Application of VPS53 in intervention target of thyroid cancer caused by long-term low-dose ionizing radiation

Abstract

The application provides application of VPS53 in intervention target of thyroid cancer caused by long-term low-dose ionizing radiation, and belongs to the technical field of biological medicine.The application takes VPS53 as the intervention target of thyroid cancer caused by long-term low-dose ionizing radiation, finds that the copy number of VPS53 gene increases after long-term low-dose irradiation, and the expression level of VPS53 increases.In the thyroid cancer cell line with high expression of VPS53, the expression of VPS53 is knocked down, the proliferation, migration and invasion ability is weakened, the tumor volume is smaller, and the tumor grows more slowly;in the thyroid cancer cell line with low expression of VPS53, the expression of VPS53 is overexpressed, the proliferation, invasion and migration ability is enhanced, the tumor volume is larger, and the tumor grows faster.The application proves that knocking down VPS53 is a candidate intervention target of the occurrence and development of thyroid cancer caused by long-term low-dose ionizing radiation.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of VPS53 as an intervention target for thyroid cancer induced by long-term low-dose ionizing radiation. Background Technology

[0002] Thyroid carcinoma (TC) is the most common malignant tumor of the human endocrine system, accounting for approximately 94.5% of all endocrine tumors and 3% of all systemic malignant tumors. Ionizing radiation is a clearly defined high-risk factor for thyroid cancer, especially in children and adolescents whose thyroid tissue is highly sensitive. Radiation exposure dose is positively correlated with the risk of developing thyroid cancer, primarily differentiated thyroid cancer. Early screening and treatment lead to better prognosis.

[0003] The thyroid gland is one of the most sensitive organs in the human body to ionizing radiation. Thyroid cells proliferate actively and can accumulate iodine (which radiation easily targets and binds to). Ionizing radiation can damage thyroid cell DNA, causing gene mutations, leading to abnormal cell proliferation and eventually cancer. The younger the age of exposure, the higher the sensitivity, and the risk is dozens of times higher than that of adults. As adults age, their sensitivity gradually decreases.

[0004] Over 90% of thyroid cancers caused by ionizing radiation are differentiated thyroid cancers (papillary carcinoma is the most common, followed by follicular carcinoma), characterized by low malignancy and slow progression. Early stages are often asymptomatic, with only a palpable painless nodule in the neck. Later stages may present with hoarseness, difficulty swallowing, and enlarged cervical lymph nodes. Therefore, screening for thyroid cancer caused by ionizing radiation is challenging, generally requiring regular thyroid ultrasounds in exposed individuals, and fine-needle aspiration biopsy when nodules are suspicious. Given that thyroid cancer (TC) is a rapidly increasing and common tumor that has received considerable attention, researching the regulatory mechanisms of TC formation and development to improve early intervention and treatment is an urgent need in my country and worldwide. Summary of the Invention

[0005] This invention provides the application of VPS53 as an intervention target for thyroid cancer induced by long-term low-dose ionizing radiation, which can be used as an intervention target for the occurrence and development of thyroid cancer induced by long-term low-dose ionizing radiation.

[0006] This invention provides the application of a reagent for detecting VPS53 expression levels in the preparation of kits for assessing the occurrence, development, and / or prognosis of thyroid cancer.

[0007] In one specific embodiment of the present invention, the reagent includes a reagent for detecting the content of VPS53 in cells and / or the expression level of the encoding gene.

[0008] In one specific embodiment of the present invention, when VPS53 is highly expressed, the probability of thyroid cancer development and progression increases, and the prognosis is poor.

[0009] The present invention also provides the application of a reagent for regulating the expression level of VPS53 in the preparation of drugs that inhibit the occurrence and development of thyroid cancer, wherein the regulation includes inhibiting the expression of VPS53 or knocking out VPS53.

[0010] In one specific embodiment of the present invention, the thyroid cancer includes thyroid cancer caused by long-term low-dose ionizing radiation.

[0011] In one specific embodiment of the present invention, the low dose includes a single dose not exceeding 0.01 Gy.

[0012] In one specific embodiment of the present invention, the effects of the drug include at least one of the following: inhibiting cell proliferation, reducing invasiveness, decreasing migration ability, inhibiting tumor volume increase, and inhibiting tumor growth rate.

