Construction method of shRNA knock-down plasmid for inhibiting expression of human CASP7 gene and application of shRNA knock-down plasmid in treatment of non-small cell lung cancer

By constructing an shRNA plasmid that inhibits the human CASP7 gene and using RNA interference technology to reduce CASP7 gene expression, the problem of CASP7 gene expression in non-small cell lung cancer was solved. This achieved the effect of significantly inhibiting cancer cell proliferation and increasing pyroptosis, providing a new method for the treatment of non-small cell lung cancer.

CN122060799APending Publication Date: 2026-05-19SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610245669.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-02
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively suppress the expression of the CASP7 gene in non-small cell lung cancer, resulting in strong tumor cell proliferation and low survival rates.

Method used

We designed and constructed shRNA plasmids to inhibit the expression of the human CASP7 gene. By using RNA interference technology, we reduced the mRNA and protein expression levels of the CASP7 gene, increased pyroptosis, and inhibited cancer cell proliferation.

Benefits of technology

Significantly reducing the mRNA and protein expression of CASP7 in non-small cell lung cancer cells, increasing pyroptosis levels, and significantly inhibiting cancer cell proliferation provide a new approach for the treatment of non-small cell lung cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060799A_ABST
    Figure CN122060799A_ABST
Patent Text Reader

Abstract

The invention discloses a construction method of a shRNA knock-down plasmid for inhibiting expression of a human CASP7 gene and application of the shRNA knock-down plasmid in treatment of non-small cell lung cancer. The target sequence of the shRNA knock-down plasmid for inhibiting the expression of the human CASP7 gene is shRNA3 (short hairpin ribonucleic acid 3). The method comprises the following steps: firstly, designing a DNA sequence containing shRNA (short hairpin Ribonucleic Acid) for inhibiting human CASP7 gene expression; the DNA sequence is cloned to a lentiviral vector pLKO.1 to obtain pLKO.1-CASP7-shRNA recombinant plasmid, then lentiviral packaging is performed, human non-small cell lung cancer cells are infected, the nucleic acid and protein level of CASP7 can be greatly reduced, the pyroptosis level of the non-small cell lung cancer cells can be remarkably improved, and the proliferation capacity of cancer cells can be remarkably inhibited. The shRNA knock-down plasmid disclosed by the invention can be applied to the function research of CASP7, and has an extremely important value for the treatment research of diseases caused by CASP7.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an shRNA knockout method for inhibiting human CASP7 gene expression. Low-plasmid construction methods and their application in the treatment of non-small cell lung cancer. Background Technology

[0002] In my country, lung cancer is the leading cause of death among malignant tumors. Non-small cell lung cancer (NSCLC) includes squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. Compared to small cell carcinoma, its cancer cells grow and divide more slowly, and metastasize relatively late. NSCLC accounts for as much as 85% of all lung cancer cases, and most lung cancer patients are already in an advanced stage at initial diagnosis, resulting in a very low overall survival rate.

[0003] Pyroptosis is an inflammatory programmed cell death process, typically triggered by inflammasomes and executed by the gasdermin protein. The main characteristics of pyroptosis are cell swelling, cell membrane perforation, and release of cellular contents. Under normal physiological conditions, pyroptosis plays a crucial role in the host's defense against pathogen infection. However, excessive pyroptosis can induce a large and persistent inflammatory response, leading to inflammatory diseases. On the other hand, as an immunogenic cell death, pyroptosis can serve as a novel anti-cancer strategy by inducing pyroptotic cell death and activating a strong anti-tumor immune response. Caspases are aspartate-specific cysteine ​​proteases with active sites containing cysteine ​​residues. They specifically cleave peptide bonds after aspartate residues in target proteins, are closely related to eukaryotic apoptosis, and participate in the regulation of cell growth, differentiation, and apoptosis. Caspases selectively cleave certain proteins, resulting in activation or inactivation of the target protein, rather than complete degradation. Caspase-7, encoded by the human CASP7 gene, plays an important role in apoptosis by influencing granzymes. However, the role of CASP7 in pyroptosis remains unclear.

