Internal standard gene

Abstract

The purpose of the present invention is to provide a novel internal standard gene in gene expression analysis and a gene expression analysis method using the internal standard gene. The gene expression analysis method provided by the present invention is a gene expression analysis method for a test sample, and the method comprises the following steps: (a) a step of determining the expression level of a desired gene; (b) a step of determining an internal standard gene, wherein the internal standard gene is at least one selected from the group consisting of ABCF3, FBXW5, MLLT1, FAM234A, PITPNM1, WDR1, NDUFS7 and AP2A1; (c) a step of comparing the expression level of the desired gene with the expression level of the internal standard gene.

Description

Technical Field

[0001] The present invention relates to an internal standard gene, and in particular to an internal standard gene used when measuring the expression amount or expression level of a target gene, wherein the target gene exists in a biological sample (including breast cancer tissue and normal breast tissue) from a breast cancer patient. Background Art

[0002] One of the methods for comparing two or more different biological samples and detecting differences between them is gene expression analysis. Gene expression analysis is a method of extracting RNA contained in each biological sample, measuring the expression amount or expression level of a specific gene therefrom, and comparing them. When performing gene expression analysis using Northern blot hybridization, RT-PCR, real-time PCR, etc., it is not enough to compare the expression amount or expression level of a specific gene alone. It is necessary to compare their expression amount or expression level as a relative value of the expression amount or expression level of a gene called an internal standard gene. This is because (1) it is difficult to accurately make the amount of the biological sample to be compared the same, and even if the same amount of biological sample is used, the RNA extraction efficiency will vary from biological sample to biological sample; (2) even if the amount of RNA is the same, the ratio of mRNA contained therein will vary from biological sample to biological sample, etc. For these reasons, relative comparison with the internal standard gene has always been required. Among the internal standard genes, the 3-glyceraldehyde-phosphate dehydrogenase (GAPDH) gene and the β-actin (ACTB) gene, which are known as so-called housekeeping genes, have been traditionally used. These housekeeping genes are expressed constantly to maintain the life activities of the cell itself, and are expressed at a constant level regardless of the type of cell or tissue, so they can be used under the assumption that there will be no changes even after experimental treatments.

[0003] However, it is gradually known that the expression of internal standard genes varies according to cell or tissue types, and the expression is regulated by experimental conditions, developmental stages, etc. In fact, during gene expression analysis, since internal standard genes whose expression amount is changed due to their experimental conditions, etc. are selected, there is a risk of being misinterpreted in gene expression analysis, and many researchers have also pointed out this concern. Now, the following internal standard gene exploration has been carried out: the internal standard gene is independent of specific tissues or experimental conditions and can be generally and effectively used for the standardization of gene expression analysis (patent document 1). However, these studies are mostly explored using gene expression data registered in existing public databases. In addition, in public databases, due to the mixing of data measured by different platforms in different multiple institutions, it can be said that simply comparing side by side is actually difficult. On the other hand, there are also studies (patent document 2) that want to explore suitable internal standard genes in a closed system customized in a specific experiment. In most cases, the internal standard genes obtained by these explorations are selected based on the results of verification based on the data measured by the same platform in the same institution, so it is believed that the reliability is high as long as it is used in this system.

[0004] Breast cancer has diversity and is classified into multiple subtypes with various characteristics. This subtype classification was originally completed by comprehensive gene expression analysis (non-patent literature 1). Because of this classification, prognosis and drug sensitivity are different, so this classification becomes an index for drug therapy selection. In actual clinical practice, simple immunohistochemical methods are usually used for diagnosis, but there are also many cases that are different from the classification using genetic expression analysis. Therefore, it is always desirable to utilize the high-precision inspection method of gene expression analysis. In addition, breast cancer research has a long history, and many studies conducted are also based on the gene expression analysis using the cell line from breast cancer. What supports the reliability of these inspection methods and research is the internal standard gene.

[0005] Prior art literature

[0006] Patent Literature

[0007] Patent Document 1: Japanese Patent No. 5934036

[0008] Patent Document 2: Japanese Patent Application Publication No. 2012-105614

[0009] Non-patent literature

[0010] Non-patent document 3: Perou CM, Sorlie T, Eisen MB, et al. Molecular portraits of human breast tumours. Nature 406: 747-752, 2000 Summary of the invention

[0011] Problems to be solved by the invention

[0012] The present invention aims to provide a novel internal standard gene in gene expression analysis and a gene expression analysis method using the internal standard gene. In particular, a gene that can be used as an internal standard gene in comparative analysis of samples from breast cancer and a gene expression analysis method from breast cancer samples using the gene are provided.

[0013] Technical solutions to the problem

[0014] In order to solve the above problems, the inventors obtained gene expression profiles of 14,400 genes from samples of 470 cases totaling breast cancer tissue (453 cases) and normal breast tissue (17 cases), and successfully screened out internal standard genes for gene expression analysis of biological tissues from breast cancer (including normal breast tissue), thereby completing the present invention.

[0015] That is, the present invention includes the following aspects:

[0016] In one embodiment of the present invention,

[0017] [1] A method for analyzing gene expression is provided, which is a method for analyzing gene expression of a test sample, and the method comprises the following steps:

[0018] (a) a step of determining the expression level of a desired gene;

[0019] (b) a step of determining an internal standard gene, wherein the internal standard gene is at least one selected from the group consisting of ABCF3, FBXW5, MLLT1, FAM234A, PITPNM1, WDR1, NDUFS7 and AP2A1;

[0020] (c) a step of normalizing the desired gene expression level using the internal standard gene expression level.

[0021] Here, in one embodiment, the gene expression analysis method of the present invention comprises:

[0022] [2] The gene expression analysis method according to [1] above, characterized in that:

[0023] The test sample is a sample from a breast cancer patient.

[0024] In one embodiment, the gene analysis method of the present invention includes:

[0025] [3] The gene expression analysis method according to [2] above, characterized in that:

[0026] The desired gene is a gene used to identify or classify breast cancer subtypes.

[0027] In another aspect of the present invention,

[0028] [4] relates to an internal standard gene for gene expression analysis, which consists of at least one gene selected from the group consisting of FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1.

[0029] Here, in one embodiment, the internal standard gene of the present invention is

[0030] [5] The internal standard gene according to [4] above, characterized in that:

[0031] The internal standard gene is an internal standard gene used for gene expression analysis in a test sample from a breast cancer patient.

[0032] In addition, in one embodiment, the internal standard gene of the present invention is

[0033] [6] The internal standard gene according to [5] above, characterized in that:

[0034] The gene expression analysis in the test sample from the breast cancer patient is a gene expression analysis for identifying breast cancer subtypes.

[0035] In another aspect of the present invention,

[0036] [7] relates to a composition for analyzing the expression of an internal standard gene, which comprises the tool for measuring the expression level of the internal standard gene as described in [4] above.

[0037] Here, in one embodiment, the composition for analyzing the expression of the internal standard gene of the present invention is:

[0038] [8] relates to a composition for analyzing the gene expression of an internal standard gene for identifying or classifying breast cancer, which comprises a tool for measuring the expression level of the internal standard gene as described in [5] or [6] above.

[0039] Here, in one embodiment, the composition for analyzing gene expression of an internal standard gene for identifying or classifying breast cancer of the present invention is:

[0040] [9] The composition for analyzing gene expression of an internal standard gene for identifying or classifying breast cancer according to [8] above, characterized in that:

[0041] The means for measuring the expression level of the gene is at least one means selected from the group consisting of primers, probes, antibodies against the gene, or markers thereof.

[0042] In addition, in one embodiment, the composition for analyzing gene expression of an internal standard gene for identifying or classifying breast cancer of the present invention is:

[0043]

[10] A composition for analyzing gene expression of an internal standard gene for identifying or classifying breast cancer according to [8] or [9] above, characterized in that:

[0044] The composition for analyzing gene expression is used for PCR, microarray or RNA sequencing.

[0045] Effects of the Invention

[0046] The internal standard gene of the present invention provides a novel internal standard gene that can be used for gene expression analysis. In addition, a gene expression analysis method utilizing the internal standard gene can be provided. In addition, the internal standard gene of the present invention is not affected by breast cancer subtypes in samples from breast cancer patients, the fluctuation range of expression level is narrow, and the difference in expression level is relatively small compared with the expression level of human universal reference. Therefore, the internal standard gene of the present invention is particularly useful in gene expression analysis of samples from breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 This is a graph showing the distribution of expression levels of four genes (ABCF3, MLLT1, FBXW5, and FAM234A) in the gene expression profiles of 470 samples measured in Example 3 described below.

[0048] Figure 2 This is a graph showing the distribution of expression levels of four genes (PITPNM1, NDUFS7, WDR1, and AP2A1) in the gene expression profiles of 470 samples measured in Example 3 described below.

[0049] Figure 3 This is a graph showing the distribution of GAPDH gene expression levels in the gene expression profiles of 470 samples measured in Example 3 described below.

[0050] Figure 4 The heat map shows the results of cluster analysis using the group average method of Euclidean distance for 470 cases using 207 types of discrimination marker gene combinations including the internal standard gene described in Example 4 below. DETAILED DESCRIPTION

[0051] 1. Internal standard gene

[0052] 1-1. Overview

[0053] The first embodiment of the present invention is an internal standard gene that can be used for gene expression analysis.

[0054] The internal standard gene of the present invention consists of at least one gene selected from the group consisting of FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1.

[0055] 1-2. Definition

[0056] "Internal standard gene" refers to a gene used for normalization of the relative expression of a specific gene amount in gene expression analysis. As described above, the internal standard genes of the present invention are 8 genes, namely FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1. The following table shows the gene abbreviation (Symbol), gene name (Name) and reference sequence number (Reference Sequence ID) (RefSeq ID) registered in the NCBI database of the internal standard gene.

[0057] [Table 1]

[0058]

[0059] The internal standard genes (FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1) of the present invention can be determined as genes (or polynucleotides) having base sequences shown in SEQ ID NO: 1 to SEQ ID NO: 8, respectively.

[0060] In one embodiment, the internal standard gene of the present invention is at least one gene selected from the group consisting of the following genes: a gene consisting of the base sequence shown in SEQ ID NO: 1, a gene consisting of the base sequence shown in SEQ ID NO: 2, a gene consisting of the base sequence shown in SEQ ID NO: 3, a gene consisting of the base sequence shown in SEQ ID NO: 4, a gene consisting of the base sequence shown in SEQ ID NO: 5, a gene consisting of the base sequence shown in SEQ ID NO: 6, a gene consisting of the base sequence shown in SEQ ID NO: 7, and a gene consisting of the base sequence shown in SEQ ID NO: 8.

[0061] In the present specification, the FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1 genes also include genes composed of base sequences containing degenerate codons encoding the same amino acid sequence, various variants (variants) of each gene, mutant genes such as point mutation genes, and orthologous genes of other species such as chimpanzees. Such genes include polynucleotides composed of base sequences having a base identity of 70% or more (preferably 75% or more, 80% or more, 85% or more, more preferably 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) with the base sequences determined by SEQ ID NO: 1 to SEQ ID NO: 8, and genes composed of polynucleotides that maintain the function of the target gene.

[0062] For example, in one embodiment, the ABCF3 gene used in the present invention can be determined as a gene (or polynucleotide) consisting of the base sequence shown in SEQ ID NO: 1, and in this case, the ABCF3 gene contains a polynucleotide consisting of the following base sequence and a gene consisting of a polynucleotide that maintains the function of the ABCF3 gene, wherein the base sequence has a base identity of 70% or more (preferably 75% or more, 80% or more, 85% or more, more preferably 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) with the base sequence shown in SEQ ID NO: 1. In addition, the "base identity" in this specification refers to the ratio (%) of the number of identical bases in the base sequence of the nucleotide to be compared to the total number of bases in the gene when two base sequences are arranged (aligned) and gaps are introduced as needed so that the base identity of the two base sequences is maximized.

[0063] In addition, in this specification, when a gene consisting of a base sequence shown in a specific SEQ ID NO. is referred to, it also includes a polynucleotide that hybridizes with a nucleotide fragment consisting of the following base sequence under stringent conditions and maintains the function of the target gene, and the base sequence is complementary to a partial base sequence of the gene. "Stringent conditions" refer to conditions under which non-specific hybridization is not formed. Generally, the lower the salt concentration and the higher the temperature, the higher the stringency. Low stringency conditions refer to conditions such as washing with 1×SSC, 0.1% SDS, and about 37°C in the washing after hybridization, and more stringent conditions are washing with 0.5×SSC, 0.1% SDS, and about 42°C to 50°C. More stringent high stringency conditions refer to conditions such as washing with 0.1×SSC and 0.1% SDS at 50°C to 70°C, 55°C to 68°C, or 65°C to 68°C in the washing after hybridization. High stringency conditions are generally preferred. The combination of SSC, SDS and temperature described above is only an example. In addition to the above-mentioned SSC, SDS and temperature, those skilled in the art may also appropriately combine other conditions such as probe concentration, probe base length, hybridization time, etc. to determine the stringency of hybridization. In addition, a polynucleotide that hybridizes with a nucleotide fragment consisting of the following base sequence under stringent conditions, wherein the base sequence is complementary to a partial base sequence of a gene consisting of a base sequence shown in a specific SEQ ID NO. In a preferred embodiment, the polynucleotide is a polynucleotide consisting of the following base sequence, wherein the base sequence has a base identity of more than 70% (preferably more than 75%, more than 80%, more than 85%, more preferably more than 90%, more than 95%, more than 96%, more than 97%, more than 98% or more than 99%) with the base sequence shown in the specific SEQ ID NO.

[0064] In this specification, the term "internal standard gene" includes, in addition to genes identified by DNA sequences, gene products based on transcription products (mRNA, cDNA) and the like and translation products (proteins) of the genes.

[0065] At least one internal standard gene of the present invention can be selected and used, or two or more internal standard genes can be used in combination. When two or more internal standard genes are combined, the internal standard gene can be selected from the group consisting of FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1, or internal standard genes other than the above group can be used in combination.

[0066] As internal standard genes other than the group consisting of FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1, commercially available general references, well-known housekeeping genes (e.g., 3-phosphoglyceraldehyde dehydrogenase (GAPDH) gene, β-actin (ACTB) gene) or combinations thereof can be cited. In addition, those skilled in the art can select internal standard genes suitable for each gene expression analysis condition through experiments, and can also use the selected internal standard genes together with the internal standard genes of the present invention.

[0067] In addition, the internal standard gene of the present invention is, in one embodiment, an isolated gene (or gene product). In this specification, "isolated" refers in a broad sense to a gene (or gene product) isolated from an organism, and in a narrow sense includes a gene (or gene product) substantially free of naturally associated factors.

[0068] The internal standard gene of the present invention has little variation in gene expression level even in test samples from healthy individuals and patients with any subtype of breast cancer.

[0069] Therefore, the internal standard gene of the present invention, in one embodiment, can be used for the gene expression analysis in the tested sample from the breast cancer patient.Herein, the gene expression analysis in the tested sample from the breast cancer patient refers to, for example, including the gene expression analysis for distinguishing whether to suffer from breast cancer, for distinguishing or classifying the breast cancer subtype.Herein, "differentiation or classification" refers to the sample from the testee with a history of breast cancer, distinguishing the presence of breast cancer, or distinguishing the height of the possibility of breast cancer, or distinguishing or classifying which subtype breast cancer belongs to, or distinguishing or classifying which height of the possibility of histological typing belongs to.

[0070] By using the internal standard gene of the present invention in the gene expression analysis of a test sample from a breast cancer patient, a more accurate relative value of gene expression can be provided compared to a known internal standard gene (eg, GAPDH) or the like.

[0071] In this specification, "test sample" refers to a sample used for gene expression analysis. The test sample that can be used in the present invention is not particularly limited as long as it is a sample expressing the internal standard gene of the present invention. As the source animal of the test sample, for example, humans, monkeys, chimpanzees, preferably humans, can be cited. In addition, "sample" refers to, for example, tissues, cells, body fluids (blood (including serum, plasma and interstitial fluid), cerebrospinal fluid (cerebrospinal fluid), urine, lymph, digestive fluid, ascites, pleural effusion, nerve root periarthritis fluid, extracts of various tissues or cells, etc.) or peritoneal lavage fluids, samples collected from organisms, cultured cells or their purified products and preparations.

