rounds of screening based on binding affinity scoring, the five principles of drug-likeness, and polar surface area, candidate molecules were narrowed down from a vast pool of compounds; (c) Interaction mode analysis showed that the finally selected compound 8010-8498 can form stable hydrogen bonds and other interactions with key amino acid residues Asn215, Gly202, and Thr176 in the IGF2BP2 active pocket; (d) Preliminary in vitro cell experiments verified that compound 8010-8498 can effectively inhibit the proliferation and migration of ICC cells (RTCA experiment). This work not only validates the feasibility of targeting IGF2BP2 but also provides specific evidence of the discovery pathway, binding mechanism, and in vitro activity of the inhibitor 8010-8498 described in this invention.
[0060] This invention provides the use of the IGF2BP2-m6A-VCAN-TLR2 signaling axis in the preparation of drugs for treating intrahepatic cholangiocarcinoma lymph node metastasis, specifically the use of the insulin-like growth factor 2 mRNA-binding protein 2-N6-methyladenosine-multipotent proteoglycan-Toll-like receptor 2 signaling axis as a target in the preparation of drugs for treating or preventing intrahepatic cholangiocarcinoma lymph node metastasis. The core of this invention is to provide a small molecule inhibitor that targets this signaling axis, particularly insulin-like growth factor 2 mRNA-binding protein 2, and to elucidate its preparation method, mechanism of action, and efficacy in combating intrahepatic cholangiocarcinoma lymph node metastasis.
[0061] I. Virtual Screening and Discovery of Insulin-like Growth Factor 2 mRNA-binding protein 2 Inhibitors To obtain small molecule inhibitors targeting insulin-like growth factor 2 mRNA-binding protein 2, we employed a structure-based virtual screening strategy, the specific steps of which are as follows: 1. Preparation of target protein structure: The crystal structure of human insulin-like growth factor 2 mRNA-binding protein 2 was obtained from a protein database, or its three-dimensional structure was constructed through homology modeling. The protein structure was preprocessed using the Protein Preparation Wizard module in the Schrödinger software package, including completing missing side chain atoms, optimizing the hydrogen bond network, correcting unreasonable amino acid conformations, and assigning appropriate force field parameters. Subsequently, the protein structure was optimized using molecular dynamics simulations or energy minimization methods to obtain a stable conformation for subsequent docking.
[0062] 2. Combining pocket analysis and definition: The SiteMap module in Schrödinger software was used to analyze potential small molecule binding pockets on the surface of insulin-like growth factor 2 mRNA-binding protein 2. Combining known RNA-binding domain and key functional region information, and considering parameters such as scoring, hydrophobicity, hydrophilicity, and volume, an optimal potential inhibitory site located near the RNA-binding domain and rich in polar amino acid residues such as asparagine 215, glycine 202, and threonine 176 was identified as the target region for virtual screening.
[0063] 3. Compound library preparation: By integrating the Chemdiv and TargetMol commercial compound libraries, an initial database containing over 1.62 million structurally diverse small molecule compounds was obtained. All compounds were preprocessed using the LigPrep module, including generating possible ionization states, tautomers, and stereoisomers, and performing energy minimization to generate three-dimensional structures suitable for molecular docking.
[0064] 4. High-throughput virtual screening and molecular docking: High-throughput virtual screening was performed using the Glide module in Schrödinger software. First, standard-precision docking was performed, connecting over 1.62 million pre-processed compounds to a defined insulin-like growth factor 2 mRNA-binding protein 2 binding pocket. Preliminary ranking was based on GlideScore docking scores, selecting the top 1% (approximately 16,000 compounds) to proceed to the next round of screening.
[0065] 5. Detailed matching and further screening: The approximately 16,000 compounds obtained from the initial screening were subjected to high-precision docking in Extra Precision mode to obtain more accurate binding conformations and binding free energies. Based on the high-precision docking scores and key molecular interaction modes such as hydrogen bonds, π-π stacking, and hydrophobic interactions formed between the compounds and key amino acid residues asparagine 215, glycine 202, and threonine 176, approximately 1,000 candidate compounds with excellent binding modes were screened.
[0066] 6. Drug-likeness and drug-likeness assessment: Rigorous drug-likeness and druggability assessments were conducted on approximately 1000 candidate compounds. Compounds meeting the following criteria were calculated and screened: conforming to Lipinski's five principles for drug-likeness, namely, molecular weight less than 500 Daltons, lipid-water partition coefficient LogP less than 5, number of hydrogen bond donors less than 5, number of hydrogen bond acceptors less than 10; polar surface area within a reasonable range; predicted good water solubility; no potential hERG potassium channel inhibition cardiotoxicity; and no strong inhibitory risk on major cytochrome P450 enzymes. This step yielded approximately 200 candidate compounds with good druggability potential.
[0067] 7. Interaction mode analysis and selection of final candidate compounds: Using the Protein-Ligand Interaction Fingerprints method in Schrödinger software, we conducted in-depth analysis of the interaction fingerprints between approximately 200 candidate compounds and the insulin-like growth factor 2 mRNA-binding protein 2 binding pocket. We focused on compounds that formed stable interactions with key residues such as asparagine 215, glycine 202, and threonine 176. Considering the novelty of the binding mode, structural diversity, and synthetic feasibility, a compound designated 8010-8498 was ultimately selected as the primary candidate inhibitor. Molecular simulations showed that the phenylpropionylpyrrole ring of compound 8010-8498 forms an aromatic ring-hydrogen bond interaction with asparagine 215, while the amino group in the molecule forms a hydrogen bond with glycine 202, and the carbonyl group forms a hydrogen bond with threonine 176, exhibiting highly complementary binding characteristics.
[0068] II. In vitro experimental verification of the anti-lymphatic metastasis effect of insulin-like growth factor 2 mRNA-binding protein 2 inhibitor 8010-8498 on intrahepatic cholangiocarcinoma. 1. Cell culture and treatment: Human intrahepatic cholangiocarcinoma cell lines HuccT1 and RBE were purchased from the American Type Culture Collection and cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin antibiotics at 37°C and 5% carbon dioxide. Compound 8010-8498 was dissolved in dimethyl sulfoxide to prepare a stock solution, which was then diluted to the required concentration with serum-free medium before experiments. Control cells were treated with an equal volume of dimethyl sulfoxide.
[0069] 2. Cell proliferation and colony formation experiments: Cell proliferation was detected using real-time label-free cell analysis. HuccT1 or RBE cells were seeded in E-Plate microplates, and after adhesion, different concentrations of compound 8010-8498 were added, with continuous monitoring of cell index changes. Results showed that compound 8010-8498 significantly inhibited the proliferation of HuccT1 and RBE cells in a dose-dependent manner, with half-maximal inhibitory concentrations (IC50) of 5.2 μmol / L and 6.8 μmol / L, respectively.
[0070] Colony formation assay: Single-cell suspensions were seeded into six-well plates. After adhesion, different concentrations of compound 8010-8498 were added. The drug-containing medium was changed every 3 days. After culturing for 10-14 days, the cells were fixed with methanol, stained with Giemsa, and the number of colonies with more than 50 cells was counted. The results showed that, compared with the control group, the colony formation ability of cells treated with compound 8010-8498 was significantly reduced.
[0071] 3. Cell migration and invasion experiments: Migration assays were performed using Transwell chambers, while invasion assays were performed by pre-coating the polycarbonate membrane of the Transwell chamber with Matrigel to simulate the extracellular matrix. HuccT1 or RBE cells suspended in serum-free medium were seeded in the upper chamber, while the lower chamber contained medium with 10% fetal bovine serum as a chemotactic agent, along with different concentrations of compound 8010-8498. After culturing for 24-48 hours, unmigrated cells in the upper chamber were wiped off with cotton swabs, and cells on the bottom surface of the lower chamber membrane were fixed with methanol, stained with crystal violet, and counted under a microscope in five randomly selected fields. The experiment was repeated three times. The results showed that treatment with compound 8010-8498 significantly reduced the number of cells penetrating the membrane, indicating its effective inhibition of the migration and invasion of intrahepatic cholangiocarcinoma cells.