[0013] The present invention also provides a drug for inhibiting the occurrence and development of thyroid cancer, the active ingredient of which includes a reagent for inhibiting or knocking out VPS53 expression, and also includes pharmaceutically acceptable excipients.

[0014] In one specific embodiment of the present invention, the inhibition of VPS53 expression includes inhibiting the expression of VPS53 using shRNA.

[0015] In one specific embodiment of the present invention, the designed shRNA sequence is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0016] Beneficial Effects: This invention involves long-term low-dose irradiation of normal human thyroid follicular epithelial cells. Long-term low-dose irradiation enhances the proliferation capacity of thyroid follicular epithelial cells and increases soft agar colony formation. Malignant clones are then screened and their whole genomes are sequenced. Sequencing results show that, compared with the control group, the copy number of the VPS53 gene is increased in the long-term low-dose irradiation group. By constructing a VPS53 plasmid and lentiviral vector, the shRNA sequence was introduced into the VPS53-overexpressing thyroid cancer cell lines BCPAP and 8305C, establishing long-term stable VPS53 knockdown thyroid cancer cell lines. Compared with the control group, in the stably knocked-down VPS53 thyroid cancer cell lines, cell proliferation, colony formation, invasion, and migration were weakened. Overexpression of VPS53 in the low-expressing VPS53 thyroid cancer cell lines K1 and CAL-62 enhanced cell proliferation, colony formation, invasion, and migration. In the nude mouse tumorigenesis experiment, compared with the control group, the subcutaneous tumors of nude mice with thyroid cancer cells overexpressing VPS53 were larger and grew faster; the subcutaneous tumors of nude mice with thyroid cancer cells knocked down VPS53 were smaller and grew slower, suggesting that knocking down VPS53 can significantly inhibit the growth of xenograft tumors of thyroid cancer. Based on the above results, VPS53 is a candidate intervention target for inhibiting the occurrence and development of thyroid cancer induced by long-term low-dose ionizing radiation. Attached Figure Description

[0017] Figure 1 This diagram illustrates the malignant transformation of thyroid follicular epithelial cells induced by long-term low-dose ionizing radiation and the screening of candidate target genes. A: Schematic diagram of malignant transformation of thyroid follicular epithelial cells induced by long-term low-dose ionizing radiation; B: Whole-genome sequencing indicates frequent copy number variations during malignant transformation; C: The gene VPS53, associated with poor prognosis in thyroid cancer, was screened; D: Immunohistochemistry of VPS53 in thyroid cancer patient tissue microarrays shows high expression of VPS53 in thyroid cancer tissues. Figure 2 This diagram illustrates the expression of VPS53 in thyroid-associated cells and the construction of stable cell lines. In the diagram: A: Gene expression level of VPS53 in thyroid-associated cells; B: Protein expression level of VPS53 in thyroid-associated cells; C: Stable knockdown of VPS53 in BCPAP cells; D: Stable knockdown of VPS53 in 8305C cells; E: Stable expression of VPS53 in K1 cells; F: Stable knockdown of VPS53 in CAL-62 cells. Figure 3The figure shows the results of VPS53 expression level and proliferation ability of thyroid cancer cell lines. In the figure, A: VPS53 knockdown by BCPAP and 8305C inhibits colony formation; B: VPS53 overexpression by K1 and CAL-62 enhances colony formation; C: VPS53 knockdown by BCPAP and 8305C inhibits proliferation; D: VPS53 overexpression by K1 and CAL-62 enhances proliferation. Figure 4 The figure shows the correlation between VPS53 expression level and the migration and invasion ability of thyroid cancer cell lines. In the figure, A: BCPAP knockdown of VPS53 inhibits migration and invasion ability; B: 8305C knockdown of VPS53 inhibits migration and invasion ability; C: K1 overexpression of VPS53 enhances invasion and migration ability; D: CAL-62 overexpression of VPS53 enhances invasion and migration ability. Figure 5 The figure shows the results of knocking down VPS53 to inhibit the growth of thyroid cancer xenografts. In the figure, A: BCPAP knockdown of VPS53 reduced the volume and weight of tumors in nude mice; B: K1 overexpression of VPS53 increased the volume and weight of tumors in nude mice. Detailed Implementation

[0018] This invention provides the application of a reagent for detecting VPS53 expression levels in the preparation of kits for assessing the occurrence, development, and / or prognosis of thyroid cancer.