[0072] It is explained that, in the case where the internal standard gene of the present invention is used for breast cancer identification using gene expression analysis, "tested sample" is a sample collected from a human subject, preferably comprising a tissue or a part thereof of a breast cancer tissue or a suspected breast cancer tissue. "Tissue" and "cell" mentioned herein can be any position from a subject, preferably a sample collected by biopsy or surgically removed, more specifically a breast tissue or a breast cell. Particularly preferably, breast cancer cells collected by biopsy or breast cancer tissue or a breast cancer cell suspected of having breast cancer. It is explained that these tissues or cells can be (FFPE:Formalin-Fixed ParaffinEmbedded, formalin fixed paraffin embedded) formed by being embedded in paraffin after formalin fixation.

[0073] In addition, "breast cancer" refers to cancer that usually develops from the intraductal tissue of the mammary ducts and mammary lobules. Breast cancer includes carcinomas and sarcomas, and refers to all malignant tumors of breast tissue. In addition, breast cancer is a heterogeneous disease and is classified into multiple subtypes with various characteristics.

[0074] Breast cancer subtypes are mainly classified into 11 types: Luminal A, Luminal B (HER2-positive), Luminal B (HER2-negative), HER2-positive, HER2-positive-like, triple-negative, phyllodes tumor, squamous cell carcinoma, cannot be determined, normal-like and normal.

[0075] Here, "Luminal A" refers to cases that meet all of the following clinical pathology conditions: 1) ER positive and PgR negative; 2) HER2 negative; 3) Ki67 is low; 4) MGEA (multi-gene-expression assay) is low risk of recurrence, but in this specification, the following cases are also included, the gene expression profiles of which are similar to many cases diagnosed as Luminal A in clinical pathology.

[0076] It should be noted that the clinical pathological subtype diagnosis is mainly made by confirming the expression of ER, PgR, HER2, and Ki67 through immunohistochemical staining, but is not limited to this and also includes confirmation through gene expression analysis.

[0077] "Luminal B (HER2-positive)" refers to cases that are clinically pathologically ER-positive and HER2-positive, but in this specification, it also includes the following cases whose gene expression profiles are similar to many cases diagnosed as Luminal B (HER2-positive) in clinical pathology.

[0078] "Luminal B (HER2-negative)" refers to cases that meet any of the following clinical pathology criteria: 1) ER-positive and HER2-negative, and 2) Ki67 is high; 3) PgR is negative or low; 4) MGEA is at high risk of recurrence, but in this specification, it also includes cases in which the expression of cell cycle-related gene groups in Luminal A is higher than other cases.

[0079] "HER2-positive" refers to cases that are HER2-positive, ER-negative, and PgR-negative in clinical pathology, but in this specification, it also includes the following cases whose gene expression profiles are similar to many cases diagnosed as HER2-positive in clinical pathology.

[0080] “HER2-positive-like” means that HER2 is negative, but the other gene expression profiles of the case are similar to many cases diagnosed as HER2-positive on clinical pathology.

[0081] "Triple negative" refers to cases that are ER-negative, PgR-negative, and HER2-negative in clinical pathology, but in this specification, it also includes the following cases whose gene expression profiles are similar to many cases diagnosed as triple negative in clinical pathology.

[0082] "Squamous cell carcinoma" refers to a cancer formed by malignant proliferation of cells called epidermal keratinocytes present in the epidermis, and in the present specification, refers to a cancer originating in the breast.

[0083] "Phyllodendron tumor" refers to a fibrous tumor that is similar to a breast fibroadenoma in clinical pathology, but is formed by rapid proliferation of fibrous stroma and mammary duct epithelium relative to the connective tissue proliferation within the mammary lobules of the breast.

[0084] “Unable to determine” means that the gene expression profile is not similar to any of the following: Luminal A, Luminal B (HER2-positive), Luminal B (HER2-negative), HER2-positive, HER2-positive-like, triple-negative, normal-like, normal, squamous cell carcinoma, and phyllodes tumor.

[0085] “Normal-like” refers to cases that are diagnosed as “cancer” clinically and pathologically, but the gene expression profile of the case is similar to that of normal breast tissue.

[0086] "Normal" refers to normal tissue.

[0087] The internal standard gene of the present invention can be applied to gene expression analysis for identifying the breast cancer subtypes listed above.

[0088] 2. Composition for Gene Expression Analysis

[0089] 2-1. Overview

[0090] Another aspect of the present invention relates to a composition for analyzing gene expression of an internal standard gene, the composition comprising a means for measuring the expression level of the internal standard gene.

[0091] 2-2. Definition

[0092] In this specification, "gene expression level" refers to gene transcription product amount, expression intensity or expression frequency. The gene expression level mentioned here is not limited to the wild-type gene expression level of the gene, and may also include the expression level of variant genes such as point mutation genes. In addition, in the transcription product showing gene expression, heterotypic transcription products (variants) such as splice variants and their fragments may also be included. This is because even if it is based on the information of variant genes, transcription products or their fragments, it can also be used as an internal standard gene of the present invention. The gene expression level can be obtained as a measured value by measuring the gene transcription product, i.e., the amount of mRNA, the amount of cDNA, etc. It should be noted that in a preferred embodiment, the determination of the gene expression level is the determination of mRNA.

[0093] In this specification, "a tool for measuring expression levels" refers to a compound that can bind to a gene transcription product, and is a compound that can indicate the presence or absence of the transcription product and the amount of the transcription product. In one embodiment, the tool for measuring expression levels is at least one compound selected from the group consisting of primers, probes or their markers for the gene to be measured.

[0094] The primers or probes that can be used in the present invention are usually composed of natural nucleic acids such as DNA and RNA. DNA with high stability, easy synthesis and low cost is particularly preferred. In addition, natural nucleic acids can also be combined with chemically modified nucleic acids and pseudo nucleic acids as needed. Among chemically modified nucleic acids and pseudo nucleic acids, for example, PNA (Peptide Nucleic Acid, peptide nucleic acid), LNA (Locked Nucleic Acid, locked nucleic acid; registered trademark), phosphonate methyl DNA, thiophosphate DNA, 2'-O-methyl RNA, etc. can be cited. In addition, primers and probes can use fluorescent substances and / or quenching substances; or labeling substances such as radioactive isotopes (for example, 32P, 33P, 35S); or biotin or (streptavidin) avidin; or modified substances such as magnetic beads as labeled or modified markers. The labeling substance is not limited, and commercially available products can be used. For example, if it is a fluorescent substance, FITC, Texas, Cy3, Cy5, Cy7, Cyanine3, Cyanine5, Cyanine7, FAM, HEX, VIC, fluorescein and its derivatives and rhodamine and its derivatives can be used. If it is a quenching substance, AMRA, DABCYL, BHQ-1, BHQ-2 or BHQ-3 can be used. The labeling position of the labeling substance in the primer and probe can be appropriately determined according to the characteristics of the modified substance and the purpose of use. Generally speaking, most of them are modified at the 5' or 3' end. In addition, a primer and probe molecule can also be labeled with more than one labeling substance. The labeling of nucleotides by these substances can be carried out by known methods.

[0095] The nucleotide used as a primer or probe may be any of the nucleotides consisting of the sense strand or antisense strand of the gene to be measured. In a preferred embodiment, the nucleotide used as a primer or probe is a primer or probe used for PCR, microarray or RNA sequencing.

[0096] The base length of primer or probe is not particularly limited, as long as the target gene expression level can be measured. In the case of probe, if used in the hybridization method described later, it is at least 10 bases in length to the full length of the gene, preferably 15 bases in length to the full length of the gene, more preferably 30 bases in length to the full length of the gene, and more preferably 50 bases in length to the full length of the gene, if used in a microarray, it is 10 to 200 bases in length, preferably 20 to 150 bases in length, and more preferably 30 to 100 bases in length. Usually the longer the probe is, the higher the hybridization efficiency is, and the higher the sensitivity is. On the other hand, the shorter the probe is, the lower the sensitivity is, but the specificity is improved. On the other hand, in the case of primer, the forward primer and the reverse primer can be 10 to 50bp respectively, preferably 15 to 30bp.

[0097] When the expression level of the internal standard gene of the present invention is measured by a nucleic acid amplification method or the like, it is not limited to the following, but for example, probes represented by SEQ ID NO: 9 to SEQ ID NO: 16 for FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1, respectively, can be used (Table 2). The preparation of the primers or probes used in each gene expression analysis method is known to those skilled in the art, and can be prepared, for example, according to the method described in the aforementioned Green & Sambrook, Molecular Cloning (2012). In addition, sequence information can be provided to a nucleic acid synthesis commissioned manufacturer for commissioned production.

[0098] [Table 2]

[0099]

[0100] In addition, when the tool for measuring the expression level is a probe as described above, it can also be provided in the form of a DNA microarray or DNA microchip in which each probe is fixed on a substrate. The material of the substrate on which each probe is fixed is not limited, and a glass plate, a quartz plate, a silicon wafer, etc. can generally be used. The size of the substrate can be, for example, 3.5 mm × 5.5 mm, 18 mm × 18 mm, 22 mm × 75 mm, etc., but this can be set in various ways according to the number of light spots of the probe and the size of its light spots. 0.1 μg to 0.5 μg of nucleotides are generally used for each light spot of the probe. The following methods can be cited for fixing nucleotides: a method of electrostatically bonding the nucleotides to a solid phase carrier treated with a polycation surface such as polylysine, poly-L-lysine, polyethyleneimine, and polyalkylamine using the charge of the nucleotides, and a method of covalently bonding nucleotides introduced with functional groups such as amino groups, aldehyde groups, thiol groups (SH groups), and biotin to a solid phase surface introduced with functional groups such as amino groups, aldehyde groups, and epoxy groups.

[0101] In addition, the composition for analyzing the expression of the internal standard gene of the present invention can also be provided as a kit, which includes: other reagents required for the determination or detection of gene expression (for example, probes, primers or their markers, buffers, etc. for other genes), instruments (culture dishes, etc.), and instructions for breast cancer identification.

[0102] 3. Genetic expression analysis method using internal standard gene

[0103] 3-1. Overview

[0104] Another aspect of the present invention relates to a method for analyzing gene expression of a test sample using the standard gene of the present invention, the method comprising the following steps:

[0105] (a) a step of determining the expression level of a desired gene,

[0106] (b) determining an internal standard gene, wherein the internal standard gene is at least one selected from the group consisting of ABCF3, FBXW5, MLLT1, FAM234A, PITPNM1, WDR1, NDUFS7 and AP2A1,

[0107] (c) a step of normalizing the expression level of the desired gene using the expression level of the internal standard gene.

[0108] 3-2. Definition

[0109] The gene expression analysis method of the present invention comprises the step of (a) measuring the expression level of a desired gene.

[0110] The "step of measuring the gene expression level" is a step of measuring the gene expression level in a test sample and obtaining the measured value.

[0111] It should be noted that the determination of gene expression level preferably measures the expression level per unit amount. In this specification, "unit amount" refers to a sample amount that can be arbitrarily specified. For example, volume (expressed in μL, mL) or weight (expressed in μg, mg, g) all conform to this definition. The unit amount is not particularly specified, but the unit amount measured in a series of gene expression analysis methods is preferably fixed.

[0112] In this specification, "desired gene" refers to a gene for studying the relative value of gene expression level using the internal standard gene of the present invention. As long as the desired gene is a gene expressed in the same cell as the cell expressing the internal standard gene of the present invention, there is no particular limitation. If it is a person skilled in the art, the desired gene can be appropriately selected according to the purpose of gene expression analysis. It should be noted that in one embodiment, the desired gene is a gene for identifying breast cancer. The gene used to identify breast cancer refers to a gene whose expression level changes specifically in breast cancer. Therefore, in this embodiment, the desired gene can adopt a gene known to show that the expression level changes specifically in breast cancer. In addition, in a more preferred embodiment, the desired gene is a gene for identifying or classifying breast cancer subtypes.

[0113] Genes used to identify or classify breast cancer subtypes are not limited to the following, and examples thereof include: ABCF3 gene, FBXW5 gene, MLLT1 gene, FAM234A gene, PITPNM1 gene, WDR1 gene, NDUFS7 gene, AP2A1 gene, KRTDAP gene, SERPINB3 gene, SPRR2A gene, SPRR1B gene, KLK13 gene, KRT1 gene, LGALS7 gene, PI3 gene, SERPINH1 gene, SNAI2 gene, GPR173 gene, HAS2 gene, PTH1R gene, PAGE5 gene, ITLN1 gene, SH3PXD2B gene, TAP1 gene, FN 1 gene, CTHRC1 gene, MMP9 gene, ADIPOQ gene, CD36 gene, G0S2 gene, GPD1 gene, LEP gene, LIPE gene, PLIN1 gene, SDPR gene, LIFR gene, TGFBR3 gene, CAPN6 gene, PIGR gene, KRT15 gene, KRT5 gene, KRT14 gene, DST gene, WIF1 gene, SYNM gene, KIT gene, GABRP gene, SFRP1 gene, ELF5 gene, MIA gene, MMP7 gene, FDCSP gene, CRABP1 gene, PROM1 gene, KRT23 gene, S100A1 gene, WIPF3 gene, CYYR1 gene gene, TFCP2L1 gene, DSC2 gene, MFGE8 gene, KLK7 gene, KLK5 gene, DSG3 gene, TTYH1 gene, SCRG1 gene, S100B gene, ETV6 gene, OGFRL1 gene, MELTF gene, HORMAD1 gene, PKP1 gene, FOXC1 gene, ITGB8 gene, VGLL1 gene, ART3 gene, EN1 gene, SPHK1 gene, TRIM47 gene, COL27A1 gene, RFLNA gene, RASD2 gene, A2ML1 gene, MARCO gene, TSPYL5 gene, TM4SF1 gene, FABP5 gene, SPIB gene, BCL2A1 gene , MZB1 gene, KCNK5 gene, LMO4 gene, RNF150 gene, LYZ gene, C21orf58 gene, ATP13A5 gene, NUDT8 gene, HSD17B2 gene, ABCA12 gene, ENPP3 gene, WNT5A gene, MPP3 gene, VPS13D gene, PXMP4 gene, GGT1 gene, TRPV6 gene, C2orf54 gene, CLDN8 gene, LBP gene, SRD5A3 gene, PAPSS2 gene, TMEM45B gene, CLCA2 gene, FASN gene, MPHOSPH6 gene, NXPH4 gene, HPGD gene, KYNU gene, GLYATL2 gene,KMO gene, SRPK3 gene, THRSP gene, PLA2G2A gene, TFAP2B gene, FABP7 gene, SLPI gene, SERHL2 gene, S100A9 gene, KRT7 gene, TMEM86A gene, MBOAT1 gene, PGAP3 gene, STARD3 gene, ERBB2 gene, MIEN1 gene, GRB7 gene, GSDMB gene, ORMDL3 gene, MED24 gene, MSL1 gene, CASC3 gene, WIPF2 gene, THSD4 gene, MAPT gene, LONRF2 gene, TCEAL3 gene, DBNDD2 gene, FGD3 gene, GFRA1 gene, PARD6B gene, STC2 gene, SLC39A6 gene, ENPP5 gene, ZNF703 gene, EVL gene, TBC1D9 gene, CHAD gene, GREB1 gene, HPN gene, IL6ST gene, FAM198B gene, CA12 gene, KCN E4 gene, NAT1 gene, CYP2B6 (CYP2B7P) gene, ARMT1 gene, MAGED2 gene, CELSR1 gene, INPP5J gene, PADI2 gene, PPP1R1B gene, ESR1 gene, MLPH gene, FOXA1 gene, XBP1 gene, GATA3 gene, ZG16B gene, KIAA0040 gene, TMC4 gene, AGR2 gene, TFF3 gene, SCGB2A2 gene, MUCL1 gene Gene, DDX11 gene, ATAD2 gene, GGH gene, CDCA3 gene, CCNA2 gene, CCNB2 gene, ANLN gene, UBE2C gene, CKS2 gene, MKI67 gene, FOXM1 gene, UBE2T gene, MCM4 gene, CKAP2 gene, HN1 gene, KPNA2 gene, H2AFX gene, H2AFZ gene, CDK1 gene, PTTG1 gene, CDC20 gene, MYBL2 gene and RRM2 gene.

[0114] The determination of gene expression can be implemented by the determination of transcription products. Below, the determination method of gene transcription products is specifically described. It should be noted that the determination method of gene transcription products is well known. Below, reference is made to or cites and records the description of the determination method of gene transcription products or translation products in Japanese Patent Publication No. 2016-13081. In addition, the determination method of representative gene transcription products is described below, but it is not limited to these methods, and known determination methods can be used.

