Application of Parp7 overexpression reagent in preparation of medicine for treating hypertensive nephropathy and protecting acute kidney injury caused by sepsis

Abstract

The invention provides application of a Parp7 overexpression reagent in preparation of drugs for treating hypertensive nephropathy and protecting acute kidney injury caused by sepsis, and belongs to the technical field of biological medicine. According to the application disclosed by the invention, the pathological processes of the two diseases can be effectively relieved by increasing the expression level of Parp7 in the renal proximal tubule epithelial cells in a targeted manner. The invention further provides an adeno-associated virus vector comprising a renal proximal tubule epithelial cell specific promoter, a nucleotide sequence encoding Parp7 protein, and a transcription termination signal sequence. Experiments show that the strategy can significantly improve renal function indexes, relieve pathological injury of kidney tissues and inhibit local inflammatory response in an animal model. The invention provides a brand new target spot and gene therapy strategy for the treatment of hypertensive nephropathy and sepsis acute kidney injury.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of reagents that overexpress Parp7 in the preparation of drugs for treating hypertensive nephropathy and protecting against acute kidney injury in sepsis. Background Technology

[0002] Hypertensive nephropathy is one of the most common target organ damages caused by hypertension. Poor long-term blood pressure control can lead to progressive tubulointerstitial fibrosis, glomerular sclerosis, and renal failure. Its pathogenesis involves multiple pathophysiological processes, including hemodynamic changes, activation of the renin-angiotensin system, inflammatory responses, and oxidative stress. Currently, clinical treatment for hypertensive nephropathy mainly relies on antihypertensive drugs (such as angiotensin-converting enzyme inhibitors and angiotensin II receptor antagonists) to control blood pressure and slow disease progression. However, there is still a risk that some patients do not respond well to these drugs and that the disease continues to progress to end-stage renal disease. Therefore, developing novel treatment strategies that can target key pathological processes in the kidneys and provide more direct renal protection is of significant clinical importance.

[0003] Sepsis is a life-threatening organ dysfunction caused by a dysregulation of the host response to infection, and acute kidney injury (AKI) is one of the most common and serious complications of sepsis. The pathological mechanisms of AKI in sepsis are complex, involving uncontrolled systemic inflammatory responses, microcirculatory disturbances, mitochondrial dysfunction, and programmed cell death. Despite advances in supportive care, the morbidity and mortality rates of AKI remain high, and there are currently no specific and effective treatments available clinically. Intervention targeting its core inflammatory pathways or key regulatory molecules represents a highly promising research direction.

[0004] Poly(ADP-ribose) polymerase 7 (Parp7, also known as Tiparp), a member of the PARP family, is believed to play a role in DNA damage repair, transcriptional regulation, and inflammatory responses. Existing research suggests that Parp7 may act as a negative regulator of inflammation and stress responses. For example, existing technology (CA3211149A1) discloses that Parp7 inhibitors can be used to treat sepsis, suggesting that inhibiting Parp7 activity may exacerbate inflammatory responses. However, the specific role of Parp7 in stress-induced injury in specific organs (such as the kidneys), particularly its function in proximal tubular epithelial cells—a key kidney cell type—remains unclear. Furthermore, no studies have revealed a specific relationship between Parp7 activity (e.g., overexpression) and two different etiologies of kidney injury: hypertensive nephropathy and septic acute kidney injury, nor are there any technological indications suggesting the treatment or protection against these diseases by targeting and upregulating Parp7 expression in renal tubular epithelial cells.

[0005] In conclusion, developing novel therapeutic drugs based on kidney cell-specific targets for hypertensive nephropathy and septic acute kidney injury, two common clinical diseases with urgent treatment needs, has significant theoretical value and promising prospects for clinical translation. Summary of the Invention

[0006] The purpose of this invention is to provide the use of agents overexpressing Parp7 in the preparation of medicaments for treating hypertensive nephropathy and protecting against acute kidney injury in sepsis.

[0007] This invention provides the use of agents that overexpress Parp7 in the preparation of medicaments for treating hypertensive nephropathy and protecting against acute kidney injury caused by sepsis.

[0008] Furthermore, the reagent for overexpressing Parp7 is an adeno-associated virus vector that overexpresses Parp7.

