Methods for treating hepcidin-mediated disorders

Abstract

The present invention provides methods for treating hepcidin-mediated disorders.

Description

[0001] This application is a divisional application of a patent application filed on July 28, 2016, with application number 201680045105.6 and titled “Methods for treating hepcidin-mediated disorders”.

[0002] 1. Cross-reference to related applications

[0003] This application claims priority to U.S. Provisional Application No. 62 / 199,434, filed on July 31, 2015, and U.S. Provisional Application No. 62 / 268,788, filed on December 17, 2015, each of which is incorporated herein by reference in its entirety. 2. Background Technology

[0005] The peptide hormone hepcidin plays a major role in systemic iron homeostasis. Hentze et al., Cell 142:24-38 (2010). Hepcidin expression is known to be affected by the product of the TMPRSS6 gene, interstitial proteinase-2, which is a type II transmembrane serine protease. Common variants of the TMPRSS6 gene have been shown to be associated with iron status. Benyamin et al., Nature Genetics 41(11):1173-1175 (2009), where the rs855791 SNP (2321G→A; A736V) has been shown to be associated with naturally occurring variants in hepcidin expression and blood hemoglobin content.

[0006] Hepcidin expression has also been implicated in human iron disorders (Pietrangelo, J. Hepatology 54:173-181 (2011)) and anemia of chronic disease (ACD), also known as anemia of inflammation (AI). ACD is prevalent in patients with chronic infections, autoimmune diseases, cancer, and chronic kidney disease (CKD). Sun et al., Am. J. Hematol. 87(4):392-400 (2012).

[0007] There is a need in the art for methods of treating hepcidin-mediated disorders. 3. Summary of the Invention

[0009] Reduced IL-6 signaling has been shown to provide clinical benefit in patients with hepcidin-mediated disorders, including anemia of chronic disease and hepcidin-mediated cytotoxicity, but only in those patients with at least one copy of the TMPRSS6 rs855791 major allele, with the greatest effect in patients with elevated IL-6 levels.

[0010] Thus, in a first aspect, a method for treating a hepcidin-mediated condition is provided. The method comprises administering a therapeutically effective amount of an IL-6 antagonist to a patient suffering from a hepcidin-mediated condition, the patient having been determined to have at least one copy of the major allele at the TMPRSS6rs855791 SNP. In a first series of embodiments, the patient has previously been determined to have at least one copy of the TMPRSS6rs855791 major allele. In another series of embodiments, the method further comprises a prior step of determining that the patient has at least one copy of the TMPRSS6rs855791 major allele. Typically, the patient has an elevated pre-treatment serum IL-6 level. In some embodiments, the patient has an elevated pre-treatment serum CRP level.

[0011] In various embodiments, the hepcidin-mediated condition is anemia of chronic disease.

[0012] In some anemia embodiments, the patient is male and has a pre-treatment hemoglobin (Hb) level of less than 14 g / dl; a pre-treatment Hb level of less than 13 g / dl; a pre-treatment Hb level of less than 12 g / dl; or a pre-treatment Hb level of less than 11 g / dl. In some anemia embodiments, the patient is female and has a pre-treatment Hb level of less than 12 g / dl; a pre-treatment Hb level of less than 11 g / dl; a pre-treatment Hb level of less than 10 g / dl; or a pre-treatment Hb level of less than 9 g / dl.

[0013] In some anemia embodiments, the patient is male and the pre-treatment hematocrit is less than 40%, less than 35%, or 30-34%. In some embodiments, the patient is female and the pre-treatment hematocrit is less than 36%, less than 35%, less than 34%, less than 33%, less than 32%, or less than 31%. In some embodiments, the pre-treatment hematocrit of a female patient is 26-29%.

[0014] In various anemia embodiments, the patient has received at least one pre-treatment administration of an erythropoiesis stimulating agent (ESA). In certain embodiments, the patient has received at least one pre-treatment administration of an ESA and has a normal Hb content or a normal hematocrit. In various embodiments, the patient has received at least one pre-treatment administration of an iron supplement. In certain embodiments, the patient has received at least one pre-treatment administration of an iron supplement and has a normal Hb content or a normal hematocrit. In various embodiments, the patient has received at least one pre-treatment transfusion of blood or red blood cell concentrate. In certain embodiments, the patient has received at least one pre-treatment transfusion of blood or red blood cell concentrate and has a normal Hb content or a normal hematocrit.

[0015] In various anemia embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to increase the patient's Hb level above the pre-treatment level. In various embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to increase the patient's hematocrit above the pre-treatment level. In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's ESA dose below the level immediately prior to treatment without reducing the patient's Hb level. In certain embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's ESA dose below the level immediately prior to treatment without reducing the patient's hematocrit.

[0016] In various embodiments, a dose of the IL-6 antagonist is administered on a schedule sufficient to reduce the patient's ESA dose by at least 10% compared to the pre-treatment ESA dose, to reduce the patient's ESA dose by at least 20% compared to the pre-treatment ESA dose, to reduce the patient's ESA dose by at least 30% compared to the pre-treatment ESA dose, to reduce the patient's ESA dose by at least 40% compared to the pre-treatment ESA dose, or to reduce the patient's ESA dose by at least 50% compared to the pre-treatment ESA dose.

[0017] In some embodiments, a dose of an IL-6 antagonist is administered on a schedule and for a period of time sufficient to reverse functional iron deficiency.

[0018] In one series of embodiments, the hepcidin-mediated condition is a chronic disease such as chronic kidney disease (CKD) or anemia of chronic disease.

[0019] In some CKD embodiments, the patient has KDOQI stage 1 chronic kidney disease, KDOQI stage 2 chronic kidney disease, KDOQI stage 3 chronic kidney disease, KDOQI stage 4 chronic kidney disease, or KDOQI stage 5 chronic kidney disease. In specific embodiments, the patient has KDOQI stage 5 chronic kidney disease.

[0020] In some CKD embodiments, the patient suffers from cardiorenal syndrome (CRS). In specific embodiments, the patient suffers from type 4 CRS. In certain embodiments, the patient has received at least one prior dialysis treatment.

[0021] In some CKD embodiments, a dose of an IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiovascular (CV) mortality compared to age-matched and disease-matched historical controls.

[0022] In various embodiments, the hepcidin-mediated condition is anemia of chronic disease where the chronic disease is a chronic inflammatory disease.

[0023] In some embodiments, the chronic inflammatory disease is rheumatoid arthritis (RA). In certain embodiments, the patient's pre-treatment DAS28 score is greater than 5.1. In some embodiments, the patient's pre-treatment DAS28 score is between 3.2 and 5.1. In specific embodiments, the patient's pre-treatment DAS28 score is less than 2.6. In selected embodiments, the patient's pre-treatment RA is moderately active to severely active.

[0024] In some RA embodiments, the patient has received at least one pre-treatment administration of methotrexate. In some embodiments, the patient has received at least one pre-treatment administration of a TNFα antagonist. In selected embodiments, the TNFα antagonist is selected from the group consisting of etanercept, adalimumab, infliximab, certolizumab, and golimumab.

[0025] In some RA embodiments, the patient has received at least one pre-treatment administration of an IL-6 antagonist. In certain embodiments, the pre-treatment IL-6 antagonist is tocilizumab or tofacitinib.

[0026] In a preferred series of embodiments, the therapeutic IL-6 antagonist is MEDI5117.

[0027] In various embodiments, the hepcidin-mediated disorder chronic disease is selected from the group consisting of anemia of chronic disease, juvenile idiopathic arthritis, ankylosing spondylitis, plaque psoriasis, psoriatic arthritis, inflammatory bowel disease, Crohn's disease, and ulcerative colitis.

[0028] In some embodiments, the hepcidin-mediated condition is anemia of chronic disease, wherein the chronic disease is cancer. In certain embodiments, the cancer is selected from the group consisting of solid tumors, small cell lung cancer, non-small cell lung cancer, blood cancer, multiple myeloma, leukemia, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), lymphoma, Hodgkin's lymphoma, and hepatic adenoma.

[0029] In some embodiments, the hepcidin-mediated condition is anemia of chronic disease, wherein the chronic disease is a chronic infection.

[0030] In some embodiments, the hepcidin-mediated condition is anemia of chronic disease, wherein the chronic disease is congestive heart failure (CHF).

[0031] In some embodiments, the hepcidin-mediated disorder is iron-refractory iron deficiency anemia (IRIDA).

[0032] In some embodiments, the hepcidin-mediated condition is acute coronary syndrome. In specific embodiments, the patient has suffered a myocardial infarction (MI) within 60 days prior to the first administration of the IL-6 antagonist, within 30 days prior to the first administration of the IL-6 antagonist, within 48 hours prior to the first administration of the IL-6 antagonist, or within 24 hours prior to the first administration of the IL-6 antagonist.

[0033] In some acute coronary syndrome embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to improve myocardial contractility compared to pre-treatment levels. In some acute coronary syndrome embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to improve cardiac ejection fraction compared to pre-treatment levels. In some acute coronary syndrome embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to reduce cardiac fibrosis compared to pre-treatment levels.

[0034] In some embodiments, the hepcidin-mediated disorder is Castleman's Disease.

[0035] In another aspect, a method for improving treatment of a hepcidin-mediated disorder is provided, comprising interrupting administration of an IL-6 antagonist to a patient suffering from a hepcidin-mediated disorder, wherein the patient is determined to be homozygous for the TMPRSS6 rs855791 minor allele.

[0036] In another aspect, a method for improving the treatment of hepcidin-mediated conditions by interrupting inefficient therapy is provided, thereby reducing side effects and reducing costs without losing therapeutic efficacy. The method comprises interrupting the administration of an IL-6 antagonist to a patient suffering from a hepcidin-mediated condition, wherein the patient has been determined to be homozygous for the TMPRSS6rs855791 minor allele. In one series of embodiments, it has been previously determined that the patient is homozygous for the TMPRSS6rs855791 minor allele. In another series of embodiments, the method further comprises an earlier step of determining that the patient is homozygous for the TMPRSS6rs855791 minor allele. In a typical embodiment, the patient has an elevated serum IL-6 level before treatment. In various embodiments, the patient has an elevated serum CRP level before treatment. In various embodiments, the patient suffers from a hepcidin-mediated condition selected from those conditions described in Section 5.4.1 herein. In certain embodiments, the patient suffers from anemia of chronic disease.

[0037] The data presented in Examples 2, 3, and 5 demonstrate that IL-6 antagonists provide therapeutic benefit in individuals with elevated pre-treatment IL-6 levels and at least one copy of the TMPRSS6 major allele, even in the absence of anemia. Thus, in another aspect, methods are provided for treating IL-6-mediated inflammatory conditions in patients without anemia of chronic inflammation. The methods comprise administering a therapeutically effective amount of an IL-6 antagonist to an individual, typically a human patient, suffering from an IL-6-mediated inflammatory condition, wherein the patient does not suffer from anemia and wherein the individual has been determined to have at least one copy of the TMPRSS6 rs855791 major allele. In a first series of embodiments, the individual has previously been determined to have at least one copy of the TMPRSS6 rs855791 major allele. In another series of embodiments, the methods further comprise an earlier step of determining that the individual has at least one copy of the TMPRSS6 rs855791 major allele. Typically, the methods positively exclude treatment of individuals who are homozygous for the TMPRSS6 rs855791 minor allele. Typically, patients have elevated pre-treatment serum IL-6 levels.

[0038] In a specific embodiment of any of the methods of treatment, the patient has an elevated pre-treatment serum IL-6 level. In certain embodiments, the patient's pre-treatment serum IL-6 level is greater than 2.5 pg / ml, greater than 5 pg / ml, greater than 7.5 pg / ml, greater than 10 pg / ml, or greater than 12.5 pg / ml.

[0039] In various embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the level of free IL-6 in the patient's serum below pre-treatment levels. In specific embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the level of free IL-6 by at least 10% compared to pre-treatment levels, by at least 20% compared to pre-treatment levels, or by at least 50% compared to pre-treatment levels.

[0040] In the specific embodiment of any one of the methods of treatment, the patient has an elevated C-reactive protein (CRP) level before treatment. In certain embodiments, the patient's CRP level before treatment is greater than 2 mg / ml, greater than 3 mg / ml, greater than 5 mg / ml, greater than 7.5 mg / ml, or even greater than 10 mg / ml.

[0041] In various embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's CRP level below the pre-treatment level. In specific embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's CRP level by at least 50% compared to the pre-treatment level.

[0042] In a specific embodiment of any of the methods of treatment, using Real-time PCR analysis determined that the patient had at least one copy of the TMPRSS6 rs855791 major allele.

[0043] In an embodiment of any of the treatment methods, the IL-6 antagonist is an anti-IL-6 antibody or an antigen-binding fragment or derivative thereof.

[0044] In certain embodiments, the anti-IL-6 antibody, antigen-binding fragment, or derivative has a K of less than 100 nM, less than 50 nM, less than 10 nM, or less than 1 nM for binding to human IL-6. D In certain embodiments, the anti-IL-6 antibody, antigen-binding fragment, or derivative has an elimination half-life of at least 7 days, at least 14 days, at least 21 days, or at least 30 days following intravenous administration.

[0045] In various antibody embodiments, the IL-6 antagonist is a full-length monoclonal anti-IL-6 antibody, such as an IgG1 or IgG4 antibody.

[0046] In selected embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative is fully human. In some embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative is humanized.

[0047] In currently preferred embodiments, the anti-IL-6 antibody, antigen-binding fragment, or derivative comprises all six variable region CDRs of MED5117. In some of these embodiments, the antibody comprises the VH and VL of MED5117. In specific embodiments, the antibody is MED5117.

[0048] In various embodiments, the anti-IL-6 antibody, or antigen-binding fragment, or derivative comprises all six variable region CDRs of an antibody selected from the group consisting of siltuximab, gerilimzumab, sirukumab, clazakizumab, olokizumab, elsilimomab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0049] In some embodiments, the anti-IL-6 antibody, antigen-binding fragment, or derivative comprises a heavy chain V region and a light chain V region from an antibody selected from the group consisting of siltuximab, grillinzumab, seleukumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; ElevenBio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In a specific embodiment, the anti-IL-6 antibody is an antibody selected from the group consisting of siltuximab, glierinzumab, selenuocumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0050] In some embodiments, the anti-IL-6 antibody, or antigen-binding fragment or derivative, is an antibody selected from the group consisting of siltuximab, girinetuzumab, selenuocumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In a specific embodiment, the anti-IL-6 antibody is an antibody selected from the group consisting of siltuximab, gliadinizumab, selenuocumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0051] In various embodiments, the IL-6 antagonist is a single domain antibody, a VHH nanobody, a Fab, or a scFv.

[0052] In various embodiments, the IL-6 antagonist is an anti-IL-6R antibody or an antigen-binding fragment or derivative thereof. In certain embodiments, the anti-IL-6R antibody, antigen-binding fragment or derivative is tocilizumab or vobarilizumab.

[0053] In various embodiments, the IL-6 antagonist is a JAK inhibitor. In specific embodiments, the JAK inhibitor is selected from the group consisting of tofacitinib (Xeljanz), decernotinib, ruxolitinib, upadacitinib, baricitinib, filgotinib, lestaurtinib, pacritinib, peficitinib, INCB-039110, ABT-494, INCB-047986, and AC-410.

[0054] In various embodiments, the IL-6 antagonist is a STAT3 inhibitor.

[0055] In some embodiments where the IL-6 antagonist is an antibody, antigen-binding fragment, or derivative, the IL-6 antagonist is administered parenterally. In certain embodiments, the IL-6 antagonist is administered subcutaneously.

[0056] In some embodiments, the IL-6 antagonist is a JAK inhibitor or a STAT3 inhibitor, wherein the IL-6 antagonist is administered orally.

[0057] 4. Brief description of the attached figure

[0058] Figure 1 A and IB provide box plots showing that increased amounts of erythropoietin ("EPO") are required for treatment in chronic kidney disease patients (CKD stage 5 dialysis individuals) who have elevated serum IL-6 levels and at least one copy of the major allele at the known SNP rs855791 in the TMPRSS6 gene (G or C at nucleotide position 2321, encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736; 736A); but not in chronic kidney disease patients who have elevated IL-6 levels and are homozygous for the rs855791 TMPRSS6 minor allele (T or A at nucleotide position 2321, encoding a TMPRSS6 polypeptide with valine at position 736; 736V). Data from patients who are homozygous for the minor allele (A / A) are shown in Figure 1 A; Data from patients with at least one copy of the major allele (homozygous G / G and heterozygous G / A) were collected and presented in Figure 1In Figure 2, the two patient populations were further divided into groups based on tertiles of serum IL-6 levels: "low" (IL-6 <5 pg / ml); "intermediate" (IL-6 = 5-15 pg / ml); and "highest" (IL-6 > 15 pg / ml). Box plots with error bars are overlaid on the raw data. Each box plot represents a patient group based on both IL-6 levels and genotype. Details are provided in Example 1.

[0059] Figure 2A and 2B Survival curves are provided, which demonstrate that the TMPRSS6 rs855791 major allele confers higher all-cause mortality in response to elevated IL-6 levels in chronic kidney disease stage 5 dialysis individuals. Figure 2A Data from a patient homozygous for the minor allele (A / A) are shown. Figure 2B Data from patients with at least one copy of the major allele (homozygous G / G and heterozygous G / A) are presented. Figure 1 The IL-6 levels of the groups were divided into tertiles based on serum IL-6 levels. Details are provided in Example 1.

[0060] Figure 3 Figure 1 shows that increasing amounts of EPO are required for therapy in chronic kidney disease patients (CKD stage 5 dialysis individuals) who have elevated serum levels of the acute phase reactant CRP and at least one copy of the TMPRSS6 rs855791 major allele; however, therapy is not required for chronic kidney disease patients who have elevated serum levels of the acute phase reactant CRP and are homozygous for the rs855791 minor allele. Each genotype group has serum CRP levels <2 mg / L compared to >2 mg / L. Details are provided in Example 1.

[0061] Figure 4 A and 4B provide graphs demonstrating that the TMPRSS6 rs855791 major allele confers higher all-cause mortality in response to elevated IL-6 levels in patients following myocardial infarction ("MI"). Figure 4 A depicts the cumulative odds of mortality over time (y-axis) compared to days post-MI (x-axis) for a population homozygous for the TMPRSS6 rs855791 minor allele. Figure 4 B depicts the cumulative probability of death over time for a population with at least one copy of the TMPRSS6 rs855791 major allele. As indicated, the groups were divided into tertiles of serum IL-6 levels. IL-6 levels were measured one month after myocardial infarction. Mortality was measured one to 12 months after myocardial infarction. Details are provided in Example 2.

[0062] Figure 5 A and 5B provide graphs demonstrating that the TMPRSS6 rs855791 major allele confers a higher risk of heart failure ("HF") in response to elevated IL-6 levels in post-MI patients. Figure 5 A depicts the cumulative odds of HF over time (y-axis) compared to days post-MI (x-axis) for the population homozygous for the TMPRSS6 rs855791 minor allele. Figure 5 B depicts the cumulative odds of a HF event over time for a population with at least one copy of the TMPRSS6 rs855791 major allele. Groups were divided into tertiles of serum IL-6 levels as indicated. IL-6 levels were measured one month after myocardial infarction. HF was measured one to 12 months after myocardial infarction. Details are provided in Example 2.

[0063] Figure 6A and 6B Present results from analysis of human iPS cells that had been transfected with constructs constitutively expressing the TMPRSS6 rs855791 minor or major allele and differentiated into cardiomyocytes upon in vitro exposure to BMP2 + IL-6 or BMP2 alone, demonstrating that the TMPRSS6 rs855791 major allele confers a higher risk of cell death (Trypan Blue positivity) in response to IL-6. Figure 6A Results are shown for normoxic environments. Figure 6B Results after exposure to hypoxic conditions and reoxygenation are shown. The data suggest that reduced IL-6 exposure should improve the survival of cardiomyocytes in patients with the TMPRSS6 rs855791 major allele, but not in patients with the TMPRSS6 rs855791 minor allele. Details are provided in Example 3.

[0064] Figure 7Figure 4 is an accompanying drawing showing the experimental design of the cardiorenal syndrome study described in Example 4. CRS4 was induced in rats that were genotypically similar to humans homozygous for the TMPRSS6 rs855791 major allele. The accompanying drawing shows various events in the study along the timeline. In the study, myocardial infarction ("MI") was induced in rats at week 0. At week 2, a single nephrectomy ("Nx") was performed in each individual. After nephrectomy until the end of the study, anti-IL-6 antibody (ab9770, Abcam Plc, UK) (Rx) or isotype control antibody ("IgG"; ab171516, Abcam Plc, UK) was administered once every 3 days starting on day 1 (D1). After Nx until the end of the study, standard of care therapy (ACE inhibitor - perindopril) was administered daily from day 1. At week 6, the rodents were sacrificed. MI and Nx were not performed in the "sham" control group. Various assessments of rodents were performed at the time points indicated by arrows.

[0065] Figures 8A-8D Shown are cardiac ejection fractions in rats treated with an anti-IL-6 antibody ("IL-6ab"), a standard of care ACE inhibitor (perindopril or "Peri"), compared to a control ("isotype") treated group and sham-operated animals in a model of cardiorenal syndrome summarized in FIG. 7 and described in detail in Example 4. Figure 8A Figure 2 is a graph showing the extent of baseline ejection fraction in all groups two weeks after myocardial infarction but before nephrectomy. Figure 8B Graph showing the degree of ejection fraction in all groups one week after nephrectomy and one week after treatment. Figure 8C Graph showing the degree of ejection fraction in all groups two weeks after nephrectomy and two weeks after treatment. Figure 8D Figure 1 shows the extent of ejection fraction in all groups four weeks after nephrectomy and four weeks after treatment. Results are expressed as mean + / - SEM and demonstrate that anti-IL-6 therapy has therapeutic efficacy in the cardiorenal syndrome model, as measured by changes in cardiac ejection fraction, equivalent to standard of care therapy.