[0115] It should be noted that the determination of the gene transcription product can be the determination of the amount of mRNA, and can also be the determination of the amount of cDNA obtained by reverse transcription of mRNA. The following method can be used to determine the gene transcription product: nucleotides containing all or part of the base sequence of the above gene are used in primers or probes to measure the gene expression level in absolute or relative values.

[0116] The measurement of gene transcription products is not particularly limited as long as it is a known nucleic acid detection / quantification method, and examples thereof include hybridization methods, nucleic acid amplification methods, and RNA sequencing (RNA-Seq) analysis methods.

[0117] "Hybridization method" refers to a method in which a nucleic acid fragment having a base sequence complementary to all or part of the base sequence of a target nucleic acid to be detected is used as a probe, and the base pairing between the nucleic acid and the probe is utilized to detect and quantify the target nucleic acid or its fragment. In this method, the mRNA or cDNA or its fragment of each gene constituting the identification marker conforms to the target nucleic acid. Generally, the hybridization method is preferably carried out under stringent conditions in order to exclude nucleic acids other than the target of non-specific hybridization. The aforementioned high stringency conditions at low salt concentration and high temperature are more preferred. Among the hybridization methods, several methods with different detection tools are known, for example, preferably Northern blot hybridization method (Northern hybridization method), microarray method, surface plasmon resonance method or quartz crystal microbalance method.

[0118] "Northern blot hybridization" is the most commonly used method for analyzing gene expression. The total RNA or mRNA prepared from the sample is separated by electrophoresis using agarose gel or polyacrylamide gel under denaturing conditions, transferred (blotted) to a membrane, and then a probe with a base sequence specific to the target RNA is used to detect the target nucleic acid. The target nucleic acid can also be quantified by labeling the probe with an appropriate marker such as a fluorescent dye or a radioactive isotope, for example, using a Chemilumi (chemiluminescence) imaging analysis device (e.g., LightCapture, ATTO Co., Ltd.), a scintillation counter, an imaging analyzer (e.g., FUJIFILM Co., Ltd., BAS series) and other measuring devices. Northern blot hybridization is a well-known technique known in the art. For example, Green and Sambrook (2012) mentioned above can be referred to.

[0119] "Microarray method" is a method in which a nucleic acid fragment complementary to all or part of the base sequence of a target nucleic acid is used as a probe and arranged in a high-density small spot shape on a substrate, so that a target nucleic acid sample reacts with a solid-phase microarray or microchip, and the nucleic acid hybridized with the substrate spot is detected using fluorescence or the like. The target nucleic acid can be any of RNA such as mRNA or DNA such as cDNA. For detection and quantification, it can be achieved by detecting / determining the fluorescence based on hybridization of the target nucleic acid or the like using a microplate reader or a scanner. The presence ratio of them relative to the amount of mRNA or cDNA or the reference mRNA (Reference RNA) can be determined by the measured fluorescence intensity. The microarray method is also a well-known technology in the art. For example, reference can be made to the DNA microarray method ("DNA microarray and the latest PCR method" (Japanese original: "DNA microarray and the latest PCR method") (2000) edited by Masaaki Muramatsu and Hiroyuki Naba, published by Shurunsha) and the like.

[0120] The "surface plasmon resonance (SPR) method" is a method for detecting and quantifying adsorbates on the surface of a metal film with extremely high sensitivity using the surface plasmon resonance phenomenon, which refers to the phenomenon that when the incident angle of the laser irradiated to the metal film is changed, the reflected light intensity at a specific incident angle (resonance angle) is significantly attenuated. In the present invention, for example, a probe having a sequence complementary to the base sequence of the target nucleic acid is fixed to the surface of the metal film, and other portions of the metal film surface are sealed, and then a sample collected from a subject or a healthy person or a group of healthy people is circulated on the surface of the metal film to form base pairing between the target nucleic acid and the probe, thereby detecting and quantifying the target nucleic acid based on the difference in the measured values ​​before and after the sample is circulated. Detection and quantification using the surface plasmon resonance method can be performed, for example, using an SPR sensor sold by Biacore. This technology is well known in the art. For example, reference may be made to "Real-time analysis experimental method for biosubstance interaction" by Kazuhiro Nagata and Hiroshi Handa, Springer-Verlag Tokyo, Tokyo, 2000.

[0121] The "Quartz Crystal Microbalance (QCM) method" refers to a mass measurement method that utilizes the phenomenon that when a substance is adsorbed on the electrode surface mounted on the quartz crystal resonator, the resonance frequency of the quartz crystal resonator decreases along with the mass of the substance, thereby quantitatively capturing a very small amount of adsorbed substance by the change in resonance frequency. Detection and quantification using this method also utilize commercially available QCM sensors in the same manner as the SPR method. For example, the target nucleic acid can be detected and quantified by pairing the probe fixed to the electrode surface with the base of the target nucleic acid in a sample collected from a subject or a healthy person or a group of healthy persons, wherein the probe has a sequence complementary to the base sequence of the target nucleic acid. This technology is well known in the art. For example, see Christopher J. et al., 2005, Self-Assembled Monolayers of a Form of Nanotechnology, Chemical Review, 105: 1103-1169 and Toyoei Moriizumi and Takamichi Nakamoto, (1997) Sensor Engineering, Shokodo Publishing.

[0122] "Nucleic acid amplification method" refers to a method in which a specific region of a target nucleic acid is amplified using a forward / reverse primer and a nucleic acid polymerase. For example, PCR method (including RT-PCR method), NASBA method, ICAN method, LAMP (registered trademark) method (including RT-LAMP method) can be cited. PCR method is preferred. In the determination method of gene transcription products using nucleic acid amplification method, a quantitative nucleic acid amplification method such as real-time RT-PCR method can be used. In the real-time RT-PCR method, it is known that there are also intercalator methods using SYBR (registered trademark) Green, Taqman (registered trademark) probe method, digital PCR method and cycle probe method, any method can be used. These methods are all known methods, and are also recorded in the appropriate operating steps instructions in the technical field, and these instructions can be referred to.

[0123] "RNA sequencing (RNA-Seq) analysis" refers to a tool for measuring the expression level of a gene by converting RNA into cDNA through a reverse transcription reaction and counting the readings of the cDNA using a next-generation sequencer (such as the HiSeq series (Illumina) or the Ion Proton system (Thermo Fisher), but not limited to these). These methods are all well-known methods and are also recorded in appropriate operating procedure instructions in the technical field, and these instructions can be referred to.

[0124] The method of quantitatively analyzing gene transcription products by real-time RT-PCR can be briefly described by citing an example below. Real-time RT-PCR is a method of quantitatively analyzing nucleic acids by using a temperature cycler in a reaction system in which the PCR amplification products are specifically fluorescently labeled using cDNA prepared by reverse transcription reaction from mRNA in a sample as a template. The temperature cycler has the function of detecting the fluorescence intensity from the amplification products. The amount of target nucleic acid amplification products in the reaction is monitored in real time, and the results are regressed by a computer. As a method for labeling amplification products, there are methods using fluorescently labeled probes (e.g., TaqMan (registered trademark) PCR method) and intercalator methods using reagents that specifically bind to double-stranded DNA. TaqMan (registered trademark) PCR method uses a probe whose 5' end is quenched and whose 3' end is modified by a fluorescent dye. Usually, the quenching substance at the 5' end inhibits the fluorescent dye at the 3' end, but when PCR is performed, the 5'→3' exonuclease activity of Taq nucleic acid polymerase decomposes the probe, thereby removing the inhibition of the quenching substance, so fluorescence is emitted. Its fluorescence reflects the amount of amplification products. Since there is an inverse correlation between the number of cycles (CT) when the amplified product reaches the detection limit and the initial template amount, the initial template amount is quantified by measuring CT in the real-time assay. By measuring CT using a known amount of template at several stages and drawing a calibration curve, the absolute value of the initial template amount of the unknown sample can be calculated. The reverse transcriptase used in RT-PCR can use M-MLV RTase, ExScript RTase (TaKaRa), SuperScript II RT (Thermo Fisher Scientific), etc.

[0125] The reaction conditions of real-time PCR are usually based on the known PCR method. Since the base length of the nucleic acid fragment to be amplified and the amount of template nucleic acid, the base length of the primer used and the Tm value, the optimal reaction temperature and the optimal pH of the nucleic acid polymerase used vary, they can be appropriately set according to these conditions. As an example, the denaturation reaction is usually carried out at 94°C to 95°C for 5 seconds to 5 minutes, the annealing reaction is carried out at 50°C to 70°C for 10 seconds to 1 minute, and the extension reaction is carried out at 68°C to 72°C for 30 seconds to 3 minutes, which is taken as one cycle, and 15 to 40 cycles can be repeated before the extension reaction is carried out. When using the commercially available kit of the above-mentioned manufacturer, in principle, the operating steps and instructions attached to the kit can be followed.

[0126] The nucleic acid polymerase used in real-time PCR is a DNA polymerase, particularly a thermostable DNA polymerase. Such nucleic acid polymerases have various commercially available products, and these commercially available products can also be utilized. For example, the TaqDNA polymerase included in the above-mentioned Applied Biosystems TaqMan MicroRNA Detection Kit (Thermo Fisher Scientific) can be cited. In particular, such commercially available kits are accompanied by a buffer solution that optimizes the activity of the accompanying DNA polymerase, and are therefore very useful.

[0127] In addition, the gene expression analysis method of the present invention further comprises, in addition to the above step (a), a step of (b) determining an internal standard gene, wherein the internal standard gene is at least one selected from the group consisting of ABCF3, FBXW5, MLLT1, FAM234A, PITPNM1, WDR1, NDUFS7 and AP2A1.

[0128] Step (a) and step (b) can be performed simultaneously or one after the other. Preferably, steps (a) and (b) are performed simultaneously.

[0129] The gene expression analysis method of the present invention comprises, after step (a) and step (b), a step (c) of standardizing the expression level of the desired gene using the expression level of the internal standard gene.

[0130] In this specification, "standardization" refers to the ability to compare the desired gene expression level in the test sample measured under specific conditions with the desired gene expression level in the test sample measured under different conditions. More specifically, it refers to comparing the desired gene expression level relative to the test sample measured under specific conditions with the internal standard gene expression level relative to the test sample measured under the same conditions, thereby calculating the desired gene expression level in the test sample as a relative value relative to the internal standard gene expression level.

[0131] In the standardization step, the method of calculating the desired gene expression level as a relative value is not limited as long as it can be compared with the desired gene expression level in the tested sample measured under different conditions. For example, the desired gene expression level value relative to the tested sample measured under specific conditions can be divided by the internal standard gene expression level value relative to the tested sample measured under the same conditions, thereby expressing it as a relative value.

[0132] The desired gene expression level normalized by the above step (c) can be determined under different conditions and can be relatively compared with the gene expression level normalized by the same method.

[0133] Example

[0134] (Example 1. RNA preparation)

[0135] Total RNA was extracted from breast cancer tissue collected during surgery using ISOGEN (Japan Gene Co., Ltd., Tokyo, Japan). In addition, normal breast tissue and a portion of breast cancer tissue were purchased from overseas operators and total RNA was extracted in the same manner. Samples that could obtain more than 125 μg of total RNA were then purified using the MicroPoly(A)purist kit (Ambion, Austin, Texas, USA) for poly(A)+RNA.

[0136] As the human universal reference RNA, Human Universal Reference RNA Type I (MicroDiagnostic, Tokyo, Japan) or Human Universal Reference RNA Type II (MicroDiagnostic) was used.

[0137] (Example 2. Comprehensive gene expression analysis)

[0138] The DNA microarray used in obtaining gene expression profiles using poly(A)+RNA (referred to as "system 1") used 31,797 synthetic DNAs (80mers) (MicroDiagnostic) corresponding to human-derived transcripts arrayed on a glass slide using a stacking arrayer. On the other hand, the DNA microarray used to obtain gene expression profiles using total RNA (referred to as "system 2") used 14,400 synthetic DNAs (80mers) (MicroDiagnostic) corresponding to human-derived transcripts arrayed on a glass slide using a stacking arrayer.

[0139] Labeled cDNA was synthesized from RNA from samples using SuperScript II (Invitrogen Life Technologies, Carlsbad, CA, USA) and Cyanine 5-dUTP (Perkin-Elmer) from 2 μg of poly(A)+ RNA in the case of system 1 and from 5 μg of total RNA in the case of system 2. Similarly, labeled cDNA was synthesized from human universal reference RNA using SupreScript II and Cyanine 3-dUTP (Perkin-Elmer) from 2 μg of poly(A)+ RNA or from 5 μg of total RNA.

[0140] Hybridization with a DNA microarray was performed using a Labeling and Hybridization kit (MicroDiagnostic).

[0141] The fluorescence intensity after hybridization with DNA microarray is measured using GenePix 4000B Scanner (Axon Instruments, Union City, California, USA). In addition, the expression ratio (fluorescence intensity of sample source Cyanine-5 labeled cDNA / fluorescence intensity of human universal reference source Cyanine-3 labeled cDNA) is calculated by dividing the fluorescence intensity of sample source Cyanine-5 labeled cDNA by the fluorescence intensity of human universal reference source Cyanine-3 labeled cDNA. Moreover, using GenePix Pro 3.0 software (Axon Instruments), the calculated expression ratio is multiplied by the standardization factor for normalization. Then, the expression ratio is converted to Log2, and the converted value is called Log2 ratio (Log2 ratio). It is explained that the conversion of the expression ratio is carried out using Excel software (Microsoft, Bellevue, Washington, USA) and MDI gene expression analysis software package (MicroDiagnostic, Inc.).

[0142] (Example 3. Internal standard genes useful in identifying breast cancer subtypes)

[0143] In this example, genes whose expression patterns do not change in any subtype of breast cancer are identified.

[0144] By using the RNA preparation method and comprehensive gene expression analysis method described in Examples 1 and 2 above, gene expression profiles of 14,400 genes were obtained for each sample of 470 cases of breast cancer tissue (453 cases) and normal breast tissue (17 cases).

[0145] In the obtained gene expression profile, genes with less variation in expression ratio in any breast cancer subtype were selected. Specifically, the number of samples with no detected signal was less than 3, the absolute value of expression ratio was less than 0.45, the standard deviation was less than 0.35, the value of maximum-minimum was less than 2.2, and the internal standard gene was selected from genes with an average value of "sum of medians" greater than 400. As a result, 8 genes, ABCF3, FBXW5, MLLT1, FAM234A, PITPNM1, WDR1, NDUFS7 and AP2A1, were successfully selected as internal standard genes.

[0146] The following table shows the standard deviation, maximum value and minimum value of ABCF3, FBXW5, MLLT1, FAM234A, PITPNM1, WDR1, NDUFS7 and AP2A1 in the above gene expression profiles.

[0147] [Table 3]

[0148] Symbol ABCF3 FBXW5 MLLT1 FAM234A PITPNM1 WDR1 NDUFS7 AP2A1 Standard Deviation 0.253 0.247 0.292 0.296 0.269 0.329 0.273 0.282 Maximum 1.647 1.213 1.052 1.240 1.132 0.739 0.637 0.602 Minimum -0.425 -0.951 -1.132 -0.501 -1.053 -2.250 -1.305 -1.232

[0149] In addition, in the gene expression profiles of the above 8 internal standard genes, the distribution of each data interval divided by 1.0 expression ratio is shown in the following Tables 4 and Figures 1 to 3 . It is noted that Table 4 and Figures 1 to 3 In the figure, the distribution of GAPDH (Accession No.: NM_002046), which has been used as a housekeeping gene, is also shown as a comparison with the above 8 internal standard genes.

[0150] [Table 4]

[0151]

[0152] As shown in Table 4 and Figures 1 to 3 As shown, the expression ratios of the eight internal standard genes mentioned above vary less between samples than that of the GAPDH gene, and the expression ratio distributions mostly converge to the middle data interval of -0.5 to 0.5.