[0019] The VPS53 (Vacuolar Protein Sorting-Associated Protein 53), Gene ID: 55275, described in this invention, is located at 17p13.3 (the terminal of the short arm, adjacent to the TP53 gene region) on the human chromosome. It encodes the VPS53 protein, which is approximately 680-709 amino acids in length and contains a conserved N-terminal domain and a homologous domain of Munc13. It is located in the trans-Golgi network (TGN) and cytoplasm. As a core subunit of the GARP complex (Golgi-associated retrograde protein complex), VPS53 mediates retrograde transport of intracellular vesicles, maintaining homeostasis of the metabolic cycle between the Golgi apparatus and endosomes. Within the cell, it is primarily responsible for the transport and recycling of substances between endosomes and lysosomes. VPS53 helps transport proteins from endosomes back to the Golgi apparatus, ensuring that these proteins are correctly distributed throughout the cell.

[0020] In this embodiment of the invention, a thyroid cell model induced by long-term low-dose ionizing radiation was constructed. Compared with normal cells, the thyroid follicular epithelial cells in the long-term low-dose irradiation group showed enhanced proliferative capacity. Malignant clones were screened from these cells, and whole-genome sequencing of the malignant clones revealed that the copy number of the VPS53 gene was increased in the long-term low-dose irradiation group, which has the potential to serve as a biomarker for the occurrence and development of thyroid cancer induced by long-term low-dose ionizing radiation. Furthermore, high expression of VPS53 was associated with an increased probability of thyroid cancer occurrence and development, and a poor prognosis.

[0021] The reagents described in this invention include those for detecting the content of VPS53 in cells and / or the expression level of its encoding gene. The content of the VPS53 gene and / or the expression level of its encoding gene are detected using qRT-PCR and Western blot techniques. In one embodiment, β-actin is used as an internal reference gene. The primer sequences for detecting the expression level of VPS53 are shown below: VPS53 forward primer (SEQ ID No. 3): 5'-TGTTCCCAACCGAGCAATCTC-3'; VPS53 reverse primer (SEQ ID No. 4): 5'-ACGTTCGTCTGACCTCTTACA-3'; β-actin forward primer (SEQ ID No. 5): 5'-AAGGAGCCCCACGAGAAAAAT-3'; β-actin reverse primer (SEQ ID No. 6): 5'-ACCGAACTTGCATTGATTCCAG-3'.

[0022] The present invention also provides the application of a reagent for regulating the expression level of VPS53 in the preparation of drugs that inhibit the occurrence and development of thyroid cancer, wherein the regulation includes inhibiting the expression of VPS53 or knocking out VPS53.

[0023] The thyroid cancer described in this invention includes thyroid cancer caused by long-term low-dose ionizing radiation, wherein the low dose includes a single dose not exceeding 0.01 Gy.

[0024] In this embodiment of the invention, a VPS53 plasmid and lentiviral vector were constructed to introduce shRNA sequences into the VPS53-overexpressing thyroid cancer cell line BCPAP, thereby establishing a long-term stable VPS53-knockdown thyroid cancer cell line. Compared with the control group, overexpression of VPS53 in the VPS53-low-expressing thyroid cancer cell line TPC-1 enhanced cell proliferation, colony formation, invasion, and migration. Compared with the control group, in the stably knocked-down VPS53 thyroid cancer cell line, cell proliferation, colony formation, invasion, and migration were weakened. In nude mouse tumorigenesis experiments, compared with the control group, the subcutaneous tumors of nude mice with VPS53-overexpressing thyroid cancer cells were larger and grew faster; the subcutaneous tumors of nude mice with VPS53-knockdown thyroid cancer cells were smaller and grew slower, suggesting that VPS53 knockdown can significantly inhibit the growth of thyroid cancer xenografts. These results indicate that VPS53 is a candidate intervention target for inhibiting the development and progression of thyroid cancer induced by long-term low-dose ionizing radiation.