[0066] Figure 9 Draw a drawing that shows the Figure 7In the cardiorenal syndrome model described in detail in Example 4, myocardial contractility was measured in rats treated with an anti-IL-6 antibody ("IL-6ab"), standard of care (perindopril or "Peri"), compared to a control ("isotype") treated group. Myocardial contractility was assessed at the end of the study by measuring dP / dtmax (mmHb / millisecond), a measure of intracardiac pressure. Measurements for all groups are shown four weeks after nephrectomy and four weeks after treatment. The results are expressed as mean + / - SEM and indicate that anti-IL-6 therapy has a therapeutic effect equivalent to standard of care therapy, as demonstrated by increased myocardial contractility in the rodent group treated with anti-IL-6.

[0067] Figures 10A-10C We show that anti-IL-6 therapy has an anti-cardiorenal syndrome effect equivalent to standard of care therapy, as measured by the extent of fibrosis in heart tissue from groups of rodents treated with anti-IL-6 ("IL-6Ab"), standard of care (perindopril or "Peri"), and control ("IgG"). Figure 10A This micrograph shows a histological section of cardiac tissue stained with picrosirius red. Two zones of tissue were analyzed: a "normal" zone and a "fibrosis boundary" zone. The "normal" zone is indicated by a demarcated section of the tissue section. The inset in the micrograph shows a magnified view of the "normal" zone, showing that a small portion of the "normal" zone has fibrotic tissue. The "fibrosis boundary" zone is the area of ​​tissue within the "normal" zone that surrounds the fibrotic tissue. Figure 10B Figure 2 is a graph showing the percentage of area of ​​"normal" areas indicated as fibrotic tissue (ie, stained / dark areas) in tissue samples from all groups. Figure 10C A plot showing the percentage of area in the "fibrosis limit" zone, indicated as fibrotic tissue, in tissue samples from all groups. Results are expressed as mean + / - SEM. Details are provided in Example 4.

[0068] Figure 11A and 11B Data from an in vivo model are presented in which myocardial infarction was induced in mice genotypically similar to humans homozygous for the TMPRSS6 rs855791 major allele. A control group received no therapy. An experimental group was treated with an anti-murine IL-6 antibody. Figure 11A Treatment with anti-IL-6 was shown to provide a statistically significant improvement in ejection fraction. Figure 11BTreatment with anti-IL-6 was shown to provide a statistically significant improvement in contractility, a measure of fractional shortening of the heart's left ventricle. The data suggest that anti-IL-6 therapy, given immediately after myocardial infarction, improves functional recovery of the left ventricle in rodents that mimic human patients with the TMPRSS6 rs855791 major allele. Details are provided in Example 5.

[0069] For purposes of illustration only, the accompanying drawings depict various embodiments of the present invention. One skilled in the art will readily recognize from the following discussion that alternative embodiments of the structures and methods described herein may be employed without departing from the principles of the invention described herein. 5. Specific implementation methods

[0071] 5.1 Overview of Experimental Results

[0072] The peptide hormone hepcidin plays a major role in systemic iron homeostasis. Hentze et al., Cell 142:24-38 (2010). Hepcidin expression is known to be affected by the product of the TMPRSS6 gene, intercalated proteinase-2, a type II transmembrane serine protease. Common variants of the TMPRSS6 gene have been shown to be associated with iron status. Benyamin et al., Nature Genetics 41(11):1173-1175 (2009), where the rs855791 SNP (2321G→A; A736V) was shown to be associated with naturally occurring variants in hepcidin expression and blood hemoglobin content. Hepcidin expression has also been implicated in human iron disorders (Pietrangelo, J. Hepatology 54:173-181 (2011)) and anemia of chronic disease (ACD), also known as anemia of inflammation (AI). ACD is prevalent in patients with chronic infections, autoimmune diseases, cancer, and chronic kidney disease (CKD). Sun et al., Am. J. Hematol. 87(4):392-400 (2012).

[0073] To determine whether the genotype at the TMPRSS6 rs855791 SNP predicts the degree of anemia in end-stage renal disease, data previously collected in a clinical study of patients with chronic kidney disease were analyzed in combination with the newly identified SNP genotyping. Because hepcidin expression is also regulated by IL-6, Casanovas et al., PLOS Computational Biol. 10(1):e1003421 (2014), the data were further analyzed to determine whether serum IL-6 levels can predict the degree of anemia in end-stage renal disease.

[0074] As described in Example 1 and Figure 1In the study, we show that in patients with at least one copy of the major allele at the TMPRSS6 rs855791 SNP, the degree of basal anemia—measured as clinically titrated EPO dose—was associated only with IL-6 levels. In these patients, higher serum IL-6 levels were associated with higher required EPO doses ( Figure 1 B). In contrast, the degree of anemia in patients with two copies of the minor allele did not correlate with serum IL-6 levels ( Figure 1 A).

[0075] Similarly, in patients with at least one copy of the major allele at TMPRSS6 SNP rs855791, overall survival was associated only with IL-6 levels. Among individuals with at least one copy of the TMPRSS6 rs855791 major allele, survival was inversely correlated with serum IL-6 levels, with patients in the highest quartile of serum IL-6 levels having statistically significantly worse survival than those in the lowest quartile of IL-6 levels ( Figure 2B In contrast, overall survival in patients homozygous for the minor allele at rs855791 was not affected by IL-6 levels ( Figure 2A ).

[0076] Without intending to be bound by theory, in patients with at least one copy of the TMPRSS6 major allele, increased serum IL-6 may promote increased hepcidin expression, thereby increasing anemia. The increased risk of death is a result of dysregulated iron metabolism, resulting anemia, and / or increased doses of erythropoiesis-stimulating agents (such as EPO, administered for treatment). These associations raise the possibility that reduced IL-6 levels or IL-6 signaling may reduce anemia, reduce required EPO doses, and increase survival in patients with chronic kidney disease, but only in those patients with at least one copy of the TMPRSS6 rs855791 major allele, and with the greatest effect in those patients with elevated serum IL-6 levels.

[0077] To determine whether TMPRSS6 rs855791 genotype affects IL-6 sensitivity in patients with acute rather than chronic disease, in Example 2 we combined genotyping of the newly identified SNP with analysis of data previously collected in a clinical study of patients hospitalized with acute coronary syndrome.

[0078] Death in individuals homozygous for the minor allele (A) of the TMPRSS6 rs855791 SNP was not associated with IL-6 variants ( Figure 4A). However, in response to elevated IL-6 levels in individuals after myocardial infarction, one or two copies of the major allele (G) conferred a higher risk of all-cause mortality ( Figure 4 B) Thus, TMPRSS6 regulates IL-6-mediated mortality risk after myocardial infarction.

[0079] The effect of TMPRSS6 genotype on the risk of IL-6-mediated heart failure was also assessed. Heart failure in individuals homozygous for the minor allele (A) was not associated with the IL-6 variant ( Figure 5 A). However, the G allele of TMPRSS6 confers a higher rate of heart failure in response to elevated IL-6 levels in individuals after myocardial infarction ( Figure 5 B) Thus, TMPRSS6 regulates IL-6-mediated heart failure risk after myocardial infarction.

[0080] The data from Example 2 suggest that the correlation between TMPRSS6 genotype, IL-6 levels, and adverse clinical outcomes is not limited to patients with chronic kidney disease. Without intending to be bound by theory, in patients with at least one copy of the TMPRSS6 major allele, increased serum IL-6 may promote increased hepcidin expression, followed by increased iron chelation in cardiomyocytes, and subsequent iron-mediated cytotoxicity. These correlations raise the possibility that reduced IL-6 levels or IL-6 signaling may reduce heart failure and death in patients with acute coronary syndromes, but only in those patients with at least one copy of the TMPRSS6rs855791 major allele, and with the greatest effect in those patients with elevated serum IL-6 levels.

[0081] Although the correlations observed in Examples 1 and 2 strongly suggest that reduced IL-6-mediated signaling should provide clinical benefit in patients with at least one copy of the TMPRSS6 rs855791 major allele, elevated IL-6 levels, and anemia or hepcidin-mediated cytotoxicity, the observed correlations cannot prove causality. Therefore, in Example 3, human induced pluripotent stem (iPS) cardiomyocytes were engineered to express only the TMPRSS6 rs855791 major allele or the minor allele and tested in vitro.

[0082] Hepcidin expression is regulated by BMP6 / SMAD and IL-6 / STAT signal transduction pathways, wherein both BMP and IL-6 act via their respective receptors to promote increased hepcidin expression. Casanovas et al., PLOS Comp. Biol. 10(1): e1003421(2014). In vitro, major allele and minor allele iPS cardiomyocytes were treated with agonists of the signal transduction pathway - recombinant BMP2 and IL-6 - or with agonists of BMP2 alone to model clinical interventions with reduced IL-6 content (or signal transduction). Control iPS cells were not treated with agonists. Cell death rates were measured under normal oxygen tension (normoxia) and also under conditions of simulated hypoxia followed by simulated reoxygenation (reperfusion).

[0083] Figure 6A Results are shown when cells were treated under normal oxygen levels. iPS cardiomyocytes expressing only the TMPRSS6 rs855791 minor allele ("736V minor allele") were not significantly affected by ablation of IL-6 signaling ("ns"): cell death, measured as the percentage of trypan blue-positive cells, was not significantly reduced when cells were treated with BMP2 compared to treatment with BMP2+IL-6. In contrast, iPS cardiomyocytes expressing the TMPRSS6 rs855791 major allele exhibited statistically significantly lower cell death when IL-6 signaling was ablated.

[0084] Figure 6B Results are shown when cells were subjected to hypoxia followed by reoxygenation. Hypoxia / reoxygenation was toxic to iPS cardiomyocytes compared to normoxic conditions, with approximately 40 percent of major and minor allele control cells killed compared to approximately 20 percent of control cells killed under normoxic conditions (compared to Figure 6A Compared to the control group, the minor allele iPS cardiomyocytes were not significantly affected by the ablation of IL-6 signaling, despite this increased background toxicity: cell death was not significantly reduced when cells were treated with BMP2 alone compared to treatment with BMP2 + IL-6. In contrast, iPS cardiomyocytes expressing the TMPRSS6 rs855791 major allele exhibited statistically significantly lower cell death when IL-6 signaling was ablated.

[0085] These data reinforce the inference drawn from the ad hoc analysis following the clinical trial data in Examples 1 and 2: reduction of IL-6 signaling effectively reduces IL-6-mediated toxicity in cardiomyocytes expressing the TMPRSS6 rs855791 major allele, but not in cardiomyocytes expressing only the minor allele. Without intending to be bound by theory, the IL-6 that promotes increased toxicity in major allele iPS cardiomyocytes may be due to an IL-6-mediated increase in hepcidin expression, followed by increased iron chelation in the cells, and subsequent iron-mediated cytotoxicity.

[0086] Patients with chronic kidney disease, such as those enrolled in the MIMICK study analyzed in Example 1, often suffer from impaired cardiac function, which is a major contributor to overall mortality. This secondary cardiac injury following primary chronic kidney disease is called type 4 cardiorenal syndrome (type 4 CRS). To directly test whether anti-IL-6 therapy is effective as a treatment in CRS4 patients with at least one copy of the TMPRSS6rs855791 major allele, as demonstrated by the data in Examples 1 and 3, we used a CRS4 model that is genotypically similar to humans who are homozygous for the TMPRSS6rs855791 major allele in rats.

[0087] After 4 weeks of treatment, the treated groups—those treated with anti-IL-6 antibody and those treated with the standard of care ACE inhibitor therapy, perindopril—demonstrated statistically significant increases in ejection fraction (EF) compared to the isotype control group. Figure 8D )(p<0.001). Similar levels of ejection fraction in the anti-IL-6 and standard of care groups measured after 4 weeks of treatment demonstrate that anti-IL-6 therapy has equivalent efficacy to ACE inhibitors. Figure 9 These results suggest that anti-IL-6 therapy is as effective as ACE inhibitors in preserving myocardial contractility. Figures 10A-10C These results suggest that anti-IL-6 therapy is also effective in reducing cardiac fibrosis.

[0088] These data demonstrate that treatment with an anti-IL-6 agent effectively reduces cardiac damage and restores function in an in vivo model of cardiorenal syndrome in animals genotypically similar to humans homozygous for the TMPRSS6 rs855791 major allele.

[0089] Similarly, the data in Examples 2 and 3 indicate that reduced IL-6 levels or IL-6 signaling can reduce heart failure and death in patients with acute coronary syndromes, but only in those patients with at least one copy of the TMPRSS6 rs855791 major allele, and with the greatest effect in those patients with elevated serum IL-6 levels.

[0090] Studies were conducted to determine the effect of anti-IL-6 therapy after acute myocardial infarction in mice genotypically similar to humans homozygous for the TMPRSS6 rs855791 major allele.

[0091] Figure 11A and 11B Data from an in vivo model are presented in which myocardial infarction was induced in mice genotypically similar to humans homozygous for the TMPRSS6 rs855791 major allele. A control group received no therapy. An experimental group was treated with an anti-murine IL-6 antibody. Figure 11A It was demonstrated that treatment with anti-IL-6 provided a statistically significant improvement in ejection fraction compared to controls. Figure 11B The results showed that treatment with anti-IL-6 provided a statistically significant improvement in contractility, measured as fractional shortening, compared to controls. These data suggest that anti-IL-6 therapy, given immediately after myocardial infarction, improves left ventricular functional recovery in rodents genotypically similar to human patients with the TMPRSS6 rs855791 major allele.

[0092] In summary, our data suggest that therapeutic interventions that reduce IL-6 signaling in patients with hepcidin-mediated conditions, such as anemia or hepcidin-mediated cytotoxicity, will provide clinical benefit, but only in those patients with at least one copy of the TMPRSS6rs855791 major allele, with the greatest effect in patients with elevated IL-6 levels.

[0093] Thus, as further described below, in a first aspect, a method for treating a hepcidin-mediated condition is provided. The method comprises administering a therapeutically effective amount of an IL-6 antagonist to a patient suffering from a hepcidin-mediated condition, the patient having been determined to have at least one copy of the major allele at the TMPRSS6 rs855791 SNP. In a second aspect, a method for improving the treatment of a hepcidin-mediated condition is provided, the method comprising interrupting administration of an IL-6 antagonist to a patient suffering from a hepcidin-mediated condition, wherein the patient has been determined to be homozygous for the TMPRSS6 rs855791 minor allele. The treatment is improved by interrupting an inefficient therapy, thereby reducing side effects and reducing costs without losing therapeutic efficacy. In another aspect, a method for treating an IL-6 mediated inflammatory disorder in a patient without anemia of chronic inflammation is provided, the method comprising administering to the patient a therapeutically effective amount of an IL-6 antagonist, the patient having an IL-6 mediated inflammatory disorder, not having anemia, and wherein the individual has been determined to have at least one copy of the TMPRSS6 rs855791 major allele.

[0094] 5.2 Definitions

[0095] Unless defined otherwise, all technical and scientific terms used herein have the meanings commonly understood by one skilled in the art to which this invention belongs. As used herein, the following terms have the meanings ascribed to them below.

[0096] "Hepcidin" means a polypeptide having at least about 85% or greater amino acid identity to the amino acid sequence provided by NCBI Accession No. NP_066998 ("Hepcidin proprotein") or a biologically active fragment thereof. Exemplary hepcidin biological activities include binding to and reducing the level of the iron export channel transferrin, inhibiting iron transport, inhibiting intestinal iron absorption, and inhibiting iron release from macrophages and the liver. An exemplary hepcidin proprotein amino acid sequence is provided below:

[0097]

[0098] With reference to the above sequence, hepcidin exists in various forms, including as a preprohormone (amino acids 25-84), a prohormone (amino acids 25-84), and mature forms designated hepcidin-25 (amino acids 60-84), hepcidin-22 (amino acids 63-84), and hepcidin-20 (amino acids 65-84).

[0099] A "hepcidin-mediated disorder" is any disorder in which hepcidin expression contributes to the etiology of the disorder or any of its symptoms. The contribution of hepcidin to the etiology may be known, suspected, or inferred from the observation that administration of an IL-6 antagonist provides a greater therapeutic benefit in patients with a disorder who have at least one copy of the TMPRSS6 rs855791 SNP major allele compared to patients with the disorder who are homozygous for the TMPRSS6 rs855791 SNP minor allele. Hepcidin-mediated disorders are further described below in Section 5.4.1.

[0100] By "transmembrane protease serine 6 (TMPRSS6) polypeptide" is meant a polypeptide or fragment thereof having at least about 85% or greater amino acid identity to the amino acid sequence provided as NCBI Accession No. NP_001275929 and having serine protease activity. TMPRSS6 polypeptides, also known as MT2, break down hepcidin and inhibit bone morphogenetic protein signaling. An exemplary TMPRSS6 amino acid sequence having alanine (736A) at position 736 is provided below:

[0101]

[0102] An exemplary TMPRSS6 amino acid sequence with valine at position 736 (736V) is provided below:

[0103]

[0104] "TMPRSS6 nucleic acid molecule" means a polynucleotide encoding a TMPRSS6 polypeptide (transmembrane proteinase-2; MT2). ​​An exemplary TMPRSS6 nucleic acid molecule sequence is provided as NCBI Accession No. NM_001289000. The TMPRSS6 nucleic acid sequence having a G at nucleotide position 2321 ("G allele"; "major allele") is provided below:

[0105]

[0106]

[0107] The TMPRSS6 nucleic acid sequence with an A at nucleotide position 2321 is provided below:

[0108]

[0109]

[0110]

[0111] "Variant" means a polynucleotide or polypeptide sequence that differs from a reference sequence by one or more nucleotides or one or more amino acids. An exemplary TMPRSS6 variant is TMPRSS6(A736V), caused by SNP rs855791 (G→A).

[0112] "Single nucleotide polymorphism" or "SNP" means a naturally occurring DNA sequence variant in which a single nucleotide in a genome differs between members of a biological species or between paired chromosomes in an individual. SNPs can be used as genetic markers for variant alleles. In one embodiment, the TMPRSS6 SNP is rs855791.

[0113] "rs855791" refers to a single nucleotide polymorphism (SNP) in the human TMPRSS6 gene, 2321G→A, which causes an alanine to valine substitution (A736V) in the catalytic domain of the MT2 protein encoded by the TMPRSS6 gene. The allele with the highest frequency in the human population (the major allele) is 2321G, encoding 736A. The allele with the lowest frequency in the human population (the minor allele) is 2321A, encoding 736V.

[0114] "Heterozygous" means that a chromosomal locus has two different alleles. In one embodiment of the methods described herein, heterozygous refers to a genotype in which one allele has a TMPRSS6 nucleic acid sequence encoding a TMPRSS6 polypeptide with alanine at amino acid position 736 (e.g., a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule) (rs855791 major allele), and the other allele has a variant TMPRSS6 nucleic acid sequence encoding a TMPRSS6 polypeptide comprising valine at amino acid position 736 (e.g., an A or T at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule) (rs855791 minor allele).

[0115] "Homozygous" means that a chromosomal locus has two identical alleles. In certain embodiments of the methods described herein, homozygous refers to a genotype in which both alleles have a TMPRSS6 nucleic acid sequence encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 (e.g., a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule) (rs855791 homozygous major allele). In some embodiments, homozygous refers to a genotype in which both alleles have a TMPRSS6 nucleic acid sequence encoding a TMPRSS6 polypeptide comprising valine at amino acid position 736 (e.g., an A or T at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule) (rs855791 homozygous minor allele).

[0116] "Determining that the patient has at least one copy of the TMPRSS6 rs855791 major allele" includes, but is not limited to, performing an analysis to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele; ordering the analysis to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele; specifying the analysis to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele; otherwise directing or controlling the analysis to be performed to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele; and reviewing TMRSS6 genotype analysis data or protein or nucleic acid sequence data to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele.

[0117] "Interleukin 6 (IL-6)" or "IL-6 polypeptide" refers to a polypeptide or fragment thereof having at least about 85% or greater amino acid identity to the amino acid sequence provided as NCBI Accession No. NP_000591 and having IL-6 biological activity. IL-6 is a pleiotropic cytokine with multiple biological functions. Exemplary IL-6 biological activities include immunostimulatory and pro-inflammatory activities. An exemplary IL-6 amino acid sequence is provided below:

[0118]

[0119] "Interleukin 6 (IL-6) nucleic acid" means a polynucleotide encoding an interleukin 6 (IL-6) polypeptide. An exemplary interleukin 6 (IL-6) nucleic acid sequence is provided as NCBI Accession No. NM_000600. An exemplary sequence of NCBI Accession No. NM_000600 is provided below.

[0120]

[0121]

[0122] "Interleukin 6 receptor (IL-6R) complex" refers to a protein complex comprising the IL-6 receptor subunit α (IL-6Rα) and the interleukin 6 signaling glycoprotein 130, also known as the interleukin 6 receptor subunit β (IL-6Rβ).