[0153] (Example 4. Identification of breast cancer subtypes using gene expression analysis)

[0154] The present inventors have successfully identified, through the gene expression profiles obtained in Example 3, a group of genes showing a characteristic expression pattern in squamous cell carcinoma (hereinafter referred to as "group a"), a group of genes showing a characteristic expression pattern in phyllodes tumor (hereinafter referred to as "group b"), a group of genes showing a characteristic expression pattern in cancer (hereinafter referred to as "group c"), a group of genes showing a characteristic expression pattern in normal tissue (hereinafter referred to as "group d"), a group of genes showing a characteristic expression pattern in normal samples (hereinafter referred to as "group e"), a group of genes showing a characteristic expression pattern in the triple-negative group and a characteristic expression pattern in normal tissue or normal samples (hereinafter referred to as "TNBC1") (hereinafter referred to as "group f"), a group of genes showing a characteristic expression pattern in triple-negative (hereinafter referred to as "TNBC2") (hereinafter referred to as "group g"), and a group of genes showing a characteristic expression pattern in triple-negative (hereinafter referred to as "TNBC2"). The gene group (hereinafter referred to as "TNBC3") that shows a characteristic expression pattern in the negative and is also similar to the expression pattern of the gene of the cancer lacking characteristics (cannot be determined) (hereinafter referred to as "h group"), the gene group (hereinafter referred to as "i group") that shows a characteristic expression pattern in the HER2+ sample, the gene group (hereinafter referred to as "HER2 amplification-1") related to HER2 amplification and present in the vicinity of the HER2 gene and the chromosome (hereinafter referred to as "HER2 amplification-1") group (hereinafter referred to as "j group"), the gene group (hereinafter referred to as "HER2 amplification-2") related to HER2 amplification and other than the j group (hereinafter referred to as "k group"), the hormone sensitivity-related gene group (hereinafter referred to as "l group"), ESR1 (hereinafter referred to as "m group"), the differentiation-related gene group (hereinafter referred to as "n group") and the cell cycle-related gene group (hereinafter referred to as "o group") were determined as the genes contained in these a~o groups (identification marker gene combination for identifying breast cancer subtypes). The genes contained in the identification marker gene combination are shown in the table below.

[0155] [Table 5A]

[0156]

[0157] [Table 5B]

[0158]

[0159] [Table 5C]

[0160]

[0161] [Table 5D]

[0162]

[0163] [Table 5E]

[0164]

[0165] [Table 5F]

[0166]

[0167] [Table 5G]

[0168]

[0169] For the total of 207 genes consisting of the above 8 internal standard genes and the above 199 genes, the gene expression level of each gene was measured (data not shown) and cluster analysis was performed. In addition, cluster analysis was performed using ExpressionView Pro software (MicroDiagnostic) using the group average method of Euclidean distance. The results of cluster analysis are recorded in Figure 4 In. Figure 4 As shown, when performing hierarchical cluster analysis based on the expression profiles of the extracted 207 genes, the genes included in the a to o groups showed characteristic expression ratios in each subtype, and no expression changes were observed in the genes of the control group in any subtype. In addition, through this hierarchical cluster analysis, breast cancer subtypes can be classified into clusters of normal-like group, undeterminable group, normal group, luminal A group, HER2+-like group, luminal B group, HER2+ group, triple-negative group, and other groups.

[0170] The sequence information of the probes for 207 genes used in Examples 3 and 4 is shown in the following table.

[0171] [Table 6A]

[0172]

[0173] [Table 6B]

[0174]

[0175] [Table 6C]

[0176]

[0177] [Table 6D]