[0025] The present invention also provides a drug for inhibiting the occurrence and development of thyroid cancer, the active ingredient of which includes a reagent for inhibiting or knocking out VPS53 expression, and also includes pharmaceutically acceptable excipients.

[0026] In one embodiment of this invention, VPS53 expression was knocked down using shRNA. The shRNA was constructed into a viral vector using molecular biology techniques, and this vector could interfere with VPS53 gene expression. Since the constructed vector contained a puromycin site, cells successfully expressing the vector were screened using puromycin after transfection, indicating successful knockdown. By knocking down the VPS53 gene in BCPAP cells that highly expressed VPS53, a control group of cells stably expressed shNC, and an experimental group of cells stably expressed shVPS53. Functional validation was achieved through a series of phenotypic experiments.

[0027] The shRNA sequence designed in one embodiment of the present invention is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0028] shVPS53#1 (SEQ ID No.1):CACTCAGTTCTGCGTTAAATT; shVPS53#2 (SEQ ID No. 2):CCAGAAGT-ACCTCCGAGAATA.

[0029] To further illustrate the present invention, the application of VPS53 provided by the present invention as an intervention target for long-term low-dose ionizing radiation-induced thyroid cancer is described in detail below with reference to embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0030] Unless otherwise specified, the materials and methods used in the embodiments of this invention are all conventional commercially available materials and common experimental methods in the field.

[0031] In this embodiment of the invention, normal thyroid follicular epithelial cells (N-thy-ori-3-1), thyroid cancer cell lines BCPAP, 8305C, and CAL-62 were purchased from Pronosei Biotechnology Co., Ltd., thyroid cancer cell line K1 was purchased from Jinyuan Biotechnology, and thyroid cancer tissue microarrays were purchased from Shanghai Xinchao Biotechnology Co., Ltd.

[0032] 1. Overexpression of VPS53: (1) Prepare thyroid cancer cell lines K1 and CAL-62 with good growth status. Before the experiment, ensure that the cells are free from contamination and the cell fusion rate is close to 70%.

[0033] (2) The CDS region sequence (NM_001128159.3) of the VPS53 gene was obtained by searching the NCBI database. The pcDNA3.1(+) vector was used. This type of vector has a strong cytomegalovirus (CMV) promoter, which can drive the fusion protein to be expressed efficiently in mammalian cells. The VPS53 sequence needs to be extracted from a cDNA library or an existing clone by polymerase chain reaction (PCR). Forward primer (SEQ ID No. 7): 5'-CCGGAATTCATGGAGGAGGAGGAAG-3' contains protective bases + EcoRI restriction site recognition sequence + specific start sequence at the 5' end of the VPS53 gene. The reverse primer (SEQ ID No. 8): 5'-CGCGGATCCTCAAACAGGTGAGATGGACGTA -3' contains a protective base, a BamHI restriction site recognition sequence, and a specific sequence at the 3' end of the VPS53 gene (note whether the stop codon inherent to VPS53 is retained; typically, plasmids with N-terminal tags need to retain the stop codon of the target gene). After amplification catalyzed by high-fidelity DNA polymerase, the full-length VPS53 sequence with EcoRI and BamHI sites at both ends is obtained. The purified PCR product and the selected vector (pcDNA3.1(+)) must be subjected to double digestion with EcoRI and BamHI under the same conditions. The restriction enzymes cleave the DNA double strand to produce matching sticky ends, providing a structural basis for the physical binding of the two. The cleaved vector backbone and the target fragment covalently bind under the catalysis of T4 DNA ligase, closing the loop to form a complete recombinant expression plasmid. A 3×FLAG tag was added to synthesize the VPS53 overexpression plasmid FLAG-VPS53.

[0034] (3) Using the constructed vector and transfection reagent, the constructed FLAG-VPS53 overexpression plasmid was transfected into the cell line. The medium was changed 8 hours after transfection. After transfection, cells were screened using complete medium containing puromycin.

[0035] (4) Cells were cultured continuously in a complete medium containing puromycin to detect the overexpression of VPS53.