[0123] "Interleukin 6 receptor subunit alpha (IL-6Rα) polypeptide" means a polypeptide or fragment thereof having at least about 85% or greater amino acid identity to the amino acid sequence provided as NCBI Accession No. NP_000556 or NP_852004 and having IL-6 receptor biological activity. Exemplary IL-6Rα biological activities include binding to IL-6, binding to glycoprotein 130 (gp130), and regulating cell growth and differentiation. Exemplary IL-6R sequences are provided below:

[0124]

[0125] "Interleukin 6 receptor subunit beta (IL-6Rβ) polypeptide" means a polypeptide or fragment thereof having at least about 85% or greater amino acid identity to the amino acid sequence provided by NCBI Accession No. NP_002175, NP_786943, or NP_001177910 and having IL-6 receptor biological activity. Exemplary IL-6Rβ biological activities include binding to IL-6Rα, IL-6 receptor signaling activity, and regulation of cell growth, differentiation, hepcidin expression, etc. Exemplary IL-6Rβ sequences are provided below:

[0126]

[0127]

[0128] "IL-6 antagonist" means an agent that reduces the biological activity of IL-6. IL-6 antagonists include agents that reduce the level of IL-6 polypeptide in serum, including agents that reduce the expression of IL-6 polypeptide or nucleic acid; agents that reduce the ability of IL-6 to bind to IL-6R; agents that reduce the expression of IL-6R; and agents that reduce signal transduction through the IL-6R receptor when bound by IL-6. In preferred embodiments, the IL-6 antagonist reduces the biological activity of IL-6 by at least about 10%, 20%, 30%, 50%, 70%, 80%, 90%, 95%, or even 100%. As further described in Section 5.9 below, IL-6 antagonists include IL-6 binding polypeptides, such as anti-IL-6 antibodies and antigen-binding fragments or derivatives thereof; IL-6R binding polypeptides, such as anti-IL-6R antibodies and antigen-binding fragments or derivatives thereof; and synthetic chemical molecules, such as JAK1 and JAK3 inhibitors.

[0129] "IL-6 antibody" or "anti-IL-6 antibody" refers to an antibody that specifically binds to IL-6. Anti-IL-6 antibodies include monoclonal and polyclonal antibodies specific for IL-6, as well as antigen-binding fragments or derivatives thereof. IL-6 antibodies are described in more detail in Section 5.9.1 below.

[0130] "IL-6-mediated inflammatory disorder" means any disorder in which IL-6 is known or suspected to contribute to the etiology of the disease or any of its symptoms.

[0131] "Erythropoietin (EPO)" means a polypeptide or fragment thereof having at least about 85% or greater amino acid identity to the amino acid sequence provided as NCBI Accession No. NP_000790 and having EPO biological activity. Exemplary EPO biological activities include binding to the erythropoietin receptor and the resulting proliferation and terminal differentiation of erythroid precursor cells and / or increasing erythropoiesis (red blood cell production). An exemplary EPO amino acid sequence is provided below:

[0132]

[0133] "Erythropoiesis-stimulating agent (ESA)" means an agent that stimulates erythropoiesis. ESAs include, but are not limited to, EPO; darbepoetin (Aranesp); epoetin beta (NeoRecormon); epoetin delta (Dynepo); epoetin omega (Epomax); and epoetin zeta.

[0134] "Erythropoietic factor" refers to an agent that increases the growth or proliferation of red blood cells or their progenitor cells (e.g., hematopoietic stem cells) and / or reduces cell death of red blood cells or their progenitor cells. In various embodiments, erythropoietic factors include erythropoiesis stimulating agents, HIF stabilizers, and iron supplementation.

[0135] "C-reactive protein (CRP) polypeptide" means a polypeptide or fragment thereof having at least about 85% or greater amino acid identity to the amino acid sequence provided as NCBI Accession No. NP_000558 and having complement activation activity. CRP levels increase in response to inflammation. An exemplary CRP sequence is provided below:

[0136]

[0137] "Agent" means any compound or composition suitable for administration in therapy, and specifically includes chemical compounds; proteins, including antibodies or antigen-binding fragments thereof; peptides; and nucleic acid molecules.

[0138] "Subject" means a human or non-human mammal (including but not limited to bovine, equine, canine, ovine, feline, and rodent species, including murine and house mouse species). A "patient" is a human subject.

[0139] As used herein, the term "treat" and its analogs refer to reducing or ameliorating a disorder and / or signs or symptoms associated therewith, or slowing or stopping its progression. It should be understood that treating a disorder or condition does not require, although not precluded, complete elimination of the disorder, condition, or symptoms associated therewith.

[0140] "Prior to treatment" means prior to the first administration of an IL-6 antagonist according to the methods described herein. Prior to treatment does not exclude, and often includes, prior administration of treatment other than an IL-6 antagonist.

[0141] As used herein, the words "comprise," "contain," "have," "include," and "includes" and variations thereof have the meanings ascribed thereto in U.S. patent law, permitting the presence of additional components other than those expressly recited.

[0142] "Biological sample" means any tissue, cell, body fluid or other substance derived from an organism (eg, a human individual). In certain embodiments, the biological sample is serum or blood.

[0143] "Angiotensin-converting enzyme (ACE) inhibitors" refers to agents that inhibit the biological function of angiotensin-converting enzyme (ACE) to convert angiotensin I to angiotensin II. ACE inhibitors include, but are not limited to, quinapril, perindopril, ramipril, captopril, benazepril, trandolapril, fosinopril, lisinopril, moexipril, and enalapril. In various embodiments, the ACE inhibitor is perindopril.

[0144] 5.1 Other Illustrative Conventions

[0145] Unless otherwise specified, antibody constant region residue numbering is according to the EU index as in Kabat.

[0146] 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50.

[0147] Unless the context specifically requires or is obvious, the term "or" used herein should be understood to be inclusive. Unless the context specifically requires or is obvious, the terms "a", "an" and "the" used herein should be understood to be singular or plural.

[0148] Unless otherwise specified or obvious from the context, the term "about" as used herein should be understood to mean within normal tolerances in the art, such as within 2 standard deviations of the mean. Approximately can be understood to mean within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise apparent from the context, all numerical values ​​provided herein are modified by the term about.

[0149] 5.2 Methods of Treating Hepcidin-Mediated Conditions

[0150] In a first aspect, methods of treating hepcidin-mediated disorders are provided.

[0151] The method comprises administering a therapeutically effective amount of an IL-6 antagonist to an individual (typically a human patient) having a hepcidin-mediated condition, wherein the individual has been determined to have at least one copy of the TMPRSS6 rs855791 major allele. In a first series of embodiments, the individual has previously been determined to have at least one copy of the TMPRSS6 rs855791 major allele. In another series of embodiments, the method further comprises a prior step of determining that the individual has at least one copy of the TMPRSS6 rs855791 major allele. Typically, the method positively excludes treatment of individuals who are homozygous for the TMPRSS6 rs855791 minor allele. Typically, the patient has an elevated pre-treatment serum IL-6 level.

[0152] 5.2.1 Hepcidin-mediated conditions

[0153] 5.2.1.1 Chronic diseases / chronic inflammatory anemia

[0154] In various embodiments, the hepcidin-mediated disorder treated by the methods described herein is anemia of chronic disease, also known as anemia of chronic inflammation.

[0155] In various embodiments, the patient is male and has a hemoglobin (Hb) level of less than 14 g / dl before treatment. In some embodiments, the Hb level of a male patient before treatment is 13.0-13.9 g / dl, 12.0-12.9 g / dl, 11.0-11.9 g / dl, 10.0-10.9 g / dl, or less than 10 g / dl. In various embodiments, the patient is female and has a Hb level of less than 12 g / dl before treatment. In some embodiments, the Hb level of a female patient before treatment is 11.0-11.9 g / dl, 10.0-10.9 g / dl, 9.0-9.9 g / dl, 8.0-8.9 g / dl, or less than 8 g / dl. In some of these embodiments, the patient has previously been treated with an ESA. In some embodiments, the patient has been treated with iron supplementation. In some embodiments, the patient has been treated with a transfusion of blood or red blood cell concentrate.

[0156] In various embodiments, the patient is male and has a pre-treatment hematocrit of less than 40%. In some embodiments, the pre-treatment hematocrit of a male patient is less than 39%, less than 38%, less than 37%, less than 36%, or less than 35%. In certain embodiments, the pre-treatment hematocrit of a male patient is 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, or 30%. In various embodiments, the patient is female and has a pre-treatment hematocrit of less than 36%. In some embodiments, the pre-treatment hematocrit of a female patient is less than 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, or 26%. In certain embodiments, the pre-treatment hematocrit of a female patient is 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, or 26%. In some of these embodiments, the patient has been treated with an ESA. In some embodiments, the patient has been treated with iron supplementation.In some embodiments, the patient has been treated with transfusions of blood or red blood cell concentrates.

[0157] In some embodiments, the patient has been treated with an ESA and has a normal pre-treatment Hb level and / or a normal pre-treatment hematocrit. In certain embodiments, the patient is male and has a pre-treatment hemoglobin (Hb) level of at least 14 g / dL and / or a pre-treatment hematocrit of at least 40%. In certain embodiments, the patient is female and has a pre-treatment Hb level of at least 12 g / dL and / or a hematocrit of at least 36%. In specific embodiments, the ESA is EPO. In specific embodiments, the ESA is darbepoetin alfa.

[0158] In some embodiments, the patient has been treated with iron supplementation and has a normal pre-treatment Hb level and / or a normal pre-treatment hematocrit. In certain embodiments, the patient is male and has a pre-treatment hemoglobin (Hb) level of at least 14 g / dl and / or a pre-treatment hematocrit of at least 40%. In certain embodiments, the patient is female and has a pre-treatment Hb level of at least 12 g / dl and / or a hematocrit of at least 36%.

[0159] In some embodiments, the patient has been treated with transfusions of whole blood or red blood cell concentrates and has a normal pre-treatment Hb level and / or a normal pre-treatment hematocrit. In certain embodiments, the patient is male and has a pre-treatment hemoglobin (Hb) level of at least 14 g / dl and / or a pre-treatment hematocrit of at least 40%. In certain embodiments, the patient is female and has a pre-treatment Hb level of at least 12 g / dl and / or a hematocrit of at least 36%.

[0160] In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to increase the patient's Hb level above pre-treatment levels. In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to increase the patient's hematocrit level above pre-treatment levels. In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to increase both the Hb level and the hematocrit level above pre-treatment levels.

[0161] In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to reduce the patient's ESA dose below pre-treatment levels without reducing the patient's Hb level. In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to reduce the patient's ESA dose below pre-treatment levels without reducing the patient's hematocrit. In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to reduce the patient's ESA dose without reducing the patient's Hb level and hematocrit.

[0162] In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's ESA dose by at least 10% compared to the pre-treatment ESA dose. In certain embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's ESA dose by at least 20%, 30%, 40%, or 50% compared to the pre-treatment ESA dose. In a specific embodiment, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's ESA dose by at least 60% or even at least 75% compared to the pre-treatment ESA dose.

[0163] In some embodiments, a dose of an IL-6 antagonist is administered on a schedule and for a period of time sufficient to reverse functional iron deficiency.

[0164] 5.2.1.1.1 Chronic kidney disease

[0165] In various embodiments, the chronic disease is chronic kidney disease (CKD).

[0166] In some embodiments, the patient has KDOQI stage 1 chronic kidney disease. In certain embodiments, the patient has KDOQI stage 2 chronic kidney disease, KDOQI stage 3 chronic kidney disease, KDOQI stage 4 chronic kidney disease, or KDOQI stage 5 chronic kidney disease.

[0167] In some embodiments, the patient has cardiorenal syndrome (CRS). In certain embodiments, the patient has type 4 CRS.

[0168] In some embodiments, the patient has been treated with dialysis.

[0169] In some embodiments, a dose of an IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiovascular (CV) mortality compared to an age-matched and disease-matched historical cohort.

[0170] 5.2.1.1.2 Chronic inflammatory diseases

[0171] In various embodiments, the chronic disease is a chronic inflammatory disease.

[0172] In some embodiments, the chronic inflammatory disease is rheumatoid arthritis (RA).

[0173] In specific embodiments, the patient's pre-treatment DAS28 score is greater than 5.1. In some embodiments, the patient's pre-treatment DAS28 score is between 3.2 and 5.1. In some embodiments, the patient's pre-treatment DAS28 score is less than 2.6. In various embodiments, the patient's pre-treatment RA is severely active. In some embodiments, the patient's pre-treatment RA is moderately active.

[0174] In certain embodiments, the patient has been treated with methotrexate. In some embodiments, when treatment with an IL-6 antagonist is initiated, methotrexate is discontinued. In some embodiments, when treatment with an IL-6 antagonist is initiated, treatment with methotrexate is continued.

[0175] In certain embodiments, the patient has been treated with an anti-TNFα agent. In a specific embodiment, the anti-TNFα agent is selected from etanercept, adalimumab, infliximab, certolizumab pegol, and golimumab. In a specific embodiment, the anti-TNFα agent is discontinued when treatment with an IL-6 antagonist is initiated.

[0176] In certain embodiments, the patient has been treated with an IL-1 receptor antagonist. In a specific embodiment, the IL-1 receptor antagonist is anakinra. In a particular embodiment, the IL-1 receptor antagonist is discontinued when treatment with an IL-6 antagonist is initiated.

[0177] In certain embodiments, the patient is already being treated with abatacept. In specific embodiments, abatacept is discontinued when treatment with an IL-6 antagonist is initiated.

[0178] In certain embodiments, the patient has been treated with an IL-6 antagonist, and the method further comprises continuing to administer the IL-6 antagonist only to those patients newly determined to have at least one copy of the TMPRSS6 rs855791 major allele. In a specific embodiment, the IL-6 antagonist is tocilizumab. In a specific embodiment, the IL-6 antagonist is tofacitinib.

[0179] In various embodiments, the chronic inflammatory disease is selected from the group consisting of juvenile idiopathic arthritis, ankylosing spondylitis, plaque psoriasis, psoriatic arthritis, inflammatory bowel disease, Crohn's disease, and ulcerative colitis.

[0180] 5.2.1.1.3 Cancer

[0181] In various embodiments, the chronic disease is cancer.

[0182] In some embodiments, the cancer is selected from the group consisting of solid tumors, small cell lung cancer, non-small cell lung cancer, blood cancer, multiple myeloma, leukemia, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), lymphoma, and Hodgkin's lymphoma.

[0183] 5.2.1.1.4 Chronic infection

[0184] In various embodiments, the chronic disease is a chronic infection.

[0185] 5.2.1.1.5 Congestive Heart Failure

[0186] In various embodiments, the chronic disease is congestive heart failure (CHF).

[0187] 5.2.1.2 Iron-Refractory Iron Deficiency Anemia (IRIDA)

[0188] In various embodiments, the hepcidin-mediated disorder is iron-refractory iron deficiency anemia (IRIDA).

[0189] 5.2.1.3 Anemia associated with hepcidin-producing hepatic adenomas

[0190] In various embodiments, the hepcidin-mediated disorder is anemia associated with a hepcidin-producing hepatic adenoma.

[0191] 5.2.1.4 Acute coronary syndrome

[0192] The data presented in Examples 2, 3, and 5 below demonstrate that IL-6 antagonists are effective in reducing the risk of heart failure and death, and in increasing cardiac function and reducing fibrosis following acute myocardial infarction. Thus, in various embodiments, the hepcidin-mediated condition is acute coronary syndrome.

[0193] In certain embodiments, the patient has suffered a myocardial infarction within 60 days prior to the first administration of the IL-6 antagonist. In specific embodiments, the patient has suffered a myocardial infarction within 30 days, 14 days, 7 days, 48 ​​hours, or 24 hours prior to the first administration of the IL-6 antagonist.

[0194] In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to improve cardiac contractility compared to pre-treatment levels. In certain embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to improve cardiac ejection fraction compared to pre-treatment levels. In certain embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a sufficient period of time to reduce cardiac fibrosis compared to pre-treatment levels.

[0195] 5.2.1.5 Castleman's disease

[0196] In various embodiments, the hepcidin-mediated disorder is Castleman's disease.

[0197] 5.3 Methods for Improving Treatment of Hepcidin-Mediated Conditions

[0198] In another aspect, a method for improving the treatment of hepcidin-mediated conditions by interrupting inefficient therapy is provided, thereby reducing side effects and reducing costs without losing therapeutic efficacy. The method comprises interrupting the administration of an IL-6 antagonist to a patient suffering from a hepcidin-mediated condition, wherein the patient has been determined to be homozygous for the TMPRSS6rs855791 minor allele. In one series of embodiments, the patient has previously been determined to be homozygous for the TMPRSS6rs855791 minor allele. In another series of embodiments, the method further comprises an earlier step of determining that the patient is homozygous for the TMPRSS6rs855791 minor allele. In a typical embodiment, the patient has an elevated pre-treatment serum IL-6 level. In various embodiments, the patient has an elevated pre-treatment serum CRP level.

[0199] In various embodiments, the patient has a hepcidin-mediated disorder selected from those described in Section 5.4.1, supra. In certain embodiments, the patient has anemia of chronic disease.

[0200] 5.4 Methods of Treating IL-6-Mediated Inflammatory Disorders

[0201] The data presented in Examples 2, 3, and 5 demonstrate that IL-6 antagonists provide therapeutic benefit in individuals with elevated pre-treatment IL-6 levels and at least one copy of the TMPRSS6 major allele, even in the absence of anemia. Thus, in another aspect, methods are provided for treating IL-6-mediated inflammatory disorders in patients without anemia of chronic inflammation.

[0202] The method comprises administering a therapeutically effective amount of an IL-6 antagonist to an individual, typically a human patient, having an IL-6-mediated inflammatory condition, wherein the patient is not anemic and wherein the individual has been determined to have at least one copy of the TMPRSS6 rs855791 major allele. In a first series of embodiments, the individual has previously been determined to have at least one copy of the TMPRSS6 rs855791 major allele. In another series of embodiments, the method further comprises the prior step of determining that the individual has at least one copy of the TMPRSS6 rs855791 major allele. Typically, the method positively excludes treatment of individuals who are homozygous for the TMPRSS6 rs855791 minor allele. Typically, the patient has an elevated pre-treatment serum IL-6 level.

[0203] In some embodiments, the IL-6 mediated disorder is rheumatoid arthritis (RA).

[0204] In specific embodiments, the patient's pre-treatment DAS28 score is greater than 5.1. In some embodiments, the patient's pre-treatment DAS28 score is between 3.2 and 5.1. In some embodiments, the patient's pre-treatment DAS28 score is less than 2.6. In various embodiments, the patient's pre-treatment RA is severely active. In some embodiments, the patient's pre-treatment RA is moderately active.

[0205] In certain embodiments, the patient has been treated with methotrexate. In some embodiments, when treatment with an IL-6 antagonist is initiated, methotrexate is discontinued. In some embodiments, when treatment with an IL-6 antagonist is initiated, methotrexate is continued.

[0206] In certain embodiments, the patient has been treated with an anti-TNFα agent. In a specific embodiment, the anti-TNFα agent is selected from etanercept, adalimumab, infliximab, certolizumab pegol, and golimumab. In a specific embodiment, the anti-TNFα agent is discontinued when treatment with an IL-6 antagonist is initiated.

[0207] In certain embodiments, the patient is already being treated with an IL-1 receptor antagonist. In a specific embodiment, the IL-1 receptor antagonist is anakinra. In a particular embodiment, the IL-1 receptor antagonist is discontinued when treatment with an IL-6 antagonist is initiated.

[0208] In certain embodiments, the patient is already being treated with abatacept. In specific embodiments, abatacept is discontinued when treatment with an IL-6 antagonist is initiated.

[0209] In various embodiments, the IL-6 mediated disorder is selected from the group consisting of juvenile idiopathic arthritis, ankylosing spondylitis, plaque psoriasis, psoriatic arthritis, inflammatory bowel disease, Crohn's disease, and ulcerative colitis.

[0210] 5.5 Serum IL-6 and CRP levels before treatment

[0211] In typical embodiments of the methods described herein, the patient has elevated pre-treatment serum IL-6 levels.

[0212] In some embodiments, the patient's pre-treatment serum IL-6 level is greater than 2.5 pg / ml. In various embodiments, the patient's pre-treatment serum IL-6 level is greater than 5 pg / ml, greater than 7.5 pg / ml, greater than 10 pg / ml, greater than 12.5 pg / ml, or greater than 15 pg / ml.

[0213] In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce a patient's serum IL-6 level below pre-treatment levels. In certain embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce a patient's serum IL-6 level by at least 10%, 20%, 30%, 40%, or 50% compared to pre-treatment levels.

[0214] In various embodiments, the patient has an elevated pre-treatment C-reactive protein (CRP) level. In some embodiments, the patient's pre-treatment CRP level is greater than 2 mg / ml, 2.5 mg / ml, 3 mg / ml, 3.5 mg / ml, 4 mg / ml, 4.5 mg / ml, or 5 mg / ml. In some embodiments, the patient's pre-treatment CRP level is greater than 7.5 mg / ml, 10 mg / ml, 12.5 mg / ml, or 15 mg / ml.

[0215] In some embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's CRP level below the pre-treatment level. In certain embodiments, a dose of an IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's CRP level by at least 10%, 20%, 30%, 40%, or 50% compared to the pre-treatment level.

[0216] 5.6TMPRSS6 rs855791 genotyping

[0217] The methods described herein comprise administering a therapeutically effective amount of an IL-6 antagonist to an individual determined to have at least one copy of the TMPRSS6 rs855791 major allele. Preferably, both alleles corresponding to the gene of interest are identified, thereby allowing identification and differentiation of patients who are homozygous for the TMPRSS6 rs855791 major allele, heterozygous for both the major and minor TMPRSS6 rs855791 alleles, and homozygous for the TMPRSS6 rs855791 minor allele.

[0218] The absence (major allele) or presence (minor allele) of SNP rs855791 (2321G→A) in the TMPRSS6 gene was determined using standard techniques.

[0219] Typically, PCR is used to amplify a biological sample obtained from a patient.