[0178] Sequence Listing <110> Fukushima Medical University <120> Internal standard gene <130> <160> 215 <170> PatentIn version 3.5 <210> 1 <211> 2362 <212> DNA <213> Homo sapiens <400> 1 ctcggccatc gatgcctcgg ggctcgtggc gtcgggcctg gcgggctccc cgttgggcgg 60 gggcggcggt ccgagcggct gcggcagcgg aagcgggtcc gggtcgcgca gggcgggggc 120 ggcgcagcgg gcggaggcgg ccgtgggccg cctgggcaga atgtcacgat ggacgagggc 180 ggcacgcccc tgctccccga cagcctggtc taccagatct tcctgagcct gggcccggcc 240 gacgtgctgg ccgccgggct ggtgtgccgc caatggcagg ccgtgtcgcg ggacgagttc 300 ctgtggaggg agcagttcta ccgctactac caggtggccc gcgacgtgcc ccgacaccca 360 gcggccatgt cctggtacga ggagttccag cggctgtatg acacggtgcc ctgcgtggag 420 gtgcagacgc tgcgggaaca cacagaccag gtcctgcacc tcagcttctc ccattccggg 480 taccagttcg cgtcctgctc caaggactgc actgtgaaga tctggagcaa cgacctgacc 540 atctcgctgc tgcacagcgc ggacatgcgg ccctacaact ggagctacac ccagttctcc 600 cagttcaaca aggacgactc gctactgctg gcctcggggg tgttcctggg gccgcacaac 660 tcctcatccg gcgagattgc tgtcatcagc ctagactcct tcgcgctgct gtcccgcgtg 720 cggaacaagc cctatgacgt gtttggctgt tggctcaccg agaccagcct catctcgggg 780 aacctgcacc gcatcggaga tatcacctcc tgctcggtgc tgtggctcaa caatgccttc 840 caggatgtgg agtcagagaa cgtcaacgtg gtgaagcggc tgttcaagat ccagaacctc 900 aatgccagca ccgtccgcac ggtgatggtg gccgactgca gccgcttcga cagccctgac 960 ctgctgctgg aagccggtga cccggccacg tccccctgcc gcatctttga cctgggcagc 1020 gacaacgagg aggtggtggc tggcccggcc cccgcccacg ccaaggaggg cttgcggcac 1080 tttctggacc gcgtgctgga ggggcgggcg cagccacagc tgtcggagcg catgctagag 1140 accaaggtgg ccgagctgct ggcccagggc cacaccaagc cacccgagcg cagtgccaca 1200 ggcgccaaga gcaagtacct catcttcacc actggctgcc tcacctactc cccacaccag 1260 atcggcatca agcagatcct gccacaccag atgaccacgg cagggcccgt gctgggtgag 1320 ggccggggct ccgatgcctt cttcgacgcg ctggaccacg tcatagacat acacggacac 1380 atcatcggca tgggcctgtc gcccgacaac aggtacctgt acgtgaacag ccgcgcctgg 1440 cccaacggtg cggtggtggc cgaccccatg cagccgccac caatcgcgga ggagattgac 1500 ctgctggtgt tcgacctcaa gaccatgcgg gaggtgaggc gggctctgcg tgcgcaccgc 1560 gcctacacgc ccaacgacga gtgcttcttc atcttcctgg acgtcagcag ggacttcgtg 1620 gccagcgggg cggaggaccg gcacggctac atctgggacc gccactacaa catctgtctg 1680 gccaggctgc ggcacgagga tgtggtcaac tcagtggtct tcagtcccca ggagcaggag 1740 ctgctgctca cggccagcga cgacgccacc atcaaagcct ggcgctcccc acgcaccatg 1800 cgcgtcctcc aggcacctcg cccacggcct cgcaccttct tctcctggct tgccagccag 1860 aggcgctgag gtgtgctggg tgcactggag ccaccgggac cccttgagga catcgccagg 1920 ctctgtggct ttttcccgag cgggagaggt ggagatgctt atagcagtta cgccttagga 1980 aggggacaac caggccccgc cacacgctca cacacaaacc tgctcacgca gctgtgatgc 2040 ttggcacggg gtggccagtg cagatggagc ccaaggcccc ctcggcctcc tgggcaactt 2100 ggggtacaca ggatactggg ggtgccgctc ctcactcaac cccaggctag gggtacacct 2160 gacccagctg gcctcggccc ggggcacctt cggctggtcc tgtggggccc tggacggtgg 2220 cccagtggtg gcaggggctg ctcctggctg tggttgtgcg cccggggctt gggagcggcc 2280 ggtcacgctg ctgtgggccc gagtgtgttg catgtccacg caccacccgt tcagggccct 2340 gaataaacag ttggcaacag ca 2362 <210> 2 <211> 4217 <212> DNA <213> Homo sapiens <400> 2 aggggcgccg gcgggcggat cgagaggaag gtcggggcca tgggccggca ctgcgcctcg 60 ggagggtccg gccaccgctg gaacccgagg ccggggctgg gggcgctccg ggctccgacc 120 cacgggccgg ccggccctgc ccgggctggg tgaggggcgc ccgcctcaag ctagaggagg 180 agcggaggcc gcgcgcggcc cgccgagcgc cttcaggatg ctcatcaagg aataccacat 240 tctgctgccc atgagcctgg acgagtacca ggtggcccag ctctacatga tccagaaaaa 300 gagccgggag gagtctagtg gtgagggcag cggcgtggag atcctggcca accggcccta 360 cacggatggg cccgggggca gcgggcaata cacacacaag gtgtaccacg tgggctccca 420 catcccaggc tggttccggg cactgctgcc caaggctgcc ctgcaggtag aaggaatc 480 ctggaatgcc tacccctaca cccgaacccg gtacacctgc cctttcgtgg agaaattctc 540 cattgaaatt gagacctatt acctgcctga tggggggcag cagccaaacg tcttcaacct 600 gagcggggcc gagaggac agcgcatcct ggacaccatc gacatcgtgc gggatgcagt 660 ggccccaggc gagtacaaag cagaagga cccccggctt tatcactcgg tcaagacggg 720 ccgagggcca ctgtctgatg actgggcacg gacggcggca cagacggggc cccttatgtg 780 tgcctataag ctgtgcaagg ttgagttccg ctactggggc atgcaagcca agatcgagca 840 gttcatccat gatgtaggtc tgcgtcgggt gatgctgcgg gcccaccgcc aggcctggtg 900 ctggcaggat gagtggacag agctgagcat ggctgacatc cgggcactgg aagaggac 960 tgctcgcatg ctggcccagc gcatggccaa gtgcaacaca ggcagtgagg ggtccgaggc 1020 ccagcccccc gggaaaccga gcaccgaggc ccggtctgcg gccagcaaca ctggcacccc 1080 cgatgggcct gaggcccccc caggcccaga tgcctccccc gatgccagct ttgggaagca 1140 gtggtcctca tcctcccgtt cctcctactc atcccaacat ggaggggctg tgtctcccca 1200 gagcttgtct gagtggcgca tgcagaacat tgcccgagac tctgagaaca gctccgagga 1260 agagttcttt gatgcccacg aaggcttctc ggacagtgag gaggtcttcc ccaaggagat 1320 gaccaagtgg aactccaatg acttcattga tgcctttgcc tccccagtgg aggcagaggg 1380 aacgccagag cctggagccg aggcagctaa aggcattgag gatggggccc aagcacccag 1440 ggactcagag ggcctggatg gagccgggga gctgggggct gaggcatgcg cagtccacgc 1500 cctcttcctt atcctgcaca gcggcaacat cctggactca ggccctggag acgccaactc 1560 caagcaggcg gatgtgcaga cgctgagctc cgccttcgag gccgtcaccc gcatccactt 1620 ccctgaggcc ttgggccacg tggcgctgcg actggtgccc tgtccaccca tctgcgccgc 1680 cgcctatgcc cttgtctcca acctgagccc ttacagccac gatggggaca gcctgtctcg 1740 ctcccaagac cacattccac tggctgccct gccactgctg gccacctcat cctcccgcta 1800 ccagggcgcc gtggccaccg tcattgcccg caccaaccag gcctactcag ccttcctgcg 1860 ctcacctgag ggtgccggct tctgtgggca ggtcgcactg attggagatg gtgttggtgg 1920 catcctgggc tttgatgcac tctgccacag tgctaacgcg ggcaccggga gtcggggcag 1980 cagccgccgt gggagcatga acaatgagct gctctctccg gagtttggcc cagtgcggga 2040 ccccctggca gatggtgtgg aaggcctggg tcggggcagc ccagaaccct cggccttgcc 2100 tccccagcgc atccccagcg acatggccag tcctgagccc gagggctctc agaacagcct 2160 tcaggcagcc cccgcaacca cctcctcctg ggagccccgg cgggcaagca cggccttctg 2220 cccacccgct gccagttccg aggcacctga cggccccagc agcactgccc gccttgactt 2280 caaggtctct ggcttcttcc tcttcggctc cccactgggc ctggtgctgg ctctgcgcaa 2340 aactgtgatg cccgccctgg aggcagccca gatgcgccca gcctgtgaac agatctacaa 2400 cctcttccac gcggctgacc cctgcgcctc acgcctcgag cccctgctgg ccccgaagtt 2460 ccaggccatc gccccactga ccgtgccccg ctaccagaag ttccccctgg gagatggctc 2520 atccctgctg ctggccgaca ctctgcagac gcactccagc ctctttctgg aggagctgga 2580 gatgctggtg ccctcaacac ccacctctac tagcggtgcc ttctggaagg gcagtgagtt 2640 ggccactgac cccccggccc agccagccgc ccccagcacc accagtgagg tggttaagat 2700 cctggagcgc tggtggggga ccaagcggat cgactactcg ctgtactgcc ccgaggcgct 2760 caccgccttt cccaccgtca cgctgcccca cctcttccac gccagctact gggagtccgc 2820 cgacgtggtg gcgttcatcc tgcgccaggt gatcgagaag gagcggccac agctggcgga 2880 atgcgaggag ccgtccatct acagcccggc cttccccagg gagaagtggc agcgaaaacg 2940 cacgcaggtc aagatccgga acgtcacttc caaccaccgg gcgagcgaca cggtggtgtg 3000 cgagggccgc ccccaggtgc taagcgggcg cttcatgtac gggcccctgg acgtcgtcac 3060 gctcactgga gagaaggtgg atgtctacat catgacgcag ccgctgtcgg gcaagtggat 3120 ccactttggc accgaagtca ccaatagctc gggccgcctc accttcccag ttcccccaga 3180 acgcgcgctg ggcattggtg tctaccccgt gcgcatggtg gtcaggggcg accacaccta 3240 tgccgaatgc tgcctgactg tggtggcccg cggcacggag gctgtggtct tcagcatcga 3300 cggctccttc accgccagcg tctccatcat gggcagcgac cccaaggtgc gagctggcgc 3360 cgtggacgtg gtcaggcact ggcaggactc cggctacctg atcgtgtatg tcacaggccg 3420 gccggatatg cagaagcacc gcgtggtggc atggctgtcg cagcacaact tcccccacgg 3480 cgtcgtctcc ttctgcgacg gcctcaccca cgaccacta cgccagaagg caatgtttct 3540 gcagagcctg gtgcaggagg tagaactgaa catcgtggcc ggttatgggt ctcccaaaga 3600 tgtggctgta tacgcggcgc tggggctgtc cccgagccag acctacatcg tgggccgtgc 3660 cgtgcggaag ctacaggcgc agtgccagtt cctgtcagac ggctatgtgg cccacctggg 3720 ccagctggaa gcgggctcgc actcgcatgc ctcctcggga cccccgagag ctgccttggg 3780 caagagcagc tatggtgtgg ctgccccccgt ggacttcctg cgcaaacaga gccagctgct 3840 tcgctcgagg ggccccagcc aggcggagcg tgagggcccg ggaacaccac ccaccaccct 3900 ggcacggggc aaagcacgga gcatcagcct gaagctggac agcgaggagt gaggcccaca 3960 ccagcctgga cctgggttat ttattgacac acccaagggg cccgaggggc tgcgtgtggg 4020 aggctgggga cccagacttt tggccccagc gctggccccc ccagccccac accctatatc 4080 tccgtgtgct cctcggtgtt acttcccttt catatgaggg gacccagcgc cggggggagg 4140 gaggagggcg tgggcatggg cgcagaggct tttccagtgt gtataaatcc atgaaaataa 4200 acgccacctg cacccca 4217 <210> 3 <211> 4532 <212> DNA <213> Homo sapiens <400> 3 gcgcgacccg ggctggcggt ggtttccggt tccgcggggc tggcgggcga gcgggcggcc 60 gggatcggcg gcggcggcgg cggcggcggc gcttgacaga caatgagggc ggcggggcgg 120 cgttgagcgg cggcggcggc ggcggcggcg gcgagcgacg cggggcccgg gggcggggcg 180 gggcgccagc catggacaat cagtgcaccg tccaggtgag gttagagctg gggcatcgcg 240 cccaactgcg caagaagccc accacggagg ggttcactca cgactggatg gtgtttgtcc 300 gcggccccga gcaatgtgac atccagcact tcgtggagaa ggtggtcttc tggctgcacg 360 acagcttccc caagcccaga cgcgtgtgca aggagccccc ctacaaagta gaggagtcgg 420 ggtacgctgg cttcatcatg cccatcgagg tgcacttcaa aaacaaggag gagccgagga 480 aggtctgctt cacctacgac ctgttcctga acctggaagg caacccgccc gtgaaccacc 540 tgcgctgcga gaagctcacc ttcaacaacc ccaccacgga gttccggtac aagctcctgc 600 gggccggcgg ggtgatggta atgcccgaag gagcagacac ggtgtccagg cccagtcccg 660 actaccccat gttacccaca attccactct ctgccttctc tgaccccaag aagaccaaac 720 catcccacgg ctccaaggac gccaacaagg agagcagcaa gacctccaag ccacacaagg 780 tgaccaagga gcaccgggag cggccccgca aagactccga gagcaagagc tcctccaagg 840 agctggagcg tgagcaggcc aaaagctcca aggacacctc gcggaagctg ggcgagggcc 900 ggctgcccaa ggaggagaag gcgccaccgc ccaaggctgc cttcaaggaa cccaagatgg 960 ccctgaaaga gaccaagctg gaaagcacgt cccccaaggg tgggccccca cccccacccc 1020 cacccccacc ccgggcttcc agcaagcggc cggccaccgc cgactcgcca aagcccagcg 1080 ccaagaagca gaagaagc agctcgaagg ggtcccggag tgctccaggc acctcgcccc 1140 gcacctcctc ctcctcctcc ttctcggaca agaagccggc caaggacaag agcagcacca 1200 gaggggagaa ggtgaaggcc gagagtgagc cccgggaggc caaaaaggcc ctggaggtgg 1260 aggagtccaa ctcagaggac gaggcctcct tcaagtccga gtctgcccag tcaagcccgt 1320 ccaactccag ctccagctca gactccagct cagactcaga cttcgagcca tcccagaacc 1380 acagccaagg acccctgcgc tccatggtgg aggacctgca gtccgaggag tccgacgagg 1440 acgactcttc gtcaggcgag gaggctgccg gcaagaccaa cccgggggagg gactccaggt 1500 tgagcttcag cgacagcgag agtgacaaca gcgccgactc ctccctgccc agccgtgagc 1560 ccccaccccc ccagaagcca cccccgccca acagcaaggt gtcaggccgg aggagccccg 1620 agtcctgcag caagcctgag aagatcctca agaagggcac ctacgacaag gcctacacgg 1680 atgagctggt ggagctacac cggaggctga tggcgctgcg ggagcgcaac gtgctgcagc 1740 agattgtgaa tctgatcgag gagactggcc acttcaatgt caccaacacc acccttgact 1800 tcgacctctt ctccctggac gagaccaccg tgcgcaaact gcagagctgc ctggaggccg 1860 tggccacatg accctgggcc gcgtgccggg cccccaccgc cggggtcctg ggaggctgca 1920 gccaggcctc gcctgccctc ctctcccgtc tcgcctgccc gcagcactgc cttagcgaca 1980 gccctgtcct cgcccgcaca gcccgctgca ctttcctcgg cggctccctg cccactctcc 2040 ccgctccatc gccaggagcc ctggggccgg gctggggccac acgggagccg ccccccgggc 2100 tctctgggct cccctcagag agcggctggt gttgaaggca gctctgggca gagacagggc 2160 cggggcccc tcgcccagcc ttgggaccag cccccactgc tcggcgggct gtgcggcgtc 2220 gctgccccag cctttctgag cagcggatcg acggctgggg ggcatctcca gcctcccgaa 2280 tggttcagaa cacaccctcc gcccaccctg gacctcagaa ggccctgcct gtgtgtctgc 2340 gtcgtcctcc gtgtagacct agcgccggct cctccccggc tcgcgctgcg ctggggtctg 2400 tgctgtatagat ttctctctat tatatatgtg tgtgcactgt ctggtcaaga gcagtgtcca 2460 tgtgcgtttc tgtggcagca gtgcacgtgg ggtgggtggg gggtgcgtac ggtggggctt 2520 gtaggttaag atgtctctgc ggtggtgtgg ggctggaggc cgagccaggc acggcagctg 2580 gccctctcca ggcgcatgga ggaattctcc ctttgccgtt ccaaggatgc cgccgcctcc 2640 taccggggct cccggggggg tcagccaaca ctacaaaggg cagcgagtcc tcagggcgcc 2700 cgggagccac cagtctgctc tcgggctcta ctcagactag cgccaacagt ctccgcggac 2760 agactcgcat cagccgccct ggggctcggc ctcctcccat aggctcctct tcctctcttt 2820 cattcaagtc ttcaaacttt gaaaaaaata tgagcttttg ccaaataaga cgggatagtt 2880 tatggagttt tctgaggcgc attgaactct ggtcagcccc tcgagcgtgg gctcggccat 2940 cagcaggccc ggtgggttgg ccgggctggc cctcccaggc tgcctttctc tctggtcgcg 3000 gcctggcccg ccccggcctc caccgccgca attcatgctg gtgccgcgcc cgcagcccca 3060 ctcctggtat gcctgagatt ctccaggggc caagccggtc ctccttcccg gcccactctt 3120 ccagggccag gacgctcccg cggagccagc ccatcgtggc tgggggtccc aggggctgga 3180 ggcctgcctg gttagcctct gtttcccaga cattgactcg aggcgcctcc agtcctctca 3240 accccctgac tttcaagtcc tttcaagtcc ttgtgccctg accaagttat gaggaaaaga 3300 gggctgaggg cctggaggtg ggctcgcacc ccctcgaacc cacctagatg tctcctcctc 3360 cccagcctat gagttcagac ttggggggct ccatctgtcc ctccctgagg tccctcatct 3420 tgtccctgct ctgattctgt cagcagatcc tgaacactcc ttggtgggga cccatgcctc 3480 caaggctgcc cccaatgcca gctgtcctgg ggaaactccc cagaactctc ggggaaaggc 3540 ccgagaacct tcggaggaag cctccgggac tcctcgccac ctgctctgtt tctctcccgg 3600 ccccactgcc ttcaggtatc aggaagaggg caggcccctg tgccccctct ccccttccca 3660 gggcggccaa caatactcca ccatggggcg cttcctttct tctctggaaa ctaagacatt 3720 ggactgaagg aactggcctg aggggggctg accgggggcc cgtgctgctg ggagctctac 3780 gcacaagagg ccgccggggt cacggacagg aacctcagcc cagggtgctg gcctttctcc 3840 ttcgcaggag tcccccaaaa tccacacagc gactcgagca gccttccact cagccagagg 3900 agggtcgggc tcccccgcct gctctcggtg gtggcgtctg gcccttcctg ccgtttccaa 3960 ggcctccgga agcaccaacc cagttctcag ttacctcctc tggccggaag gcctcacgtt 4020 gtcctccaga gctgctctgg gcccagggct ggctccgtga ccacctgatg gacgtgctgg 4080 gcagcatggg ctcccaaggc agcatcccca gctgctctcc caccccaccc cagctgcccg 4140 gcggctgggc ccacgagggc tctggggaca cttccatagg aaaggggcct ggcactttgt 4200 gattgccacg tgtttcctgt taagccgcct gcccccagtg caaatctctg tgttttgctc 4260 tctcctgaac aaaaatgtaa accgacgccg gaaagcaaat ggtatcgaat acctttcttg 4320 cccataaggg tttttacaaa gaacgtgtct cactaggaac taggacactc atcggcccga 4380 gaccaactcc tggataaaag gaataaggag aatcgtgttt gtaacgagtt acaggattgt 4440 ttctttcctg gattttaaac ttttgttaaa ttgtgaaatt atggaggagt tttatagaaa 4500 aaaaaagtga aataaagtca gatgggaaag ca 4532 <210> 4 <211> 2993 <212> DNA <213> Homo sapiens <400> 4 actccactcc cggcacgccc ggtgccgcct tccggctcca gtccccgggc tcggcctcgg cgaggtgtaa ttcgcagcgc gggccggccc cggaggctct cggcgagcgc ggcgcggtaa caagtgggcg aggatgccgt acgagatcaa gaaggtgttc gccagcctcc cgcaggtgga 180 gaggggcgtc tccaagatca tcggcggcga ccctaagggc aacaatttc tgtacaccaa tggaagtgc gtcatcctaa ggaacatcga caacccagcc cttgctgaca tctacacaga gcacgcccat caggtggtgg tggccagta tgcgcccagc ggattctaca ttgcctccgg 360 agatgtgtct gggaagctga ggatctggga taccacgcag aaggagcacc tgttgaagta 420 tgagtaccag cctttcgctg ggaagatcaa agacattgct tggactgaag acagtaagag gatcgccgtg gtcggggag gaagggaga gtttggagca gtcttcctct gggatagtgg 540 ctcttctgtg ggcgagatta caggacacaa caaagtcatc aacagcgtgg cagacaagca gagccggcca taccggctgg ccacgggaag cgatgataac tgcgcggcat tctttgaggg 660 acccccattc aagttcaagt tcacaattgg cgaccacagc cgctttgtca actgtgtgcg 720 attctctcct gatgggaca gatttgccac agccagtgct gacggccaga tatacatcta 780 tgacgggaag actggggaga aggtgtgcgc gctgggcgga agcaggccc acgacggtgg 840 gatttacgca attagttgga gtcccgacag cacccattg ctttctgctt ctggggacaa 900 aacttccaag atttgggacg tcagcgtgaa ctccgtggtc agcacattc ccatgggctc 960 cacggttctg gaccagcagc tgggctgcct atggcagaag gaccacctgc tcagtgtctc 1020 cctgtccggg tacatcact atctggacag aaaaacccc agcaagcccc tgcacgtcat 1080 caagggtcac agtaaatcga tccagtgtct gacggtgcat aaaaacggcg gcaagtccta 1140 catttactct gggagccacg acggacat taattactgg gattcagaga cgggggagaa 1200 cgactccttc gctgggaag gccacacgaa ccaggtgtcc aggatgaccg tggatgagtc 1260 ggggcagctc atcagctgca gcatggacga caccgtgcgg tacaccagcc tcatgctgcg 1320 ggactacagc ggacaggag ttgtgaact ggacgttcag ccaagtgcg tagccgtcgg 1380 ccccggggga tcgccgtgg tcgtgtgcat tggacagatt gtcctgctga aggatcagg 1440 gaagtgcttc agcatcgaca accccggcta cgagccccgaa gttgtggcag tgcaccccgg 1500 cggggacacg gtggcaattg ggggtgtgga cggcaacgtc cgcctgtatt ccatcctggg 1560 1620 ctactcccac gacggcgcct tcctcgcggt gtgcgacgcc agcaaggtgg tcacagtgtt 1680 cagcgttgct gacggctact cggagaacaa tgtttttat ggacaccatg caaaaatcgt 1740 ctgcctggcc tggtccccag aaatgaaca ctttgcctcc ggtggcatgg acatgatggt 1800 gtatgtttgg accctgagtg accccggaaac cagagtcaag atccaagatg cacaccggct 1860 gcaccatgtc agcagcctgg