[0009] Furthermore, the adeno-associated virus vector is an AAV9 serotype vector.

[0010] Furthermore, the reagent for overexpressing Parp7 comprises a renal proximal tubular epithelial cell-specific promoter and a nucleotide sequence encoding the Parp7 protein.

[0011] Furthermore, the specific promoter for the proximal tubular epithelial cells of the kidney is the sglt2 gene promoter.

[0012] Furthermore, the nucleotide sequence encoding the Parp7 protein is shown in SEQ ID NO:1.

[0013] Furthermore, the hypertensive nephropathy is renal impairment, glomerular sclerosis, and renal interstitial fibrosis caused by angiotensin II-induced hypertension.

[0014] Furthermore, the septic acute kidney injury refers to acute renal dysfunction, renal tubular damage, and inflammatory response caused by lipopolysaccharide-induced sepsis.

[0015] The present invention also provides an AAV9-sglt2-Parp7 adeno-associated virus vector, wherein the vector comprises an sglt2 gene promoter and a nucleotide sequence encoding the Parp7 protein; the nucleotide sequence encoding the Parp7 protein is shown in SEQ ID NO:1.

[0016] The present invention also provides a pharmaceutical composition comprising the above-described AAV9-sglt2-Parp7 adeno-associated virus vector as an active ingredient, and a pharmaceutically acceptable carrier or excipient.

[0017] The present invention has achieved the following beneficial effects: This invention discovers that targeted upregulation of Parp7 expression in proximal renal tubular epithelial cells can effectively alleviate hypertensive nephropathy and septic acute kidney injury, providing a novel and clear intervention target and pathway for the treatment of these two diseases. By employing a proximal renal tubular epithelial cell-specific promoter (such as the Sglt2 promoter) to drive gene expression, this invention can precisely limit the therapeutic effect to key diseased cells in the kidney, improving local efficacy while potentially significantly reducing systemic side effects and demonstrating good safety potential. Animal experiments show that proximal renal tubule-specific overexpression of Parp7 can significantly improve renal function indicators in two kidney injury models (septic AKI and hypertensive nephropathy), alleviate characteristic pathological damage (such as renal tubular injury and fibrosis), and inhibit local renal inflammatory responses, confirming the effectiveness of this treatment strategy from both functional and structural perspectives. The gene therapy vector (such as AAV9) used in this invention is mature and has high safety. The constructed modular design of "tissue-specific promoter + therapeutic gene" is clear, providing a direct and feasible technical solution for developing novel gene therapy drugs or targeted delivery systems for kidney diseases, and has clear clinical translational value.

[0018] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0019] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0020] Figure 1 This is a vector map.

[0021] Figure 2 These are the sequencing alignment results.

[0022] Figure 3 For AAV9- Sglt2 - Parp7 Alleviating LPS-induced acute renal dysfunction, inflammation, and histopathological damage: (A) Schematic diagram of experimental procedure: AAV9- is administered via tail vein injection. Sglt2 -Vector or AAV9- Sglt2 - Parp7 Mice were given a total dose of 2 × 10⁻⁶. 11 vg. Four weeks later, AAV9- Sglt2 -Vector or AAV9- Sglt2 - Parp7Mice were intraperitoneally injected with normal saline (NS) or lipopolysaccharide (LPS, 10 mg / kg, 6 h). (BC) Renal function was assessed by measuring blood urea nitrogen (BUN, B) and serum creatinine (CRE, C). (DE) Representative histological images of renal tissue sections stained with hematoxylin-eosin (H&E, D) and glycogen (PAS, E). (FI) Representative images of F4 / 80 (F) and CD11b (H) immunohistochemical staining, and corresponding statistical analyses (G, I). (JM) AAV9- Sglt2 -Vector and AAV9- Sglt2 - Parp7 Kidney tissue of mice after injection of NS or LPS Ifn-β (J) Tnf-α (K) Il-6 (L) and Il-1β (M) mRNA level.