[0220] In some embodiments, real-time PCR (RT-PCR) is used simultaneously to detect the absence or presence of polymorphisms under amplification. In certain embodiments, RT-PCR analysis utilizes 5' nuclease ( probes), molecular beacons and / or FRET hybridization probes. Reviewed in Espy et al., Clin. Microbiol. Rev. 2006 Jan;19(1):165-256, which is incorporated herein by reference in its entirety. In typical embodiments, commercially available assays are used. In selected embodiments, commercially available assays are selected from the group consisting of: TaqMan TM SNP genotyping assay (ThermoFisher); PCR SNP genotyping assay (Qiagen); Novallele genotyping assay (Canon); and SNP Type TM Analysis (formerly SNPtype) (Fluidigm).

[0221] In some embodiments, after amplification, use hybridization, restriction endonuclease digestion, nucleic acid sequencing, primer extension, microarray or gene chip analysis, mass spectrometry and / or DNA enzyme protection analysis with a probe specific to SNP rs855791 to detect the lack or existence of polymorphism. In some embodiments, allelic variants are interpreted by sequencing. In certain embodiments, Sanger sequencing is used. In certain embodiments, one of the various next generation sequencing technologies is used, including, for example, the sequencing technology selected from the group consisting of: microarray sequencing, Solexa sequencing (Illumina), ion rapid flow (Life Technologies), SOliD (Applied Biosystems), pyrophosphate sequencing, single molecule real-time sequencing (Pacific Bio), nanopore sequencing and tunneling current sequencing.

[0222] 5.7 IL-6 antagonists

[0223] IL-6 antagonists used in the methods described herein are capable of reducing the biological activity of IL-6.

[0224] 5.7.1 Anti-IL-6 Antibodies

[0225] In various embodiments, the IL-6 antagonist is an anti-IL-6 antibody or an antigen-binding fragment or derivative thereof.

[0226] In some embodiments, the IL-6 antagonist is a full-length anti-IL-6 monoclonal antibody. In specific embodiments, the full-length monoclonal antibody is an IgG antibody. In certain embodiments, the full-length monoclonal antibody is an IgG1, IgG2, IgG3, or IgG4 antibody. In some embodiments, the IL-6 antagonist is a polyclonal composition comprising multiple species of the full-length anti-IL-6 antibody, each of which has unique CDRs. In some embodiments, the IL-6 antagonist is an antibody fragment selected from Fab, Fab', and F(ab')2 fragments. In some embodiments, the IL-6 antagonist is an scFv, a disulfide-linked Fv (dsFv), or a single-domain antibody, such as a camel-derived VHH single-domain nanobody. In some embodiments, the IL-6 antagonist is an immunoconjugate or fusion comprising an IL-6 antigen-binding fragment. In some embodiments, the antibody is bispecific or multispecific, wherein at least one of the antigen-binding moieties is specific for IL-6.

[0227] In some embodiments, the antibodies are fully human. In some embodiments, the antibodies are humanized. In some embodiments, the antibodies are chimeric and have non-human V regions and human C regions. In some embodiments, the antibodies are murine.

[0228] In typical embodiments, the anti-IL-6 antibody has a K of less than 100 nM for binding to human IL-6. D In some embodiments, the anti-IL-6 antibody has a K of less than 75 nM, 50 nM, 25 nM, 20 nM, 15 nM, or 10 nM for binding to human IL-6. D In certain embodiments, the anti-IL-6 antibody has a K of less than 5 nM, 4 nM, 3 nM, or 2 nM for binding to human IL-6. D In selected embodiments, the anti-IL-6 antibody binds to human IL-6 with a K of less than 1 nM, 750 pM, or 500 pM. D In specific embodiments, the anti-IL-6 antibody has a K of no greater than 500 pM, 400 pM, 300 pM, 200 pM, or 100 pM for binding to human IL-6. D .

[0229] In typical embodiments, the anti-IL-6 antibody neutralizes the biological activity of IL-6. In some embodiments, the neutralizing antibody prevents IL-6 from binding to the IL-6 receptor.

[0230] In typical embodiments, the anti-IL-6 antibody has an elimination half-life of at least 7 days after intravenous administration. In certain embodiments, the anti-IL-6 antibody has an elimination half-life of at least 14 days, at least 21 days, or at least 30 days.

[0231] In some embodiments, the anti-IL-6 antibody has a human IgG constant region with at least one amino acid substitution (that increases serum half-life) compared to an unsubstituted human IgG constant domain.

[0232] In certain embodiments, the IgG constant domain comprises substitutions at residues 252, 254, and 256, wherein the amino acid substitution at amino acid residue 252 is with tyrosine, the amino acid substitution at amino acid residue 254 is with threonine, and the amino acid substitution at amino acid residue 256 is with glutamine ("YTE"). See U.S. Patent No. 7,083,784, which is incorporated herein by reference in its entirety. In certain extended half-life embodiments, the IgG constant domain comprises a substitution selected from the group consisting of: T250Q / M428L (Hinton et al., J. Immunology 176:346-356 (2006)); N434A (Yeung et al., J. Immunology 182:7663-7671 (2009)); or T307A / E380A / N434A (Petkova et al., International Immunology, 18:1759-1769 (2006)).

[0233] In some embodiments, the elimination half-life of anti-IL-6 antibodies is increased by utilizing the FcRN binding properties of human serum albumin. In certain embodiments, the antibody is bound to albumin (Smith et al., Bioconjug. Chem., 12: 750-756 (2001)). In some embodiments, the anti-IL-6 antibody is fused to a bacterial albumin binding domain (Stork et al., Prot. Eng. Design Science 20: 569-76 (2007)). In some embodiments, the anti-IL-6 antibody is fused to an albumin binding peptide (Nguygen et al., Prot Eng Design Sel 19: 291-297 (2006)). In some embodiments, the anti-IL antibody is bispecific, one of which is specific for IL-6 and one is specific for human serum albumin (Ablynx, WO 2006 / 122825 (bispecific nanobody)).

[0234] In some embodiments, the elimination half-life of the anti-IL-6 antibody is increased by: PEGylation (Melmed et al., Nature Reviews Drug Discovery 7:641-642 (2008)); HPMA copolymer conjugation (Lu et al., Nature Biotechnology 17:1101-1104 (1999)); polydextrose conjugation (Nuclear Medicine Communications, 16:362-369 (1995)); conjugation to high amino acid polymers (HAP; HAP-ylated) (Schlapschy et al., Prot Eng Design Sel 20:273-284 (2007)); or polysialylation (Constantinou et al., Bioconjug. Chem. 20:924-931 (2009)).

[0235] 5.7.1.1.1 MED5117 and derivatives

[0236] In certain embodiments, the anti-IL-6 antibody, or antigen-binding portion thereof, comprises all six CDRs of MEDI5117. In a specific embodiment, the antibody, or antigen-binding portion thereof, comprises the MEDI5117 heavy chain V region and light chain V region. In a specific embodiment, the antibody is a full-length MEDI5117 antibody. The MEDI5117 antibody is described in WO 2010 / 088444 and US 2012 / 0034212, the disclosures of which are incorporated herein by reference in their entireties. The MEDI5117 antibody has the following CDRs and heavy and light chain sequences:

[0237] MEDI5117 VH CDR1

[0238]

[0239] MEDI5117 VH CDR2

[0240]

[0241] MEDI5117 VH CDR3

[0242]

[0243] MEDI5117 VL CDR1

[0244]

[0245] MEDI5117 VL CDR2

[0246]

[0247] MEDI5117 VL CDR3

[0248]

[0249] MEDI5117 heavy chain

[0250]

[0251] MEDI5117 light chain

[0252]

[0253] In various embodiments, the anti-IL-6 antibody is a derivative of MED5117.

[0254] In some embodiments, the MED5117 derivative comprises one or more amino acid substitutions in the MED5117 heavy chain and / or light chain V region.

[0255] In certain embodiments, relative to the initial V of MEDI5117 anti-IL-6 antibody, H and / or V L , the derivative comprises fewer than 25 amino acid substitutions, fewer than 20 amino acid substitutions, fewer than 15 amino acid substitutions, fewer than 10 amino acid substitutions, fewer than 5 amino acid substitutions, fewer than 4 amino acid substitutions, fewer than 3 amino acid substitutions, fewer than 2 amino acid substitutions, or 1 amino acid substitution while retaining specificity for human IL-6.

[0256] In certain embodiments, the MED5117 derivative comprises an amino acid sequence that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of the VH and VL domains of MEDI5117. The percent sequence identity is determined using the BLAST algorithm using default parameters.

[0257] In certain embodiments, the MED5117 derivative comprises an amino acid sequence wherein the CDR comprises an amino acid sequence that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of a respective CDR of MEDI5117. The percent sequence identity is determined using the BLAST algorithm using default parameters.

[0258] In certain embodiments, V H and / or V L The CDR derivatives comprise conservative amino acid substitutions at one or more predicted nonessential amino acid residues (ie, amino acid residues that are not critical for specific binding of the antibody to human IL-6).

[0259] 5.7.1.1.2 Other anti-IL-6 antibodies

[0260] In various embodiments, the anti-IL-6 antibody comprises six CDRs from an antibody selected from the group consisting of siltuximab, glierinzumab, seleukumab, clazakinumab, onokimab, eskalomab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In certain embodiments, the anti-IL-6 antibody comprises a heavy chain V region and a light chain V region from an antibody selected from the group consisting of sildenafil, glierinzumab, selenuocumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In a specific embodiment, the anti-IL-6 antibody is an antibody selected from the group consisting of sildenafil, gliadinizumab, selenuocumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0261] In some embodiments, the anti-IL-6 antibody comprises six CDRs from an antibody selected from those described in US 2016 / 0168243, US 2016 / 0130340, US 2015 / 0337036, US 2015 / 0203574, US 2015 / 0140011, US 2015 / 0125468, US 2014 / 0302058, US 2014 / 0141013, US 2013 / 0280266, US 2013 / 0017575, US 2010 / 0215654, US 2008 / 0075726, U.S. Pat. No. 5,856,135, US 2006 / 0240012, US 2006 / 0257407 or U.S. Patent No. 7,291,721, the disclosures of which are incorporated herein by reference in their entirety.

[0262] 5.7.2 Anti-IL-6 Receptor Antibodies

[0263] In various embodiments, the IL-6 antagonist is an anti-IL-6 receptor antibody or an antigen-binding fragment or derivative thereof.

[0264] In some embodiments, the IL-6 antagonist is a full-length anti-IL-6 receptor monoclonal antibody. In specific embodiments, the full-length monoclonal antibody is an IgG antibody. In certain embodiments, the full-length monoclonal antibody is an IgG1, IgG2, IgG3, or IgG4 antibody. In some embodiments, the IL-6 antagonist is a polyclonal composition comprising multiple species of full-length anti-IL-6 receptor antibodies, each of which has unique CDRs. In some embodiments, the IL-6 antagonist is an antibody fragment selected from Fab and Fab' fragments. In some embodiments, the IL-6 antagonist is a scFv, a single-domain antibody, including a VHH single-domain nanobody derived from camelids. In some embodiments, the antibody is bispecific or multispecific, wherein at least one of the antigen-binding moieties is specific for IL-6R.

[0265] In some embodiments, the antibodies are fully human. In some embodiments, the antibodies are humanized. In some embodiments, the antibodies are chimeric and have non-human V regions and human C regions. In some embodiments, the antibodies are murine.

[0266] In typical embodiments, the anti-IL-6 receptor antibody has a K of less than 100 nM for binding to human IL-6R. D In some embodiments, the anti-IL-6R antibody has a K of less than 75 nM, 50 nM, 25 nM, 20 nM, 15 nM, or 10 nM for binding to human IL-6R. DIn certain embodiments, the anti-IL-6 receptor antibody has a K of less than 5 nM, 4 nM, 3 nM, or 2 nM for binding to human IL-6R. D In selected embodiments, the anti-IL-6 receptor antibody binds to human IL-6R with a K of less than 1 nM, 750 pM, or 500 pM. D In specific embodiments, the anti-IL-6 receptor antibody binds to human IL-6R with a K of no greater than 500 pM, 400 pM, 300 pM, 200 pM, or 100 pM. D .

[0267] In typical embodiments, the anti-IL-6R reduces the biological activity of IL-6.

[0268] In typical embodiments, the anti-IL-6R antibody has an elimination half-life of at least 7 days following intravenous administration. In certain embodiments, the anti-IL-6R antibody has an elimination half-life of at least 14 days, at least 21 days, or at least 30 days.

[0269] In some embodiments, the anti-IL-6R antibody has a human IgG constant region with at least one amino acid substitution (that increases serum half-life) compared to an unsubstituted human IgG constant domain.

[0270] In certain embodiments, the IgG constant domain comprises substitutions at residues 252, 254, and 256, wherein the amino acid substitution at amino acid residue 252 is with tyrosine, the amino acid substitution at amino acid residue 254 is with threonine, and the amino acid substitution at amino acid residue 256 is with glutamine ("YTE"). See U.S. Patent No. 7,083,784, which is incorporated herein by reference in its entirety. In certain extended half-life embodiments, the IgG constant domain comprises a substitution selected from the group consisting of: T250Q / M428L (Hinton et al., J. Immunology 176:346-356 (2006)); N434A (Yeung et al., J. Immunology 182:7663-7671 (2009)); or T307A / E380A / N434A (Petkova et al., International Immunology, 18:1759-1769 (2006)).

[0271] In some embodiments, the elimination half-life of the anti-IL-6R antibody is increased by utilizing the FcRN binding properties of human serum albumin. In certain embodiments, the antibody is bound to albumin (Smith et al., Bioconjug. Chem., 12: 750-756 (2001)). In some embodiments, the anti-IL-6R antibody is fused to a bacterial albumin binding domain (Stork et al., Prot. Eng. Design Science 20: 569-76 (2007)). In some embodiments, the anti-IL-6 antibody is fused to an albumin binding peptide (Nguygen et al., Prot Eng Design Sel 19: 291-297 (2006)). In some embodiments, the anti-IL antibody is bispecific, one of which is specific for IL-6R and one is specific for human serum albumin (Ablynx, WO 2006 / 122825 (bispecific nanobody)).

[0272] In some embodiments, the elimination half-life of the anti-IL-6R antibody is increased by: PEGylation (Melmed et al., Nature Reviews Drug Discovery 7:641-642 (2008)); HPMA copolymer conjugation (Lu et al., Nature Biotechnology 17:1101-1104 (1999)); polydextrose conjugation (Nuclear Medicine Communications, 16:362-369 (1995)); conjugation to high amino acid polymers (HAP; HAP-ylated) (Schlapschy et al., Prot Eng Design Sel 20:273-284 (2007)); or polysialylation (Constantinou et al., Bioconjug. Chem. 20:924-931 (2009)).

[0273] In certain embodiments, the anti-IL-6R antibody, or antigen-binding portion thereof, comprises all six CDRs of tocilizumab. In specific embodiments, the antibody, or antigen-binding portion thereof, comprises the heavy chain V region and light chain V region of tocilizumab. In a specific embodiment, the antibody is a full-length tocilizumab antibody.

[0274] In certain embodiments, the anti-IL-6R antibody, or antigen-binding portion thereof, comprises all six CDRs of sarilumab. In specific embodiments, the antibody, or antigen-binding portion thereof, comprises the heavy and light chain V regions of sarilumab. In a specific embodiment, the antibody is a full-length sarilumab antibody.

[0275] In certain embodiments, the anti-IL-6R antibody, or antigen-binding portion thereof, comprises all six CDRs of VX30 (Vaccinex), ARGX-109 (arGEN-X), FM101 (Formatech), SA237 (Roche), NI-1201 (NovImmune), or an antibody described in US 2012 / 0225060.

[0276] In certain embodiments, the anti-IL-6R antibody, or antigen-binding portion thereof, is a single-domain antibody. In a specific embodiment, the single-domain antibody is a camelid VHH single-domain antibody. In a specific embodiment, the antibody is fulviciding (ALX-0061) (Ablynx NV).

[0277] 5.7.3 Anti-IL-6:IL-6R Complex Antibodies

[0278] In various embodiments, the IL-6 antagonist is an antibody specific for a complex of IL-6 and IL-6R. In certain embodiments, the antibody has six CDRs selected from those described in US 2011 / 0002936, which is incorporated herein by reference in its entirety.

[0279] 5.7.4 JAK and STAT Inhibitors

[0280] IL-6 is known to signal via the JAK-STAT pathway.

[0281] In various embodiments, the IL-6 antagonist is an inhibitor of the JAK signaling pathway. In some embodiments, the JAK inhibitor is a JAK1 specific inhibitor. In some embodiments, the JAK inhibitor is a JAK3 specific inhibitor. In some embodiments, the JAK inhibitor is a pan-JAK inhibitor.

[0282] In certain embodiments, the JAK inhibitor is selected from the group consisting of tofacitinib (Xeljanz), dersentinib, ruxolitinib, upadatinib, baricitinib, filgotinib, letutinib, paritinib, pifitinib, INCB-039110, ABT-494, INCB-047986, and AC-410.

[0283] In various embodiments, the IL-6 antagonist is a STAT3 inhibitor. In a specific embodiment, the inhibitor is AZD9150 (AstraZeneca, Isis Pharmaceuticals), a STAT3 antisense molecule.

[0284] 5.7.5 Additional IL-6 Antagonists

[0285] In various embodiments, the IL-6 antagonist is an antagonist peptide.

[0286] In certain embodiments, the IL-6 antagonist is C326 (Avidia's IL-6 inhibitor, also known as AMG220) or FE301, a recombinant protein inhibitor of IL-6 (Ferring International Center SA, Conaris Research Institute AG). In some embodiments, the anti-IL-6 antagonist comprises soluble gp130, FE301 (Conaris / Ferring).

[0287] 5.8 Dosage Regimen

[0288] 5.8.1 Antibodies, Antigen-Binding Fragments, and Peptides

[0289] In typical embodiments, the antibodies, antigen-binding fragments, and peptide IL-6 antagonists are administered parenterally.

[0290] In some parenteral embodiments, the IL-6 antagonist is administered intravenously. In certain intravenous embodiments, the IL-6 antagonist is administered as a bolus. In certain intravenous embodiments, the IL-6 antagonist is administered as an infusion. In certain intravenous embodiments, the IL-6 antagonist is administered as a bolus followed by an infusion. In some parenteral embodiments, the IL-6 antagonist is administered subcutaneously.

[0291] In various embodiments, the antibody, antigen-binding fragment, or peptide IL-6 antagonist is administered in a dose that is independent of the patient's body weight or surface area (uniform dose).

[0292] In some embodiments, the intravenous uniform dose is 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, or 10 mg. In some embodiments, the intravenous uniform dose is 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, or 20 mg. In some embodiments, the intravenous uniform dose is 25 mg, 30 mg, 40 mg, or 50 mg. In some embodiments, the intravenous uniform dose is 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg. In some embodiments, the intravenous uniform dose is 1-10 mg, 10-15 mg, 15-20 mg, 20-30 mg, 30-40 mg, or 40-50 mg. In some embodiments, the intravenous uniform dose is 1-40 mg or 50-100 mg.

[0293] In some embodiments, the subcutaneous uniform dose is 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg. In some embodiments, the subcutaneous uniform dose is 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, or 200 mg. In some embodiments, the subcutaneous uniform dose is 210 mg, 220 mg, 230 mg, 240 mg, or 250 mg. In some embodiments, the subcutaneous uniform dose is 10-100 mg, 100-200 mg, or 200-250 mg. In some embodiments, the subcutaneous uniform dose is 10-20 mg, 20-30 mg, 30-40 mg, 40-50 mg, 50-60 mg, 60-70 mg, 70-80 mg, 80-90 mg, or 90-100 mg. In some embodiments, the subcutaneous uniform dose is 100-125 mg, 125-150 mg, 150-175 mg, 175-200 mg, or 200-250 mg.

[0294] In various embodiments, the antibody, antigen-binding fragment, or peptide IL-6 antagonist is administered at a dose based on the patient's body weight.

[0295] In some embodiments, the antagonist is administered at an intravenous dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, or 1.0 mg / kg. In some embodiments, the antagonist is administered at a dose of 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4.5 mg / kg, or 5 mg / kg.

[0296] In some embodiments, the subcutaneous weight-based dose is 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, or 1.0 mg / kg. In some embodiments, the antagonist is administered at a dose of 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4.5 mg / kg, or 5 mg / kg.

[0297] In various intravenous embodiments, the IL-6 antagonist is administered once every 7 days, once every 14 days, once every 21 days, once every 28 days, or once a month. In various subcutaneous embodiments, the IL-6 antagonist is administered once every 14 days, once every 28 days, once a month, once every two months (every other month), or once every three months.

[0298] In certain preferred embodiments, the IL-6 antagonist is the MEDI5117 antibody. In various embodiments, MEDI5117 is administered IV once weekly at a uniform dose of 1-30 mg. In certain embodiments, the MEDI5117 antibody is administered IV once weekly at a uniform dose of 1, 2, 3, 4, 5, 7.5, 10, 15, 20, 25, or 30 mg. In some embodiments, the MEDI5117 antibody is administered sc once monthly to once every three months at a uniform dose of 25-250 mg. In specific embodiments, MEDI5117 is administered sc once monthly, once every two months, or once every three months at a dose of 30 mg, 45 mg, 60 mg, 75 mg, 100 mg, 120 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, or 250 mg.

[0299] In some embodiments, the IL-6 antagonist is tocilizumab. In various embodiments, for patients ≥100 kg, tocilizumab is administered subcutaneously at a starting dose of 162 mg once weekly. In some embodiments, tocilizumab is administered intravenously at a dose of 4 mg / kg every 4 weeks, followed by an increase to 8 mg / kg every 4 weeks based on clinical response.

[0300] 5.8.2 JAK and STAT Inhibitors

[0301] In typical embodiments, the small molecule JAK inhibitor and the STAT inhibitor are administered orally.