[0036] 2. Knock down VPS53 expression using shRNA: The shVPS53#1 (SEQ ID No. 1) and shVPS53#2 (SEQ ID No. 2) vectors were designed using pSLenti-U6-shRNA-CMV-F2A-Puro-WPRE. These vectors were constructed by Shanghai Heyuan Biotechnology Co., Ltd. and used in the article (Hao J, Yang Y, Xie L, Li Z, Ma B, Wang B, et al. Actl6a regulates autophagyvia Sox2-dependent Atg5 and Atg7 expression to inhibit apoptosis in spinalcord injury. Journal of advanced research. 2025;77:281-96.). U6 in the vector is an RNA polymerase III-dependent promoter, dedicated to transcribing short RNA sequences. Here, this element is deployed for precise transcription of inserted short hairpin RNA (shRNA); a strong cytomegalovirus (CMV) promoter governs downstream expression elements. The F2A peptide, as a self-cleaving sequence, enables ribosome jumping during translation, ensuring equimolar expression of the resistance gene (Puro) and potential upstream fluorescent reporter genes within the same open reading frame. The puromycin resistance gene provides a survival advantage for selecting positively transformed cells; the marmot hepatitis virus post-transcriptional regulatory element (WPRE) is responsible for promoting nuclear transport and translation efficiency of RNA molecules. The introduction of this structure significantly enhances viral titer and the expression abundance of exogenous genes in target cells. High-titer viral fluid is used to infect target cell lines, and puromycin is applied to eliminate unsuccessfully transduced cells. Inside surviving positive cells, the host cell's Dicer enzyme recognizes and cleaves shRNA transcribed from U6, generating short interfering RNA (siRNA). Free siRNA assembles into the RNA-induced silencing complex (RISC), mediating the cleavage and degradation of target mRNA through base pairing principles, thus knocking down the expression of specific genes.

[0037] 3. Real-time quantitative PCR (relative quantification method) to detect VPS53 expression level: Design primers: VPS53 forward primer (SEQ ID No. 3), VPS53 reverse primer (SEQ ID No. 4), β-actin forward primer (SEQ ID No. 5), and β-actin reverse primer (SEQ ID No. 6); 20 μL qPCR reaction system: 10 μL 2×TSINGKE® Master qPCR Mix, 0.8 μL 10 µM upstream primer, 0.8 μL 10 µM downstream primer, 1 μL template cDNA, and 8.4 μL ddH2O; qPCR program: incubate at 50℃ for 2 min; pre-denature at 95℃ for 2 min; denature at 95℃ for 15 s, anneal and extend at 60℃ for 30 s, 40 cycles; store at 4℃.

[0038] 4. Proliferation capacity test: (1) Prepare healthy cells in the logarithmic growth phase, digest and centrifuge them to prepare a single-cell suspension and count them accurately. In a 96-well plate, usually add 100 μL of cell suspension to each well. The cell seeding density needs to be determined based on the actual growth rate, and is generally controlled between 1,000 and 10,000 cells per well. To prevent errors caused by liquid evaporation from the edge wells during culture, the outermost ring of the 96-well plate is usually not seeded with cells, but only an equal volume of sterile PBS or basal culture medium is added. After seeding, transfer the culture plate to an incubator at 37°C and 5% CO2 and let it stand overnight to allow the cells to fully adhere and recover.

[0039] (2) Gently add 10 μL of CCK-8 working solution to each well under light-protected conditions. Special care should be taken during this operation; the pipette tip should ideally be close to the liquid surface on the well wall to minimize the formation of air bubbles. Tiny air bubbles can refract the light during measurement, leading to significant deviations in the final reading. After adding the reagent, return the plate to the incubator for further incubation. The color development time is typically between 1 and 4 hours. Incubation can be stopped when the liquid in the wells appears distinctly orange-yellow to the naked eye.

[0040] (3) Place the incubated 96-well plate stably on the stage of the microplate reader. Set the detection wavelength to 450 nm, and the instrument will directly measure and output the absorbance (OD) value of each well. In order to minimize interference from possible minor scratches or cell debris on the bottom of the plate, a reference wavelength between 600 nm and 650 nm is set for dual-wavelength calibration to obtain purer experimental data.