[0072] 4. Detection of biomarkers related to epithelial-mesenchymal transition: To investigate the effect of compound 8010-8498 on epithelial-mesenchymal transition (EMT), HuccT1 cells were treated with different concentrations of compound 8010-8498 for 48 hours, and total protein was extracted. The expression levels of epithelial markers E-cadherin, mesenchymal markers N-cadherin, and vimentin were detected using Western blotting. The results showed that, compared with the control group, E-cadherin expression was upregulated in cells treated with compound 8010-8498, while N-cadherin and vimentin expression were downregulated, indicating that compound 8010-8498 can reverse the EMT process in intrahepatic cholangiocarcinoma cells.
[0073] 5. Macrophage co-culture system to verify the regulatory effect of drugs on the tumor microenvironment: Monocytes were isolated from peripheral blood of healthy volunteers and induced to differentiate into M0 macrophages using RPMI 1640 medium containing 100 ng / mL macrophage colony-stimulating factor.
[0074] Establish a co-culture system: HuccT1 cells pretreated with compound 8010-8498 or control dimethyl sulfoxide for 24 hours were seeded in the lower chamber of Transwell, and differentiated macrophages were seeded in the upper chamber. The cells were co-cultured for 48 hours.
[0075] Chemotaxis assay: After co-culture, the number of macrophages that migrated to the bottom of the lower chamber membrane was counted. The results showed that, compared with the control group, pretreatment of tumor cells with compound 8010-8498 significantly reduced the number of migrating macrophages.
[0076] Enzyme-linked immunosorbent assay (ELISA) was used to detect cytokines: The supernatant of the co-culture system was collected, and the concentrations of vascular endothelial growth factor C (VEGF-C), tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) were detected using an ELISA kit. The results showed that the concentrations of VEGF-C, TNF-α, and IL-6 in the supernatant of the compound 8010-8498 treatment group were significantly lower than those in the control group. This result confirms that compound 8010-8498 indirectly inhibits the recruitment of tumor-associated macrophages and the secretion of lymphangiogenic factors by acting on tumor cells.
[0077] III. In vivo experiments verify the anti-lymphatic metastasis effect of insulin-like growth factor 2 mRNA-binding protein 2 inhibitor 8010-8498 on intrahepatic cholangiocarcinoma. 1. Nude mouse popliteal lymph node metastasis model: Female BALB / c nude mice aged 4-6 weeks were randomly divided into a control group, a low-dose group (compound 8010-8498), and a high-dose group (compound 8010-8498). All mice were subcutaneously injected with a suspension of RBE cholangiocarcinoma cells stably overexpressing insulin-like growth factor 2 mRNA-binding protein 2 in their hind paw pads. One week after inoculation, drug administration began. The control group received an intraperitoneal injection of the solvent, while the low- and high-dose groups received intraperitoneal injections of 20 mg / kg body weight and 40 mg / kg body weight of compound 8010-8498, respectively, three times a week. Tumor volume at the primary site was measured periodically. Six weeks after inoculation, mice were sacrificed, and the popliteal lymph nodes were dissected, weighed, and the primary tumor and metastatic lymph node tissues were collected for histological analysis.
[0078] Results: Compared with the control group, the growth rate of primary tumors in mice treated with compound 8010-8498 was slowed, and the final tumor weight was significantly reduced. More importantly, the incidence of metastasis and the weight of metastatic lymph nodes in the popliteal fossa of mice treated with compound 8010-8498 were significantly lower than those in the control group. Hematoxylin-eosin staining and immunohistochemical staining for the lymphatic endothelial marker placopoietin showed that the density of lymphatic vessels in and around the tumor tissue in the compound 8010-8498 treatment group was significantly reduced.
[0079] 2. Sleeping Beauty transposon system-mediated spontaneous intrahepatic cholangiocarcinoma model in mice: Transgenic mice exhibiting liver-specific overexpression of insulin-like growth factor 2 mRNA-binding protein 2 were constructed. Spontaneous intrahepatic cholangiocarcinoma was induced in transgenic mice and littermate wild-type control mice by hydrodynamic tail vein injection of a plasmid mixture containing the Sleeping Beauty transposon, the oncogene KRAS, and p19 shRNA. Transgenic mice were randomly assigned to a model control group, a compound 8010-8498 treatment group, a gemcitabine combined with cisplatin chemotherapy group, and a compound 8010-8498 combined with gemcitabine and cisplatin treatment group. Treatment began after tumor formation and lasted for 4 weeks. After treatment, mice were sacrificed, livers were harvested, weighed, and tumor burden was calculated. Peritoneal and distant lymph node metastases were observed, and liver tissue was pathologically evaluated.
[0080] Results: Monotherapy with compound 8010-8498 significantly reduced liver tumor burden and peritoneal lymph node metastasis in transgenic mice. Western blot analysis of tumor tissues showed decreased expression levels of pluripotent proteoglycans, Toll-like receptor 2, and phosphorylated protein kinase B, while increased expression of E-cadherin was observed in the treated tumor tissues.
[0081] IV. Synergistic effect of insulin-like growth factor 2 mRNA-binding protein 2 inhibitor 8010-8498 with chemotherapy drugs To evaluate the combined efficacy of compound 8010-8498 with first-line clinical chemotherapy regimens, we conducted in vitro and in vivo synergistic experiments.
[0082] 1. In vitro synergistic effect: The inhibitory effect of compound 8010-8498, alone or in combination with gemcitabine or cisplatin, on the proliferation of HuccT1 cells was detected using the CCK-8 assay. The combination index was calculated using CompuSyn software. A combination index less than 1 indicated a synergistic effect. The results showed that compound 8010-8498, in combination with gemcitabine or cisplatin, exhibited a synergistic inhibitory effect on the proliferation of intrahepatic cholangiocarcinoma cells at multiple concentration ratios, with a combination index ranging from 0.3 to 0.8.
[0083] 2. In vivo synergistic effect: In nude mouse models of popliteal lymph node metastasis or spontaneous cholangiocarcinoma, three treatment groups were established: a monotherapy group using compound 8010-8498, a group receiving gemcitabine combined with cisplatin chemotherapy, and a three-drug group using compound 8010-8498 combined with gemcitabine and cisplatin. Results showed that compared to either monotherapy or two-drug chemotherapy, the three-drug combination therapy more effectively inhibited primary tumor growth, almost completely blocked popliteal lymph node metastasis, and was well-tolerated by mice, with no significant weight loss or increased toxicity. Molecular analysis of tumor tissues revealed that the three-drug combination group exhibited the most significant regulatory effects on the downstream signaling pathway of insulin-like growth factor 2 mRNA-binding protein 2 and epithelial-mesenchymal transition markers.
[0084] In summary, the insulin-like growth factor 2 mRNA-binding protein 2 inhibitor compound 8010-8498 provided by this invention, discovered through virtual screening and confirmed by in vitro and in vivo experiments, can effectively inhibit the malignant biological behavior of intrahepatic cholangiocarcinoma cells, regulate the tumor immune microenvironment, and inhibit lymphangiogenesis, thereby exerting an anti-lymphatic metastasis effect. Furthermore, it has a synergistic effect with existing chemotherapy drugs, providing a new candidate drug and combination therapy for the treatment of intrahepatic cholangiocarcinoma lymphatic metastasis.
[0085] Example 1: Preparation and Identification of Insulin-like Growth Factor 2 mRNA-binding protein 2 Inhibitor 8010-8498 1.1 Chemical Synthesis Compound 8010-8498, based on its determined chemical structure (its structural characterization data is a trade secret and will not be disclosed here), was chemically synthesized by a professional custom compound synthesis company. The synthetic route employed classic organic reaction steps, including but not limited to Suzuki coupling, Buchwald-Hartwig amination, and amide condensation. The final product was purified by column chromatography to obtain a pale yellow solid powder.