[0004] RNA interference (RNAi) is a post-transcriptional gene silencing mechanism mediated by small RNA molecules. It inhibits gene expression by specifically recognizing and degrading target mRNAs. As an important form of RNAi, short hairpin RNA (shRNA) can be continuously expressed in cells and processed by the Dicer enzyme to generate small interfering RNA (siRNA), which then mediates target gene silencing through the RNA-induced silencing complex (RISC). In recent years, shRNA technology has become an important tool for studying the mechanisms of cancer development and screening potential therapeutic targets. By knocking down specific oncogenes or key molecules in signaling pathways, their functions in tumor cell proliferation, apoptosis, migration, invasion, and drug resistance can be revealed.

[0005] In view of this, the applicant proposes this invention based on the basic principles of RNA interference technology, and designs an shRNA sequence, namely the shRNA3 sequence, that can greatly inhibit the expression of human CASP7 gene and inhibit the proliferation of malignant tumor cells, providing a beneficial approach for the treatment of non-small cell lung cancer and other related cancers.

[0006] The information disclosed in this background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0007] Based on the fundamental principles of RNA interference technology, this invention provides a method for constructing shRNA knockdown plasmids to inhibit the expression of the human CASP7 gene. This method is used to improve the pyroptosis level of non-small cell lung cancer tumor cells and inhibit the proliferation of cancer cells, providing a foundation for in-depth research on the specific functions of CASP7 protein and its regulation of tumor development.

[0008] To achieve the above objectives, the present invention provides an shRNA sequence for inhibiting the expression of the human CASP7 gene (GenBank ID: NM_001227.5), namely shRNA3, the specific sequence of which is: shRNA3 (SEQ ID NO.3): GCTTCGCCTGCATCCTCTTAA.

[0009] Further, oligonucleotide sequences targeting the human CASP7 gene shRNA sequence were cloned. The forward oligonucleotide sequence of shRNA3 is: 5'- CCGGGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGCTTTTTG -3' (SEQ ID NO.8); the reverse oligonucleotide sequence of shRNA3 is: 5'- AATTCAAAAAGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGC -3' (SEQ ID NO.9).

[0010] This invention also provides a method for constructing a shRNA knockdown plasmid of the human CASP7 gene, specifically including the following steps: S1. Design the shRNA sequence of the human CASP7 gene as described above; S2. Synthesize and prepare the double-stranded DNA fragment expressed by the shRNA sequence; S3. Construction and packaging of the shRNA knockdown plasmid.

[0011] Preferably, in step S1, multiple interference target sequences are designed for the human CASP7 gene, and the shRNA sequence is selected by knockdown effect.

[0012] Preferably, step S2 specifically involves synthesizing a complementary oligonucleotide single strand based on the shRNA sequence described in step S1, and annealing the forward and reverse oligonucleotide sequences to form a double-stranded DNA fragment.

[0013] Preferably, step S3 specifically involves double digesting the pLKO.1 lentiviral vector plasmid to form a pLKO.1 lentiviral vector fragment with sticky ends; and ligating the double-stranded DNA fragment from step S2 with the pLKO.1 lentiviral vector fragment with sticky ends using a ligase to obtain the shRNA knockdown plasmid that inhibits the expression of the human CASP7 gene.

[0014] Furthermore, it also includes the following steps: S4. Verify the knockdown efficiency of the shRNA knockdown plasmid.

[0015] This invention also provides the application of the above-mentioned shRNA knockdown plasmid that inhibits the expression of the human CASP7 gene in the preparation of a non-small cell lung cancer therapeutic drug targeting the human CASP7 gene.

[0016] The shRNA knockdown plasmid designed in this invention targeting the human CASP7 gene can significantly reduce the expression levels of CASP7 mRNA and protein in non-small cell lung cancer cells, significantly increase the pyroptosis level of non-small cell lung cancer cells and inhibit the proliferation of cancer cells. This is of great significance for the treatment of non-small cell lung cancer and provides a foundation for in-depth research on the specific functions of CASP7 protein. Attached Figure Description

[0017] Figure 1 The graph shows the effect of real-time quantitative PCR on the inhibition of human CASP7 gene expression by CASP7 knockdown plasmid.

[0018] Figure 2 The graph shows the effect of Western blotting on the inhibition of human CASP7 gene expression by CASP7 knockdown plasmid.

[0019] Figure 3 A comparative diagram showing the inhibitory effect of CASP7 knockdown plasmid on the proliferation of A549 non-small cell lung cancer cells as evaluated by the CCK8 assay.

[0020] Figure 4 To detect the protein expression levels of Caspase-3 and GSDME in cells after CASP7 knockdown and PTX administration using Western blotting.