[0041] 5. Detection of migration and invasion capabilities (1) Perform routine digestion and centrifugation on cells in the logarithmic growth phase. To eliminate interference from the original serum, wash and resuspend the cell pellet in serum-free medium. Count the cells accurately under a microscope and adjust the cell concentration to an appropriate range.

[0042] (2) Migration Assay. Add 500-600 μL of complete culture medium containing 10%-20% fetal bovine serum (FBS) to the lower chamber of a 24-well plate as a chemokine to guide cell downward migration. Carefully place a Transwell chamber (typically 8 μm in diameter) into the well using forceps. Slowly add 100-200 μL of prepared serum-free cell suspension to the upper chamber. Transfer the entire plate to an incubator and incubate statically for 12-24 hours.

[0043] (3) After culturing, remove the chamber and aspirate the internal liquid. Gently wipe the inner surface of the filter membrane of the chamber with a cotton swab to thoroughly remove any cells that have not migrated. Place the chamber in a well containing 4% paraformaldehyde or methanol and fix at room temperature for 20 to 30 minutes. After fixation, transfer it to a 0.1% crystal violet solution for staining for about 20 minutes. Rinse the chamber repeatedly with pure water to remove the background stain and air dry. Take pictures of multiple fields of view randomly under a microscope and count the number of cells that have passed through the micropores to reach the outside of the filter membrane.

[0044] (4) Invasion Assay. The core of the invasion assay is to simulate the extracellular matrix barrier in vivo. Before the experiment, pre-cooled serum-free culture medium and Matrigel need to be mixed evenly on ice at a specific ratio (e.g., 8:1 dilution). Carefully pour 50 μL to 100 μL of diluted Matrigel into the bottom of the upper chamber of each Transwell chamber, being careful not to generate air bubbles. Place the chamber in a 37°C incubator and let it stand for 2 to 4 hours until the Matrigel solidifies into a semi-solid state.

[0045] (5) After the matrix gel solidifies, the subsequent procedures are basically the same as those for the migration experiment. Serum-free resuspended cells are seeded into the upper chamber of the chamber coated with matrix gel, and high-serum-concentration culture medium is added to the lower chamber for chemotaxis induction. Since the cells need to secrete additional matrix metalloproteinases (MMPs) to degrade the matrix gel at the bottom in order to pass through the micropores, this process takes longer, and the culture time is usually extended to 24 to 48 hours.

[0046] (6) After the culture period, remove the chamber and use a cotton swab to vigorously wipe away any uninvaded cells and residual matrix gel in the upper cavity. The subsequent fixation, crystal violet staining, and microscopic photography and counting steps are exactly the same as the previous migration experiment. The deep blue cell population on the outer membrane at the end visually reflects the cells' ability to overcome the matrix barrier.

[0047] 6. Plate colony formation ability test: (1) Based on the proliferative potential of the target cells and the expected intensity of physical or chemical intervention, inoculate the calculated number of cells into 6-well plates or 100 mm culture dishes. For the untreated control group, usually only 200 to 500 cells are inoculated per well to ensure that a statistically significant number of clones will eventually grow. After adding the cell suspension, the culture plate must be gently shaken in a "cross" motion on the operating table to force the free cells to achieve an absolutely uniform spatial distribution on the bottom surface.

[0048] (2) Transfer the well plate to an incubator at 37°C and 5% CO2 for static growth for 1 to 3 weeks. Fresh culture medium is usually added only once very slowly during the growth period.

[0049] (3) The experiment can be terminated when the number of cells in the vast majority of independent communities exceeds 50 under the microscope. Discard the old culture medium and rinse very slowly along the well wall with sterile PBS to remove residual serum proteins that may interfere with staining. Add 4% paraformaldehyde or pure methanol solution to the wells and fix the cell bodies in situ at room temperature for 15 to 20 minutes. Discard the fixative and directly cover with 0.1% crystal violet staining solution. After staining at room temperature for about 15 minutes, take the dish to the sink and rinse the background stain thoroughly with a fine stream of pure water. Invert the culture dish on absorbent paper to air dry naturally, then count and record the cells.