[0086] 1.2 Structural Characterization and Purity Analysis The structure of the synthesized product was confirmed by 1H NMR, 1C NMR, and high-resolution mass spectrometry. All spectral data were consistent with the theoretical structure of the target compound 8010-8498. The purity of the compound was analyzed by high-performance liquid chromatography (HPLC) under the following conditions: an Agilent ZORBAX SB-C18 column; a gradient elution of acetonitrile-water (containing 0.1% formic acid) as the mobile phase; a flow rate of 1.0 mL / min; and a detection wavelength of 254 nm. The analytical results showed that the chromatographic purity of compound 8010-8498 was greater than 98.0%, meeting the requirements for biological experiments.
[0087] 1.3 Preparation and storage of stock solutions Accurately weigh 10.0 mg of compound 8010-8498 powder and dissolve it in 1.0 mL of high-purity dimethyl sulfoxide to prepare a stock solution with a concentration of 10 mg / mL (approximately 20 mmol / L). Filter the stock solution through a sterile membrane with a pore size of 0.22 μm, aliquot it into sterile centrifuge tubes, and store it at -20°C protected from light for later use. All working solutions used in in vitro and in vivo experiments are prepared by diluting this stock solution with the appropriate culture medium or physiological saline.
[0088] Example 2: Effect of in vitro inhibition of cholangiocarcinoma cell migration and epithelial-mesenchymal transition 2.1 Cell Culture and Treatment Human intrahepatic cholangiocarcinoma cell lines HuccT1 (highly expressing insulin-like growth factor 2 mRNA-binding protein 2) and RBE (lowly expressing insulin-like growth factor 2 mRNA-binding protein 2) were purchased from the American Type Culture Collection. Cells were cultured in Durbeco modified Eagle medium containing 10% fetal bovine serum, 100 units / mL penicillin, and 100 μg / mL streptomycin, and incubated at 37°C with 5% CO2. For experiments, cells in the logarithmic growth phase were digested with 0.25% trypsin to prepare single-cell suspensions.
[0089] 2.2 Cell scratch healing experiment HuccT1 cells were distributed per well Cells were seeded at a density of [number] cells per well in 6-well plates and cultured until a dense monolayer formed. A straight, vertical scratch was made on the monolayer using a 200 μL sterile pipette tip, and the cells were gently washed away with phosphate-buffered saline (PBSS) to remove any detached cells. The medium was then replaced with culture medium containing different concentrations of compound 8010-8498 (0 μmol / L, 2.5 μmol / L, 5.0 μmol / L, and 10.0 μmol / L) and 1% fetal bovine serum. Images were taken at the same location under an inverted microscope at 0, 24, and 48 hours post-scratching. The scratch area was measured using ImageJ software, and the scratch healing rate was calculated.
[0090] Results: As shown in Table 1, compound 8010-8498 significantly inhibited the scratch healing ability of HuccT1 cells in a concentration-dependent manner.
[0091] Table 1: Inhibitory effect of compound 8010-8498 on scratch healing of HuccT1 cells Note: Data are mean ± standard deviation, n=3; *P<0.05, **P<0.01, compared with the 0 μmol / L group.
[0092] 2.3 Transwell Invasion Experiment The upper chamber membrane of the Transwell chamber (8-micron pore size) was pre-coated with 50 μL of 1:8 diluted Matrigel (BD Biosciences, USA) and cured at 37°C for 2 hours. HuccT1 cells (containing different concentrations of compound 8010-8498) suspended in serum-free medium were seeded into the upper chamber (per chamber). (100 cells), and culture medium containing 10% fetal bovine serum was added to the lower chamber as a chemotactic source. After culturing for 24 hours, uninvaded cells in the upper chamber were wiped off with a cotton swab, and cells on the bottom surface of the lower chamber membrane were fixed with methanol, stained with 0.1% crystal violet for 30 minutes, and the number of cells in 5 random fields of view were counted under a microscope.
[0093] Results: As shown in Table 2, compound 8010-8498 significantly inhibited the invasive ability of HuccT1 cells.
[0094] Table 2: Inhibitory effect of compound 8010-8498 on HuccT1 cell invasion 2.4 Detection of epithelial-mesenchymal transition markers HuccT1 cells were seeded in 6-well plates. When the cell density reached 60%-70%, the medium was replaced with complete medium containing 0 or 5.0 μmol / L of compound 8010-8498 and treated for 48 hours. Cells were collected, and total protein was extracted using RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors. Protein concentration was determined using the BCA method. An equal volume of protein was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane. After blocking with 5% skim milk, the membrane was incubated overnight at 4°C with anti-E-cadherin antibody, anti-N-cadherin antibody, anti-vimentin antibody, and anti-glyceraldehyde-3-phosphate dehydrogenase antibody, respectively. After washing, the membrane was incubated at room temperature for 1 hour with horseradish peroxidase-labeled secondary antibody. The membrane was then developed using an enhanced chemiluminescence reagent, and the band gray values were analyzed using ImageLab software. Standardization was performed using glyceraldehyde-3-phosphate dehydrogenase as an internal control.
[0095] Results: Compared with the control group, after treatment with 5.0 μmol / L compound 8010-8498 for 48 hours, the expression of E-cadherin in HuccT1 cells was upregulated by about 2.1 times, while the expression of N-cadherin and vimentin was downregulated to about 45% and 52% of the control group, respectively, indicating that compound 8010-8498 can effectively reverse epithelial-mesenchymal transition.
[0096] Example 3: Effect of inhibiting macrophage secretion of vascular endothelial growth factor C 3.1 Preparation of macrophages derived from human peripheral blood mononuclear cells Peripheral blood mononuclear cells (PBMCs) were isolated from peripheral blood of healthy volunteers (with ethical approval and informed consent) using density gradient centrifugation. The isolated PBMCs were seeded into cell culture plates and cultured for 7 days in RPMI 1640 medium containing 100 ng / mL macrophage colony-stimulating factor and 10% fetal bovine serum, with half the medium replaced every 3 days to induce differentiation into M0 macrophages. Flow cytometry analysis confirmed that the expression of cell surface markers CD14 and CD68 was positive in more than 95% of the samples, confirming successful macrophage differentiation.
[0097] 3.2 Co-culture and treatment of tumor cells and macrophages HuccT1 cells were seeded into the lower chamber of a 6-well plate. After cell attachment, the medium was replaced with serum-free medium containing 0 or 5.0 μmol / L of compound 8010-8498 for 24 hours for pretreatment. After pretreatment, the supernatant was discarded, and the cells were washed twice with phosphate-buffered saline. Then, the M0 macrophages prepared in the above steps were seeded into the upper chamber (0.4 μm pore size) of a Transwell plate, and fresh medium containing 10% fetal bovine serum was added to the lower chamber to establish a non-direct contact co-culture system. Co-culture was carried out for 48 hours.
[0098] 3.3 Conditioned culture medium collection and vascular endothelial growth factor C detection After co-culture, carefully collect all the conditioned medium from the lower chamber, centrifuge at 12,000 rpm for 10 minutes at 4°C to remove cell debris, and aliquot the supernatant and store at -80°C for later analysis. Use the human vascular endothelial growth factor C enzyme-linked immunosorbent assay kit, strictly following the instructions, to detect the protein concentration of vascular endothelial growth factor C in the conditioned medium. Each sample was tested in triplicate, and the concentration was calculated based on the standard curve.
[0099] Results: As shown in Table 3, compared with the control group without the compound, the level of vascular endothelial growth factor C secreted by macrophages in the co-culture system was significantly reduced after HuccT1 cells were pretreated with 5.0 μmol / L of compound 8010-8498.