[0302] In various embodiments, the inhibitor is administered orally at a dose of 1-10 mg, 10-20 mg, 20-30 mg, 30-40 mg, or 40-50 mg once or twice a day. In some embodiments, the inhibitor is administered orally at a dose of 50-60 mg, 60-70 mg, 70-80 mg, 80-90 mg, or 90-100 mg once or twice a day. In some embodiments, the inhibitor is administered orally at a dose of 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 mg once or twice a day. In some embodiments, the inhibitor is administered orally at a dose of 75 mg QD or BID and at a dose of 100 mg QD or BID.

[0303] In certain embodiments, the JAK inhibitor is tofacitinib and is administered at a dose of 5 mg PO BID or at a dose of 11 mg PO QD.

[0304] In certain embodiments, the JAK inhibitor is dersentinib and is administered at a dose of 25 mg, 50 mg, 100 mg, or 150 mg PO BID.

[0305] In certain embodiments, the inhibitor is ruxolitinib and is administered at a dose of 25 mg PO BID, at a dose of 20 mg PO BID, at a dose of 15 mg PO BID, at a dose of 10 mg PO BID, or at a dose of 5 mg PO BID.

[0306] 5.9 Other therapeutic agents

[0307] In various embodiments of the methods described herein, the method further comprises administering a therapeutic agent in addition to the IL-6 antagonist, wherein the second therapeutic agent is also capable of reducing hepcidin expression.

[0308] In some embodiments, the second therapeutic agent is a BMP antagonist. In certain embodiments, the BMP antagonist is an anti-BMP6 antibody. In a specific embodiment, the anti-BMP6 antibody has six CDRs of the antibodies described in US 2016 / 0176956 or US 2016 / 0159896, the disclosures of which are incorporated herein by reference in their entirety.

[0309] In certain embodiments, the second therapeutic agent is a hepcidin antagonist. In a specific embodiment, the hepcidin antagonist is an anti-hepcidin antibody. In a specific embodiment, the anti-hepcidin antibody comprises six CDRs of the antibody disclosed in Kovac et al., Haematologica (2016) doi:10.3324 / haematol.2015.140772 [Epub ahead of print].

[0310] In certain embodiments, the second therapeutic agent is a hepcidin antagonist. In a specific embodiment, the hepcidin antagonist is an anti-hepcidin antibody. In a specific embodiment, the antibody has six CDRs of the antibody described in US2016 / 0017032, the disclosure of which is incorporated herein by reference in its entirety.

[0311] 5.10 Kit

[0312] In another aspect, kits are provided.

[0313] In typical embodiments, the kit provides reagents to determine a patient's genotype at the TMPRSS6 SNP rs855791 position from a biological sample obtained from the patient.

[0314] 5.11 Other aspects and implementation methods

[0315] 5.11.1 Methods for treating inflammation in chronic kidney disease or cardiovascular disease

[0316] In other aspects and embodiments, compositions and methods are provided for characterizing and treating inflammation in chronic kidney disease or cardiovascular disease with IL-6 antagonists, as well as methods for characterizing a patient's response to treatment.

[0317] These aspects and embodiments are based, at least in part, on the discovery that inflammatory conditions in patients with chronic kidney disease and cardiovascular disease who have one or more alleles of TMPRSS6 containing a G or C at nucleotide position 2321 (encoding a TMPRSS6 polypeptide containing alanine at amino acid position 736) place these patients at higher risk of death, and that such individuals can be treated with IL-6 antagonists to reduce this risk. As reported in more detail below, patients with chronic kidney disease were genotyped, serum levels of IL-6 and CRP were analyzed, and these diagnostic data were compared with the EPO dose administered and the risk of death. Patients who had one or more alleles of TMPRSS6 containing a G or C at nucleotide position 2321 (encoding a TMPRSS6 polypeptide containing alanine at amino acid position 736) and elevated levels of IL-6 and / or CRP required higher EPO doses for treatment and had a higher mortality rate. The nucleotide at this position has been shown to be important in identifying patients with iron deficiency anemia (see Finberg et al., Nat. Genet. 2008; 40(5): 569-571, which is hereby incorporated by reference in its entirety for all purposes, including sequences, variants, nomenclature, etc.). These data strongly support the identification of a subset of patients based on TMPRSS6 genotype who require higher EPO doses and / or have a higher risk of death and who will likely respond to IL-6 inhibition in the presence or absence of standard therapy for treating anemia (e.g., associated with chronic kidney disease). By inhibiting inflammation, EPO dosing can be reduced, thereby avoiding adverse side effects of EPO (e.g., cardiovascular risk).

[0318] These aspects and embodiments are further based on the discovery that patients with one or more alleles of TMPRSS6 containing a G or C at nucleotide position 2321 (encoding a TMPRSS6 polypeptide containing alanine at amino acid position 736) are at increased risk of death associated with myocardial infarction or cardiovascular disease. These patients may also benefit from IL-6 inhibition, which will reduce inflammation and increased risk.

[0319] Thus, methods are provided for treating inflammation associated with cardiovascular disease or chronic kidney disease (including anemia of chronic kidney disease) and / or reducing the risk of death associated with such conditions by inhibiting IL-6 bioactivity, for example, in patients selected by TMPRSS6 genotyping at SNP rs855791, by blocking the binding of IL-6 or its receptor (gp80) to each other, or blocking their signaling or expression (e.g., by anti-IL-6 antibodies or by anti-IL-6R antibodies or JAK1 / STAT3 inhibition). In one embodiment, treatment of chronic kidney disease is performed in the presence or absence of standard treatment for anemia and by characterizing the response of patients with chronic kidney disease to treatment for anemia, for example, by genotyping TMPRSS6 at SNP rs855791 and measuring the levels of inflammatory markers (e.g., increased serum levels of IL-6 and / or CRP).

[0320] Provided are methods for treating cardiovascular disease or anemia in chronic kidney disease and / or reducing mortality associated with chronic inflammation in such patients by administering an agent that inhibits IL-6 bioactivity or expression.

[0321] In some aspects and embodiments, compositions and methods are provided for treating chronic inflammatory diseases that contribute to death in individuals with chronic kidney disease or cardiovascular disease, and for characterizing the patient's response to such therapy. In specific embodiments, methods are provided for characterizing and treating chronic inflammatory anemia and death (e.g., in chronic kidney disease), and for characterizing the patient's response to treatment for anemia (e.g., administration of erythropoietin or an erythropoiesis-stimulating agent). In one aspect, a method for treating chronic inflammatory diseases in a selected individual is provided, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is selected for treatment by having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736.

[0322] In another aspect, a method for treating inflammatory or chronic inflammatory conditions in a selected individual with cardiovascular disease or chronic kidney disease is provided, the method comprising administering an IL-6 antagonist (e.g., an anti-IL-6 antibody) to the individual, wherein the individual is selected for treatment by having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736. In one embodiment, the method reduces the risk of death in the individual. In one embodiment, the individual has a history of myocardial infarction or heart failure.

[0323] In another aspect, a method is provided for reducing inflammation and risk of death in a selected individual with cardiovascular disease or renal disease, the method comprising administering an IL-6 antagonist (e.g., an anti-IL-6 antibody) to the individual, wherein the individual is selected to have one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 and has increased inflammation relative to a reference. In one embodiment, the individual has a history of myocardial infarction or heart failure.

[0324] In another aspect, methods are provided for reducing the risk of mortality in an individual with chronic kidney disease or heart failure, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is identified as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 and has increased inflammation relative to a reference.

[0325] In another aspect, a method of treating anemia in an individual is provided, the method involving administering an IL-6 antagonist to the individual, alone or in combination with a therapy for anemia, wherein the individual is identified as having one or more alleles encoding a TMPRSS6 polypeptide (also known as MT2) comprising alanine at amino acid position 736 (e.g., having a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule) and has increased inflammation relative to a reference.

[0326] In another aspect, methods are provided for treating anemia in an individual with increased inflammation, the methods involving administering an IL-6 antagonist (e.g., an IL-6 antibody), alone or in combination with an erythropoietic factor, in an amount effective to neutralize inflammation in the individual, the individual having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 (e.g., having a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule).

[0327] In yet another aspect, methods are provided for enhancing the response to EPO in an individual identified in need thereof, the method comprising administering an IL-6 antagonist (e.g., an IL-6 antibody) in an amount effective to neutralize inflammation in the individual, thereby reducing the EPO dose, wherein the individual has one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 (e.g., having a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule).

[0328] In another aspect, a method of reducing mortality in an individual with increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual, the individual having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 (e.g., having a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule).

[0329] In yet another aspect, a method of selecting a therapy for an individual identified as in need thereof is provided, the method involving: characterizing the individual as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 (e.g., having a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule); and detecting the level of one or more inflammatory markers IL-6 or CRP, wherein the characterization indicates that an IL-6 antagonist should be administered alone or in combination with a therapy for anemia.

[0330] In yet another aspect, a method is provided for increasing the proliferation or survival of red blood cells or their progenitors (e.g., hematopoietic stem cells, pre-erythroblasts, erythroblasts, or reticulocytes) in an individual identified as in need thereof, the method comprising administering to the individual an IL-6 antagonist and an erythropoietic factor, wherein the individual is identified as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 (e.g., having a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule) and has increased inflammation relative to a reference.

[0331] In various embodiments of any one of the aspects described herein, the individual suffers from or is identified as having anemia, including anemia of cancer, anemia in chronic autoimmune diseases, anemia in chronic inflammatory diseases, anemia in cardiovascular diseases, anemia in metabolic syndrome, and similar anemias. In various embodiments of any one of the aspects described herein, the individual suffers from or is identified as having chronic kidney disease. In various embodiments of any one of the aspects described herein, the individual suffers from or is identified as having inflammatory. In various embodiments of any one of the aspects described herein, the individual has or is identified as having an increased risk of death associated with chronic inflammatory, chronic kidney disease, or cardiovascular disease. In various embodiments of any one of the aspects described herein, the individual is identified as needing treatment. In various embodiments of any one of the aspects described herein, the individual suffers from or is identified as having increased inflammatory. In various embodiments of any of the aspects described herein, the individual has or is identified as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 (e.g., a G or C at nucleotide position 2321 of the TMPRSS6 nucleic acid molecule) and has increased inflammatory conditions relative to a reference. In various embodiments of any of the aspects described herein, the method comprises administering an IL-6 antagonist to the individual. In various embodiments of any of the aspects described herein, the method comprises administering an IL-6 antagonist and a therapy for anemia to the individual. In various embodiments of any of the aspects described herein, the individual is human.

[0332] In various embodiments of any of the aspects described herein, the therapy for anemia comprises administering an erythropoietic factor. In various embodiments, the erythropoietic factor is one or more of erythropoietin, an erythropoiesis stimulating agent, a HIF stabilizer, and iron supplementation.

[0333] In various embodiments, increased inflammation is characterized by increased IL-6 and / or CRP levels relative to a reference group (e.g., as measured by a conventional CRP assay or a high sensitivity assay (hsCRP), both of which detect CRP but differ in assay performance). In various embodiments, increased inflammation is characterized by IL-6 greater than about 5 pg / ml. In various embodiments, increased inflammation is characterized by CRP greater than about 2 mg / L.

[0334] In various embodiments of any of the aspects described herein, the IL-6 antagonist is administered in an amount effective to neutralize inflammation. In various embodiments, the amount effective to neutralize inflammation reduces IL-6 to less than about 15 pg / ml, less than about 10 pg / ml, or less than about 5 pg / ml. In various embodiments, the amount effective to neutralize inflammation reduces CRP to less than about 2 mg / L or less than about 0.2 mg / L.

[0335] In various embodiments of any of the aspects described herein, administration of an IL-6 antagonist or anti-IL-6 antibody reduces the dose of EPO. In certain embodiments, the dose of EPO is reduced by about 40 IU / kg / week, about 50 IU / kg / week, about 80 IU / kg / week, about 100 IU / kg / week, or greater than 100 IU / kg / week. In various embodiments, administration of an IL-6 antagonist or anti-IL-6 antibody reduces the side effects of an increased EPO dose.

[0336] In one embodiment, the patient with chronic kidney disease is treated under the presence or absence of standard treatment for anemia. In detail, in the presence or absence of treatment for anemia (such as giving EPO, ESA, HIF tranquilizer, supplementing iron or red blood cell transfusion), the individual suffering from the anemia associated with chronic kidney disease is provided with a medicament that suppresses IL-6 biological activity or expression. The treatment for anemia works by stimulating erythropoiesis or erythrocyte production. Therefore, the medicament that increases the growth or proliferation of erythrocytes or their progenitor cells and / or reduces the cell death of erythrocytes or their progenitor cells can also be given. Erythrocyte progenitor cells include, for example, hematopoietic stem cells, common bone marrow progenitor cells, pre-erythrocyte mother cells, erythrocyte mother cells, reticulocytes or any cell that can differentiate or mature into erythrocytes.

[0337] Agents that inhibit the biological activity of IL-6 by blocking the binding of IL-6 or its receptor (gp80) to each other or blocking its signal transduction or expression can be provided to individuals with anemia associated with chronic kidney disease in the form of a pharmaceutical composition, wherein the pharmaceutical composition comprises an effective amount of the agent, an agent for treating anemia (e.g., EPO, ESA, HIF prolyl-hydroxylase inhibitor, iron supplementation) and a suitable excipient. In one embodiment, the agent is an IL-6 antagonist or anti-IL-6 antibody that reduces the content or activity of an IL-6 polypeptide or nucleic acid molecule in an individual, or inhibits intracellular signal transduction triggered by IL-6 receptor activation. Anti-IL-6 antibodies (e.g., MEDI5117) can be administered in combination with treatments for anemia (e.g., administration of EPO, ESA, HIF tranquilizers, iron supplementation). The method for treating anemia varies depending on the patient's TMPRSS6 genotype and the patient's inflammatory state. In the context of anemia treatment (e.g., administration of EPO, ESA, HIF stabilizers, iron supplementation), patients who are homozygous or heterozygous for the major allele of TMPRSS6 containing a G or C at nucleotide position 2321 (encoding a TMPRSS6 polypeptide containing alanine at amino acid position 736) and have elevated levels of inflammatory markers (e.g., IL-6 and / or CRP) are administered an IL-6 antagonist or anti-IL-6 antibody, which reduces the level or activity of the IL-6 polypeptide. Patients who are homozygous for the minor allele of TMPRSS6 containing an A or T at nucleotide position 2321 (encoding a TMPRSS6 polypeptide containing valine at amino acid position 736) do not require anti-IL-6 therapy to supplement their anemia treatment. The method of treatment for anemia varies depending on the stage of chronic kidney disease, patient age, health status, and physical condition.

[0338] In another aspect, there is provided an analysis suitable for characterizing an individual suffering from anemia (e.g., in chronic kidney disease) associated with chronic inflammatory conditions. Inflammatory markers IL-6 and CRP can be detected by any suitable method. The methods described herein can be used individually or in combination for detecting IL-6 or CRP biomarkers and / or inflammatory conditions. In one embodiment, relative to the expression of a reference (e.g., serum from a healthy control individual), inflammation is characterized by the content of IL-6 and / or CRP polypeptides in the biological sample (e.g., serum) of the individual, wherein an increase in IL-6 and / or CRP expression indicates inflammation. In another embodiment, an increase in IL-6 and / or CRP expression indicates that the individual suffering from anemia associated with chronic kidney disease will not react to the treatment for anemia, and / or when given in combination with an IL-6 antagonist (e.g., anti-IL-6 antibody), the treatment for anemia will react.

[0339] In one embodiment, IL-6 and / or CRP polypeptide levels are measured by immunoassay. Immunoassays typically use antibodies (or other agents that specifically bind to markers) to detect the presence or content of biomarkers in a sample. Antibodies can be prepared by methods well known in the art (e.g., by immunizing an animal with a biomarker or a fragment thereof). Biomarkers can be separated from samples based on their binding characteristics. Alternatively, if the amino acid sequence of a polypeptide biomarker is known, the polypeptide can be synthesized and used to produce antibodies by methods well known in the art.

[0340] In various embodiments, conventional immunoassays are used, including, for example, Western blotting; sandwich immunoassays, including ELISA and other enzyme immunoassays; fluorescence-based immunoassays and chemiluminescence. Turbidimetric assays are performed in liquid phase, where the antibody is in solution. The binding of the antigen to the antibody results in a change in absorbance, which is measured. Other forms of immunoassays include magnetic immunoassays, radioimmunoassays, and real-time quantitative PCR (iqPCR). Other detection methods include liquid chromatography and mass spectrometry.

[0341] Immunoassays can be performed on solid substrates (e.g., chips, beads, microfluidic platforms, membranes) or on any other format that supports binding of antibodies to markers and subsequent detection. A single marker can be detected at a time or a multiplex format can be used. Multiplex immunoassays may involve planar microarrays (protein chips) and bead-based microarrays (suspension arrays).

[0342] Chronic kidney disease patients with anemia identified as having increased IL-6 and / or CRP polypeptide levels are selected for treatment with an agent that reduces IL-6 expression or activity (e.g., an anti-IL-6 antibody) in combination with anemia treatment. Patients treated with the methods of the present invention can be monitored by measuring changes in hemoglobin, hematocrit, erythropoietin dosage, IL-6 and / or CRP expression after treatment. Patients who show reduced IL-6 and / or CRP expression and / or reduced inflammation are identified as responding to IL-6 inhibition.

[0343] Further aspects and embodiments are provided in the following numbered clauses.

[0344] 1. A method for treating chronic inflammatory disease in a selected individual, the method comprising administering to the individual an IL-6 antagonist, wherein the individual selected for treatment has one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736.

[0345] 2. A method for treating inflammatory bowel disease in a selected individual suffering from cardiovascular disease, heart failure, and / or chronic kidney disease, the method comprising administering to the individual an IL-6 antagonist, wherein the individual selected for treatment has one or more alleles encoding a TMP RSS6 polypeptide comprising alanine at amino acid position 736.

[0346] 3. A method of reducing inflammation and risk of mortality in a selected individual with cardiovascular disease, heart failure, and / or chronic kidney disease, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is selected as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 and having increased inflammation relative to a reference subject.

[0347] 4. A method of treating anemia in an individual with chronic kidney disease, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is identified as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 and has increased inflammation relative to a reference.

[0348] 5. The method of any one of clauses 1 to 4, wherein the IL-6 antagonist is administered in an amount effective to neutralize inflammation.

[0349] 6. The method of any one of clauses 1 to 4, wherein the IL-6 antagonist is an anti-IL-6 antibody.

[0350] 7. The method of clause 5, wherein the method further comprises administering an erythropoietic factor to the individual.

[0351] 8. The method of any one of clauses 1 to 4, wherein the method reduces the risk of death in the individual.

[0352] 9. A method of reducing the risk of mortality in an individual with chronic kidney disease or heart failure, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is identified as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736 and has increased inflammation relative to a reference.

[0353] 10. A method of treating anemia in a subject suffering from increased inflammation, the method comprising:

[0354] The erythropoietic factor and the anti-IL-6 antibody are administered in amounts effective to neutralize inflammation in a subject having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736.

[0355] 11. The method of any one of clauses 1 to 10, wherein the increased inflammation is characterized by increased IL-6 and / or CRP levels relative to a reference.

[0356] 12. The method of clause 11, wherein the increased inflammation is characterized by IL-6 greater than about 5 pg / ml, about 10 pg / ml, or about 15 pg / ml.

[0357] 13. The method of clause 10, wherein increased inflammation is characterized by a CRP greater than about 2 mg / L.

[0358] 14. The method of clause 10, wherein the erythropoietic factor is one or more of erythropoietin, an erythropoiesis-stimulating agent, a HIF stabilizer, and iron supplementation.

[0359] 15. A method of enhancing a response to EPO in an individual identified as in need thereof, the method comprising administering an IL-6 antagonist or anti-IL-6 antibody in an amount effective to neutralize inflammation in the individual, thereby enhancing the individual's response to EPO, wherein the individual has one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736.

[0360] 16. The method of clause 15, wherein the amount of anti-IL-6 antibody effective to neutralize inflammation reduces IL-6 to less than about 15 pg / ml, less than about 10 pg / ml, or less than about 5 pg / ml.

[0361] 17. The method of clause 16, wherein the amount of the IL-6 antagonist or anti-IL-6 antibody effective to neutralize inflammation reduces CRP to less than about 2 mg / L.

[0362] 18. The method of clause 15, wherein administration of an IL-6 antagonist or anti-IL-6 antibody reduces the dose of EPO.

[0363] 19. The method of clause 17, wherein the dose of EPO is reduced by about 40 IU / kg / week, about 50 IU / kg / week, about 80 IU / kg / week, about 100 IU / kg / week, or greater than 100 IU / kg / week.

[0364] 20. The method of clause 15, wherein administration of an IL-6 antagonist or anti-IL-6 antibody reduces the side effects of increased EPO.

[0365] 21. A method for selecting a therapy for an individual identified as in need thereof, the method comprising:

[0366] a) characterizing the individual as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736; and

[0367] b) detecting the level of one or more inflammatory markers IL-6 and CRP, wherein the characterization indicates that the IL-6 antagonist should be administered in combination with a therapy for anemia.

[0368] 22. The method of clause 21, wherein the method further comprises administering to the individual an IL-6 antagonist and a therapy for anemia.

[0369] 23. The method of clause 21, wherein the therapy for anemia comprises administering an erythropoietic factor.

[0370] 24. A method for increasing the proliferation or survival of red blood cells or progenitor cells thereof in an individual identified as in need thereof, the method comprising administering to the individual an IL-6 antagonist and an erythropoietic factor, wherein the individual is identified as having one or more alleles encoding a TMPRSS6 polypeptide comprising alanine at amino acid position 736, and wherein the individual has increased inflammation relative to a reference.