[0050] 7. Formation and marker detection of transplanted tumors: (1) Constructing an in vivo microenvironment is the basis for verifying the tumorigenic capacity of cells. Immunodeficient mice aged 4 to 6 weeks, such as BALB / c nude mice or NOD / SCID mice, are usually selected for the experiment to minimize the body's rejection response. After the animals are purchased, they must be acclimatized in an SPF (specific pathogen-free) barrier facility for at least one week.

[0051] (2) Collect target tumor cells in the logarithmic growth phase and obtain a single-cell suspension through routine digestion. To thoroughly remove any potential irritation to local tissues from residual culture medium and animal serum, the cell pellet should be gently washed at least twice with sterile PBS. Cell viability should be confirmed under a microscope using trypan blue staining, and the percentage of live cells must be maintained above 90%. Based on the known tumorigenicity of this cell line, resuspend the cells in serum-free basal medium or PBS, typically adjusting the concentration to 1 × 10⁻⁶ cells / mL. 7 Up to 5×10 7 One. Pre-cooled serum-free Matrigel is added in equal proportion to the suspension. Utilizing the physical property of Matrigel to rapidly solidify at body temperature, free cells can be forcibly anchored at the injection site, preventing the droplets from spreading disorderly to surrounding tissues.

[0052] (3) Secure the mouse properly, fully exposing its back, flank, or axillary region. These areas have loose subcutaneous tissue, relatively rich blood supply, and are not easily damaged by animal bites. Thoroughly disinfect the local skin with 75% alcohol. Using a 1 mL syringe with a fine needle, insert the needle with the needle face upwards at a very small angle into the subcutaneous tissue. Slowly inject 100 μL to 200 μL of cell suspension. After removing the needle, gently press the puncture site with a sterile cotton swab for a moment to prevent backflow of the high-pressure fluid. After the inoculation procedure is completed according to the procedure, a clear, translucent wheal will immediately appear under the skin of the mouse.

[0053] (4) The experiment was terminated when the mice showed obvious signs of cachexia, such as sharp weight loss. The animals were euthanized using cervical dislocation or carbon dioxide asphyxiation. The major diameter (L) and minor diameter (S) of the tumor were measured with calipers. The volume was calculated using the formula: V = (L × S) 2 2. Incise the skin along the tumor margin, carefully dissect the surrounding connective tissue and microvascular network, and completely remove the orthotopic transplanted tumor. Obtain the absolute wet weight of the solid tumor using a balance. Rapidly cut the excised tissue along a specific axis; one portion is directly immersed in liquid nitrogen or frozen at -80°C for subsequent quantitative analysis of nucleic acids (RNA / DNA) and proteins; the other portion is immersed in 4% paraformaldehyde solution for deep fixation, providing a complete morphological sample for histological sections (such as H&E staining) and immunohistochemical (IHC) analysis.

[0054] Example 1 according to Figure 1 The procedure shown involves long-term low-dose irradiation (single dose 0.01 Gy) of normal human thyroid follicular epithelial cells, with passage after each irradiation. After 50 consecutive irradiations, followed by another 50 passages after irradiation cessation, the long-term low-dose irradiation group showed enhanced thyroid follicular epithelial cell proliferation and increased soft agar colony formation compared to the control group. Figure 1 (A)

[0055] Thyroid follicular epithelial cells irradiated with long-term low doses were monocloned, and their malignancy was screened by soft agar colony-forming ability, resulting in eight malignant monoclonal clones. Whole-genome sequencing was performed on these eight malignant clones. Sequencing results showed that, compared with the control group, the copy number of the VPS53 gene was increased in the long-term low-dose irradiation group. Figure 1 (B) Analysis of the TCGA database revealed a close correlation between VPS53 expression levels and the prognosis of thyroid cancer patients; thyroid cancer patients with high VPS53 expression had a significantly poorer prognosis. Figure 1 In the thyroid cancer patient sample, VPS53 expression was increased in thyroid cancer tissue compared to adjacent non-cancerous samples from 53 patients with thyroid cancer. Figure 1 (D).