[0023] Figure 4 AAV9 -Sglt2-Parp7 Relief of AngII-induced hypertensive nephropathy: (A) Schematic diagram of experimental procedure: AAV9- is injected via tail vein. Sglt2 -EV or AAV9- Sglt2 - Parp7 Mice were given a total dose of 2 × 10⁻⁶. 11 vg. Four weeks later, AAV9- Sglt2 -EV or AAV9- Sglt2 - Parp7 A hypertensive nephropathy model was induced in mice by subcutaneous micropump perfusion with Ang II. (BD) Renal function and degree of renal injury were assessed by measuring BUN (B), serum CRE (C), and the kidney injury-associated protein KIM-1 (D). (E) Representative histological images of PAS-stained kidney tissue sections. (F) Representative images of Masson-stained kidney sections. (G) Representative images of Sirius Red-stained kidney sections. (HK) AAV9- Sglt2 -EV and AAV9- Sglt2 - Parp7 mouse kidney tissue Ifn-β (H) Tnf-α (I) Il-6 (J) and Il-1β (K) mRNA levels. Detailed Implementation

[0024] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0025] Example 1, AAV9- sglt2 - Parp7 (Tiparp)Preparation of adeno-associated virus vector I. AAV9- sglt2 - Parp7 (Tiparp) Preparation of adeno-associated virus vector 1. Vector and target gene information 1.1 Purpose Carrier Information Carrier spectrum as follows Figure 1 As shown.

[0026] 1.2 Target gene sequence information: The target gene of this invention is Parp7 ( Tiparp Its complete encoded nucleotide sequence (SEQ ID No. 1) is as follows:

[0027] 2. Vector enzyme digestion The vector was double-digested with restriction endonucleases KpnI and HindIII to obtain a linearized vector homologous to the ends of the target fragment. The digestion system (total volume 40 µL) was prepared according to Table 1 and reacted at 37℃ for 1–2 hours. After the reaction was complete, the target band was recovered by agarose gel electrophoresis.

[0028] Table 1. Vector Enzyme Digestion System 3. Acquisition of the target fragment 3.1 Primer Design: Parp7 The gene sequence was synthesized as a whole and cloned into a vector. Using this plasmid as a template, the target fragment was amplified by PCR using specific primers.

[0029] 3.2 PCR amplification of the target fragment Prepare the PCR amplification system as shown in Table 2, mix gently, and place in a PCR instrument for reaction. The PCR program is shown in Table 3.

[0030] Table 2 PCR amplification system The nucleotide sequence (SEQ ID No. 2) of primer F (AAV-m-Tiparp-F) is gtctagagctagcactagtggtaccaGCCACCatggaagtggaaaccac; the nucleotide sequence (SEQ ID No. 3) of primer R (AAV-m-Tiparp-R) is CTTGTCATCGTCATCCTTGTAGTCaatggaaacagtgttactgacttc.

[0031] Table 3 PCR Procedure 4. Ligation of the target fragment to the vector Using HB Infusion TM One-step cloning connection system: Prepare the reaction system as shown in Table 4 in an ice-water bath. After reacting the connected reaction solution at 50°C for 30 min, place it on ice for 5 min and immediately convert it.

[0032] Table 4 Reaction System 5. Transformation 1) Take the DH5α competent cells out of the -80℃ freezer and thaw them on ice. The competent cells should be handled gently during the dispensing process to reduce mechanical damage. 2) After the competent cells have thawed, dispense them into 50 μL tubes (20 μL is sufficient for plasmid transformation). After dispensing, add the ligation product in an amount not exceeding 1 / 10 of the competent cell volume (in this embodiment of the invention, 5 μL of ligation product is added), and place on ice for 20-30 min. 3) Heat shock at 42℃ for 90 seconds, and immediately after heat shock, insert into ice for 2-3 minutes for incubation; In a clean bench, add 500 μL of antibiotic-free LB medium and gently invert the container 3-5 times. 5) Incubate at 37℃ and 230 rpm with shaking for 45-60 min; 6) Spread the bacterial solution evenly onto the corresponding resistant solid plate, then invert the plate and incubate it in a 37℃ incubator for 12-16 hours.

[0033] 6. Bacterial culture PCR identification 6.1 Bacterial PCR Identification System Table 5. Bacterial PCR Identification System The nucleotide sequence (SEQ ID No. 4) of primer 1 (SGLT2-F) is tccagggctggttaatcttc; the nucleotide sequence (SEQ ID No. 5) of primer 2 (WPRE-R) is ACAAAGGCATTAAAGCAGCG.