[0371] 25. The method of clause 24, wherein the method reduces cell death of erythrocytes or progenitor cells thereof.

[0372] 26. The method of clause 24, wherein the progenitor cell is a hematopoietic stem cell, a pre-erythroblast, an erythroblast, or a reticulocyte.

[0373] 27. The method of any one of clauses 15 to 24, wherein the subject has chronic kidney disease.

[0374] 28. The method of any one of clauses 15 to 24, wherein the subject has anemia.

[0375] 29. The method of clause 28, wherein the anemia is anemia of cancer, anemia in chronic autoimmune disease, anemia in chronic inflammatory disease, or anemia in metabolic syndrome.

[0376] 30. The method of any one of clauses 15 to 24, wherein the IL-6 antagonist is administered in an amount effective to neutralize inflammation.

[0377] 31. The method of any one of clauses 15 to 24, wherein the IL-6 antagonist is an anti-IL-6 antibody.

[0378] 32. The method of any one of clauses 15 to 24, wherein the increased inflammation is characterized by increased IL-6 and / or CRP levels relative to a reference.

[0379] 33. The method of any one of clauses 15 to 24, wherein increased inflammation is characterized by IL-6 greater than about 5 pg / ml, about 10 pg / ml, or about 15 pg / ml.

[0380] 34. The method of any one of clauses 15 to 24, wherein increased inflammation is characterized by a CRP greater than about 2 mg / L.

[0381] 35. The method of any one of clauses 15 to 24, wherein the effective neutralizing inflammatory amount reduces IL-6 to less than about 10 pg / ml or less than about 5 pg / ml.

[0382] 36. The method of any one of clauses 15 to 24, wherein the amount effective to neutralize inflammation reduces CRP to less than about 2 mg / L.

[0383] 37. The method of any one of clauses 15 to 24, wherein the erythropoietic factor is one or more of erythropoietin, an erythropoiesis stimulating agent, a HIF stabilizer, and iron supplementation.

[0384] 38. The method of clause 24, wherein administration of the IL-6 antagonist reduces the dose of EPO.

[0385] 39. The method of clause 38, wherein the IL-6 antagonist is an anti-IL-6 antibody.

[0386] 40. The method of clause 38, wherein the dose of EPO is reduced by about 40 IU / kg / week, about 50 IU / kg / week, about 80 IU / kg / week, about 100 IU / kg / week, or greater than 100 IU / kg / week.

[0387] 41. The method of clause 23, wherein administration of an IL-6 antagonist reduces the side effects of increased EPO.

[0388] 42. The method of any one of clauses 1 to 40, wherein the allele comprises a G at position 2321 of the TMPRSS6 polynucleotide.

[0389] 43. The method of any one of clauses 1 to 42, wherein the IL-6 antagonist is an anti-IL-6 antibody having one or more CDRs selected from the following nucleic acid sequences:

[0390] SNYMI (SEQ ID NO: 12);

[0391] DLYYYAGDTYYADSVKG(SEQ ID NO:13);

[0392] WADDHPPWIDL (SEQ ID NO: 14);

[0393] RASQGISSWLA (SEQ ID NO: 15);

[0394] KASTLES (SEQ ID NO: 16); and

[0395] QQSWLGGS (SEQ ID NO: 17).

[0396] 44. The method of clause 42, wherein the anti-IL-6 antibody has a heavy chain CDR1 comprising the sequence SNYMI (SEQ ID NO: 12); a heavy chain CDR2 comprising the sequence DLYYYAGDTYYADSVKG (SEQ ID NO: 13); a heavy chain CDR3 comprising the sequence WADDHPPWIDL (SEQ ID NO: 14); a light chain CDR1 comprising the sequence RASQGISSWLA (SEQ ID NO: 15); a light chain CDR2 comprising the sequence (SEQ ID NO: 16); and a light chain CDR3 comprising the sequence QQSWLGGS (SEQ ID NO 17).

[0397] 45. The method of clause 42, wherein the anti-IL-6 antibody has a heavy chain comprising the sequence:

[0398]

[0399] 46. ​​The method of clause 42, wherein the anti-IL-6 antibody has a light chain comprising the sequence:

[0400]

[0401] 47. The method of clause 42, wherein the anti-IL-6 antibody is MEDI5117.

[0402] 48. The method of any one of clauses 1 to 47, wherein the subject is a human.

[0403] 5.11.2 Methods for treating cardiorenal syndrome

[0404] In other aspects and embodiments, compositions and methods for treating cardiorenal syndrome are provided.

[0405] These aspects and embodiments are based at least in part on the following findings: anti-IL-6 treatment of cardiac injury in a rodent model of cardiorenal syndrome has an effect equivalent to standard care therapy. As reported in more detail below, after myocardial infarction, a rodent model of cardiorenal syndrome is treated with anti-IL-6 or standard care therapy (ACE inhibitors, perindopril). After treatment, the ejection fraction, myocardial contractility, and percentage of fibrotic tissue in cardiac tissue are measured. Compared with the content in the individual group treated with a control therapeutic agent, the degree of ejection fraction in the individual group treated with anti-IL-6 and the individual group treated with standard care therapy is increased. Compared with the content in the individual group treated with a control therapeutic agent, myocardial contractility in the group treated with anti-IL-6 and the group treated with standard care therapy is increased. Compared with the amount in the individual group treated with a control therapeutic agent, the amount of fibrotic tissue in the group treated with anti-IL-6 and the group treated with standard care therapy is reduced. Furthermore, the degree of ejection fraction and the amount of fibrotic tissue were similar in the group of subjects treated with anti-IL-6 and the group treated with standard of care therapy. The results suggest that anti-IL-6 therapy has equivalent efficacy to standard of care therapy in treating cardiorenal syndrome in rodent models.

[0406] These aspects and embodiments are further based, at least in part, on the discovery that patients identified as having cardiorenal syndrome after myocardial infarction and having elevated IL-6 levels are particularly at increased risk of cardiovascular death (including heart failure). Without being bound by theory, IL-6 may play a causal role in the development and / or progression of cardiorenal syndrome. Thus, patients with elevated IL-6 levels after myocardial infarction or patients with cardiorenal syndrome and elevated IL-6 levels may benefit from IL-6 inhibition.

[0407] Thus, methods are provided for treating cardiac and / or renal damage in individuals with cardiorenal syndrome, which involve administering an IL-6 antagonist to the individual. In some embodiments, cardiac and / or renal damage in individuals with cardiorenal syndrome is treated in the presence or absence of standard treatment for cardiorenal syndrome. Also provided are methods for characterizing the risk of cardiovascular death in patients after myocardial infarction, which involve detecting an increase in IL-6 levels in a biological sample obtained from the patient.

[0408] In one aspect, a method of treating cardiac and / or renal damage in a subject suffering from cardiorenal syndrome is provided, the method comprising administering to the subject an IL-6 antagonist.

[0409] In another aspect, a method of increasing cardiac function in a subject suffering from cardiorenal syndrome is provided, the method involving administering to the subject an IL-6 antagonist.

[0410] In yet another aspect, a method of reducing fibrosis in an individual suffering from cardiorenal syndrome is provided, the method involving administering to the individual an IL-6 antagonist.

[0411] In various embodiments of any one of the aspects described herein, the method further involves administering a standard of care therapy to the individual. In various embodiments, the standard of care therapy is an angiotensin-converting enzyme (ACE) inhibitor.

[0412] In various embodiments of any of the aspects described herein, the increase in cardiac function is characterized by an increase in ejection fraction and / or myocardial contractility in the subject relative to a reference group. In various embodiments of any of the aspects described herein, the decrease in fibrosis is characterized by a decrease in the percentage of fibrotic tissue in a tissue sample from the subject relative to a reference group. In various embodiments, the fibrosis is in cardiac tissue.

[0413] In various embodiments of any one of the aspects described herein, the subject suffers from cardiac and / or renal injury. In various embodiments of any one of the aspects described herein, the subject suffers from cardiac injury and subsequently suffers from renal injury.

[0414] In another aspect, the present invention provides a method for identifying an increased risk of cardiovascular death (e.g., heart failure) in an individual after myocardial infarction, the method involving measuring the level of one or more IL-6 polynucleotides or polypeptides in a sample from the individual relative to a reference group, wherein an increased level of one or more IL-6 polynucleotides or polypeptides indicates an increased risk of cardiovascular death.

[0415] In another aspect, the present invention provides a method for characterizing the risk of cardiovascular death (e.g., heart failure) in an individual after myocardial infarction, the method involving measuring the level of one or more IL-6 polynucleotides or polypeptides in a sample from the individual relative to a reference, wherein an increased level of one or more IL-6 polynucleotides or polypeptides indicates an increased risk of cardiovascular death.

[0416] In various embodiments of any one of the aspects described herein, the individual suffers from cardiorenal syndrome, heart failure, chronic kidney disease, or no cardiorenal pathology. In various embodiments of any one of the aspects described herein, the individual is identified as suffering from cardiorenal syndrome, heart failure, chronic kidney disease, or no cardiorenal pathology about one month after a myocardial infarction.

[0417] In another aspect, the present invention provides a method of treating cardiac and / or renal damage in a selected individual suffering from cardiorenal syndrome, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is selected for treatment by detecting increased levels of one or more IL-6 polynucleotides or polypeptides in a biological sample from the individual relative to a reference.

[0418] In yet another aspect, the present invention provides a method of reducing the risk of cardiovascular death (e.g., heart failure) in a selected individual with cardiorenal syndrome, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is selected by detecting increased levels of one or more IL-6 polynucleotides or polypeptides in a biological sample from the individual relative to a reference. In various embodiments of any of the aspects described herein, the individual has suffered a myocardial infarction.

[0419] In various embodiments of any of the aspects described herein, the IL-6 antagonist is an anti-IL-6 antibody. In various embodiments, the anti-IL-6 antibody is MEDI5117.

[0420] In various embodiments of any of the aspects described herein, the biological sample is a plasma sample or a serum sample. In various embodiments of any of the aspects described herein, the individual is a human.

[0421] In another aspect, a method is provided for treating cardiorenal syndrome and / or reducing the risk of death or heart failure in patients with cardiorenal syndrome by administering an agent that inhibits IL-6 bioactivity or expression. In one embodiment, a patient with cardiorenal syndrome is treated in the presence or absence of a standard treatment for cardiorenal syndrome (e.g., an angiotensin-converting enzyme (ACE) inhibitor). Specifically, an agent that inhibits IL-6 bioactivity or expression is provided to an individual with cardiorenal syndrome (e.g., administering an anti-IL-6 antibody).

[0422] In another aspect, methods of increasing cardiac function and reducing fibrosis in individuals with cardiorenal syndrome are provided. The methods comprise administering to the individual an agent that inhibits IL-6 bioactivity or expression. In some embodiments, the increase in cardiac function is characterized by an increase in the individual's ejection fraction relative to a reference (e.g., ejection fraction of a healthy control individual), or an increase in myocardial contractility (e.g., dP / dt) relative to a reference (e.g., myocardial contractility of a healthy control individual). 最大 ). In some embodiments, the reduction in fibrosis is characterized by a decrease in the percentage of fibrotic tissue in a tissue sample from the individual relative to a reference (e.g., a tissue sample obtained from a healthy control individual). In one embodiment, the fibrosis is in cardiac tissue.

[0423] Agents that inhibit the biological activity of IL-6 by blocking the binding of IL-6 or its receptors (gp80) to each other or blocking their signal transduction or expression can be provided to individuals with cardiorenal syndrome in the form of a pharmaceutical composition, wherein the pharmaceutical composition comprises an effective amount of the agent and a suitable excipient. In one embodiment, the agent is an IL-6 antagonist or anti-IL-6 antibody that reduces the content or activity of IL-6 polypeptides or polynucleotides in the individual, or inhibits intracellular signal transduction triggered by IL-6 receptor activation. Anti-IL-6 antibodies (e.g., MEDI5117) can be administered. The method for the treatment of cardiorenal syndrome can vary depending on the stage of cardiorenal syndrome, the patient's age, health status, and physical condition.

[0424] In various embodiments, individuals with cardiorenal syndrome are treated with IL-6 antagonists. In addition, individuals with increased risk of cardiovascular death and / or heart failure after myocardial infarction can be identified by characterizing the plasma IL-6 content in the individual. Individuals with elevated IL-6 content have increased risk of cardiovascular death and / or heart failure. For treatment with IL-6 antagonists, such individuals can be selected. In addition, individuals with cardiorenal syndrome and increased IL-6 content, including such individuals who have suffered myocardial infarction, can be selected for treatment. After treatment selection, such individuals can be given almost any IL-6 antagonist known in the art. Suitable IL-6 antagonists include, for example, IL-6 antagonists, commercially available IL-6 antagonists, IL-6 antagonists developed using methods well known in the art, and antagonists for the intracellular signal transduction system associated with IL-6R.

[0425] In another aspect, an analysis is provided for characterizing the risk of cardiovascular death, heart failure and / or death in an individual after myocardial infarction. The analysis provides detection of IL-6 in a biological sample obtained from an individual. IL-6 can be detected by any suitable method. In one embodiment, the risk of cardiovascular death or heart failure is characterized by detecting the IL-6 polypeptide content in the individual's biological sample (e.g., serum or plasma) relative to expression in a reference (e.g., serum or plasma from a healthy control individual or from a control individual without cardio-renal lesions), wherein an increase in IL-6 indicates an increased risk of cardiovascular death or heart failure. Individuals identified as having an increased risk of cardiovascular death, heart failure or death can be selected for treatment. In another embodiment, for treatment with an IL-6 antagonist (e.g., an anti-IL-6 antibody), individuals with cardiorenal syndrome and increased IL-6 content are selected.

[0426] In one embodiment, the level of IL-6 polynucleotide is measured. The level of IL-6 polynucleotide can be measured by standard methods such as quantitative PCR, Northern blotting, microarrays, mass spectrometry, and in situ hybridization.

[0427] In one embodiment, the IL-6 polypeptide content is measured. The content of IL-6 polypeptide can be measured by standard methods (such as by immunoassay). Immunoassays typically use antibodies (or other agents that specifically bind to the marker) to detect the presence or content of the biomarker in the sample. Antibodies can be prepared by methods well known in the art (e.g., by immunizing an animal with the biomarker or a fragment thereof). Biomarkers can be separated from the sample based on their binding characteristics. Alternatively, if the amino acid sequence of the polypeptide biomarker is known, the polypeptide can be synthesized and used to produce antibodies by methods well known in the art.

[0428] In various embodiments, the assay utilizes conventional immunoassays, including, for example, Western blotting; sandwich immunoassays, including ELISA and other enzyme immunoassays; fluorescence-based immunoassays and chemiluminescence. Turbidimetric assays are assays performed in liquid phase, where the antibody is in solution. Binding of the antigen to the antibody results in a change in absorbance, which is measured. Other forms of immunoassays include magnetic immunoassays, radioimmunoassays, and real-time quantitative immunoPCR (iqPCR). Other detection methods include liquid chromatography and mass spectrometry.

[0429] Immunoassays can be performed on solid substrates (e.g., chips, beads, microfluidic platforms, membranes) or on any other format that supports binding of antibodies to markers and subsequent detection. Single markers can be detected at a time or multiplex formats can be used. Multiplex immunoassays can involve planar microarrays (protein chips) and bead-based microarrays (suspension arrays).

[0430] For treatment with agents that reduce IL-6 expression or activity (e.g., anti-IL-6 antibodies), patients with cardiorenal syndrome identified as having increased IL-6 polypeptide content are selected. The therapeutic agent can be administered in combination with standard treatments for cardiorenal syndrome (e.g., ACE inhibitors). Patients treated with the methods of the present invention can be monitored by detecting changes in IL-6 after treatment.

[0431] Further aspects and implementations are provided in the following numbered clauses.

[0432] 1. A method for treating cardiac and / or renal damage in a subject suffering from cardiorenal syndrome, the method comprising administering to the subject an IL-6 antagonist.

[0433] 2. A method of increasing cardiac function in a subject suffering from cardiorenal syndrome, the method comprising administering to the subject an IL-6 antagonist.

[0434] 3. A method of reducing fibrosis in a subject suffering from cardiorenal syndrome, the method comprising administering to the subject an IL-6 antagonist.

[0435] 4. The method of clause 2, wherein the increase in cardiac function is characterized by an increase in ejection fraction in the individual relative to a reference group.

[0436] 5. The method of clause 3, wherein the fibrosis is in cardiac tissue.

[0437] 6. The method of clause 3 or 5, wherein the reduction in fibrosis is characterized by a reduction in the percentage of fibrotic tissue in a tissue sample from the individual relative to a reference group.

[0438] 7. The method of any one of clauses 1 to 6, wherein the subject suffers from cardiac and / or renal impairment.

[0439] 8. The method of any one of clauses 1 to 7, wherein the subject suffers from cardiac injury and subsequently suffers from renal injury.

[0440] 9. The method of any one of clauses 1 to 8, further comprising administering a standard of care therapy to the individual.

[0441] 10. The method of any one of clauses 1 to 9, wherein the standard of care therapy is an angiotensin-converting enzyme (ACE) inhibitor.

[0442] 11. A method for identifying an increased risk of cardiovascular death in an individual following myocardial infarction, the method comprising measuring the level of one or more IL-6 polynucleotides or polypeptides in a sample from the individual relative to a reference, wherein an increased level of one or more IL-6 polynucleotides or polypeptides indicates an increased risk of cardiovascular death.

[0443] 12. A method for characterizing the risk of cardiovascular death in an individual after myocardial infarction, the method comprising measuring the level of one or more IL-6 polynucleotides or polypeptides in a sample from the individual relative to a reference, wherein an increased level of one or more IL-6 polynucleotides or polypeptides indicates an increased risk of cardiovascular death.

[0444] 13. The method of clause 11 or 12, wherein the individual has cardiorenal syndrome, heart failure, chronic kidney disease, or no cardiorenal disease.

[0445] 14. The method of any one of clauses 11 to 13, wherein the individual is identified as having cardiorenal syndrome, heart failure, chronic kidney disease, or no cardiorenal disease about one month after a myocardial infarction.

[0446] 15. A method of treating cardiac and / or renal damage in a selected individual suffering from cardiorenal syndrome, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is selected for treatment by detecting increased levels of one or more IL-6 polynucleotides or polypeptides in a biological sample from the individual relative to a reference.

[0447] 16. A method of reducing the risk of cardiovascular death in a selected individual with cardiorenal syndrome, the method comprising administering an IL-6 antagonist to the individual, wherein the individual is selected by detecting increased levels of one or more IL-6 polynucleotides or polypeptides in a biological sample from the individual relative to a reference.

[0448] 17. The method of clause 15 or 16, wherein the subject has suffered a myocardial infarction.

[0449] 18. The method of any one of clauses 1 to 10 or 15 to 17, wherein the IL-6 antagonist is an anti-IL-6 antibody.

[0450] 19. The method of clause 18, wherein the anti-IL-6 antibody is MEDI5117.

[0451] 20. The method of any one of clauses 11 to 19, wherein the biological sample is a plasma sample.

[0452] 21. The method of any one of clauses 1 to 20, wherein the subject is a human.

[0453] 5.12 Examples

[0454] The following examples are offered by way of illustration and not limitation.

[0455] 5.12.1 Example 1: EPO dose and overall survival in chronic kidney disease patients are associated only with serum IL-6 and CRP levels in patients with at least one copy of the TMPRSS6 SNPrs855791 major allele

[0456] The peptide hormone hepcidin plays a major role in systemic iron homeostasis. Hentze et al., Cell 142:24-38 (2010). Hepcidin expression is known to be affected by intercalated proteinase-2, a type II transmembrane serine protease, a product of the TMPRSS6 gene. Common variants of the TMPRSS6 gene have been shown to be associated with iron status. Benyamin et al., Nature Genetics 41(11):1173-1175 (2009), and certain mutations in the TMPRSS6 gene have been shown to cause iron-refractory iron-deficiency anemia (IRIDA). Finberg et al., Nature Genetics 40(5):569-571 (2008). SNPrs855791 (2321G→A; A736V) is a naturally occurring variant of the TMPRSS6 gene that is associated with naturally occurring variants in hepcidin expression and blood hemoglobin content.

[0457] To determine whether the genotype at the TMPRSS6 rs855791 SNP predicts the degree of anemia in end-stage renal disease, data previously collected in a clinical study of patients with chronic kidney disease were analyzed in combination with the newly identified SNP genotyping. Because hepcidin expression is also regulated by IL-6, Casanovas et al., PLOS Computational Biol. 10(1):e1003421 (2014), also analyzed data to determine whether serum IL-6 levels can predict the degree of anemia in end-stage renal disease.

[0458] method

[0459] Based on the prevailing dialysis criteria, ferritin>100 ng / mL and Hb>10 mg / dL, data from N=257 patients enrolled in the MIMICK1, MIMICK2 (localization of inflammatory markers in chronic kidney disease) and MIA (malnutrition, inflammation and atherosclerosis) cohorts were curated to N=208 to select patients who were stable on hemodialysis in the absence of iron deficiency anemia and in the absence of marked anemia, thereby excluding patients with factors that could separate iron transport from hemoglobin content, said cohorts being recruited in six dialysis units in the Stockholm-Uppsala (Sweden) region during the period October 2003-September 2004.

[0460] All patient clinical data, including erythropoietin (EPO) dose in IU / kg / week, IL-6 serum level in pg / ml, CRP serum level in mg / L, survival in months, and TMPRSS6 genotype at SNPrs855791, were collated and analyzed using statistical analysis software (SPSS Statistical Desktop; IBM). The TMPRSS6 alleles studied and their nucleotide and amino acid sequences are indicated in Table 1.