[0100] Table 3: Effects of pretreatment with compound 8010-8498 on the secretion of vascular endothelial growth factor C in the co-culture system Example 4: Effect of inhibiting lymphatic metastasis in animal models 4.1 Establishment and drug administration of a nude mouse popliteal lymph node metastasis model All animal experiments were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee. Female BALB / c nude mice aged 4-6 weeks and weighing 18-22 grams were randomly divided into three groups: a model control group, a low-dose group of compound 8010-8498, and a high-dose group of compound 8010-8498, with 8 mice in each group. Each mouse received a subcutaneous injection of RBE cell suspension stably overexpressing insulin-like growth factor 2 mRNA-binding protein 2 into the right hind paw pad. (50 μL of cells). Administration began on day 7 post-inoculation, when small lumps were palpable in the footpads. The control group received an intraperitoneal injection of an equal volume of solvent (5% dimethyl sulfoxide + 45% polyethylene glycol 300 + 50% saline), the low-dose group received an intraperitoneal injection of compound 8010-8498 (20 mg / kg body weight), and the high-dose group received an intraperitoneal injection of compound 8010-8498 (40 mg / kg body weight). Administration was given three times a week for five consecutive weeks.
[0101] 4.2 Observational Indicators and Histological Analysis Twice a week, the long and short diameters of the primary tumor in the footpad were measured using calipers, and the tumor volume was calculated. After drug administration, all mice were anesthetized and euthanized, and the right popliteal lymph nodes were completely isolated and weighed. Tissue samples from the primary tumor and popliteal lymph nodes were collected; one portion was fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, and subjected to hematoxylin-eosin staining and immunohistochemical staining for flatfoot proteins to assess lymphatic vessel density; the other portion was flash-frozen in liquid nitrogen and stored at -80°C for Western blot analysis.
[0102] 4.3 Results 1. Primary tumor growth: The growth rate of primary tumors in the footpads of the compound 8010-8498-treated group was significantly slower than that of the control group. At the treatment endpoint, the average tumor weight of the low- and high-dose groups was reduced by approximately 41% and 63%, respectively, compared to the control group.
[0103] 2. Lymph node metastasis: In the control group, 7 out of 8 mice (87.5%) showed visible metastasis to the popliteal lymph nodes, with an average metastatic lymph node weight of 65.3 ± 12.1 mg. In the low-dose group, the metastasis rate was 3 / 8 (37.5%), with an average weight of 22.8 ± 9.4 mg. In the high-dose group, only 1 mouse (12.5%) showed micrometastasis, with an average weight of 8.5 ± 7.2 mg. The difference between the high-dose group and the control group was highly significant.
[0104] 3. Lymphatic vessel density: Immunohistochemical staining for plasopodium protein showed that the control group had abundant and dilated lymphatic vessels at the tumor periphery. In the treatment groups with compound 8010-8498, especially the high-dose group, the density of plasopodium-positive lymphatic vessels in and around the tumor tissue was significantly reduced.
[0105] 4. Molecular mechanism verification: Western blotting showed that, compared with the control group, the protein expression levels of pluripotent proteoglycans and phosphorylated protein kinase B were downregulated and the expression of E-cadherin was upregulated in the tumor tissue treated with compound 8010-8498, which was consistent with the results of in vitro experiments.
[0106] Example 5: Therapeutic effect of combination therapy with gemcitabine and cisplatin 5.1 Synergistic Effect Analysis of In Vitro Combined Drug Use The synergistic effect of compound 8010-8498 with gemcitabine or cisplatin was evaluated using the CCK-8 assay. HuccT1 cells were seeded in 96-well plates and, after adhesion, treated with different concentrations of compound 8010-8498, gemcitabine, or cisplatin alone or in combination for 72 hours. Each group had six replicates. Then, 10 μL of CCK-8 solution was added to each well, and after incubation for another 2 hours, the absorbance at 450 nm was measured using a microplate reader. Cell viability was calculated. The combination index of each drug combination was calculated using CompuSyn software based on the intermediate-effect principle. Combination indices less than 1, equal to 1, and greater than 1 represent synergistic, additive, and antagonistic effects, respectively.
[0107] Results: As shown in Table 4, compounds 8010-8498 showed synergistic effects with gemcitabine or cisplatin at multiple effect levels (half-maximal inhibitory concentrations).
[0108] Table 4: Combination index of compound 8010-8498 with chemotherapy drugs 5.2 In vivo combined therapy experiment Based on the nude mouse popliteal lymph node metastasis model of Example 4, two additional treatment groups were established: a gemcitabine plus cisplatin group and a compound 8010-8498 plus gemcitabine and cisplatin triple-drug group. The dosing regimens for gemcitabine and cisplatin were based on the commonly used doses in preclinical models: gemcitabine intraperitoneally, 100 mg / kg body weight twice weekly; cisplatin intraperitoneally, 5 mg / kg body weight once weekly. The dosing regimen for compound 8010-8498 was the same as the high-dose group in Example 4 (40 mg / kg body weight, three times weekly). The control group received the corresponding solvent. All treatments began on day 7 post-inoculation and lasted for 5 weeks.
[0109] result: 1. Tumor suppression effect: At the end of treatment, the inhibition rate of the primary tumor in the gemcitabine plus cisplatin group was about 68%, the inhibition rate of the high-dose monotherapy group of compound 8010-8498 was about 63%, and the inhibition rate of the three-drug combination group reached 92%, which was significantly better than any single-drug or two-drug chemotherapy group.
[0110] 2. Anti-lymph node metastasis effect: The incidence of lymph node metastasis in the gemcitabine combined with cisplatin group was 2 / 8 (25%), with an average metastatic lymph node weight of 15.2±6.8 mg. In contrast, no gross or pathologically visible metastatic lymph node metastasis was found in any of the 8 mice in the three-drug combination group (0 / 8), indicating the strongest anti-metastasis effect.
[0111] 3. Safety observation: The weight of mice in each group remained stable throughout the experiment, and no deaths or lethargy caused by obvious toxic reactions occurred, indicating that the combination drug regimen was well tolerated at the selected dose.
[0112] To ensure the clarity, accuracy, and unambiguity of the technical content of this invention, all abbreviations, shorthand terms, and technical terms that may cause confusion in this invention are explained in detail. All explanations are based on the conventional understanding of those skilled in the art and are clarified in conjunction with the specific context of this invention.
[0113] 1. IGF2BP2: Abbreviation for Insulin-like Growth Factor 2 mRNA Binding Protein 2. It is an RNA-binding protein belonging to the N6-methyladenosine methylated "reader" protein family. It specifically recognizes and binds to messenger RNA molecules containing N6-methyladenosine modification, enhancing the stability of target mRNA and promoting its translation efficiency. In this invention, it specifically refers to homologous proteins derived from humans or mice.
[0114] 2. m6A: Abbreviation for N6-methyladenosine. It is the most abundant and conserved internal chemical modification on eukaryotic messenger RNA molecules. Formed by a methyltransferase complex, it can be eliminated by demethylases and recognized by specific reading proteins, thereby regulating RNA splicing, nuclear export, stability, and translation efficiency at the post-transcriptional level.
[0115] 3. VCAN: Abbreviation for Versican, a large chondroitin sulfate proteoglycan found in the extracellular matrix and belonging to the agglutinin family. Its core protein carries multiple chondroitin sulfate glycosaminoglycan chains, participating in processes such as cell adhesion, proliferation, migration, and immune cell recruitment. In this invention, VCAN serves as a downstream target gene of IGF2BP2, and its mRNA stability is regulated in a m6A-dependent manner by IGF2BP2.
[0116] 4. TLR2: Abbreviation for Toll-like Receptor 2. It is a pattern recognition receptor mainly expressed on the surface of immune cells such as macrophages and dendritic cells. It can recognize pathogen-associated molecular patterns and damage-associated molecular patterns, initiating an innate immune response. In this invention, VCAN can act as an endogenous ligand binding to TLR2, activating macrophages to secrete pro-inflammatory cytokines.