[0021] Figure 5 To detect the mRNA expression level of IL1β in cells after CASP7 knockdown and PTX administration using real-time quantitative PCR. Detailed Implementation

[0022] The following will describe in detail the concept and technical effects of the present invention with reference to the embodiments, so as to fully understand the purpose, features and effects of the present invention. However, it should be understood that the scope of protection of the present invention is not limited to the specific implementation.

[0023] Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative effort are all within the scope of protection of the present invention.

[0024] Example 1

[0025] This embodiment provides an shRNA knockdown plasmid that inhibits the expression of the human CASP7 gene (GenBank ID: NM_001227.5), and its preparation method is as follows: S1. Design three jamming target sequences for CASP7; The three shRNA target sequences for the human CASP7 gene are shown in Table 1. Table 1. Three jamming target sequences for CASP7 S2, the complementary oligonucleotide single strands required for the synthesis and expression of shRNA; Based on the target sequence designed in step S1, complementary oligonucleotide single strands of two sets of shRNA fragments targeting the human CASP7 gene were synthesized. The corresponding forward and reverse oligonucleotide sequences are shown in Table 2. Table 2. Forward and reverse oligonucleotide sequences corresponding to the three shRNAs targeting human CASP7 gene expression. S3, complementary single-stranded oligonucleotide chains anneal to form double-stranded DNA fragments; The synthesized forward and reverse oligonucleotide chains were prepared into a 10 μM solution by treating water with DEPC, according to the following ratio. Prepare the annealing system, mix well, and place it in a standard PCR instrument. Incubate at 95°C for 4 min, then at 70°C for 10 min. Afterward, transfer the system to a beaker containing 70°C water and allow it to cool naturally to room temperature to obtain the annealed double-stranded DNA fragment product. Table 3, Annealing System Preparation S4 and pLKO.1 lentiviral vector plasmids were subjected to double enzyme digestion and purified; (1) Prepare the double enzyme digestion system according to the following proportions, mix well, and place it in a conventional PCR instrument at 37°C. Process at 65℃ for 20 min, then store at 4℃. Table 4. Preparation of the double enzyme digestion system (2) After the reaction was completed, the obtained double enzyme digestion products were separated in a 1% agarose gel and purified using a common agarose gel DNA recovery kit to obtain the pLKO.1 lentiviral vector double enzyme digestion products. S5, double-stranded DNA fragment ligated with pLKO.1 lentiviral vector double enzyme digestion fragment, transformation, plasmid extraction and sequencing; (1) Prepare the enzyme ligation system according to the following ratio, mix well and place it in a conventional PCR instrument, and treat it at 16℃ for 30 min to obtain the ligation product. Table 5. Preparation of enzyme ligation system (2) The ligation product was transformed into competent Escherichia coli DH5α, single clones were picked and cultured overnight, plasmids were extracted and sequenced for identification.

[0026] Example 2

[0027] This embodiment provides a method for packaging lentiviruses using the pLKO.1-shCASP7 knockdown plasmid and the pLKO.1 vector plasmid. The correctly identified recombinant lentiviral plasmids pLKO.1-shCASP7 and pLKO.1 vector plasmids are used, and lentiviruses are packaged according to the Lipo2000 reagent instructions. The pLKO.1 vector plasmid serves as a negative control for detecting the effect of the shCASP7 knockdown plasmid on inhibiting human CASP7 gene expression. Using a 6-well cell culture plate as an example, the specific steps for lentivirus packaging are as follows: S1. Lentiviral plasmids were co-transfected into 293T cells; (1) Seed 293T cells into 6-well cell culture plates and cultured overnight at 37°C in a 5% CO2 incubator. When the cell density reached 50%, plasmid transfection was performed. (2) Take a 1.5 mL centrifuge tube A, add 125 μL of DMEM medium, and add 4.29 μg, 1.5 μg and 2.4 μg of pLKO.1-sh CASP7, pMD2.G and psPAX2 plasmids respectively. Mix well and let stand at room temperature for later use. (3) Take a new 1.5 mL centrifuge tube B, add 125 μL of DMEM medium and 8 μL of Lipo2000, and gently mix by inverting the tube. (4) Add all the mixture from centrifuge tube A to centrifuge tube B, gently invert to mix, and let stand at room temperature for 5 minutes; (5) Transfer the mixture from step (4) above to the wells of a 6-well cell culture plate inoculated with 293T cells, mix gently, and incubate at 37°C in a 5% CO2 incubator. After 6 h, replace the culture medium with fresh DMEM complete medium. S2. Collect, filter, and preserve the viral supernatant; (1) After culturing for 48 h, the cell culture supernatant was collected in a 10 mL centrifuge tube in a biosafety cabinet and temporarily stored at 4℃. At the same time, fresh DMEM medium was added to the 6-well cell culture plate and cultured for 24 h in a 37℃, 5% CO2 incubator. (2) Collect the cell culture supernatant again in the biosafety cabinet into a 10 mL centrifuge tube, combine the two supernatants, and gently mix by inverting the tube. (3) Filter the mixed supernatant through a 0.45 μm disposable syringe filter in a biosafety cabinet, aliquot it into 1.5 mL centrifuge tubes, and store at -80℃ for later use or for direct cell infection. The method for packaging lentivirus with pLKO.1 vector plasmid is the same as above.