[0461]

[0462] The group was divided into rs855791 subgroups (homozygous AA, heterozygous AG, and homozygous GG), and each genotype group was divided into three or four quartiles of serum IL-6 levels (e.g., IL-6 <5 pg / ml compared to >10 pg / ml, and IL-6 <5 pg / ml compared to >15 pg / ml) or serum CRP levels (CRP <2 mg / L compared to >2 mg / L). EPO doses were compared in the top and bottom three and four quartiles. Statistical analysis within the genotype groups by Student's T-test and between the groups by ANOVA was performed.

[0463] result

[0464] Since each patient's EPO dose is titrated by the treating physician to achieve normal hemoglobin levels, the EPO dose can be used as a proxy for the degree of baseline anemia. EPO dose in individuals homozygous for the minor allele (A / A) was found to be relatively insensitive to IL-6 variants ( Figure 1 A; left panel). However, EPO dose in individuals with at least one copy of the major allele—patients who are heterozygous (A / G) or homozygous (G / G) for the major allele (G)—is sensitive to individual IL-6 levels ( Figure 1 B; right panel.) In these latter individuals, increased serum IL-6 levels (eg, >5 pg / ml) correlated with increasing EPO doses.

[0465] Without being bound by a particular theory, homozygosity at the minor allele abolishes the effect of IL-6 on iron transport. Therefore, regardless of IL-6 levels, the EPO dose in these patients (A / A) is approximately the same.

[0466] Individuals homozygous for the TMPRSS6 rs855791 minor allele (A) exhibited similar mortality regardless of IL-6 levels ( Figure 2A However, survival rates for individuals with at least one copy of the major allele—patients who were heterozygous or homozygous for the major allele (G)—varied according to IL-6 levels ( Figure 2BIndeed, the G allele of TMPRSS6 conferred a higher risk of all-cause mortality in response to elevated IL-6 levels in individuals with stage 5 chronic kidney disease on dialysis. In individuals with at least one copy of the major allele (G), IL-6 levels ≥5 pg / ml (i.e., median and highest IL-6) were associated with increased mortality compared to IL-6 levels <5 pg / ml (i.e., low IL-6). Figure 2B ).

[0467] Levels of the acute-phase reactant CRP—an inflammatory marker—also correlated with increasing EPO doses in individuals heterozygous or homozygous for the major allele (G), but not in patients homozygous for the minor allele ( Figure 3 ).

[0468] Discussion

[0469] like Figure 1 In the study, we show that in patients with at least one copy of the major allele at the TMPRSS6 rs855791 SNP, the degree of basal anemia—measured as clinically titrated EPO dose—correlated only with IL-6 levels. In these patients, the higher the serum IL-6 level, the higher the EPO dose required ( Figure 1 B). In contrast, the degree of anemia in patients with two copies of the minor allele did not correlate with serum IL-6 levels ( Figure 1 A).

[0470] Similarly, in patients with at least one copy of the major allele at TMPRSS6 SNP rs855791, overall survival was associated only with IL-6 levels. Among individuals with at least one copy of the TMPRSS6 rs855791 major allele, survival was inversely correlated with serum IL-6 levels, with patients in the highest quartile of serum IL-6 levels having statistically significantly worse survival than those in the lowest quartile of IL-6 levels ( Figure 2B In contrast, overall survival in patients homozygous for the minor allele at rs855791 was not affected by IL-6 levels ( Figure 2A ).

[0471] Without intending to be bound by theory, in patients with at least one copy of the TMPRSS6 major allele, increased serum IL-6 may promote increased hepcidin expression, thereby increasing anemia. The increased risk of death is a result of dysregulated iron metabolism, resulting anemia, and / or increased doses of erythropoiesis-stimulating agents (such as EPO). If these correlations reflect causality, they raise the possibility that reduced IL-6 levels or IL-6 signaling may reduce anemia, reduce required EPO doses, and increase survival in patients with chronic kidney disease, but only in those patients with at least one copy of the TMPRSS6 rs855791 major allele, and with the greatest effect in those patients with elevated serum IL-6 levels.

[0472] 5.12.2 Example 2: Risk of death and heart failure after acute myocardial infarction is associated only with IL-6 serum levels in patients with at least one copy of the TMPRSS6 SNP rs855791 major allele

[0473] To determine whether the TMPRSS6 rs855791 genotype influences IL-6 sensitivity in patients with acute but not chronic illness, data collected previously in a clinical study of patients hospitalized with acute coronary syndrome were analyzed in combination with genotyping of the newly identified SNP.

[0474] method

[0475] Data were analyzed from individuals previously enrolled in the multicenter Platelet Inhibition and Patient Outcomes (PLATO) study. Patients were eligible for PLATO if they were hospitalized for an acute coronary syndrome (with symptomatic onset within the previous 24 hours). Mortality and the presence of heart failure were measured in these individuals starting 30 days after myocardial infarction.

[0476] result

[0477] Death in individuals homozygous for the minor allele (A) of the TMPRSS6 rs855791 SNP was not associated with IL-6 variants ( Figure 4 A). However, in response to elevated IL-6 levels in individuals after myocardial infarction, one or two copies of the major allele (G) conferred a higher risk of all-cause mortality ( Figure 4 B) Thus, TMPRSS6 regulates IL-6-mediated mortality risk after myocardial infarction.

[0478] The effect of TMPRSS6 genotype on the risk of IL-6-mediated heart failure was also measured in individuals enrolled in PLATO starting 30 days after myocardial infarction. Heart failure in individuals homozygous for the minor allele (A) was not associated with the IL-6 variant ( Figure 5 A). However, the G allele of TMPRSS6 confers a higher rate of heart failure in response to elevated IL-6 levels in individuals after myocardial infarction ( Figure 5 B) Thus, TMPRSS6 regulates IL-6-mediated heart failure risk after myocardial infarction.

[0479] Discussion

[0480] These data suggest that the correlation between TMPRSS6 genotype, IL-6 levels, and adverse clinical outcomes is not limited to patients with chronic kidney disease. Without intending to be bound by theory, in patients with at least one copy of the TMPRSS6 major allele, increased serum IL-6 may drive increased hepcidin expression, followed by increased iron chelation in cardiomyocytes, and subsequent iron-mediated cytotoxicity. If these correlations reflect causality, they raise the possibility that reduced IL-6 levels or IL-6 signaling may reduce heart failure and death in patients with acute coronary syndromes, but only in those patients with at least one copy of the TMPRSS6 rs855791 major allele, and with the greatest effect in those patients with elevated serum IL-6 levels.

[0481] 5.12.3 Example 3: In vitro studies of iPS-derived human cardiomyocytes confirm a causal relationship between TMPRSS6 genotype and IL-6-mediated cytotoxicity

[0482] Although the correlations observed in Examples 1 and 2 suggest that reduced IL-6-mediated signaling should provide clinical benefit in patients with at least one copy of the TMPRSS6 rs855791 major allele, elevated IL-6 levels, and anemia or hepcidin-mediated cytotoxicity, the observed correlations do not prove causation. Therefore, experiments were performed in human induced pluripotent cell-derived cardiomyocytes (iPS-CMs) transfected with variants of TMPRSS6 to investigate the effects of BMPs and BMPs plus IL-6 on hepcidin expression and cellular susceptibility to ischemic injury.

[0483] 5.12.3.1 Method

[0484] Culture of Human iPS-Derived Cardiomyocytes - iCell Cardiomyocytes (Cellular Dynamics International, CDI Inc.) were plated onto 0.1% gelatin-coated 6-well or 96-well cell culture plates in iCell Cardiomyocyte Seeding Medium (CDI Inc.). Forty-eight hours after seeding, the seeding medium was replaced with maintenance medium (CDI Inc.). Maintenance medium was changed every other day until the day of the experiment.

[0485] Simulated Ischemia / Reoxygenation Protocol - iPS cardiomyocytes were subjected to simulated ischemia (SI) for 90 minutes by replacing the cell culture medium with "ischemia buffer" containing 118 mm NaCl, 24 mm NaHCO3, 1.0 mm NaH2PO4, 2.5 mm CaCl2-2H2O, 1.2 mm MgCl2, 20 mm sodium lactate, 16 mm KCl, 10 mm 2-deoxyglucose (pH adjusted to 6.2) as previously reported (Das, A., Xi, L., and Kukreja, KC (2005) J. Biol. Chem. 280:12944-12955; Das A, Smolenski A, Lohmann SM, Kukreja RC. (2006) J. Biol Chem. 281(50):38644-52). Cells were cultured at 37°C in a tri-gas incubator maintained at 1-2% O₂ and 5% CO₂ throughout the SI period. Reoxygenation (RO) was achieved by replacing the ischemic buffer with normal cell culture medium under normoxic conditions. Cells were necrotic after 2 or 18 hours of reoxygenation, respectively. As above, iCells underwent 4 hours of SI and 24 hours of RO.

[0486] Assessment of cell viability and apoptosis - Trypan blue exclusion analysis was performed to analyze cell necrosis as previously reported (Das, A., Xi, L., and Kukreja, KC (2005) J. Biol. Chem. 280, 12944-12955; Das A, Smolenski A, Lohmann SM, Kukreja RC. (2006) J. Biol. Chem. 281(50):38644-52).

[0487] Transfection of iCell Cardiomyocytes - On day 8 after seeding, the culture medium was replaced with fresh maintenance medium and the cells were cultured for 4 hours. ViaFect was used according to the manufacturer's instructions (Promega Corp., Madison, WI). TM Transfection reagent, cells were transfected with pCMV6-XL5 TMPRSS6 (K523) or pCMV6-XL5 TMPRSS6 (K523) V763A. 48 hours after transfection, cells were subjected to other experiments.

[0488] Western blot analysis - Western blotting was performed as previously described (Das, A., Xi, L., and Kukreja, KC (2005) J. Biol. Chem. 280, 12944-12955; Das A, Smolenski A, Lohmann SM, Kukreja RC. (2006) J. Biol. Chem. 281(50):38644-52). Total soluble protein was extracted from cells using lysis buffer (Cell Signaling, MA). The homogenate was centrifuged at 10,000 × g for 5 minutes at 4°C, and the supernatant was recovered. Protein (50 μg from each sample) was separated on a 12% acrylamide gel and transferred to a nitrocellulose membrane and then blocked with 5% skim milk powder in TBST (10 mm Tris-HCl, pH 7.4, 100 mm NaCl, and 0.1% Tween 20) for 1 hour. The membranes were then incubated overnight with rabbit monoclonal / polyclonal or goat polyclonal primary antibodies at a dilution of 1:1000 for each of the respective proteins, i.e., phospho-Beclin-1 (Ser93) (D9A5G) rabbit monoclonal antibody, Beclin-1, SQSTM1 / p62, LC3A / B (D3U4C) Rabbit monoclonal antibody, phospho-Akt (Ser473) (D9E) Rabbit monoclonal antibody, Akt (pan) (C67E7) rabbit monoclonal antibody, phospho-S6 ribosomal protein (Ser240 / 244) (D68F8) Rabbit monoclonal antibody, S6 ribosomal protein (5G10) rabbit monoclonal antibody (from Cell Signaling, Massachusetts), anti-interleukin-2 (TMPRSS6) and anti-SLC40A1 (transferrin) (from Abcam, Massachusetts), and goat polyclonal actin-HRP (Santa Cruz Biotechnology, Texas). The membrane was then incubated with anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:2000 dilution; Amersham Biosciences) for 2 hours. The blots were developed using a chemiluminescence system, and the bands were scanned and quantified by densitometry analysis.

[0489] Real-time PCR - Taqman assay - Total RNA, including small RNA, was isolated using the miRNeasy micro kit according to the manufacturer's protocol (QIAGEN Sciences, MD, USA). The concentration and purity of the isolated RNA were measured using a Nanodrop ND-1000 spectrophotometer (Agilent technologies, CA, USA). Briefly, 1 μg of total RNA was converted into cDNA using a high-capacity cDNA synthesis kit (Applied Biosystems, CA, USA) with random hexamers. Reverse transcription reactions were performed using the following PCR conditions: 25°C for 10 minutes; 37°C for 120 minutes, and 85°C for 5 minutes. Real-time PCR was performed using the Tuckerman amplicon-specific probe (Applied Biosystems, CA, USA) Hamp (CGGCTCTGCAGCCTTG) (SEQ ID NO: 20) under the following PCR cycling conditions: 95°C for 10 minutes; 95°C for 15 seconds and 60°C for 60 seconds. Hamp expression was normalized to the GAPDH (CTTCCAGGAGCGAGATCCCGCTAA) (SEQ ID NO: 21) housekeeping gene. Relative gene expression was analyzed using the 2-ΔΔCt method.

[0490] TMPRSS6 mutagenesis and transfection of iPS cells - pCMV6-XL5 TMPRSS6 was purchased from Origene Technologies (Rockville, MD) under catalog number SC306623, corresponding to GenBank accession number NM_153609. This clone contains a mutation, K253A, that causes an amino acid change. Site-directed mutagenesis was performed to revert the amino acid at position 253 to a typical lysine (K). After confirmation of the reversion, site-directed mutagenesis was performed to introduce the V736A mutation. All mutagenesis reactions were performed using the Agilent Technologies QuikChange II XL Site-Directed Mutagenesis Kit (Santa Clara, CA; catalog number 200521). All vectors were sequenced for confirmation. The primer sequences used were: antisense (as) TMPRSS6 E253KGCATGAGGTCCTTGGGGCCCTGCAG (SEQ ID NO: 22); sense (s) TMPRSS6 E253K CTGCAGGGCCCCAAGGACCTCATGC (SEQ ID NO: 23); antisense (as) TMPRSS6 V736A CCTGGTAGCGATAGGCCTCGCTGCACAGG (SEQ ID NO: 24); sense (s) TMPRSS6 V736ACCTGTGCAGCGAGGCCTATCGCTACCAGG (SEQ ID NO: 25).

[0491] 5.12.3.2 Results

[0492] Human iPS-CMs minimally express cleaved protein 2 at baseline. To emulate homozygous major allele and homozygous minor allele cardiomyocytes, cells were transfected with constructs promoting constitutive expression of either cleaved protein 2 736A, encoded by the major allele of the TMPRSS6 rs855791 SNP, or cleaved protein 2 736V, encoded by the minor allele.

[0493] Hepcidin expression is regulated by BMP6 / SMAD and IL-6 / STAT signal transduction pathways, wherein both BMP and IL-6 act via their respective receptors to promote increased hepcidin expression. Casanovas et al., PLOS Comp. Biol. 10(1): e1003421(2014). In vitro, major allele and minor allele iPS cardiomyocytes were treated with agonists of the signal transduction pathway - recombinant BMP2 and IL-6 - or with agonists of BMP2 alone to model clinical interventions with reduced IL-6 content (or signal transduction). Control iPS cells were not treated with agonists. Cell death rates were measured under normal oxygen tension (normoxia) and also under conditions of simulated hypoxia followed by simulated reoxygenation (reperfusion).

[0494] Figure 6A Results are shown when cells were treated under normal oxygen levels. iPS cardiomyocytes expressing only the TMPRSS6 rs855791 minor allele ("736V minor allele") were not significantly affected by ablation of IL-6 signaling ("ns"): cell death, measured as the percentage of trypan blue-positive cells, was not significantly reduced when cells were treated with BMP2 compared to treatment with BMP2+IL-6. In contrast, iPS cardiomyocytes expressing the TMPRSS6 rs855791 major allele exhibited statistically significantly lower cell death when IL-6 signaling was ablated.

[0495] Figure 6B Results are shown when cells were subjected to hypoxia followed by reoxygenation. Compared to normoxic conditions, hypoxia / reoxygenation was significantly toxic to iPS cardiomyocytes, with approximately 40 percent of major and minor allele control cells killed (compared to approximately 20 percent of control cells under normoxic conditions). Figure 6B and Figure 6A Compared to the control group, the minor allele iPS cardiomyocytes were not significantly affected by the ablation of IL-6 signaling, despite this increased background toxicity: cell death was not significantly reduced when cells were treated with BMP2 alone compared to treatment with BMP2 + IL-6. In contrast, iPS cardiomyocytes expressing the TMPRSS6 rs855791 major allele exhibited statistically significantly lower cell death when IL-6 signaling was ablated.

[0496] 5.12.3.3 Discussion

[0497] These data reinforce the inference drawn from the ad hoc analysis following the clinical trial data in Examples 1 and 2: that reduction of IL-6 signaling can effectively reduce IL-6-mediated toxicity in cardiomyocytes expressing the TMPRSS6 rs855791 major allele, but not in cardiomyocytes expressing only the minor allele. Without intending to be bound by theory, the IL-6 that promotes increased toxicity in major allele iPS cardiomyocytes may be due to an IL-6-mediated increase in hepcidin expression, followed by increased iron chelation in the cells, and subsequent iron-mediated cytotoxicity.

[0498] 5.12.4 Example 4: Anti-IL-6 therapy is effective as the current standard of care in a cardiorenal syndrome model in rats homozygous for the human TMPRSS6 rs855791 major allele, genotypically similar to

[0499] Patients with chronic kidney disease, such as those enrolled in the MIMICK study analyzed in Example 1, often suffer from impaired heart function, which is a major contributor to mortality. This secondary heart injury after primary chronic kidney disease is called type 4 cardiorenal syndrome (type 4 CRS).

[0500] To test whether anti-IL-6 therapy is effective as treatment in CRS4 patients with at least one copy of the TMPRSS6 rs855791 major allele, as demonstrated by the data in Examples 1 and 3, we used a CRS4 model of rats that genotypically resembles humans homozygous for the TMPRSS6 rs855791 major allele.

[0501] Figure 7 The study design is outlined.

[0502] At week 0, myocardial infarction was induced in CRS animals. Nephrectomy was performed at week 2. Instead, a control group underwent sham surgery. Before nephrectomy, various assessments were performed on the subjects. These included measurement of serum creatinine, glomerular filtration rate, 24-hour urine protein, cardiac echocardiogram, tail-cuff blood pressure, and biomarkers in plasma and urine.

[0503] Treatment began on day 1 after nephrectomy. Animals were divided into three groups: (i) control treatment, (ii) anti-IL-6 therapy, and (iii) standard care therapy. Anti-IL-6 therapy was an anti-IL-6 antibody suitable for rodents. Standard care therapy consisted of perindopril, an ACE (angiotensin-converting enzyme) inhibitor. At the start of treatment, individuals in all groups were assessed. Assessments included measurement of serum creatinine, glomerular filtration rate, 24-hour protein content, and plasma biomarkers.

[0504] All groups were evaluated on days 3 and 7 after nephrectomy. Evaluations included measurement of serum creatinine and plasma biomarkers on day 3, and measurement of serum creatinine, glomerular filtration rate, 24-hour protein, echocardiogram, blood pressure, and plasma biomarkers on day 7.

[0505] At week 6, subjects were sacrificed. Prior to sacrifice, various assessments were performed on subjects in all groups. Assessments included measurement of serum creatinine, glomerular filtration rate, 24-hour protein content, blood pressure, plasma biomarkers, cardiac ultrasound, and pressure-volume circuit analysis. Following sacrifice, tissue was also collected from subjects in all groups for histological assessment (i.e., Sirius red staining of cardiac tissue).

[0506] Figures 8A-8D Presented in Overview Figure 7 In a cardiorenal syndrome model in , cardiac ejection fraction was measured in rats without CRS ("Sham"), CRS animals treated with a pharmacologically irrelevant isotype control antibody ("Isotype"), CRS animals treated with an anti-IL-6 antibody ("IL-6ab"), and CRS animals treated with a standard of care ACE inhibitor ("Peri").

[0507] Figure 8A Baseline ejection fraction levels for all groups are shown two weeks after myocardial infarction but before nephrectomy and treatment, demonstrating that experimentally induced myocardial infarction resulted in a significant decrease in cardiac ejection fraction. Figure 8B Graph showing the degree of ejection fraction in all groups one week after nephrectomy and one week after treatment. Figure 8C Graph showing the degree of ejection fraction in all groups two weeks after nephrectomy and two weeks after treatment. Figure 8D Graph showing the degree of ejection fraction in all groups four weeks after nephrectomy and four weeks after treatment. Results are expressed as mean + / - SEM.

[0508] After 4 weeks of treatment, both the treatment groups—the group treated with anti-IL-6 and the group treated with standard of care ACE inhibitor therapy—demonstrated statistically significant increases in ejection fraction ( Figure 8D )(p<0.001). The similar degree of ejection fraction in the anti-IL-6 and standard care groups measured after 4 weeks of treatment showed that anti-IL-6 therapy had equivalent efficacy to the ACE inhibitor perindopril (standard care therapy), indicating that anti-IL-6 therapy had equivalent therapeutic efficacy to standard care therapy in preserving cardiac function in the cardiorenal syndrome model as measured by changes in cardiac ejection fraction.

[0509] Myocardial contractility measurements ( Figure 9) showed that anti-IL-6 therapy also has an effect equivalent to standard of care therapy using ACE inhibitors. After 4 weeks of treatment, myocardial contractility in the group treated with anti-IL-6 and standard of care therapy increased significantly, exceeding that of the control and isotype groups. Similar myocardial contractility in the anti-IL-6 and standard of care groups indicates that anti-IL-6 therapy has an efficacy equivalent to that of the ACE inhibitor perindopril (standard of care therapy) in maintaining cardiac function in the cardiorenal syndrome model, as measured by contractility.

[0510] Fibrosis measurements of cardiac tissue collected from animals in all groups also demonstrated that anti-IL-6 therapy had an effect equivalent to standard of care therapy ( Figures 10A-10C ). Fibrosis in cardiac tissue was quantified by measuring the percentage of fibrotic tissue area in two regions: the “normal” region and the “fibrosis limit” region. Figure 10A The inset in the micrograph shows a magnified view of the "normal" area, showing that a small portion of the "normal" area has fibrotic tissue. The "fibrosis boundary" area is the tissue area in the "normal" area surrounding the fibrotic tissue.