[0117] 5. VEGF-C: Abbreviation for Vascular Endothelial Growth Factor C. It is a member of the vascular endothelial growth factor family. It primarily induces the proliferation, migration, and tubular formation of lymphatic endothelial cells by binding to the vascular endothelial growth factor receptor 3 (VEGF receptor 3) on the surface of lymphatic endothelial cells. It is currently the most potent known lymphangiogenic factor.
[0118] 6. PDPN: Abbreviation for Podoplanim. It is a small transmembrane glycoprotein that is specifically and highly expressed on the surface of lymphatic vessel endothelial cell membranes, and is a reliable marker for lymphatic vessel morphology identification. In this invention, the expression level of PDPN is detected to assess the density of lymphatic vessels in tumor tissue.
[0119] 7. E-cadherin: E-cadherin is a calcium-dependent transmembrane adhesion molecule, mainly expressed on the basal side of epithelial cells. It mediates homocellular adhesion and maintains epithelial polarity and tissue integrity. Its expression is often significantly downregulated during epithelial-mesenchymal transition.
[0120] 8. N-cadherin: N-cadherin. It is a calcium-dependent adhesion molecule, mainly expressed in nerve tissue, muscle, and mesenchymal-derived cells. Its expression is often upregulated during epithelial-mesenchymal transition and is considered one of the markers of the mesenchymal phenotype.
[0121] 9. Vimentin: A type III intermediate filament protein characteristic of mesenchymal cells, involved in maintaining cytoskeleton structure. Its expression is significantly increased during epithelial-mesenchymal transition and is a recognized biomarker of mesenchymal phenotype.
[0122] 10. CCL2: Abbreviation for Chemokine Ligand 2. Formerly known as Mononuclear Cell Chemokine 1, it is currently the most extensively studied monocyte chemokine. Through binding to its receptor CCR2, it mediates the directed migration of monocytes, memory T cells, and other cells to sites of inflammation or tumors.
[0123] 11. TNF-α: Abbreviation for Tumor Necrosis Factor Alpha. It is a pleiotropic pro-inflammatory cytokine mainly secreted by activated macrophages, participating in inflammatory responses, immune regulation, and tumorigenesis and development. In this invention, TNF-α can be secreted by TLR2-activated macrophages, thereby inducing the expression of vascular endothelial growth factor C.
[0124] 12. IL-6: Abbreviation for Interleukin-6. It is a cytokine with multiple biological functions, participating in acute phase responses, B cell differentiation, T cell activation, and tumor-associated inflammation. In this invention, IL-6 can be secreted by TLR2-activated macrophages and promotes lymphangiogenesis.
[0125] 13. F4 / 80: The English abbreviation for a marker on the surface of mouse macrophages. It is a transmembrane glycoprotein encoded by the Emr1 gene, which is stably and highly expressed on the surface of mature macrophages in mouse tissues and is widely used as a specific marker for mouse macrophages.
[0126] 14. CD14: Abbreviation for Cluster of Differentiation 14. It is a high-affinity receptor for the lipopolysaccharide-lipopolysaccharide-binding protein complex, mainly expressed on the surface of monocytes and macrophages, and is often used in conjunction with CD68 to identify human macrophages.
[0127] 15. CD68: Abbreviation for Cluster of Differentiation 68. It is a highly glycosylated transmembrane protein, mainly located in lysosomes and intracellular endocytic structures, and is the most commonly used intracellular marker in human and rodent macrophages.
[0128] 16. GAPDH: Abbreviation for Glyceraldehyde-3-phosphate dehydrogenase. It is a key enzyme in the glycolysis pathway, constitutively and stably expressed in various tissues and cells, and is the most commonly used internal control protein in Western blotting experiments.
[0129] 17. EMT: Epithelial-Mesenchymal Transition. It refers to the reversible transdifferentiation process in which epithelial cells, under the induction of specific physiological or pathological signals, lose cell polarity, intercellular connections, and expression of epithelial markers, while acquiring mesenchymal cell-like morphology, migration ability, invasive ability, and expression of mesenchymal markers.
[0130] 18. PI3K / AKT signaling pathway: This is an abbreviation for the phosphatidylinositol 3-kinase / protein kinase B signaling pathway. Phosphatidylinositol 3-kinase is an intracellular phosphatidylinositol kinase that catalyzes the production of a second messenger, which in turn activates the downstream serine / threonine kinase AKT. This pathway is one of the core oncogenic pathways regulating cell proliferation, survival, metabolism, migration, and epithelial-mesenchymal transition.
[0131] 19. IGF2BP2-m6A-VCAN-TLR2 signaling axis: This invention is the first to fully define and validate a multi-molecular cascade signaling pathway. Its transduction pathway is as follows: IGF2BP2 expression is upregulated in intrahepatic cholangiocarcinoma cells, stabilizing VCAN transcripts and promoting protein translation by recognizing m6A modification sites in specific regions of VCAN mRNA; the VCAN protein secreted extracellularly recruits macrophages by forming a concentration gradient through binding to the chemokine CCL2, and directly binds to the TLR2 receptor on the macrophage surface, activating downstream inflammatory signals; activated macrophages secrete large amounts of VEGF-C, driving tumor-associated lymphangiogenesis.
[0132] 20. MeRIP-seq: An abbreviation for Methylated RNA Immunoprecipitation Sequencing. It is currently the core technology for mapping m6A modifications at the whole transcriptome level. Its principle is to use anti-m6A specific antibodies to enrich RNA fragments containing m6A modifications after fragmentation, construct libraries, and perform high-throughput sequencing.
[0133] 21. RIP: Abbreviation for RNA Immunoprecipitation. It is a classic experimental technique used to detect the presence of direct interactions between specific RNA-binding proteins and endogenous target RNA molecules. Its core step involves using target protein-specific antibodies to precipitate protein-RNA complexes in cell lysates, and then identifying the enriched RNA sequences in the precipitate product using reverse transcription polymerase chain reaction or sequencing.
[0134] 22. q-PCR: Abbreviation for Quantitative Real-Time Polymerase Chain Reaction. It is a nucleic acid quantification technique that introduces a fluorescent signal into a polymerase chain reaction system and quantifies the initial template copy number in real time by monitoring the cumulative fluorescence intensity.
[0135] 23. WB: Abbreviation for Western Blot. It is a protein analysis technique based on the principle of antigen-antibody specific binding. Proteins separated by gel electrophoresis are transferred to a solid membrane, where specific antibodies are used for detection and quantification.
[0136] 24. ELISA: Enzyme-Linked Immunosorbent Assay. It is an immunochemical technique that non-specifically adsorbs soluble antigens or antibodies onto the surface of a solid support, and uses an enzyme-catalyzed colorimetric reaction to qualitatively and quantitatively detect the analytes.
[0137] 25. Co-IP: Abbreviation for co-immunoprecipitation. It is a classic technique that uses specific antibodies to capture corresponding antigens and other protein molecules that physically interact with them in cell lysates, thereby identifying the composition of protein complexes.
[0138] 26. CRISPR / Cas9: An abbreviation for CRISPR-Cas9, a system of clustered regularly spaced short palindromic repeats and their associated proteins. It is currently the most widely used gene editing technology platform. Guided by guide RNA, the Cas9 endonuclease specifically cuts genomic target sites, inducing DNA double-strand breaks and intrinsic cellular repair mechanisms to achieve gene knockout, knock-in, or site-specific modification.
[0139] 27. RTCA: Abbreviation for Real-Time Cellular Analysis. It is a technology based on microelectronic biosensor chips that dynamically, quantitatively, and label-free assesses the biological state of cells by monitoring changes in electrode impedance caused by cell attachment, spreading, and proliferation in real time.
[0140] 28. DARTS: An abbreviation for Drug Affinity Responsive Target Stability. It is a target-fishing technique that does not rely on compound modification. The principle is that small molecule drugs, after binding to target proteins, can enhance the target proteins' resistance to protease hydrolysis. The direct target is identified by comparing the protease hydrolysis patterns of the drug-treated group and the control group.