[0034] 6.2 Bacterial PCR Identification Procedure Table 6. Procedure for bacterial culture PCR identification 7. Sequencing Two of the selected positive clones were used for sequencing and comparison analysis.

[0035] 7.1 Sequencing results: The following is an example of some sequencing results (SEQ ID NO:6): 7.2 Sequencing Alignment Results Sequencing alignment results as follows Figure 2 As shown, the green area represents the portion that matches the target sequence.

[0036] 8. Plasmid extraction After successful sequencing, the bacterial culture is amplified, and plasmids are extracted and purified. The plasmid extraction protocol should be followed according to the instructions of the extraction kit.

[0037] two . AAV9 -sglt2-parp7 Adeno-associated virus packaging and quality testing 1. Adeno-associated virus packaging 1.1 Day 1: AAV-293 cells were passaged into 100 mm Petri dishes for transfection. After the procedure, the dishes were placed in an incubator at 37°C, 5% CO2, and 95% relative humidity.

[0038] 1.2 Day 3: Transfection 1.3 Cell observation: Transfection can be performed once the cell density reaches a confluence of approximately 80-90%.

[0039] 1.4 Liposome transfection: Opti MEM needs to be preheated in a 37°C water bath, Lipofiter TM The transfection reagent must be brought to room temperature before use, and must be shaken well before use.

[0040] The transfection complex components required for transfecting 100 mm petri dishes are shown in Table 8. Table 8 Components of the transfection complex 1.5 Medium change: Replace with fresh complete medium containing 10% fetal bovine serum (FBS) 6 h after transfection.

[0041] 1.6 Cell collection: 72 h after transfection, cells containing AAV particles were gently scraped off with a cell scraper and collected in a 15 mL centrifuge tube. The cells were collected by centrifugation at 150 × g for 3 min, the culture supernatant was removed, the cells were washed once with PBS, and finally the cells were resuspended in 300 μL PBS.

[0042] 1.7 Cell lysis: Prepare a 37°C constant temperature water bath and liquid nitrogen. Repeat the freeze-thaw cycle three times between liquid nitrogen and the 37°C water bath. Remove cell debris and collect the lysate supernatant containing AAV particles.

[0043] 2. Purification of adeno-associated virus 2.1 Totipotency nuclease treatment: Add 0.1 μL of Benonase enzyme to each 1 mL of crude virus extract, incubate at 37℃ for 1 h to remove cellular genome and residual plasmid DNA from the viral solution. Centrifuge at 600 × g, 4℃ for 10 min, and collect the supernatant.

[0044] 2.2 Column purification 2.3 Add 4 mL of AAV virus sample liquid obtained from column purification to an ultrafiltration tube, centrifuge at 1400 × g for 30 min to obtain approximately 1 mL of AAV. Collect the finally purified virus and store it at -80℃.

[0045] Example 2, AAV9 -sglt2-parp7 Protective effect in acute kidney injury and hypertensive nephropathy caused by sepsis I. Experimental Methods 1. Animal experiments Recombinant adeno-associated virus type 9 (AAV9) carrying Parp7 (NM_178892.5) or empty vector (EV) cDNA and driven by the renal proximal tubular epithelial cell-specific promoter Sglt2 was injected into mice via tail vein. The total viral dose was 2 × 10⁻⁶. 11 Viral genome. Four weeks after AAV9 injection, an acute kidney injury model was established by intraperitoneal injection of LPS (10 mg / kg, acting for 6 hours), or a hypertensive nephropathy model was established by continuous administration of angiotensin II (Ang II, 1000 ng / kg / min, for 4 weeks) via subcutaneous implantation of a micro-osmotic pump. Subsequently, mice were euthanized under sodium pentobarbital anesthesia, and blood and kidney tissue were collected and preserved for subsequent analysis.

[0046] 2. Serum biochemical analysis Serum BUN and Cr levels were determined using a blood urea nitrogen kit (BUN, C013-2-1) and a creatinine kit (Cr, C011-2-1) manufactured by Nanjing Jiancheng Bioengineering Institute. All procedures were strictly performed according to the kit instructions. Data were analyzed spectrophotometrically using a Multiskan GO microplate reader from Thermo Fisher Scientific.