[0056] Example 2 Real-time quantitative PCR results showed that the gene expression level of VPS53 was detected in thyroid follicular epithelial cells and thyroid cancer cell lines BCPAP, 8305C, K1, and CAL-62. Figure 2 (A) and protein expression level ( Figure 2 VPS53 was highly expressed in BCPAP and 8305C cell lines, but its expression level was low in K1 and CAL-62 cells. The shRNA sequence was introduced into the VPS53-highly-expressing thyroid cancer cell line BCPAP (8305C) using a lentiviral vector. Figure 2 (B) and 8305C ( Figure 2 (C) To construct a long-term stable thyroid cancer cell line with VPS53 knockdown; to construct a VPS53 plasmid and introduce it into the K1 thyroid cancer cell line with low VPS53 expression via a lentiviral vector. Figure 2 (D) and CAL-62 ( Figure 2 (E) To construct a thyroid cancer cell line that stably expresses VPS53 in the long term.

[0057] Example 3 Compared with the control group, in the thyroid cancer cell lines BCPAP and 8305C with stable VPS53 knockdown, Figure 3 In cells of type A), the ability of cells to form colonies is weakened; conversely, in thyroid cancer cell lines K1 and CAL-62, which stably overexpress VPS53, the ability to form colonies is weakened. Figure 3 In B cells, the clonogenic ability of cells is enhanced. Additionally, compared to the control group, in the stably knocked-down VPS53 thyroid cancer cell lines BCPAP and 8305C... Figure 3 In C) cells, cell proliferation is weakened; conversely, in thyroid cancer cell lines K1 and CAL-62, which stably overexpress VPS53, cell proliferation is reduced. Figure 3 In cells D), the cell proliferation capacity is enhanced.

[0058] Example 4 Compared with the control group, in the thyroid cancer cell line BCPAP with stable VPS53 knockdown ( Figure 4 (A) and 8305C ( Figure 4 In B cells, cell migration and invasion abilities are weakened; conversely, in thyroid cancer cell lines K1 (which stably overexpress VPS53), the ability to migrate and invade is reduced. Figure 4 C) and CAL-62 ( Figure 4 In D) cells, the cell's migration and invasion abilities are enhanced.

[0059] Example 5 In tumorigenesis experiments in nude mice, it was found that, compared with the control group, nude mice with VPS53-knocked thyroid cancer cells (BCPAP) had smaller subcutaneous tumors and slower tumor growth rates. Figure 5 In nude mice, subcutaneous tumors of thyroid cancer cells K1 that overexpressed VPS53 were larger and grew faster. Figure 5 (B) The results suggest that knocking down VPS53 can significantly inhibit the growth of thyroid cancer xenografts. Based on the above results, VPS53 is a candidate intervention target for inhibiting the development and progression of thyroid cancer induced by long-term low-dose ionizing radiation.

[0060] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The use of a reagent for detecting VPS53 expression in the preparation of a kit for assessing the occurrence, development, and / or prognosis of thyroid cancer.

2. The application according to claim 1, characterized in that, The reagents include those for detecting the content of VPS53 in cells and / or the expression level of the encoding gene.

3. The application according to claim 1 or 2, characterized in that, High expression of VPS53 is associated with an increased probability of thyroid cancer development and a poor prognosis.

4. The application of a reagent for regulating VPS53 expression in the preparation of drugs that inhibit the occurrence and development of thyroid cancer, characterized in that, The regulation includes suppressing the expression of VPS53 or knocking out VPS53.

5. The application according to claim 4, characterized in that, The thyroid cancer mentioned includes thyroid cancer caused by long-term low-dose ionizing radiation.

6. The application according to claim 5, characterized in that, The low dose refers to a single dose not exceeding 0.01 Gy.

7. The application according to claim 4, characterized in that, The effects of the drug include at least one of the following: inhibiting cell proliferation, reducing invasiveness, decreasing migration ability, inhibiting tumor volume increase, and inhibiting tumor growth rate.

8. A drug for inhibiting the occurrence and development of thyroid cancer, characterized in that, The active ingredients include agents that inhibit or knock out VPS53 expression, as well as pharmaceutically acceptable excipients.

9. The drug according to claim 8, characterized in that, The inhibition of VPS53 expression includes using shRNA to inhibit the expression of VPS53.

10. The drug according to claim 9, characterized in that, The designed shRNA sequence for the target sequence is shown in SEQ ID No. 1 or SEQ ID No. 2.

Images