cctggctgga cgagcacacg ctggtcacga cctcccatga 1920 tgcctctgtc aaggagtgga caatcaccta ctgaggagcc ccaccccccgc ctctggatgg 1980 accgaatcag ggactagagt ttaactgcag cggaacatgt catttctcta tttctgtgac 2040 gcgcccccat gccccccaccc caccaaaga ggcaggaggg cccagtcatg accctcgtct 2100 2160 aaataaagcg agcacctaaa caatgtgtgg agcataacta aaacccacag cccaaccaaa 2220 ccttgagaat gcgaaacatt ccagaggcag tagcctccaa agcacacaga gcccctggcc 2280 ccgccgcggc tctcactatc tgtcagggga ggttgtacag gtgaatgagc cggggggctc 2340 atgttcctgc ctgcagaaca tttctgtact agtgagaaga gggaatatgc attgcagttc 2400 agcaaagccg gaattctgtg ttgaacagat gtctgtctcc ctagtgtgtg actcacacct 2460 tgtggctgcc ttcagagcgc cacctccaga tcagatgggg acacacaacc cctggatatg 2520 tttcattgtc agattttgtg cttgatttta agaatggaat tgtgggtatc tttccttttt 2580 ttttaatgta tcttaactgt tgcctgtcag tgtttacaaa ctagtgcgtt gacggcaccg 2640 tgtccaagtt tttagaaccc ttgttagcca gaccgaggtg tcctggtcac cgtttcacca 2700 tcatgctttg atgttcccct gtctttccct cttctgctct caagagcaaa ggttaattta 2760 aggacaaaga tgaagtcact gtaaactaat ctgtcattgt ttttaccttc cttttctttt 2820 tcagtgcaga aattaaaagt aagtataaag caccgtgatt gggagtgttt ttgcgtgtgt 2880 cggaatcact ggtaaatgtt ggctgagaac aatccctccc cttgcacttg tgaaaacact 2940 ttgagcgctt taagagatta gcctgagaaa taattaaata tcttttctct tca 2993 <210> 5 <211> 2626 <212> DNA <213> Homo sapiens <400> 5 gcactccgct cctttcctgc gtcaccgcta cacatgcgcc ttgcaaggaa gggcgagatt 60 tcgggggcag ggcggggggc gggcctaggc cggggtctca cagcgactgc gcggacgggt 120 tcctgagtgg aacatggcga cttgcgccga aatcctgcgg agcgagttcc ccgaaattga 180 cggacaagtc ttcgactacg tgaccggcgt cttgcacagc ggcagcgcgg acttcgagtc 240 tgtggatgac ctggtggaag ctgtagggga actattgcaa gaggtgtccg gggacagcaa 300 ggatgacgcg ggcatcaggg ccgtgtgcca gcgcatgtac aacactctgc gtctggctga 360 gccacaaagc cagggaaata gccaggtgct actggacgcc cctatccagt tgtcaaagat 420 aacggagaac tacgactgtg gaaccaaact tccaggactg ctaaagaggg aacagtcctc 480 gacagtgaat gcaaagaagt tagagaaggc cgaggctcga cttaaggcaa agcaggaga gcgctcagag aaggacacgc tcaagaccag caacccctta gtcttagaag aggcatcagc cagccaggca ggcagcaga aggagagtcg gttggaatca tctggcaaga acaaatccta tgatgtgcga attgagaact ttgatgtgtc ttttggcgat agagtactgc tggctggagc 720 ggatgtgaac ctggcatggg gccgccgtta cgggctggtg gggcggaatg ggttgggga 780 gacaacgtta ctgaagatgc tggccacccg gagtctgcgg gttccagccc acatttccct 840 gctgcacgtt gagcaagagg ttgctggaga tgacactcct gccctgcaga gtgtgctgga gagtgacagt gtgcgagagg atttgctacg gagggagcgg gagctcactg cccagattgc tgctggcagg gcggagggct ctgaagctgc agagctggca gaaatctatg ccaaactgga ggagattgag gctgacaagg cacctgccag ggcatcagtc attctcgctg ggcttggctt tacccctaaa atgcagcagc agcccacccg ggagttctca ggtggctgga ggatgaggct 1140 ggccctggcc cgggccctct ttgctaggcc agatcttctg ctgttagatg aacctacaaa catgctggat gtcagggcca tcctgtggct ggagaattac ctgcagacgt ggccctccac catcctagtc gtctcccacg accgcaactt cttgaatgcc atcgccacag acatcatcca cctgcacagc cagcggctag atggttaccg gggagacttt gagaccttca tcaagagtaa gcaggagcgg ctgctcaacc agcagcgtga atatgaggcg cagcagcagt atcgccagca catccaggtt ttcattgacc ggtttcgcta caatgccaac agggcctctc aagtgcagag taaactcaag atgctggaga agctgcctga gctgaagcct gtggacaagg aatcagaggt cgtaatgaag ttccctgatg ggtttgaga gttctcgccg ccaattctgc agctagatga ggtggatttc tactacgatc cgaagcacgt catcttcagt cgcctctctg tgtctgctga 1680. tctcgagtct cgcatctgtg tggttggaga gaatggggct gggaagtcta ccatgctgaa gctgcttttg ggggacctgg cacctgttcg gggcatcaga cacgctcaca ggaatctgaa gattggctat ttcagccagc accatgtgga gcagctggac ctaaacgtca gtgctgtgga actgctggca cgcaagtttc ctgggcggcc tgaggaggag taccgtcacc agctgggtcg gtatggcatc tccggagaac tggccatgcg tcctcttgcc agcctgtctg ggggccagaa 1980 gagccgagtg gcctttgctc agatgactat gccctgcccc aacttctaca ttctggatga 2040 acccacaaac cacctggaca tggagaccat tgaggctctg ggccgtgccc tcaacaattt 2100 caggggtggt gtgattctgg tgtcccacga tgagcgcttt atcaggctgg tgtgccggga 2160 gttgtgggta tgcgaaggag gcggcgtcac ccgtgtggaa ggaggatttg accagtaccg 2220 cgccctcctc caggaacagt tccgccgcga aggcttcctc tagggccacc aggctgagga 2280 ctcgcccagg acatggactg gtctctcaga cccctgggcc accatgtagg ccaccactcc 2340 aggccgtgga cttcccccaa cttggggaca gccttattcc caaatgtctc tatccttttg 2400 actggagcat cttctgcaca accttgggag cccatccaag ggttggtgag gactggtctc 2460 ccgggggtgg gggtctgggg ggtaccctct ggggttatag attcccccac tgccccagct 2520 ctgactggac cccaagtggc tgctatgtaa attaaatctc tccccgcgtc tcaaaaaaaa 2580 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaa 2626 <210> 6 <211> 758 <212> DNA <213> Homo sapiens <400> 6 gtctgaaggc cgaggccaag atggcggtgc tgtcagctcc tggcctgcgc ggcttccgga 60 tccttggtct gcgctccagc gtgggcccgg ctgtgcaggc acgaggtgtc catcagagcg 120 tggccaccga tggcccaagc agcacccagc ctgccctgcc aaaggccaga gccgtggctc 180 ccaaacccag cagccggggc gagtatgtgg tggccaagct ggatgacctc gtcaactggg 240 cccgccggag ttctctgtgg cccatgacct tcggcctggc ctgctgcgcc gtggagatga 300 tgcacatggc agcaccccgc tacgacatgg accgctttgg cgtggtcttc cgcgccagcc 360 cgcgccagtc cgacgtcatg atcgtggccg gcacactcac caacaagatg gccccagcgc 420 ttcgcaaggt ctacgaccag atgccggagc cgcgctacgt ggtctccatg gggagctgcg 480 ccaacggagg aggctactac cactattcct actcggtggt gaggggctgc gaccgcatcg 540 tgcccgtgga catctacatc ccaggctgcc cacctacggc cgaggccctg ctctacggca 600 tcctgcagct gcagaggaag atcaagcggg agcggaggct gcagatctgg taccgcaggt 660 agccgccgccg ccgccgccgc cggagcctgt cgccgtcctg tcccagcct gcttgtgtcc 720 cgtgaggttg tcataaacc tgccctcggg ctgccgcc 758 <210> 7 <211> 2909 <212> DNA <213> Humans (Homo sapiens) <400> 7 gccagcggcg cggtcgggtg agaggccgcg gcggcaggtc cacctgggct tgcgaaggca 60 cagattcccc gtccacagct cacgaccaga tgcaccagca ggattccaca tczaggagct 120 cctccgggca ctcccacgac cagtgaccag gagttaaact tgggatgtg cccgtgatgt 180 tggaccacaa ggacttagag gccgaaatcc accccttgaa aaatgaagaa agaaaatcgc 240 aggaaaatct gggaaatcca tcaaaaatg aggataacgt gaaagcgcg cctccacagt 300 cccggctctc ccggtgccga gcggcggcgt ttttctttc attgttctc tgccttttg 360 tggtgttcgt cgtctcattc gtcatcccgt gtccagaccg gccggcgtca cagcgaatgt 420 ggaggataga ctacagtgcc gctgttatct atgactttct ggctgtggat gataacag 480 gggacaggat ccagatgtt ctttttcttt aaaaacac caacagcagc aacaatttca 540 gccgatcctg tgtggacgaa ggcttttcct ctccctgcac ctttgcagct gctgtgtcgg 600 gggccaacgg cagcacgctc tgggagagac ctgtggccca agacgtggcc ctcgtggagt 660 gtgctgtgcc ccagccaaga ggcagtgagg caccttctgc ctgcatcctg gtgggcagac 720 ccagttcttt cattgcagtc aacttgttca caggggaac cctgtggaac cacagcagca gcttcagcgg gaatgcgtcc atcctgagcc ctctgctgca ggtgcctgat gtggacggcg 840 atggggcccc agacctgctg gttctcaccc aggcgggga ggaggttagt ggccacctct 900. actccggcag caccgggcac cagattggcc tcagaggcag ccttggtgtg gacggggaa gtggcttcct ccttcacgtc accaggacag gtgcccacta catcctcttt ccctgcgcaa gctccctctg cggctgctct gtgaagggtc tctacgagaa ggtgaccggg agcggcggcc 1080 cgttcaagag tgacccgcac tgggagagca tgctcaatgc caccacccgc aggatgcttt cccacagctc tggagcagtg cgctacctga tgcatgtccc agggaacgcc ggtgcagatg tgcttcttgt gggctcagag gccttcgtgc tgctggacgg gcaggagctg acgcctcgct 1260 ggacacccaa ggcagcccat gtcctgagaa aacccatctt cggccgctac aaaccagaca 1320 ccttggctgt agccgttgaa aacggaactg gcaccgacag acagatcctg tttctggacc 1380 ttggcactgg agccgtcctg tgtagcctag ccctcccgag cctccctggg ggtccactgt 1440 ccgccagcct gccgaccgca gaccaccgct cagccttctt cttctggggc ctccacgagc 1500 tggggagcac cagcgagacg gagaccgggg aggcccggca cagcctgtac atgttccacc 1560 ccaccctgcc gcgcgtgctg ctggagctgg ccaatgtctc tacccacatt gtcgcctttg 1620 acgccgtcct gtttgagcca agccgccacg ccgcctacat ccttctgaca ggcccggcag 1680 actcagaggc acccggcctg gtctctgtga tcaagcacaa ggtgcgggac cttgtcccaa 1740 gcagcagggt ggtccgcctg ggtgagggtg ggccagacag tgaccaagcc atcagggacc 1800 ggttctcccg gctgcggtac cagagtgagg cgtagaggca cgccagccag agcctgtgga 1860 gagactccgc ctgctgacac taaacgtcct gggaagtggg cccttccctg ggtctctgca 1920 ctgactcccc cactcctgac cctggtgatg gtcgccactg ggcagcagca gccttaccag 1980 tcctccatga tcacacccag ggacctgcat gggtgagggg acaccctggg cctctctccc 2040 gcccagcatc ctccctgagt ccccacacag ggcctcactc tgcaccccac cagggtcccg 2100 ctcacaccag gcagccttca tagtggtctc cctggccacc ttgggcagag ctgggtcatg 2160 cagcacccca tccttacccg gtgccctctc cttgccagct tctccccagg ccagagcggc 2220 catcgcgtag aaagaaccag ggtgtccccg ggacaggccg tcccccaccc catcctgtag 2280 aagtccattc cccttttccc tcctgtgctc tgtcccccaa ggagtcatgg aactcagggt 2340 actgggcctc aacgggaacc tgagacagct ccagcttcgc agcccttccc ggagctacag 2400 ggggatcctc tagcatgggg ggtgtgactt ggttcctttg accaggtcct gtgaggaagc 2460 ctggagcaag ggtctccccc agcaggatgg gtggggcctg ctctggagct gagcccgtgg 2520 ccgctcacag gtgtccttag tggtgttgca gctgtctact ggctgcatgt gctgtgaata 2580 tcccaaggaa ctggctgtgg aatgcgtgtt tgggtcagtc tgtgccctct cagtagacac 2640 tggagctgct ctgtccctga agaggccccg tgccccaggc atggcaagcg cctgcctctc 2700 cccttccggt gctcacacgc ccacgccgtg ccacccgatg caggactcac ctctgtgcct 2760 tgctgctcct gaggcccaag ggcagccatg gtgctctgta ctgctcgggc cgcccaggtc 2820 acagagcctg agcttcgtag ccaaagcagc ctgatgaccc acccaccaag gaagaaagca 2880 gaataaacat ttttgcactg cctgaaaaa 2909 <210> 8 <211> 3433 <212> DNA <213> Homo sapiens <400> 8 cggctcagag ctccggaccg cgggcggagg ggaggggcag ggggcggtgc cacggcctgc 60 cagcccgccc gcccgcccgc cagccagccc tccccgcggc cggctcggct ccttggcgct 120 gcctggggtc ctttccgccc ggtccccgct tgccagcccc cgctgctctg tgccctgtcc 180 ggccaggcct ggagccgaca ccaccgccat catgccggcc gtgtccaagg gcgatgggat 240 gcgggggctc gcggtgttca tctccgacat ccggaactgt aagagcaaag aggcggaaat 300 taagagaatc aacaaggaac tggccaacat ccgctccaag ttcaaaggag acaaagcctt 360 ggatggctac agtaagaaaa aatatgtgtg taaactgctt ttcatcttcc tgcttggcca 420 tgacattgac tttgggcaca tggaggctgt gaatctgttg agttccaata aatacacaga 480 gaagcaaata ggttacctgt tcatttctgt gctggtgaac tcgaactcgg agctgatccg 540 cctcatcaac aacgccatca agaatgacct ggccagccgc aaccccacct tcatgtgcct 600 ggccctgcac tgcatcgcca acgtgggcag ccgggagatg ggcgaggcct ttgccgctga 660 catcccccgc atcctggtgg ccggggacag catggacagt gtcaagcaga gtgcggccct 720 gtgcctcctt cgactgtaca aggcctcgcc tgacctggtg cccatgggcg agtggacggc 780 gcgtgtggta cacctgctca atgaccagca catgggtgtg gtcacggccg ccgtcagcct 840 catcacctgt ctctgcaaga agaacccaga tgacttcaag acgtgcgtct ctctggctgt 900 gtcgcgcctg agccggatcg tctcctctgc ctccaccgac ctccaggact acacctacta 960 cttcgtccca gcaccctggc tctcggtgaa gctcctgcgg ctgctgcagt gctacccgcc 1020 tccagaggat gcggctgtga aggggcggct ggtggaatgt ctggagactg tgctcaacaa 1080 ggcccaggag ccccccaaat ccaagaaggt gcagcattcc aacgccaaga acgccatcct 1140 cttcgagacc atcagcctca tcatccacta tgacagtgag cccaacctcc tggttcgggc 1200 ctgcaaccag ctgggccagt tcctgcagca ccgggagacc aacctgcgct acctggccct 1260 ggagagcatg tgcacgctgg ccagctccga gttctcccat gaagccgtca agacgcacat 1320 tgacaccgtc atcaatgccc tcaagacgga gcgggacgtc agcgtgcggc agcgggcggc 1380 tgacctcctc tacgccatgt gtgaccggag caatgccaag cagatcgtgt cggagatgct 1440 gcggtacctg gagacggcag actacgccat ccgcgaggag atcgtcctga aggtggccat 1500 cctggccgag aagtacgccg tggactacag ctggtacgtg gacaccatcc tcaacctcat 1560 ccgcattgcg ggcgactacg tgagtgagga ggtgtggtac cgtgtgctac agatcgtcac 1620 caaccgtgat gacgtccagg gctatgccgc caagaccgtc tttgaggcgc tccaggcccc 1680 tgcctgtcac gagaacatgg tgaaggttgg cggctacatc cttggggagt ttgggaacct 1740 gattgctggg gacccccgct ccagcccccc agtgcagttc tccctgctcc actccaagtt 1800 ccatctgtgc agcgtggcca cgcgggcgct gctgctgtcc acctacatca agttcatcaa 1860 cctcttcccc gagaccaagg ccaccatcca gggcgtcctg cgggccggct cccagctgcg 1920 caatgctgac gtggagctgc agcagcgagc cgtggagtac ctcaccctca gctcagtggc 1980 cagcaccgac gtcctggcca cggtgctgga ggagatgccg cccttccccg agcgcgagtc 2040 gtccatcctg gccaagctga aacgcaagaa ggggccaggg gccggcagcg ccctggacga 2100 tggccggagg gaccccagca gcaacgacat caacgggggc atggagccca cccccagcac 2160 tgtgtcgacg ccctcgccct ccgccgacct cctggggctg cgggcagccc ctcccccggc 2220 agcacccccg gcttctgcag gagcagggaa ccttctggtg gacgtcttcg atggcccggc 2280 cgcccagccc agcctggggc ccacccccga ggaggccttc ctcagcccag gtcctgagga 2340 catcggccct cccattccgg aagccgatga gttgctgaat aagtttgtgt gtaagaacaa 2400 cggggtcctg ttcgagaacc agctgctgca gatcggagtc aagtcagagt tccgacagaa 2460 cctgggccgc atgtatctct tctatggcaa caagacctcg gtgcagttcc agaatttctc 2520 acccactgtg gttcacccgg gagacctcca gactcagctg gctgtgcaga ccaagcgcgt 2580 ggcggcgcag gtggacggcg gcgcgcaggt gcagcaggtg ctcaatatcg agtgcctgcg 2640 ggacttcctg acgcccccgc tgctgtccgt gcgcttccgg tacggtggcg ccccccaggc 2700 cctcaccctg aagctcccag tgaccatcaa caagttcttc cagcccaccg agatggcggc 2760 ccaggatttc ttccagcgct ggaagcagct gagcctccct caacaggagg cgcagaaaat 2820 cttcaaagcc aaccacccca tggacgcaga agttactaag gccaagcttc tggggtttgg 2880 ctctgctctc ctggacaatg tggaccccaa ccctgagaac ttcgtgggg cggggatcat 2940 ccagactaaa gccctgcagg tgggctgtct gcttcggctg gagcccaatg cccaggccca 3000 gatgtaccgg ctgaccctgc gcaccagcaa ggagcccgtc tcccgtcacc tgtgtgagct 3060 gctggcacag cagttctgag ccctggactc tgccccgggg gatgtggccg gcactgggca 3120 gccccttgga ctgaggcagt tttggtggat gggggacctc cactggtgac agaagaca 3180 ccagggtttg ggggatgcct gggactttcc tccggccttt tgtttttta tttttgttca 3240 tctgctgctg tttacattct ggggggttag ggggagtccc cctccctccc tttcccccccc 3300 aagcacagag gggagagggg ccagggaagt ggatgtctcc tcccctccca ccccaccctg 3360 ttgtagcccc tcctaccccc tccccatcca ggggctgtgt attattgtga gcgaataaac 3420 agagagacgc taa 3433 <210> 9 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 9 accactggct gcctcaccta ctccccacac cagatcggca tcaagcagat cctgccacac 60 cagatgacca cggcagggcc 80 <210> 10 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 10 cactccagcc tctttctgga ggagctggag atgctggtgc cctcaacacc cacctctact 60 agcggtgcct tctggaaggg 80 <210> 11 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 11 atctgatcga ggagactggc cacttcaatg tcaccaacac caccttcgac ttcgacctct 60 tctccctgga cgagaccacc 80 <210> 12 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 12 agcctggcct ggctggacga gcacacgctg gtcacgacct cccatgatgc ctctgtcaag 60 gagtggacaa tcacctactg 80 <210> 13 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 13 tgactatgcc ctgccccaac ttctacattc tggatgaacc cacaaaccac ctggacatgg 60 agaccattga ggctctgggc 80 <210> 14 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 14 actattccta ctcggtggtg aggggctgcg accgcatcgt gcccgtggac atctacatcc 60 caggctgccc acctacggcc 80 <210> 15 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 15 tggcaccgac agacagatcc tgtttctgga ccttggcact ggagccgtcc tgtgtagcct 60 agccctcccg agcctccctg 80 <210> 16 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 16 agcattccaa cgccaagaac gccatcctct tcgagaccat cagcctcatc atccactatg 60 acagtgagcc caacctcctg 80 <210> 17 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 17 ctttgagtct atcaaaagga aacttccttt cctcaactgg gatgcctttc ctaagctgaa 60 aggactgagg agcgcaactc 80 <210> 18 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 18 tggaagagag ctatgacctc aaggacacgt tgagaaccat gggaatggtg gatatcttca 60 atggggatgc agacctctca 80 <210> 19 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 19 cctcagcagt gccagcagaa atatcctcct gtgacacctt ccccaccctg ccagtcaaag 60 tatccaccca agagcaagta 80 <210> 20 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 20 gttttcagct gctcagaatt catctgaaga gagacttaag atgaaagcaa atgattcagc 60 tcccttatac ccccattaaa 80 <210> twenty one <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> twenty one ccgtgtctca agatacgtcc tgtggatccg tgaaacaatc cgaaaatatg aaacccagca 60 gcaaaaatgg ttgaagggcc 80 <210> twenty two <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> twenty two tccgaagaag agtggaccaa ctgaagagtg atcaatctcg gttggattcg gaactgaaga 60 acatgcagga catggtggag 80 <210> twenty three <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> twenty three gcagcccttc gaggtgctca tcatcgcgtc agacgacggc ttcaaggccg tggttgggga 60 cgcccagtac caccacttcc 80 <210> twenty four <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> twenty four gttcctgtta aaggtcaaga cactgtcaaa ggccgtgttc cattcaatgg acaagatccc 60 gttaaaggac aagtttcagt 80 <210> 25 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 25 cccaagctgt tctacgccga ccaccccttc