[0047] 3. Kidney histology and immunohistochemistry Kidney tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and prepared into sections of a certain thickness for histological staining and analysis. Hematoxylin-eosin (H&E, G1120, Solarbio), glycogen staining (PAS, C0142S, Beyotime), Masson's trichrome staining (Masson, G1340, Solarbio), and Sirius Red staining (Sirius Red, G1472, Solarbio) were used to stain kidney sections to assess the degree of histopathological damage and fibrosis. All staining procedures were strictly performed according to the reagent instructions. Images of stained sections were acquired under an optical microscope (ZEISS), and quantitative analysis was performed using ImageJ software.

[0048] To analyze the distribution of inflammatory cells and PARP7 expression, immunohistochemical staining was performed to detect F4 / 80, CD11b, and PARP7. Tissue sections were incubated overnight at 4°C with anti-PARP7 antibody (ab200390, Abcam, 1:200), anti-F4 / 80 antibody (70076, CST, 1:200), and anti-CD11b antibody (ab133357, Abcam, 1:200), respectively. After washing with PBS, immunoreactivity was detected using HRP-labeled secondary antibody and diaminobenzidine (DAB, DA1010, Solarbio), followed by hematoxylin counterstaining. All images were captured and recorded under a light microscope (ZEISS).

[0049] 4. RNA extraction and real-time quantitative PCR Total RNA was extracted from kidney tissue using a rapid RNA purification kit (RN001, ES Science), strictly following the kit's instructions. Subsequently, the purified RNA was reverse transcribed into cDNA using Prime Script RT Master Mix (RR036A, Takara). SYBR Green was used in a real-time quantitative PCR system. TM Quantitative PCR was performed using Premix Ex Taq™ II (RR820A, Takara). Primers used in the experiment (including...) Ifn-β , Tnf-α , Il-6 , Il-1β and internal reference β- actin All were synthesized by Invitrogen. The mRNA expression level of the target gene was normalized using β-actin as an internal reference, and 2... -△△CT The relative expression level is calculated using this method.

[0050] Table 1 Primers for RT-qPCR 5. Western blotting Proteins were extracted from kidney tissue and lysed using RIPA lysis buffer (AR0101, Boster). Protein concentration was determined using a BCA protein assay kit (P0009, Beyotime). Equal volumes of protein were separated by SDS-PAGE electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore). Non-specific binding sites on the membrane were blocked with BSA for 2 hours, followed by overnight incubation with primary antibody at 4°C. The membrane was then incubated with HRP-labeled secondary antibody at room temperature for 2 hours. Protein bands were visualized using an ECL luminescent reagent (WBKLS0500, Merck Millipore), and protein band quantification was performed using ImageJ software.

[0051] 6. Statistical Analysis All experiments were randomized and blinded. Data from in vitro and in vivo experiments are expressed as mean ± standard error of mean (SEM). Student's t-test was used to compare two groups. One-way ANOVA with multiple comparisons was used to compare multiple groups (GraphPad Prism 10.0). In this study, a p-value <0.05 was considered statistically significant.

[0052] II. Experimental Results 1. AAV9 -sglt2-parp7 Alleviating LPS-induced acute renal dysfunction, inflammation, and histopathological damage To investigate the specific function of PARP7 in renal proximal tubular epithelial cells, this invention uses the PARP7-based formulation constructed in Example 1. Sglt2 AAV9 starter driver -sglt2-parp7 The carrier, administered via tail vein injection, is introduced into the proximal tubular epithelial cells of the kidney. Parp7 Targeted overexpression of genes ( Figure 3 A). Empty vector (EV) was injected as a control. Four weeks later, a mouse model of acute kidney injury due to sepsis was established by intraperitoneal injection of lipopolysaccharide (LPS). Experimental results showed that AAV9... -sglt2-parp7 In treated mice, LPS-induced kidney injury was significantly reduced, as evidenced by decreased serum blood urea nitrogen (BUN). Figure 3 B) and creatinine (CRE) Figure 3 C) levels decreased. H&E ( Figure 3 D) and PAS ( Figure 3 E) Staining showed that LPS-induced renal tubular damage, including luminal dilation, epithelial cell flattening, and brush border loss, was observed in AAV9. -sglt2-parp7The inflammation was significantly reduced in the treated mice. Subsequently, immunohistochemical analysis of kidney tissue sections was performed to assess inflammatory cell infiltration. The results showed that overexpression of PARP7 in proximal tubular epithelial cells significantly reduced lipopolysaccharide (LPS)-induced F4 / 80 inflammatory responses. + and CD11b + Macrophage infiltration ( Figure 3 FI). Furthermore, real-time quantitative polymerase chain reaction (RT-qPCR) analysis showed that in AAV9... -sglt2-parp7 In treated mice, LPS-induced upregulation of pro-inflammatory cytokines ( Figure 3 JM was relieved. In summary, these findings suggest that specific overexpression of PARP7 in proximal renal tubular epithelial cells can protect the body from LPS-induced acute renal dysfunction, inflammation, and histopathological damage.