[0141] 29. CETSA: Abbreviation for Cellular Thermal Shift Assay. It is a biophysical technique based on the principle that ligand binding enhances the thermal stability of target proteins, and verifies the direct binding of small molecule drugs to intracellular target proteins at the level of intact cells or lysates.
[0142] 30. HE staining: abbreviated as hematoxylin-eosin staining. It is the most basic staining method in histopathology. Hematoxylin stains the chromatin and ribosomes in the cell nucleus purple-blue, while eosin stains the cytoplasm and extracellular matrix components pink. It is used to observe tissue morphology and lesion characteristics.
[0143] 31. IHC: Immunohistochemistry. It is a technique that uses the principle of specific antigen-antibody binding to locate, qualitatively and semi-quantitatively detect the expression of specific antigens in tissue sections through colorimetric reactions.
[0144] 32. FACS: Fluorescence-Activated Cell Sorting. It is a high-throughput technique that uses flow cytometry to perform rapid, multi-parameter quantitative analysis of single cells suspended in a liquid, and to sort and collect target cell populations according to preset parameters.
[0145] 33. HuccT1: The code name for a human intrahepatic cholangiocarcinoma cell line. Derived from the Riken Cell Bank in Japan, it is an epithelial-like adherent cell line isolated from a human intrahepatic cholangiocarcinoma tissue. In this invention, this cell line was confirmed as a cell model with endogenous high expression of IGF2BP2.
[0146] 34. RBE: Code name for human intrahepatic cholangiocarcinoma cell line. Derived from the Riken Cell Bank in Japan, it is a cell line isolated from a case of human intrahepatic cholangiocarcinoma tissue. In this invention, this cell line was confirmed as a cell model with endogenous low expression of IGF2BP2.
[0147] 35. HELEC: Abbreviation for Human Lymphatic Endothelial Cells. These are primary lymphatic endothelial cells isolated and purified from human skin or mesentery, commonly used in in vitro lymphangiogenesis experiments.
[0148] 36.293T cells: The code name for the human embryonic kidney epithelial cell line. It is a human embryonic kidney epithelial cell line transformed with adenovirus E1A gene and SV40 large T antigen. It is characterized by extremely high transfection efficiency and is often used for protein expression and protein-nucleic acid interaction verification experiments.
[0149] 37. BALB / c nude mice: A strain of laboratory mice with T-lymphocyte immunodeficiency. Due to mutations in the Foxn1 gene, they are hairless and have underdeveloped thymus, lacking mature T lymphocytes. They can receive xenograft tumor cell transplantation without strong rejection, making them the most widely used xenograft model animal in oncology research.
[0150] 38. C57BL / 6 mice: The standard strain of inbred experimental mice. It is the mammalian model strain with the clearest genetic background and the most widely used. This invention is used to prepare liver-specific transgenic mice and Sleeping Beauty transposon-mediated spontaneous intrahepatic cholangiocarcinoma models.
[0151] 39. Alb-Cre mice: Abbreviation for albumin promoter-driven Cre recombinase transgenic mice. Under the regulation of the Alb promoter, Cre recombinase is specifically and efficiently expressed in hepatocytes. Mating these mice with conditionally targeted mice can obtain liver-specific gene knockout or knock-in models.
[0152] 40. Sleeping Beauty Transposon System: A non-viral gene transfer technology based on the transposon-transposase principle. In this invention, this system was used to deliver an activated KRAS gene mutant and a short hairpin RNA plasmid targeting p53 into mouse hepatocytes via hydrodynamic tail vein injection, successfully establishing an induced spontaneous intrahepatic cholangiocarcinoma model.
[0153] 41. PDX model: Abbreviation for Patient-Derived Tumor Xenograft. It is a personalized tumor model formed by directly transplanting freshly surgically removed tumor tissue from a patient into immunodeficient mice and then passaged, thus preserving the histopathological and genetic characteristics of the primary tumor to the greatest extent possible.
[0154] 42. TCGA: The abbreviation for Cancer Genome Atlas. It is a major project jointly launched in 2006 by the National Cancer Institute and the National Human Genome Institute. It has completed multi-omics mapping of over 20,000 samples from 33 common cancer types, making it the world's largest publicly available database in the field of cancer research.
[0155] 43. GEO: Abbreviation for Gene Expression Omnibus. It is an international public gene expression database maintained by the National Center for Biotechnology Information (NCBI) in the United States, containing massive amounts of raw and processed data generated by high-throughput sequencing and microarray chips.
[0156] 44. WMU Database: The abbreviation for Wenzhou Medical University Database. It is an internal validation dataset constructed by our research group based on the biobank of the First Affiliated Hospital of Wenzhou Medical University, using transcriptome sequencing of surgical specimens from 50 patients with pathologically confirmed intrahepatic cholangiocarcinoma.
[0157] 45. POSTAR2: Abbreviation for Protein-RNA Interaction Database, Second Edition. It is a comprehensive post-translational regulatory annotation database that contains precise binding site information at the whole transcriptome level for RNA-binding proteins identified by large-scale CLIP-seq experiments.
[0158] 46. m6A2target: The abbreviation for m6A target gene database. It is a specialized database that specifically collects experimentally validated m6A-modified target genes and their corresponding reading proteins, methyltransferases, and demethylases, and their regulatory relationships.
[0159] 47. SRAMP: An abbreviation for Sequence-based N6-methyladenosine Modification Site Predictor. It is an online tool based on the support vector machine algorithm, predicting potential m6A modification sites in mammalian mRNA molecules based on local RNA sequence features, secondary structure, and evolutionary conservation.
[0160] 48. Schrödinger software: Developed by Schrödinger Inc. in the United States, this software platform is a comprehensive tool for molecular simulation and computer-aided drug design in the life sciences and materials science fields. It includes core functional modules such as molecular docking, pharmacophore modeling, quantitative structure-activity relationship (QA), and molecular dynamics simulation.
[0161] 49. Glide: The molecular docking module in Schrödinger software. Its full name is Grid-Based Ligand Docking with Energetics. It is currently recognized as one of the commercially available software programs with the highest docking accuracy. It searches for the conformation, position, and orientation of the ligand in the acceptor binding pocket and scores it based on an optimized energy function.
[0162] 50. SiteMap: The binding site identification module in the Schrödinger software. It is used to predict potential drug small molecule binding pockets from the three-dimensional structure of proteins and to score and rank them based on parameters such as hydrophobicity, hydrophilicity, volume, and solvent-accessible surface area.
[0163] 51. LigPrep: The ligand preparation module in the Schrödinger software. It is used for batch preprocessing of small molecule compound databases, including generating correct 3D structures, protonated states, tautomers, stereoisomers, and energy minimization.
[0164] 52. PLIF: Abbreviation for Protein-Ligand Interaction Fingerprinting. It is a method that abstracts the interaction between proteins and ligands into binary fingerprint codes, used to quantitatively compare the similarity of binding patterns between different ligands and the same target.
[0165] 53. Chemdiv Compound Library: A diverse compound library provided by Chemdiv, Inc. This library contains over 1.5 million drug-like small molecules with novel structures and diverse skeletons, making it one of the most commercially viable and widely used compound sources in the field of drug screening.
[0166] 54. TargetMol Compound Library: A diverse compound library provided by TargetMol, Inc. This library contains over 100,000 small molecule compounds with clearly defined biological activities and a variety of drug-like molecules, widely used for phenotypic screening and target validation studies.
[0167] 55. DMSO: Abbreviation for Dimethyl Sulfoxide. It is a polar aprotic solvent with good cell membrane permeability. It is the most commonly used pharmaceutical excipient and solvent for dissolving lipid-soluble compounds in biomedical experiments.
[0168] 56. PBS: Phosphate Buffered Saline. It is an isotonic buffer mainly composed of sodium dihydrogen phosphate, disodium hydrogen phosphate, and sodium chloride. Its pH value is stable between 7.2 and 7.4, and it is widely used for cell washing, reagent preparation, and tissue preservation.