atcttcctag tgcgggacac ccaaagcggc 60 tccctgctat tcattgggcg 80 <210> 26 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 26 gctccttcct ggtcaagaag catttcaacg cctccaaaaa gccaaactac agcgaactgg 60 acacacatac agtgattatt 80 <210> 27 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 27 cacggctctt catggacctt cagtgcactc agctgcaaga ttgtggcctt tatggccgtg 60 ctcttttgct tccatgcggc 80 <210> 28 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 28 cagacagttc taattgttgg aacgttgctc tatgcatgct attgggtcat gcttttgacg 60 ctgtatgtag ttctcatcaa 80 <210> 29 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 29 ttttgtcgca atcatatact gtttctgcaa tggcgaggta caagctgaga tcaagaaatc 60 ttggagccgc tggacactgg 80 <210> 30 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 30 tgatgtggaa gcttttcaac aggaactggc tctgcttaag atagaggatg cacctggaga 60 tggtcctgat gtcagggagg 80 <210> 31 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 31 tgcatttgat ggcctgtatt ttctccgcac tgagaatggt gttatctacc agaccttctg 60 tgacatgacc tctgggggtg 80 <210> 32 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 32 agatgccact ccccagaatc ccttcttgaa gtccagacct caggttaggc caaaaccagc 60 tccttccccc aaaacggagc 80 <210> 33 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 33 acccagtggt ctgttgactc ccttacactt ggagggcctt gtccagttcc aagatgtctc 60 ctttgcctac ccaaaccgcc 80 <210> 34 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 34 aagacatacc acgtaggaga acagtggcag aaggaatatc tcggtgccat ttgctcctgc 60 acatgctttg gaggccagcg 80 <210> 35 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 35 gaaagctttg aggagtcctg gacacccaac tacaagcagt gttcatggag ttcattgaat 60 tatggcatag atcttgggaa 80 <210> 36 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 36 gtgagttccc ggagtgagtt gaaccaggtg gaccaagtgg gctacgtgac ctatgacatc 60 ctgcagtgcc ctgaggacta 80 <210> 37 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 37 ctatatgaag gatgtgaagg tcagcctctt caagaaggac aaggctatgc tcttcaccta 60 tgatcagtac caggaaaata 80 <210> 38 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 38 gctgtcattg gtgctgtcct ggctgtgttt ggaggtattc taatgccagt tggagacctg 60 cttatccaga agacaattaa 80 <210> 39 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 39 ggaaacggtc caggagctga tccccctggc caaggagatg atggcccaga agcgcaaggg 60 gaagatggtg aagctgtacg 80 <210> 40 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 40 gaagacattg gaggcaaaaa gctgactgag atcatcaaca cgcagcatga gaatgtcaaa 60 tacctgccag ggcacaagtt 80 <210> 41 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 41 acactggcag tctaccaaca gatcctcacc agtatgcctt ccagaaacgt gatccaaata 60 tccaacgacc tggagaacct 80 <210> 42 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 42 ccactgggca cggattccct caagaacctg accctgaggg acttgagcct gaggggaaac 60 tccgagacgt cgtcggacac 80 <210> 43 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 43 ctgggtggtg tggcacatac cctgcagaag accctccaga ccaccatctc ggctgtgaca 60 tgggcacctg cagctgtgct 80 <210> 44 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 44 cctgcctagc agtgagcaga tgccaaatga ccaggaagag gagtcctttg cagagggtca 60 ttccgaagcg tccctcgcca 80 <210> 45 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 45 atttagtgtc tccagactct cctagatcca tagacagcaa cagtgagatt gtctcatttg 60 gaagtccatg ctccattaat 80 <210> 46 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 46 ggataagaag cgattcagct ttgtcttcaa gcctgtcttc aacacctcac tgctctttct 60 acagtgtgag ctgacgctgt 80 <210> 47 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 47 aagggtggtc caactgccaa agtcaagcaa ggccacatca gcttcaaggt tatttccagc 60 gatgatctca ctgagctcta 80 <210> 48 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 48 caagaaggca aaaaggtcat ccaaggagga agccgagatg gcctacaaag acttcctgct 60 ccagtccagc accgtggccg 80 <210> 49 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 49 ggtagcagca gcaatttcca catcaatgta gaagagtcag tggatggaca ggtggtttct 60 tcccacaaga gagaaatcta 80 <210> 50 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 50 tgcagactca gtggagaagg agttggacca gtcaacatct ctgttgtcac aagcagtgtt 60 tcctctggatggcagtgg 80 <210> 51 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 51 gagatcaaag actacagtcc ctacttcaag accattgagg acctgaggaa caagattctc 60 acagccacag tggacaatgc 80 <210> 52 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 52 caaagccttg gtcaaaaagt atcaggaagg cctcatcaca cttacagaac ttgctgattc 60 tttgctgagc cggttagtcc 80 <210> 53 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 53 cccacctgga ttctatggag tgaactgtga caaagcaaac tgctcaacca cctgctttaa 60 tggagggacc tgtttctacc 80 <210> 54 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 54 aaggagcagg ccatgtttga taagaaggtg cagctccaga gaatggtaga ccaaaggtcg 60 gtgatttcag atgaaaagaa 80 <210> 55 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 55 tagattctag tgcattcaag cacaatggca cggttgaatg taaggcttac aacgatgtgg 60 gcaagacttc tgcctatttt 80 <210> 56 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 56 ctacagtgac ttgacaatga aaaccagcga caagttcaag tttgtcttcc gagaaaagat 60 gggcaggatt gttgattatt 80 <210> 57 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 57 atggcgacaa gaagattgtc cccaagaaga agaagcccct gaagttgggg cccatcaaga 60 agaaggacct gaagaagctt 80 <210> 58 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 58 gaatttgtac gagacctgct tctatctcct gaagaaaact gtggcattct ggaatgggaa 60 gatagggaac aaggaatttt 80 <210> 59 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 59 agcattgtcc gagaggacca gaccctgaaa cctggcaaag tcgatgtgaa gacagacaaa 60 tgggatttct actgccagtg 80 <210> 60 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 60 ccattctttg ggtatgggac attcctctga tcctaatgca gtgatgtatc caacctatgg 60 aaatggagat ccccaaaatt 80 <210> 61 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 61 tttgtgttcc cttacccata tccatttcgc ccacttccac caattccatt tccaagattt 60 ccatggttta gacgtaattt 80 <210> 62 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 62 gaggaggaga ccgtggacgg acgcaagtgc aggagtttag ccacttggga gaatgagaac 60 aagatccact gcacccaaac 80 <210> 63 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 63 cgcacaggga atggattgtt ggagagagta actaggattc tagcttctct ggattttgct 60 cagaacttca tcacaaacaa 80 <210> 64 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 64 aagatcaagg ccataaccca ggagaccatc aacggaagat tagttctttg tcaagtgaat 60 gaaatccaaa agcacgcatg 80 <210> 65 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 65 atgcccagaa ggatgtggat gctgtggaca aggtgatgaa ggagctagac gagaatggag 60 acggggaggt ggacttccag 80 <210> 66 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 66 tgcgaaatgg aagcctgcac atcattgatg acttcgagtc taaattcacg ttccattctg 60 tggaagactt tccccctccg 80 <210> 67 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 67 ctgctctttg tctacgcaga tgattgcctt gctcagtgtg gcaaagattg caaatcttac 60 tgctgtgatggaaccacgcc 80 <210> 68 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 68 tgtaccacgc catcttcctg gaagagctga ccaccttgga gctgattgag aagattgcca 60 acctgtacag catctccccc 80 <210> 69 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 69 gttgggcata gcattgctct tttgcatcct gtttacgctg gtctgtgggg cttctgggac 60 gtctaaacaa ccaaaagtaa 80 <210> 70 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 70 tggcagcagt aagatcttcc ctggcaactg ggacaaccac tcccacaaga agaacttgtt 60 tgagacgccc atcctggctc 80 <210> 71 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 71 caacccaatg acccaggagt ctacactcaa gtgtgcaagt tcaccaagtg gataaatgac 60 accatgaaaa agcatcgcta 80 <210> 72 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 72 cttctggggg tcacagagca tgttctcgcc aacaatgatg tttcctgtga ccacccctct 60 aacaccgtgc cctctgggag 80 <210> 73 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 73 ccatcccata gaagtccagc agacaggatt tgttaagtgc cagactttgt caggaagtca 60 aggagcttct gctttgtccg 80 <210> 74 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 74 gactacgatg acacagacga tgacgaccct ttcaaccctc aggaatccaa gcgctttgtg 60 cagtggcagt cgtctatctg 80 <210> 75 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 75 ttcagcgaat tgctctgctg cccaaaagac gttttctttg gaccaaagat ctctttcgtg 60 attccttgca acaatcaatg 80 <210> 76 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 76 gggagacaag cacaagctga agaaatccga actcaaggag ctcatcaaca atgagctttc 60 ccatttctta gaggaaatca 80 <210> 77 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 77 ctcattcagg tgatgtgctc tatgaactcc ttcagcatat tctgaagcag aggaaacctc 60 ggattctttt ttcaccattc 80 <210> 78 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 78 aagaaataca gagaaggaca gtaatgctga gaacatgaat tctcaacctg agaaaacagt 60 tactactccc acagaaaaaa 80 <210> 79 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 79 acaataagaa cgggttcaaa atgttcgact cctccaacta tcatggccaa gacctgcttt 60 tcaaggatgc caccgtccgg 80 <210> 80 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 80 agtcctccat cactttgatt cttctagtca agagtcagtg ccaaaaagga gaaagtttag 60 tgaaccaaag gaacatatat 80 <210> 81 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 81 atgtggtcca gcaaggaact gcagggtgtc ctcagacagc aaggtttcga taggaacatg 60 ctgggaacct tagctggggc 80 <210> 82 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 82 gaacaactct ccagtgaacg ggaatagtag ctgtcaaatg gccttccctt ccagccagtc 60 tctgtaccgc acgtccggag 80 <210> 83 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 83 tcatgtgctc tcatggaaca acagcattat gtcgaccaaa cttcagaatg tttctccagc 60 ccaagctact tgagaatatt 80 <210> 84 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 84 agtaccagcc ttccaaatga aactctttca gagttagaga cacctgggaa atactcactt 60 acaccaccaa accactgggg 80 <210> 85 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 85 gcttgaagac catggtgaga aaaaccagaa gcttgaagac catggtgtga aaatccttga 60 acccacccaa atacctgctc 80 <210> 86 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 86 tctctattcc cagtataagg gacgaaactg cgaactcctt aaagctctat ctagccaaac 60 cgcttacgac cttgtatata 80 <210> 87 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 87 ttccgcttgg agcccaagga tgggaaaggt gtgtttgcag tggatgggga attgatggtt 60 agcgaggccg tgcagggcca 80 <210> 88 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 88 gcagacaagt tcctgcagct gtttggaacc aaaggtgtca agagggtgct gtgtcctatc 60 aactacccct tgtcgcccac 80 <210> 89 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 89 cttggctgct cctctgacac catcgaggtc tcctgcaact tcactcatgg tggacagacg 60 tgtctcaagc ccatcacggc 80 <210> 90 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 90 cccacgcatg agatccgctg caactctgag gtcaagtacg cctcggagaa gcatttccag 60 gacaaggtct tctatgcgcc 80 <210> 91 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 91 gtccttcgat gaggtcaagc gccttcagaa gcagatcctg gaggtcaagt cctgcctgaa 60 gaacaagacc aaggaggcgg 80 <210> 92 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 92 aaaccagcaa ccatcaaggt ctatgactac tacctaccag atgaacaggc aacaattcag 60 tattctgatc cctgtgaatg 80 <210> 93 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 93 ggacaatttg cgatgacgag tggcaaaatt ctgatgccat tgtcttctgc cgcatgctgg 60 gttactccaa aggaagggcc 80 <210> 94 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 94 tcaacgaaga attgtggccc aatcccttgc agttctacct tttgagtgaa ggggctcgtg 60 tagagaaagg aaaggaaaaa 80 <210> 95 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 95 gatgctttct tctgtattgg ctgctctcat tggaattgca ggatctggct actgtgtcat 60 tgtggcagcc cttggcttag 80 <210> 96 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 96 acaataacaa gaaaattgaa agatgggaaa ttagtggtgg agtgtgtcat gaacaatgtc 60 acctgtactc ggatctatga 80 <210> 97 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 97 cttcagctgt ctgtacccag atggcgtctt ctatgacctg gacagctgca agcattccag 60 ctaccctgat tcagaggggg 80 <210> 98 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 98 tgccagaaca ctattcaacc aagtgatgga aaaggagttt gaagacggca tcattaactg 60 gggaagaatt gtaaccatat 80 <210> 99 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 99 ctcccggaac tggcaggact acggagttcg agaagtggac caagtgaaac gtctcacagg 60 cccaggactt agcgaggggc 80 <210> 100 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 100 aaggacgtca acatcttcag ctttctttcc aagaaggaag agacctacaa cgacctcatc 60 aagcagatcg ggaagaaggc 80 <210> 101 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 101 acatgataga cctacagctc tcatcaatgg ccatttgaat tcacttcaga gcaatccact 60 actgccagac cagaaggtct 80 <210> 102 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 102 tctaagtttc ttttcctttt ctgtctgtat ctgtttttct ctgactgcct atatcttact 60 ttgtataccc atacataaat 80 <210> 103 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 103 gtcatttatc ctgcagtgct ttgctgcaag ataacatcgc tgatgctgta gcttgtgcaa 60 agagggttgt ccgtgatcca 80 <210> 104 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 104 catggtggag ctgctgctgc tgcagaacgc acaggtgcac cagttggtcc tgcagaactg 60 gatgctcaag gccctgcccc 80 <210> 105 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 105 cttctctatg tgaagcagca gccttggtat tgtgaggtct accaatacag tgagtgtttt 60 ctggccaacc aaagcccata 80 <210> 106 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 106 accgtggtgc cagtgcttgc tggtgtaggc ccactggatc cccagagcct caggcccaac 60 tcggaggagg tgagctgggg 80 <210> 107 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 107 gactgactac aaacaatgca tggccgtgaa cttctttgga actgtggagg tcacaaagac 60 gtttttgcct cttcttagaa 80 <210> 108 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 108 aagtcctatg aaactgctga taccagcagc caaggttcca ctataagtgt tgactcacaa 60 gatgaccaga tggagtctta 80 <210> 109 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 109 aacactgatg ttcccatccc aacacactac tttgtggtgc tgaccagttg taaaaacaag 60 agccacacac cggaaaactg 80 <210> 110 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 110 gccactgcaa gttccactgg tgctgctacg tcaagtgcaa gaagtgcacg gagatcgtgg 60 accagtttgt gtgcaagtag 80 <210> 111 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 111 ggtgcctaca gccagctcaa agtggtctta gagaagctga gcaaggacac tcactgggta 60 cctgttagtt gggtcaggta 80 <210> 112 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 112 aatcgtggat ggcagattac tgtaaagatg acaaggacat agagtcagct aaatcagaag 60 actggatggg ctcttcggtg 80 <210> 113 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 113 acctacctct atgaggacag caatgtatgg cacgacatct cagacttcct cgtctataac 60 aagagccgtc cctccaatta 80 <210> 114 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 114 ccggtcagcg ggatcctgtt caataatgaa atggacgact tcagctctcc cagcatcacc 60 aacgagtttg gggtaccccc 80 <210> 115 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 115 agcatgaacg ccaaggaatg tacgttgaga atcactgctc caggcctgca ttactccttc 60 agctctgggg cagaggaagc 80 <210> 116 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 116 aacatccagg ataaggaccg gatctctgcc atgcagagca tcttccagaa gaccaggact 60 ctgggaggcg aggagagctg 80 <210> 117 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 117 ccttcccatc gcacaaccca aaaaagttat cacaccggaa agaagtcacc gagcgtctac 60 tccagaagtc agtatgtgta 80 <210> 118 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 118 aactattaca tccttaacac cctctacccc aagttcaatg ataagttggc cgaaggcttc 60 ccccttcctc tgctgaagcg 80 <210> 119 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 119 ggagactggt ttgaatatgt ttcttcccct aactacttag cagagctgat gatctacgtt 60 tccatggccg tcacctttgg 80 <210> 120 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 120 attccgagtg gctgcctaca acaaagccaa aaaagccatg gacttctatg atccagcaag 60 gcacaatgag tttgacttca 80 <210> 121 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 121 actattctct tgtttactgc cttttgactc ggatgaagag acacggaagg ggagaaatca 60 ttggaattca gaagctgaat 80 <210> 122 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 122 aaagcttatg gctctgtgat