[0053] 2. AAV9 -sglt2-parp7 Relieving AngII-induced hypertensive nephropathy For further evaluation PARP7 The role of this invention in a chronic kidney disease model was validated in a hypertensive nephropathy model. Figure 4 A). Also using AAV9 -sglt2-parp7 The vector achieved specific overexpression of angiotensin II (Ang II) in the proximal tubules of the kidney. Four weeks after tail vein injection, a mouse model of hypertensive nephropathy was established by continuous administration of angiotensin II via a subcutaneously implanted micro-osmotic pump. The results showed that specific overexpression of PARP7 in proximal tubule cells significantly reversed the Ang II-induced increases in serum creatinine (Cr), blood urea nitrogen (BUN), and KMI-1 protein levels. Figure 4 BD). Similarly, PAS staining showed that, compared with EV+Ang II mice, AAV9 -sglt2-parp7 +Ang II mice showed reduced mesangial expansion ( Figure 4 E). Furthermore, Masson and Sirius red staining results showed that proximal tubular cell-specific overexpression of PARP7 had a protective effect against hypertension-induced renal fibrosis. Figure 4 FG). Furthermore, proximal tubule cell-specific overexpression of PARP7 significantly reduced angiotensin II-induced renal inflammation, which from... Ifnb1 , Tnfa , Il6 and Il1b This was confirmed at the mRNA level ( Figure 4 HK).

[0054] In summary, the results of this experiment demonstrate that, through AAV9 -sglt2-parp7The vector enables specific overexpression of PARP7 in proximal tubular epithelial cells of the kidney, which can effectively alleviate Ang II-induced hypertensive nephropathy, improve renal function, reduce glomerular sclerosis and renal interstitial fibrosis, and inhibit local inflammatory response in the kidney.

Claims

1. Use of reagents that overexpress Parp7 in the preparation of drugs for treating hypertensive nephropathy and protecting against acute kidney injury caused by sepsis.

2. The use according to claim 1, characterized in that, The reagent used to overexpress Parp7 is an adeno-associated virus vector that overexpresses Parp7.

3. The use according to claim 2, characterized in that, The adeno-associated virus vector is an AAV9 serotype vector.

4. The use according to claim 3, characterized in that, The reagent for overexpressing Parp7 contains a renal proximal tubular epithelial cell-specific promoter and a nucleotide sequence encoding the Parp7 protein.

5. The use according to claim 4, characterized in that, The specific promoter for the proximal tubular epithelial cells of the kidney is the sglt2 gene promoter.

6. The use according to claim 4, characterized in that, The nucleotide sequence encoding the Parp7 protein is shown in SEQ ID NO:

1.

7. The use according to any one of claims 1 to 6, characterized in that, Hypertensive nephropathy is defined as renal impairment, glomerular sclerosis, and renal interstitial fibrosis caused by angiotensin II-induced hypertension.

8. The use according to any one of claims 1 to 6, characterized in that, The acute kidney injury in sepsis is defined as acute renal dysfunction, renal tubular damage, and inflammatory response caused by lipopolysaccharide-induced sepsis.

9. An AAV9-sglt2-Parp7 adeno-associated virus vector, characterized in that, The vector contains the sglt2 gene promoter and a nucleotide sequence encoding the Parp7 protein; the nucleotide sequence encoding the Parp7 protein is shown in SEQ ID NO:

1.

10. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the AAV9-sglt2-Parp7 adeno-associated virus vector of claim 9 as the active ingredient, and a pharmaceutically acceptable carrier or excipient.

Images