[0169] 57. FBS: Abbreviation for Fetal Bovine Serum. It is a pale yellow liquid obtained by collecting blood from the heart of a fetal bovine fetus, followed by coagulation, centrifugation, and filtration. Rich in growth factors, hormones, adhesion factors, and nutrients, it is the most widely used natural culture medium additive in cell culture.
[0170] 58. DMEM: Abbreviation for Dulbecco's Modified Eagle Medium. It is a universal cell culture medium developed from Eagle basal medium by increasing the concentration of amino acids and vitamins by 2 to 4 times, suitable for the in vitro culture of various adherent cell types.
[0171] 59. RPMI 1640: The abbreviation for Los Angeles Parker Memorial Institute 1640 medium. Originally designed for culturing human leukemia suspension cells, it has now become the standard culture medium for culturing lymphocytes, monocytes, macrophages, and various tumor cells.
[0172] 60. Lipinski's Five Principles for Drug Adaptation: These are guidelines for screening the drug-likeness of oral medications, proposed by Christopher Lipinski in 1997. They include a molecular weight less than 500 Daltons, a lipid-water partition coefficient (LogP) less than 5, fewer than 5 hydrogen bond donors, and fewer than 10 hydrogen bond acceptors. Violation of two or more of these principles suggests a potential risk of poor oral bioavailability.
[0173] 61. LogP: The abbreviation for lipid-water partition coefficient. It is the logarithmic ratio of the equilibrium concentrations of a compound in the n-octanol and water phases, reflecting the degree of lipid solubility of the molecule. It is a core parameter for evaluating the membrane permeability and pharmacokinetic properties of a compound.
[0174] 62. LogS: Abbreviation for Aqueous Solubility. It is the logarithm of the molar concentration of a compound when it reaches saturation in an aqueous phase. It reflects the compound's ability to dissolve in water and directly affects formulation development and in vivo absorption.
[0175] 63. TPSA: Abbreviation for Topological Polar Surface Area. It is the sum of the van der Waals surface area contributions of polar atoms such as nitrogen and oxygen and their attached hydrogen atoms in a molecule, and is highly correlated with the passive permeability of compounds and the permeability of Caco-2 cells.
[0176] 64. hERG: Abbreviation for human ether-à-go-go related gene. This gene encodes the pore-forming subunit of the cardiac fast-delayed rectifier potassium channel and is the primary target for drug-induced QT interval prolongation and torsades de pointes ventricular tachycardia. The risk of hERG inhibition must be evaluated for all candidate drugs.
[0177] 65. CYP: Abbreviation for Cytochrome P450 Proteins. It is a superfamily of heme-containing monooxygenases mainly distributed in the endoplasmic reticulum of hepatocytes, participating in phase I metabolic reactions of endogenous and exogenous compounds. Among them, CYP2C9, CYP2D6, and CYP3A4 are the most important isoenzymes in clinical drug metabolism.
[0178] 66. IC50: The abbreviation for Half-Maximal Inhibitory Concentration. It is a quantitative indicator of the inhibitory effect of a compound, referring to the molar concentration of the compound required to inhibit a certain biological effect by 50% under specific experimental conditions.
[0179] 67. CI: Abbreviation for Combination Index. It is an index used to quantitatively evaluate the combined effect of two or more drugs based on the intermediate-efficacy equation. CI less than 1, equal to 1, and greater than 1 indicate synergistic, additive, and antagonistic effects, respectively.
[0180] 68. Fa: Abbreviation for Fraction of Inhibition. It stands for Fraction Affected. It is a core parameter in the principle of intermediate efficacy, representing the percentage of cells in a cell population that are inhibited at a specific drug concentration. Its value ranges from 0 to 1.
[0181] 69. BCA method: Abbreviation for diquinoline carboxylic acid protein quantification method. It is currently the most widely used colorimetric technique for determining protein concentration in laboratories. Its principle is that under alkaline conditions, proteins reduce copper ions to cuprous ions. The cuprous ions chelate with diquinoline carboxylic acid to form a purple complex, which has a characteristic absorption peak at a wavelength of 562 nanometers.
[0182] 70. SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis. It is a classic electrophoresis technique that separates proteins based on differences in the molecular weight of their subunits. Sodium dodecyl sulfate, an anionic detergent, denatures the proteins and makes them negatively charged, eliminating differences in their native conformation and charge.
[0183] 71. PVDF membrane: Abbreviation for polyvinylidene fluoride membrane. It is a high-molecular polymer film with high mechanical strength, strong protein binding capacity, and good chemical resistance. It is the most commonly used solid-phase support for immobilizing and separating proteins in protein immunoblotting experiments.
[0184] 72. HRP: Abbreviation for Horseradish Peroxidase. It is a heme-containing glycoprotein isolated from horseradish rhizomes. It catalyzes hydrogen peroxide-mediated oxidation reactions of various chemiluminescent substrates and is the most commonly used labeling enzyme in enzyme-linked immunosorbent assays (ELISA) and Western blotting.
[0185] 73. ECL: Abbreviation for Enhanced Chemiluminescence. It is a colorimetric system based on horseradish peroxidase catalyzing luminol to generate a light signal. It has advantages such as high sensitivity, wide linear range, and simple operation, and is the gold standard for protein immunoblotting detection.
[0186] 74. CCK-8: Abbreviation for Cell Counting Kit-8. It is a cell proliferation and cytotoxicity assay based on water-soluble tetrazolium salt. In the presence of an electron carrier, mitochondrial dehydrogenases reduce the tetrazolium salt to an orange formazan product, the amount of which is directly proportional to the number of viable cells.
[0187] 75. ANOVA: An abbreviation for Analysis of Variance. It is a parametric test method used to examine whether the differences between the means of three or more samples are statistically significant.
[0188] 76. SD: Abbreviation for Standard Deviation. It is a core statistical indicator describing the dispersion of data distribution, representing the average deviation of each observation from the arithmetic mean.
[0189] 77. SEM: Abbreviation for Standard Error of the Mean. It is a sampling error index of the sample mean, equal to the standard deviation divided by the arithmetic square root of the sample size.
[0190] 78. RPM: An abbreviation for Revolutions Per Minute. It is a unit of measurement used to describe the rotational speed of a centrifuge and the agitator.
[0191] 79.g: The English symbol for gravitational acceleration. In the field of centrifugal force, it refers to relative centrifugal force and is a commonly used unit to describe the intensity of a centrifugal field. 1g is approximately equal to 9.8 meters per square second.
[0192] 80.kDa: The abbreviation for kilodalton. A kilodalton is a unit of atomic mass, approximately equal to the mass of one hydrogen atom, used to describe the molecular weight of biological macromolecules such as proteins and nucleic acids.
[0193] 81.mM: Millimoles per liter. It is a unit of measurement for molar concentration. 1 millimole per liter is equal to 0.001 moles per liter.
[0194] 82.μM: Micromoles per liter. It is a unit of measurement for molar concentration. 1 micromole per liter is equal to 0.000001 moles per liter.
[0195] 83.nM: Nanomoles per liter. It is a unit of measurement for molar concentration. 1 nanomole per liter is equal to 0.000000001 mole per liter.
[0196] 84. mg / kg: This is an abbreviation for milligrams per kilogram of body weight. It is a standard unit used in animal experiments to describe the dosage of an active ingredient administered per kilogram of the experimental animal's body weight.
[0197] 85.μg / mL: Micrograms per milliliter. It is a unit of measurement for the mass concentration of a solute in a solution.
[0198] 86 ng / mL: Nanograms per milliliter. It is a unit of measurement for the mass concentration of a solute in a solution, often used to describe the concentration of trace proteins such as cytokines.
[0199] 87.°C: The symbol for degrees Celsius. It is an internationally recognized unit of temperature measurement.
[0200] 88. CO2: The chemical formula for carbon dioxide. It is an essential gaseous component in cell culture incubators used to maintain the pH of the culture medium. Standard culture conditions are a mixed gas environment of 5% carbon dioxide and 95% air.