[0511] Figure 10B and 10C The plot in the diagram shows that when in the "normal" area ( Figure 10B ) or in the “fibrosis limit” area ( Figure 10C ), cardiac tissue from individuals in the groups treated with anti-IL-6 or standard of care therapy had significantly reduced percent fibrotic tissue area compared to the isotype control group when measured in the 24-hour fibrosis control group. In addition, the percent fibrotic tissue area measured in the anti-IL-6 and standard of care therapy groups was similar (both in the "normal" and "limit of fibrosis" zones), indicating that anti-IL-6 has an anti-fibrotic effect equivalent to that of the ACE inhibitor perindopril (standard of care therapy).

[0512] These data demonstrate that treatment with an anti-IL-6 agent effectively reduces cardiac damage and restores function in an in vivo model of cardiorenal syndrome in animals genotypically similar to humans homozygous for the TMPRSS6 rs855791 major allele.

[0513] 5.12.5 Example 5: Anti-IL-6 Therapy is Effective in Preserving Cardiac Function in an Acute Myocardial Infarction Model in Mice Genotypically Homozygous for the Human TMPRSS6 rs855791 Major Allele

[0514] The data in Examples 2 and 3 indicate that reduced IL-6 levels or IL-6 signaling can reduce heart failure and death in patients with acute coronary syndromes, but only in those patients with at least one copy of the TMPRSS6 rs855791 major allele, and with the greatest effect in those patients with elevated serum IL-6 levels.

[0515] Rodent studies were performed to determine the effects of anti-IL-6 therapy after acute myocardial infarction in mice genotypically similar to humans homozygous for the TMPRSS6 rs855791 major allele.

[0516] Figure 11A and 11B Data from an in vivo model are presented in which myocardial infarction was induced in mice genotypically similar to humans homozygous for the TMPRSS6 rs855791 major allele. A control group received no therapy. An experimental group was treated with an anti-murine IL-6 antibody. Figure 11A Treatment with anti-IL-6 was shown to provide a statistically significant improvement in ejection fraction. Figure 11B Treatment with anti-IL-6 was shown to provide a statistically significant improvement in contractility measured as cardiac fractional shortening.The data suggest that anti-IL-6 therapy given immediately after myocardial infarction improves functional recovery of the left ventricle in rodents genotypically similar to human patients with the TMPRSS6 rs855791 major allele.

[0517] 6. Incorporation by Reference

[0518] All publications, patents, patent applications, and other references cited in this application are hereby incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other reference were individually indicated to be incorporated by reference for all purposes.

[0519] 7. Equivalent forms

[0520] Although various embodiments have been illustrated and described, the above description is not intended to be limiting. It should be understood that various changes can be made without departing from the spirit and scope of the present invention. Many variations will become apparent to those skilled in the art upon reviewing this specification.

[0521] This application also relates to the following items.

[0522] 1. A method for treating a hepcidin-mediated disorder, comprising:

[0523] administering a therapeutically effective amount of an IL-6 antagonist to a patient suffering from a hepcidin-mediated disorder,

[0524] The patient was determined to have at least one copy of the TMPRSS6 rs855791 major allele.

[0525] 2. The method of claim 1 , wherein the patient has previously been determined to have at least one copy of the TMPRSS6rs855791 major allele.

[0526] 3. The method according to claim 1, further comprising the following steps:

[0527] The patient was determined to have at least one copy of the TMPRSS6 rs855791 major allele.

[0528] 4. The method of any one of items 1 to 3, wherein the patient has elevated serum IL-6 levels before treatment.

[0529] 5. The method of any one of items 1 to 4, wherein the patient has an elevated pre-treatment serum CRP level.

[0530] 6. The method of any one of items 1 to 5, wherein the hepcidin-mediated disorder is anemia of chronic disease.

[0531] 7. The method of item 6, wherein the patient is male and has a hemoglobin (Hb) level of less than 14 g / dl before treatment.

[0532] 8. The method of claim 7, wherein the patient's Hb level before treatment is less than 13 g / dl.

[0533] 9. The method of claim 8, wherein the patient's pre-treatment Hb level is less than 12 g / dl.

[0534] 10. The method of item 9, wherein the patient's Hb level before treatment is less than 11 g / dl.

[0535] 11. The method according to item 6, wherein the patient is female and has an Hb level of less than 12 g / dl before treatment.

[0536] 12. The method of claim 11, wherein the patient's Hb level before treatment is less than 11 g / dl.

[0537] 13. The method of claim 12, wherein the patient's Hb level before treatment is less than 10 g / dl.

[0538] 14. The method of claim 13, wherein the patient's pre-treatment Hb level is less than 9 g / dl.

[0539] 15. The method of any one of items 6 to 10, wherein the patient is male and has a hematocrit of less than 40% before treatment.

[0540] 16. The method of claim 15, wherein the patient's pre-treatment hematocrit is less than 35%.

[0541] 17. The method of claim 16, wherein the patient's pre-treatment hematocrit is 30-34%.

[0542] 18. The method of any one of items 6, 11 to 14, wherein the patient's pre-treatment hematocrit is less than 36%.

[0543] 19. The method of claim 18, wherein the patient's pre-treatment hematocrit is less than 30%.

[0544] 20. The method of claim 19, wherein the patient's pre-treatment hematocrit is 26-29%.

[0545] 21. The method of any one of items 6 to 20, wherein the patient has received at least one pre-treatment administration of an ESA.

[0546] 22. The method of item 6, wherein the patient has received at least one pre-treatment administration of an ESA and has a normal Hb content or a normal hematocrit.

[0547] 23. The method of any one of items 6 to 20, wherein the patient has received at least one pre-treatment administration of an iron supplement.

[0548] 24. The method of claim 6, wherein the patient has received at least one pre-treatment administration of iron supplementation and has a normal Hb content or a normal hematocrit.

[0549] 25. The method of any one of items 6 to 20, wherein the patient has received at least one pre-treatment transfusion of blood or packed red blood cells.

[0550] 26. The method of claim 6, wherein the patient has received at least one pre-treatment transfusion of blood or red blood cell concentrate and has a normal Hb content or normal hematocrit.

[0551] 27. The method of any one of items 6 to 26, wherein a dose of the IL-6 antagonist is administered on a schedule for a period of time sufficient to increase the patient's Hb level above pre-treatment levels.

[0552] 28. The method of any one of items 6 to 27, wherein a dose of the IL-6 antagonist is administered on a schedule for a period of time sufficient to increase the patient's hematocrit above pre-treatment levels.

[0553] 29. The method of claim 21 or 22, wherein a dose of the IL-6 antagonist is administered on a schedule for a period of time sufficient to allow the patient's ESA dose to be reduced without causing the patient's Hb level to fall below a level approximately present before treatment.

[0554] 30. The method of claim 21 or 22, wherein a dose of the IL-6 antagonist is administered on a schedule for a period of time sufficient to allow the patient's ESA dose to be reduced without causing the patient's hematocrit to fall below a level approximately present before treatment.

[0555] 31. The method of any one of items 21, 22, 29 or 30, wherein a dose of the IL-6 antagonist is administered on a schedule for a period of time sufficient to reduce the patient's ESA dose by at least 10% compared to the patient's pre-treatment ESA dose.

[0556] 32. The method of claim 31, wherein a dose of the IL-6 antagonist is administered on a schedule for a period of time sufficient to reduce the patient's ESA dose by at least 20% compared to the patient's pre-treatment ESA dose.

[0557] 33. The method of claim 32, wherein a dose of the IL-6 antagonist is administered on a schedule for a period of time sufficient to reduce the patient's ESA dose by at least 50% compared to the patient's pre-treatment ESA dose.

[0558] 34. The method of any one of items 6 to 33, wherein a dose of the IL-6 antagonist is administered on a schedule for a period of time sufficient to reverse functional iron deficiency.

[0559] 35. The method of any one of items 6 to 34, wherein the chronic disease is chronic kidney disease (CKD).

[0560] 36. The method of claim 35, wherein the patient has KDOQI stage 1 chronic kidney disease, KDOQI stage 2 chronic kidney disease, KDOQI stage 3 chronic kidney disease, KDOQI stage 4 chronic kidney disease, or KDOQI stage 5 chronic kidney disease.

[0561] 37. The method of claim 36, wherein the patient has KDOQI stage 5 chronic kidney disease.

[0562] 38. The method of claim 35, wherein the patient has cardiorenal syndrome (CRS).

[0563] 39. The method of claim 38, wherein the patient has type 4 CRS.

[0564] 40. The method of any one of items 35 to 39, wherein the patient has received at least one pre-treatment dialysis treatment.

[0565] 41. The method of any one of items 35 to 40, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiovascular (CV) mortality compared to an age-matched and disease-matched historical control group.

[0566] 42. The method of any one of items 6 to 34, wherein the chronic disease is a chronic inflammatory disease.

[0567] 43. The method of claim 42, wherein the chronic inflammatory disease is rheumatoid arthritis (RA).

[0568] 44. The method of claim 43, wherein the patient's pre-treatment DAS28 score is greater than 5.1.

[0569] 45. The method of claim 43, wherein the patient's pre-treatment DAS28 score is 3.2 to 5.1.

[0570] 46. ​​The method of claim 43, wherein the patient's pre-treatment DAS28 score is less than 2.6.

[0571] 47. The method of claim 43, wherein the patient's pre-treatment RA is moderately active to severely active.

[0572] 48. The method of any one of items 43 to 47, wherein the patient has received at least one pre-treatment administration of methotrexate.

[0573] 49. The method of any one of items 43 to 48, wherein the patient has received at least one pre-treatment administration of a TNFα antagonist.

[0574] 50. The method of item 49, wherein the TNFα antagonist is selected from the group consisting of etanercept, adalimumab, infliximab, certolizumab, and golimu-mab.

[0575] 51. The method of any one of items 43 to 47, wherein the patient has received at least one pre-treatment administration of an IL-6 antagonist.

[0576] 52. The method of claim 51, wherein the pre-treatment IL-6 antagonist is tocilizumab.

[0577] 53. The method of claim 51, wherein the pre-treatment IL-6 antagonist is tofacitinib.

[0578] 54. The method of any one of items 51 to 53, wherein the therapeutic IL-6 antagonist is MEDI5117.

[0579] 55. The method of item 42, wherein the chronic inflammatory disease is selected from the group consisting of juvenile idiopathic arthritis, ankylosing spondylitis, plaque psoriasis, psoriatic arthritis, inflammatory bowel disease, Crohn's disease, and ulcerative colitis.

[0580] 56. The method of any one of items 6 to 34, wherein the chronic disease is cancer.

[0581] 57. The method of claim 56, wherein the cancer is selected from the group consisting of solid tumors, small cell lung cancer, non-small cell lung cancer, blood cancer, multiple myeloma, leukemia, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), lymphoma, Hodgkin's lymphoma, and hepatic adenoma.

[0582] 58. The method of any one of items 6 to 34, wherein the chronic disease is a chronic infection.

[0583] 59. The method of any one of items 6 to 34, wherein the chronic disease is congestive heart failure (CHF).

[0584] 60. The method of any one of items 1 to 5, wherein the hepcidin-mediated disorder is iron-refractory iron deficiency anemia (IRIDA).

[0585] 61. The method of any one of items 1 to 5, wherein the hepcidin-mediated disorder is acute coronary syndrome.

[0586] 62. The method of claim 61, wherein the patient has suffered a myocardial infarction (MI) within 60 days prior to the first administration of the IL-6 antagonist.

[0587] 63. The method of claim 62, wherein the patient has suffered an MI within 30 days prior to the first administration of the IL-6 antagonist.

[0588] 64. The method of claim 63, wherein the patient has suffered an MI within 48 hours prior to the first administration of the IL-6 antagonist.

[0589] 65. The method of claim 64, wherein the patient has suffered an MI within 24 hours prior to the first administration of the IL-6 antagonist.

[0590] 66. The method of any one of items 61 to 65, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to improve myocardial contractility compared to pre-treatment levels.

[0591] 67. The method of any one of items 61 to 66, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to improve cardiac ejection fraction compared to pre-treatment levels.

[0592] 68. The method of any one of items 61 to 67, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiac fibrosis compared to pre-treatment levels.

[0593] 69. The method of any one of items 1 to 5, wherein the hepcidin-mediated disorder is Castleman's disease.

[0594] 70. A method for improving the treatment of a hepcidin-mediated disorder, the method comprising:

[0595] Discontinuation of IL-6 antagonist administration in patients with hepcidin-mediated disorders

[0596] The patient was determined to be homozygous for the TMPRSS6 rs855791 minor allele.

[0597] 71. The method of claim 70, wherein the patient has been previously determined to be homozygous for the TMPRSS6 rs855791 minor allele.

[0598] 72. The method of claim 70, further comprising the prior step of determining that the patient is homozygous for the TMPRSS6 rs855791 minor allele.

[0599] 73. A method of treating an IL-6 mediated inflammatory disorder in a patient without anemia of chronic inflammation, comprising:

[0600] administering a therapeutically effective amount of an IL-6 antagonist to a non-anemic patient suffering from an IL-6 mediated inflammatory disorder,

[0601] The patient was determined to have at least one copy of the TMPRSS6 rs855791 major allele.

[0602] 74. The method of claim 73, wherein the patient has previously been determined to have at least one copy of the TMPRSS6 rs855791 major allele.

[0603] 75. The method of claim 73, further comprising the prior step of determining that the patient has at least one copy of the TMPRSS6 rs855791 major allele.

[0604] 76. The method of any one of items 1 to 75, wherein the patient has elevated pre-treatment serum IL-6 levels.

[0605] 77. The method of claim 76, wherein the patient's pre-treatment serum IL-6 level is greater than 2.5 pg / ml.

[0606] 78. The method of claim 77, wherein the patient's pre-treatment serum IL-6 level is greater than 5 pg / ml.

[0607] 79. The method of claim 78, wherein the patient's pre-treatment serum IL-6 level is greater than 7.5 pg / ml.

[0608] 80. The method of claim 79, wherein the patient's serum IL-6 level before treatment is greater than 10 pg / ml.

[0609] 81. The method of claim 80, wherein the patient's pre-treatment serum IL-6 level is greater than 12.5 pg / ml.

[0610] 82. The method of any one of items 76 to 81, wherein a dose of the IL-6 antagonist is administered on a time schedule and for a period of time sufficient to reduce the level of free IL-6 in the patient's serum to below pre-treatment levels.

[0611] 83. The method of claim 82, wherein a dose of the IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the free IL-6 level by at least 10% compared to the pre-treatment level.

[0612] 84. The method of claim 83, wherein a dose of the IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the level of free IL-6 in the patient's serum by at least 20% compared to the level before treatment.

[0613] 85. The method of claim 84, wherein a dose of the IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the level of free IL-6 in the patient's serum by at least 50% compared to the level before treatment.

[0614] 86. The method of any one of items 1 to 85, wherein the patient has elevated pre-treatment C-reactive protein (CRP) levels.

[0615] 87. The method of claim 86, wherein the patient's pre-treatment CRP level is greater than 2 mg / ml.

[0616] 88. The method of claim 87, wherein the patient's pre-treatment CRP level is greater than 3 mg / ml.

[0617] 89. The method of claim 88, wherein the patient's pre-treatment CRP level is greater than 5 mg / ml.

[0618] 90. The method of claim 89, wherein the patient's pre-treatment CRP level is greater than 7.5 mg / ml.

[0619] 91. The method of claim 90, wherein the patient's pre-treatment CRP level is greater than 10 mg / ml.

[0620] 92. The method of any one of items 86 to 91, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's CRP level below pre-treatment levels.

[0621] 93. The method of claim 92, wherein a dose of the IL-6 antagonist is administered on a time schedule for a period of time sufficient to reduce the patient's CRP level by at least 50% compared to pre-treatment levels.

[0622] 94. The method of any one of items 1 to 93, wherein Real-time PCR analysis determined that the patient had at least one copy of the TMPRSS6 rs855791 major allele.

[0623] 95. The method of any one of items 1 to 94, wherein the IL-6 antagonist is an anti-IL-6 antibody or an antigen-binding fragment or derivative thereof.

[0624] 96. The method of claim 95, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative has a K of less than 100 nM for binding to human IL-6. D .

[0625] 97. The method of claim 96, wherein the antibody, antigen-binding fragment, or derivative has a K of less than 50 nM for binding to human IL-6. D .

[0626] 98. The method of claim 97, wherein the antibody, antigen-binding fragment, or derivative has a K of less than 10 nM for binding to human IL-6. D .

[0627] 99. The method of claim 98, wherein the antibody, antigen-binding fragment, or derivative has a K of less than 1 nM for binding to human IL-6. D .

[0628] 100. The method of any one of items 95 to 99, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative has an elimination half-life of at least 7 days following intravenous administration.

[0629] 101. The method of claim 100, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative has an elimination half-life of at least 14 days after intravenous administration.

[0630] 102. The method of claim 101, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative has an elimination half-life of at least 21 days after intravenous administration.

[0631] 103. The method of claim 102, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative has an elimination half-life of at least 30 days after intravenous administration.

[0632] 104. The method of any one of items 95 to 103, wherein the IL-6 antagonist is a full-length monoclonal anti-IL-6 antibody.

[0633] 105. The method of item 104, wherein the antibody is an IgG1 or IgG4 antibody.

[0634] 106. The method of item 105, wherein the antibody is an IgG1 antibody.

[0635] 107. The method of any one of items 95 to 106, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative is fully human.

[0636] 108. The method of any one of items 95 to 106, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative is humanized.

[0637] 109. The method of any one of items 95 to 108, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative comprises all six variable region CDRs of MED5117.

[0638] 110. The method of item 109, wherein the antibody comprises VH and VL of MED5117.

[0639] 111. The method of item 110, wherein the antibody is MED5117.

[0640] 112. The method of any one of items 95 to 108, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative comprises all six variable region CDRs of an antibody selected from the group consisting of siltuximab, gerilimzu-mab, sirukumab, clazakizumab, olokizumab, elsilimomab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Biopharmaceuticals), Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0641] 113. The method of claim 112, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative comprises the heavy chain V region and light chain V region of an antibody selected from the group consisting of siltuximab, glierinzumab, seleukumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In a specific embodiment, the anti-IL-6 antibody is an antibody selected from the group consisting of siltuximab, gliadinizumab, selenuocumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0642] 114. The method of claim 113, wherein the anti-IL-6 antibody, antigen-binding fragment, or derivative is an antibody selected from the group consisting of siltuximab, glierinzumab, seleukumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In a specific embodiment, the anti-IL-6 antibody is an antibody selected from the group consisting of sildenafil, gliadinizumab, selenuocumab, clazakinumab, onokimab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0643] 115. The method of any one of items 95 to 103, wherein the IL-6 antagonist is a single domain antibody, a VHH nanobody, a Fab or a scFv.

[0644] 116. The method of any one of items 1 to 94, wherein the IL-6 antagonist is an anti-IL-6R antibody or an antigen-binding fragment or derivative thereof.

[0645] 117. The method of claim 116, wherein the anti-IL-6R antibody, antigen-binding fragment or derivative is tocilizumab.

[0646] 118. The method of claim 116, wherein the anti-IL-6R antibody, antigen-binding fragment or derivative is vobarilizumab.

[0647] 119. The method of any one of items 1 to 94, wherein the IL-6 antagonist is a JAK inhibitor.

[0648] 120. The method of claim 119, wherein the JAK inhibitor is selected from the group consisting of tofacitinib (Xeljanz), decernotinib, ruxolitinib, upadacitinib, baricitinib, filgotinib, lestaurtinib, pacritinib, peficitinib, INCB-039110, ABT-494, INCB-047986, and AC-410.

[0649] 121. The method of any one of items 1 to 94, wherein the IL-6 antagonist is a STAT3 inhibitor.

[0650] 122. The method of any one of items 95 to 118, wherein the IL-6 antagonist is administered parenterally.

[0651] 123. The method of claim 122, wherein the IL-6 antagonist is administered subcutaneously.

[0652] 124. The method of any one of items 119 to 120, wherein the IL-6 antagonist is administered orally.

Claims

1. Use of an anti-IL-6 antibody in the preparation of a medicament for reducing the risk of heart failure in an individual or treating heart failure after acute myocardial infarction in an individual, wherein the individual has at least one copy of the TMPRSS6rs855791 major allele and the anti-IL-6 antibody comprises all six variable region CDRs of MEDI5117.

2. The use according to claim 1, wherein the individual has a history of myocardial infarction or heart failure.

3. The use according to any one of the preceding claims, wherein the individual has suffered a myocardial infarction within 60 days prior to the first administration of the IL-6 antagonist.

4. The use according to claim 3, wherein the individual has suffered a myocardial infarction within 30 days before the first administration of the IL-6 antagonist, within 48 hours before the first administration of the IL-6 antagonist, or within 24 hours before the first administration of the IL-6 antagonist.

5. The use of claim 1, wherein the subject has a pre-treatment serum IL-6 level greater than 2.5 pg / ml.

6. The use of any one of claims 1-2 and 4-5, wherein the subject has a pre-treatment CRP level greater than 2 mg / L.

7. The use of any one of claims 1-2 and 4-5, wherein a dose of the anti-IL-6 antibody is administered on a schedule and for a period of time sufficient to reduce the individual's CRP level to below the pre-treatment level.

8. The use of claim 7, wherein the anti-IL-6 antibody is administered on a schedule for a period of time sufficient to reduce the subject's CRP level by at least 50% compared to pre-treatment levels.

9. The use according to any one of claims 1-2, 4-5 and 8, wherein the anti-IL-6 antibody comprises VH and VL of MEDI5117.

10. The use according to claim 9, wherein the anti-IL-6 antibody is MEDI5117.

Images