[0028] Example 3

[0029] This embodiment provides a method for infecting A549 non-small cell lung cancer cells with lentiviral supernatant containing pLKO.1-shCASP7 knockdown plasmid and pLKO.1 vector plasmid, and uses real-time quantitative PCR and Western blotting to detect the levels of intracellular CASP7 mRNA and protein inhibited by the shCASP7 knockdown plasmid, respectively. Taking a 6-well cell culture plate as an example, the specific steps are as follows: S1, Virus infects A549 cells; A549 non-small cell lung cancer cells were seeded into 6-well cell culture plates and cultured overnight at 37°C in a 5% CO2 incubator. When the cell density reached 60%, A549 cells were infected with virus containing pLKO.1-shCASP7 recombinant plasmid and pLKO.1 vector plasmid, respectively. Polybrene was added to a final concentration of 10 μg / mL, and the cells were cultured for another 48 h at 37°C in a 5% CO2 incubator. S2, puromycin screening; After 48 h, the medium was replaced with fresh DMEM complete medium and cultured for another 24 h. Puromycin was added to a final concentration of 2 μg / mL. After screening for 7-14 days, A549 cells stably infected with lentivirus were obtained. Verification of the knockdown effect of S3 and shCASP7 knockdown plasmids; Stable cell lines infected with lentiviruses were collected, and two samples were prepared from each: one sample was used to extract total RNA and synthesize cDNA via reverse transcription, and the relative level of intracellular CASP7 mRNA was detected by real-time quantitative PCR; the other sample was used to extract total protein and detect the relative level of intracellular CASP7 protein by Western blotting. The results are shown below. Figure 1 and Figure 2 As shown. Compared with the control group shNC, all three shRNA target sequences targeting the human CASP7 gene could downregulate CASP7 mRNA and protein expression, with shRNA3 knockdown being less efficient.

[0030] Example 4

[0031] This embodiment provides an experiment for determining cell proliferation capacity using the CCK-8 assay.

[0032] Stable shRNA3 A549 cell lines with high human CASP7 gene silencing effect and negative control shNC A549 cells were selected and seeded at a density of 2000 cells / well in 96-well plates, with 8 replicates for each cell type. After culturing in a cell culture incubator at 37℃ and 5% CO2 for 0 h, 1 day, 2 days, and 3 days, CCK-8 working solution prepared according to the indicator instructions was added to each well. After returning to the cell culture incubator for another 1 h, the absorbance at 450 nm was measured using a multi-mode microplate reader to obtain the proliferation rate data for days 0, 1, 2, and 3. The cell viability calculation formula is: Cell viability (%) = (Absorbance value - Absorbance value of the 0 h group) / Absorbance value of the 0 h group × 100%. The results are shown below. Figure 3 As shown, knocking down the CASP7 gene in A549 non-small cell lung cancer cells significantly reduced cell proliferation.

[0033] Example 5

[0034] In this embodiment, the protein expression of Caspase-3 and GSDME was detected after administration of paclitaxel (PTX) to shNC and shCASP7 cells to verify the effect of CASP7 knockdown on pyroptosis. A549 shNC or A549 shCASP7 non-small cell lung cancer cells were seeded into 6-well cell culture plates and cultured overnight at 37°C in a 5% CO2 incubator. When the cell density reached 80%, the treatment group was administered PTX at a concentration of 6 μg / mL. After 24 hours of culture, the relative levels of intracellular Caspase-3 and GSDME proteins were detected by Western blotting. The results are shown below. Figure 4 As shown in the figure, compared with the control group shNC, the shRNA3 target sequence targeting the human CASP7 gene significantly increased the cleavage level of GSDME, indicating that knocking down CASP7 can increase the level of pyroptosis.