[0201] 89. pH: The Latin abbreviation for hydrogen ion concentration index. It is a numerical value that indicates the acidity or alkalinity of a solution, defined as the negative common logarithm of hydrogen ion activity. pH 7 is neutral.
[0202] 90. Gemcitabine: A fluorinated analogue of deoxycytidine, it is an antimetabolite chemotherapy drug that exerts its antitumor effect by incorporating into the DNA chain to terminate DNA synthesis and inhibiting ribonucleotide reductase. It is a core drug in first-line chemotherapy regimens for biliary tract cancer.
[0203] 91. Cisplatin: The first platinum-based antitumor drug to be used clinically. Its central platinum atom forms an intra-chain crosslink with the purine bases on the DNA strand, preventing DNA unwinding and replication, and inducing apoptosis in tumor cells.
[0204] 92. Oxaliplatin: A third-generation platinum-based antitumor drug. Its molecular structure contains a diaminocyclohexane ligand. It does not have complete cross-resistance with cisplatin and carboplatin and is commonly used for chemotherapy in colorectal cancer and biliary tract cancer.
[0205] 93.5-Fluorouracil: It is a derivative of uracil in which the hydrogen at the 5-position is replaced by fluorine. In vivo, it is converted into fluorouracil deoxynucleotide, which irreversibly inhibits thymidylate synthase and blocks DNA synthesis.
[0206] 94. Capecitabine: It is a prodrug of 5-fluorouracil. After oral administration, it is absorbed through the intestine and converted into its active product in the liver and tumor tissue through a three-step enzymatic reaction, exhibiting the characteristic of selective tumor activation.
[0207] 95. Irinotecan: A semi-synthetic derivative of camptothecin, it is a topoisomerase I inhibitor. It covalently binds to the topoisomerase I-DNA complex with the active metabolite of SN-38, leading to the accumulation of DNA single-strand breaks.
[0208] 96. Paclitaxel: A natural diterpenoid compound isolated from the bark of the Pacific yew tree. It induces apoptosis by promoting microtubule polymerization and inhibiting microtubule depolymerization, thereby arresting the cell cycle at the G2 / M phase.
[0209] 97. Docetaxel: A semi-synthetic analogue of paclitaxel, it has better water solubility than paclitaxel, higher affinity for microtubules, and stronger antitumor activity.
[0210] 98. Albumin-bound paclitaxel: Nab-Paclitaxel. This product utilizes nano-albumin technology to encapsulate paclitaxel into particles approximately 130 nanometers in diameter. It eliminates the need for polyoxyethylated castor oil as a solubilizer, significantly reducing the incidence of allergic reactions, and can achieve tumor-targeted delivery via albumin-mediated transendothelial transport.
[0211] 99. Tegafur: English S-1. It is a compound oral fluorouracil preparation composed of tegafur, gimeracil, and oteracil potassium in a molar ratio of 1:0.4:1. It achieves stable maintenance of 5-fluorouracil blood concentration by regulating the activity of dihydropyrimidine dehydrogenase.
[0212] 100. PD-1: Abbreviation for Programmed Cell Death Protein 1. It is an inhibitory receptor expressed on the surface of activated T cells. After binding to its ligand PD-L1 on the surface of tumor cells, it transmits a negative co-stimulatory signal, inhibiting T cell proliferation and effector function.
[0213] 101. PD-L1: Abbreviation for Programmed Death-Ligand 1. It is the main ligand of the PD-1 receptor, abnormally highly expressed on the surface of various tumor cells, and is a key molecule for tumor immune escape.
[0214] 102. CTLA-4: Abbreviation for Cytotoxic T-lymphocyte Associated Protein 4. It is an inhibitory receptor expressed on the surface of activated T cells. It has a higher affinity for the CD80 / CD86 molecules on the surface of antigen-presenting cells than the co-stimulatory molecule CD28, competitively blocking the second signal for T cell activation.
[0215] 103. FGFR: Abbreviation for Fibroblast Growth Factor Receptor. It is a family of transmembrane receptors with tyrosine kinase activity. Gene fusion and activating mutations are important driving events in intrahepatic cholangiocarcinoma.
[0216] 104. IDH1 / IDH2: Abbreviation for Isocitrate Dehydrogenase 1 / 2. It is a key metabolic enzyme in the tricarboxylic acid cycle. Mutant forms of this enzyme acquire a novel activity: catalyzing the reduction of α-ketoglutarate to 2-hydroxyglutarate, which is a competitive inhibitor of various histone demethylases and DNA demethylases.
[0217] 105. EGFR: Abbreviation for Epidermal Growth Factor Receptor. It is a member of the ErbB family of receptor tyrosine kinases, and its overactivation is closely related to tumor cell proliferation, angiogenesis, invasion and metastasis, and treatment resistance.
[0218] 106. VEGFR: Abbreviation for Vascular Endothelial Growth Factor Receptor. It is a high-affinity transmembrane receptor for vascular endothelial growth factor, possessing tyrosine kinase activity. VEGFR3 is primarily expressed in lymphatic endothelial cells, mediating lymphangiogenesis signals.
[0219] 107. MET: The abbreviation for MET proto-oncogene receptor tyrosine kinase. Its encoded protein is a high-affinity receptor for hepatocyte growth factor, and abnormal activation is associated with tumor invasive phenotype and acquired resistance to targeted drugs.
[0220] This invention encompasses any substitutions, modifications, equivalent methods, and solutions made within the spirit and scope of this invention. To provide the public with a thorough understanding of this invention, specific details are described in detail in the following preferred embodiments; however, those skilled in the art will fully understand the invention even without these details. Furthermore, to avoid unnecessary misunderstanding of the essence of this invention, well-known methods, processes, procedures, components, and circuits are not described in detail.
[0221] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The use of a substance that inhibits the activity or expression of the IGF2BP2-m6A-VCAN-TLR2 signaling axis in the preparation of a drug for treating intrahepatic cholangiocarcinoma with lymph node metastasis, characterized in that, The substance that inhibits the activity or expression of the IGF2BP2-m6A-VCAN-TLR2 signaling axis is compound 8010-8498; wherein, compound 8010-8498 exerts its therapeutic effect by inhibiting the activity or expression of the IGF2BP2-m6A-VCAN-TLR2 signaling axis, wherein the IGF2BP2-m6A-VCAN-TLR2 signaling axis refers to the biological functional pathway formed from N6-methyladenosine modification mediated by insulin-like growth factor 2 mRNA binding protein 2 to the expression of its downstream target pluripotent proteoglycan, and then through the binding of pluripotent proteoglycan to Toll-like receptor 2.
2. The use according to claim 1, characterized in that, The drug also includes a chemotherapy drug, which is gemcitabine and / or cisplatin.
3. The use according to claim 1, characterized in that, The drug also inhibits the epithelial-mesenchymal transition (EMT) process of intrahepatic cholangiocarcinoma cells by inhibiting the phosphatidylinositol 3-kinase / protein kinase B signaling pathway activated by the upregulation of insulin-like growth factor 2 mRNA-binding protein 2 expression, thereby reducing the migration and invasion capabilities of tumor cells. The inhibition of the EMT process is manifested by the upregulation of the epithelial marker E-cadherin and the downregulation of the mesenchymal markers N-cadherin and vimentin.
4. The use according to claim 1, characterized in that, When the drug is used to treat or prevent lymph node metastasis of intrahepatic cholangiocarcinoma, the administration method is selected from intravenous injection, arterial infusion, oral administration, subcutaneous implantation, intratumoral injection, or local sustained-release administration; the dosage form of the drug is selected from tablets, capsules, granules, injections, liposomes, nanoparticles, microspheres, or implants.
Citation Information
Patent Citations
Application of SAE1 protein inhibitor and SiRNA in preparation of medicine for treating and / or preventing intrahepatic cholangiocarcinoma
CN118416070A