[0035] Example 6

[0036] This example describes the detection of IL1β mRNA expression in shNC and shCASP7 cells after administration of paclitaxel (PTX). A549 shNC or A549 shCASP7 non-small cell lung cancer cells were seeded into 6-well cell culture plates and cultured overnight at 37°C in a 5% CO2 incubator. When the cell density reached 80%, the treatment group was administered PTX at a concentration of 6 μg / mL. After 24 hours of culture, the relative level of intracellular IL1β mRNA was detected by real-time quantitative PCR. The results are shown below. Figure 5 As shown in the figure, compared with the control group shNC, the shRNA3 target sequence targeting the human CASP7 gene significantly increased the mRNA level of IL1β, indicating that knocking down CASP7 can increase the expression of cytokines in cells.

[0037] We conducted cell-level experiments using real-time quantitative PCR and Western blotting to detect the silencing effect of shRNA 1-3 sequences on A549 non-small cell lung cancer cell models that inhibit human CASP7 gene expression. We found that shRNA 3 was the optimal sequence, which significantly improved the pyroptosis level and inhibited cell proliferation in non-small cell lung cancer cells, further elucidating the current research on the biological function of CASP7.

[0038] The above description of the embodiments is provided to enable those skilled in the art to understand and apply the present invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the embodiments described herein, and any improvements and modifications made to the present invention by those skilled in the art based on the disclosure thereof should be within the scope of protection of the present invention.

[0039] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

Claims

1. A shRNA knockdown plasmid for inhibiting human CASP7 gene expression, characterized in that, The target sequence of the shRNA knockdown plasmid is shRNA3, specifically shRNA3 (SEQ ID NO.3): GCTTCGCCTGCATCCTCTTAA.

2. The shRNA knockdown plasmid according to claim 1, characterized in that, The forward oligonucleotide sequence of shRNA3 is: 5'-CCGGGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGCTTTTTG -3' (SEQ ID NO.8); the reverse oligonucleotide sequence of shRNA3 is: 5'-AATTCAAAAAGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGC -3' (SEQ ID NO.9).

3. A method for constructing an shRNA knockdown plasmid to inhibit human CASP7 gene expression, characterized in that, Includes the following steps: S1. Design multiple interference target sequences based on the CASP7 gene, and select the shRNA sequence with excellent knockdown effect; S2. Based on the shRNA sequence described in step S1, synthesize complementary oligonucleotide single strands, and anneal the forward and reverse oligonucleotide sequences to form double-stranded DNA fragments. S3. The pLKO.1 lentiviral vector plasmid is double-digested with enzymes to form a pLKO.1 lentiviral vector fragment with sticky ends. S4. Based on the double-stranded DNA fragment described in step S2 and the pLKO.1 lentiviral vector fragment described in S3, the two are ligated using a ligase to obtain a knockdown plasmid containing the pLKO.1 lentiviral vector and the shRNA sequence containing the human CASP7 gene expression as described in claim 1.

4. The method for constructing an shRNA knockdown plasmid to inhibit human CASP7 gene expression according to claim 3, characterized in that, The oligonucleotide sequences in step S2 include the following forward and reverse oligonucleotide sequences: The forward oligonucleotide sequence of the shRNA3 is as follows: 5'-CCGGGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGCTTTTTG-3'; The reverse oligonucleotide sequence of shRNA3 is: 5'-AATTCAAAAAGCTTCGCCTGCATCCTCTTAACTCGAGTTAAGAGGATGCAGGCGAAGC-3'.

5. The method for constructing an shRNA knockdown plasmid to inhibit human CASP7 gene expression according to claim 3, characterized in that, It also includes the following steps: S5. Verify the knockdown efficiency of the shRNA plasmid.

6. The shRNA knockdown plasmid for inhibiting human CASP7 gene expression according to any one of claims 1-2, characterized in that, The shRNA knockdown plasmid was used to construct a latently infected cell model that inhibits the nucleic acid and protein expression of the human CASP7 gene.

7. The use of the shRNA knockdown plasmid that inhibits human CASP7 gene expression as described in any one of claims 1-2 in the preparation of a non-small cell lung cancer therapeutic drug targeting CASP7 as a therapeutic target.