gatattagtg accagcggag atgataagct tcttggcaat 60 tgcttaccca ctgtgctcag 80 <210> 123 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 123 tggtcttgag agatggcttg ctggagaacc agaccccaga gttcttccag gacgtctgca 60 agcccaagta cagcggcacc 80 <210> 124 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 124 gttgaagatg aaacagtaga gcttgatgtg tcagatgaag agatggctag aagatatgag 60 accttggtgg ggacaattgg 80 <210> 125 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 125 ctgtgccaag cccttcaaag tcatctgtat cttcgtctct ttcctcagct ttgactacaa 60 actggtgcag aaggtgtgcc 80 <210> 126 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 126 ctaatcttat gaacagtggt gtgagactga atgccatttg tccaggcttt gttaacacag 60 ccatccttga atcaattgaa 80 <210> 127 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 127 ttggattaca ggagatgaga gtattgtagg ccttatgaag gacattgtag gagccaatga 60 gaaagaaata gccctaatga 80 <210> 128 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 128 caggcactga acaatttggg gtttaagatt tgtccctgtg gctggcatca gtggaaatgc 60 acccccaaga aatgttgttg 80 <210> 129 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 129 catgtcacca cgatctttcc tctgcttgag aagaccatgg aactggatag ctcacttccg 60 gaatacaaca tgtttccccg 80 <210> 130 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 130 tgttcgagcc gcattctgga gaagactaca gtcgtgatga ggaccacatc gctcacatag 60 tggagcttct gggggacatc 80 <210> 131 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 131 catcacatcc tcatgcacct caccgagaaa gcccaggagg tgacaaggaa ataccaggaa 60 atgacgggac aagtttggta 80 <210> 132 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 132 tcgctgctgt gtcactcatg actgttgcta caaacgtctg gagaaacgtg gatgtggcac 60 caaatttctg agctacaagt 80 <210> 133 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 133 cctgcactcc cgaaagaata tgctgttggc caccaagcaa ctttgtaaag aatttacgga 60 tctactggcg caggaccgga 80 <210> 134 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 134 gcacattcaa gaacacggag attagtttcc agctgggaga agagtttgat gaaaccactg 60 cagatgatag aaactgtaag 80 <210> 135 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 135 gtccttcaaa gctggagtct gtcctcctaa gaaatctgcc cagtgcctta gatacaagaa 60 acctgagtgc cagagtgact 80 <210> 136 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 136 atgaaatgga gaacttgctg acctacaagc ggagagccat agagcacgtg ctgcaggtag 60 aggcctccca ggagccctcg 80 <210> 137 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 137 atggaggacc tggacacaaa tgcagacaag cagctgagct tcgaggagtt catcatgctg 60 atggcgaggc taacctgggc 80 <210> 138 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 138 agcttctcca gcagtgcggg tcctgggctc ctgaaggctt attccatccg gaccgcatcc 60 gccagtcgca ggagtgcccg 80 <210> 139 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 139 agtggtgcac tcttctttat catctcagac ctgaccatcg ccctcaacaa attctgtttt 60 cctgtgccct actctcgggc 80 <210> 140 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 140 ctgtctctta cacggtagca ccctttgtga tgttggcagt tgaaccgacc atcagcttat 60 acaagtccat gtacttttat 80 <210> 141 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 141 tcctgtgctg ctgtctggtt gagagcctgc caccgtgtgt cgggagtgtg ggccaggctg 60 agtgcatagg tgacagggcc 80 <210> 142 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 142 cctgctctgg atcatcgaac tgaatacccaa cacaggcatc cgtaagaact tggagcagga 60 gatcatccag tacaacttta 80 <210> 143 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 143 tgatggggag aatgtgaaaa ttccagtggc catcaaagtg ttgagggaaa acacatcccc 60 caaagccaac aaagaaatct 80 <210> 144 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 144 attgaggcca tccgaagagc cagtaatgga gaaaccctag aaaagatcac caacagccgt 60 cctccctgcg tcatcctgtg 80 <210> 145 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 145 ctcgatgcac acactggtat atcccatgaa gacctcatcc agaacttcct gaatgctggc 60 agctttcctg agatccaggg 80 <210> 146 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 146 cctgacatgg actatgaccc tgaggcacga attctctgtg cgctgtatgt tgttgtctct 60 atcctgctgg agctggctga 80 <210> 147 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 147 tcgtgctgta cttcctcacc agcttctaca ctaagtacga ccagatccat tttgtgctca 60 acaccgtgtc cctgatgagc 80 <210> 148 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 148 acgatgtgca gccttcgaag ttgatgcgac tgctgagctc taatgaggac gatgccaaca 60 tcctttcgag ccccacagac 80 <210> 149 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 149 tgtatcacat cacttctcaa gtattccttc attgggcttc atccttttag cagaactctt 60 ggtggtggga tagagactta 80 <210> 150 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 150 atgaagatcg gaagaatcca gcatacatac ctcggaaagg gctcttcttt gagcatgatc 60 ttcgagggca aactcaggag 80 <210> 151 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 151 tgtccggtct ttcttggatg attttgagtc aaagtattcc ttccatccag tagaagactt 60 tcctgctcca gaagaatata 80 <210> 152 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 152 acatgactct aagtaacctc tgtgaccctc agttgaaacc agaagagaga gaatcttgta 60 accctcagga ctgtgtccct 80 <210> 153 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 153 accttcctct cctaaacacg tctcttctgt cacttcccga actggcagtt ctggagcaaa 60 ggagatgaaa ctcaaggggg 80 <210> 154 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 154 tgctggctcg gttatcagac tctcatccaa cacaagctca cagggaaagc cgttccttgc 60 tccttgtgga gggagctacc 80 <210> 155 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 155 gcatctgagc agtgaggaga tgatgagaga atgtggagat gtgtcaaggg ctcaagagga 60 gctaaggaaa aaacagaaaa 80 <210> 156 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 156 aattcttcga ggacatttta cagccagaga cagagtttgt ctttcctctg tcccatctgc 60 atctcgagtc gcagagaccc 80 <210> 157 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 157 ccaggtgcag gatatcgtca agccaaacac agcacataca ttcatcataa caggaagaaa 60 aaggtccctg gagctgcaga 80 <210> 158 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 158 gtctcggtgc ttccagccac ataaccacaa aatcaatggc tgctcctcca agctgtggtc 60 tgagcccact gctggtcctg 80 <210> 159 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 159 ctgggcacta tggaggtgaa gagcaagttt ggagctgaat ttcgtcggtt ttcgctggaa 60 agatcaaaac ctggaaaatt 80 <210> 160 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 160 gtgcaggttc agtgtgagca gaactgggga agcctgtgct ccatcttgag cttctgcacc 60 tcggccatcc agaagcctcc 80 <210> 161 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 161 ctgttgctgt gttctgtcat gagttgcctc atgaattagg tgactttgct gttctactaa 60 aggctggcat gaccgttaag 80 <210> 162 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 162 caatatcacc gccatgccac acaatggatc attctggaat gtccaggatc tgctcaattc 60 agcaatgcca agggtggtcc 80 <210> 163 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 163 tcgctgtcct tgcggaatcc acacactttg ggcctaagcc ggtaccaccc ctatggcaag 60 agccacttat ccacagcggg 80 <210> 164 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 164 gcaagtaaag aagaggcaac cacgttctcc aatgcaatgc tgtttgccct gaacatcatg 60 aattcccaag aaggaggccc 80 <210> 165 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 165 ggtgcagatg atggctttgt tacggtgagc ctaaagccag acaaagggaa gagagcaaat 60 tcccaagaaa atcgtaatta 80 <210> 166 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 166 cgctgaaaca cgtccatttg gagaacaacc gcttgaacca gctaccctcg aacttcccct 60 tcgacagcct ggagaccctc 80 <210> 167 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 167 tggcctttca ttgtgatctc tgatgactcc tgcgtgatgt ggaacgtggt ggatgtcaac 60 tctgctgggg agagaagcag 80 <210> 168 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 168 ataatcagca atgatgtctg caatggcgct gacttctatg gaaaccagat caagcccaag 60 atgttctgtg ctggctaccc 80 <210> 169 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 169 cggtgatggt attttgccca ggcaacagta cttcaaacag aactgcagtc agcatgaatc 60 cagtccagat atttcacatt 80 <210> 170 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 170 ccagcttctg cagtttctgt tttgaagagc cagcacttac ggcagaaact tcttcagtct 60 ctgtttcttg ataaagtgta 80 <210> 171 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 171 cacaggattc ctgtgggtcc agctttggaa ctgggaaacc tttcttcgga tccgcactca 60 ttccactgat gccagctgcc 80 <210> 172 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 172 tctacattct ggttgtcatg tccttctacg gcattttctt gatcggaatc atgctgggct 60 acatgaaatc caagaggcgg 80 <210> 173 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 173 tggtggagat cttcgacatg ctgctggcta catcatctcg gttccgcatg atgaatctgc 60 agggagagga gtttgtgtgc 80 <210> 174 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 174 atgaagaatt tcttcattct gatctcctag aagacagcaa ataccgaaaa atctactcct 60 ttactcttaa gcctcgaaca 80 <210> 175 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 175 ctgagcactg ctctccgtga cccacactac tttgaaaaac cagacgcctt caatcctgac 60 cactttctgg atgccaatgg 80 <210> 176 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 176 aaaatgggag ttttctgttc catttcatca ggctctgaat ggcttccatc ctgcaccact 60 ctgtaccata agaacattaa 80 <210> 177 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 177 tttgggctct tcgctggcct tggtggagct ggtgccagca ccagtggcag ctctggtgcc 60 tgtggtttct cctacaagtg 80 <210> 178 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 178 accagacgga aaacccgttt ctgtgcacag tggttgccat cctcctccac tacatctaca 60 tgagcacctt tgcctggacc 80 <210> 179 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 179 tggagacttc atcctgggct actatagtca caaccacagc atcctcatcg gcatcactga 60 acccttccag atctcgctgc 80 <210> 180 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 180 tgagcagcaa gcgaatcacc atcaacaaga ttctgtccaa cgagagcctt gtgcaggaga 60 acctgtactt ccagcgctgc 80 <210> 181 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 181 ccctctggat gagtccgaga gagatggagg ctctgaggac caagtggaag acccagcact 60 aagtgagcct ggggaggaac 80 <210> 182 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 182 aaggcaatgg ctgtgcccta tcttctgaga agaaagttca gtaattccct gaaaagtcaa 60 ggtaaagatg atgattcttt 80 <210> 183 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 183 ctcggagcag cagcataagc tggacttcaa ggcatacgaa caggcactgc aatactcgcc 60 ttacggctct acgttgcccg 80 <210> 184 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 184 cagattcaga gtctgatatc ctgttgggca ttctggacaa cttggaccca gtcatgttct 60 tcaaatgccc ttccccagag 80 <210> 185 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 185 aatgtctagc aaatccaaaa agtgcaaaaa agtgcatgac tcactggagg acttccccaa 60 gaacagctcg tttaacccgg 80 <210> 186 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 186 gggcatctat ggccagtatc aactccttgg catcaagagc attggctttg aatggaatta 60 tccactagag gagccgacca 80 <210> 187 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 187 tgggcaagta tattctgctc atcaaatggt cattggctat gtactttgtg cagggaagta 60 cattatctac agtcacaaaa 80 <210> 188 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 188 cctttactgc ccctgcttaa cacggtcaag ttcctgctgc ttttctacct gaagaagctt 60 accctcttct ccacctgctc 80 <210> 189 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 189 tatgcttacg aacctgcaga tacagctctg ttgcttgaca acatgaagaa agctctcaag 60 ttgctgaaga ctgaattgta 80 <210> 190 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 190 ccaggatccc tggagtgcct tggtgtttca agcccctgac taggaagaca gaatgcacct 60 tctgaggcac ctccagctgc 80 <210> 191 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 191 tgccatagat gaattgaagg aatgttttct taaccaaacg gatgaaactc tgagcaatgt 60 tgaggtgttt atgcaattaa 80 <210> 192 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 192 gcttctacca ctgctcgtaa agacattcca gttttaccca aatgggttgg ggatctcccg 60 aatggtagag tgtgtccctg 80 <210> 193 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 193 acctgttcaa ggtgcagcga tactgtgaga agagcatgat cagcagaaag ctctttggat 60 tcactgaacg gtacggagca 80 <210> 194 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 194 cagctcatca ctgttgaaaa ggctttggca attctttctc agcctacacc ctcacttgtt 60 gtggatcatg agcgattaaa 80 <210> 195 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 195 catccagaga aagcacctta tgagtggaag aatttggatg gcatttccca tgcacctaat 60 gctgtgaaaa ccgcatttta 80 <210> 196 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 196 accctgagac tcccagatct tcaggttcta tgcgcaatag atggaaacca aacagcagca 60 aggtactagg gagatccccc 80 <210> 197 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 197 agcactctac acagtcacgg gacaaagctg gcctgaatca ttaatacgaa agactggata 60 taccctggaa agtcttaagc 80 <210> 198 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 198 gaataagtat gcaagcagca aactcctgaa gatcagcatg atccctcagc tgaactcaaa 60 agccgtcaaa gaccttgcct 80 <210> 199 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 199 ctctgtgtta ccaagaactg gctgtctgca gatactaaag aagagcggga tctctggatg 60 caaaaactca atcaagttct 80 <210> 200 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 200 gctgccgagc tctggaaaaa ccccacagct tttaagaagt acctgcaaga aacctactca 60 aagcaggtca ccagccagga 80 <210> 201 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 201 tgggttcatt acatgattca tgagccagaa ccacatattc ttctctttag acgacctctt 60 ccaaaagatc aacaaaaatg 80 <210> 202 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 202 agcctgcagc aagcactttg gagagcaaat ctgtgcagag agtaacgcgg agtgtcaaga 60 ggtgtgcaga aaatccaaag 80 <210> 203 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 203 gaaggcctgg tcctggacac aatgaatgac agcctcagca agatcctgct ggacatcagc 60 tttcctggcc tggacgagga 80 <210> 204 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 204 gacagagaag catgcaagac agaaacaaaa ggctgatgag gaagagatgc ttgataatct 60 accagaggct ggtgactcca 80 <210> 205 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 205 gaatggtttc tgcataccct cgacagctag agtcattaat ccgcttagca gaagcccatg 60 ctaaagtaag attgtctaac 80 <210> 206 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 206 taagagatca ttatccttgt gtgtcttcat tggaacagct aacggagttg ggaagagaaa 60 ctgatgcttt tgtatgccgc 80 <210> 207 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 207 ggactgcaga gaaggaactc ctctgaagca agctccggag acttcttaga tctgaaggga 60 gaaggtgata ttcatgaaaa 80 <210> 208 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 208 ctgtagagga agaggaagat caaaacgttg taccagaaac tacctctgaa ggctacactt 60 tccaagttca ggatggggct 80 <210> 209 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 209 ggcttctgaa ctggaattct gcagctaacc cttccacgac tagaacctta ggcattgggg 60 agttttagat ggactaattt 80 <210> 210 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 210 atctcaggac tctaaatact ctaacagctg tccagtgttg gtgattccag tggactgtat 60 ctctgtgaaa aacacaattt 80 <210> 211 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 211 catttggagt ataggcacca tatttgctga actagcaact aagaaaccac ttttccatgg 60 ggattcagaa attgatcaac 80 <210> 212 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 212 tccaatctgt tgcagtctcc ttcaagcatt ctgtcgaccc tggatgttga attgccacct 60 gtttgctgtg acatagatat 80 <210> 213 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemical synthesis <400> 213 cgcccaccaa gaaggaacat cagaaagcct gggctttgaa cctgaacggt tttgatgtag 60 aggaagccaa gatccttcgg 80 <210> 214 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 214 gaggaagacc aaaaagtcat cgagctggtt aagaagtatg gcacaaagca gtggacactg 60 attgccaagc acctgaaggg 80 <210> 215 <211> 80 <212> DNA <213> Artificial sequence <220> <223> Chemically synthesized <400> 215 tttgtggcag acagacttat gctggaactg ggttttagca aggttttcag agtagagaac 60 ccatttgact ttatggagaa 80

Claims

1. A gene expression analysis method, which is a gene expression analysis method for non-disease diagnosis purposes of a test sample of breast cancer tissue or normal breast tissue, wherein the test sample of the breast cancer tissue or normal breast tissue belongs to any breast cancer subtype selected from the group consisting of Luminal A, Luminal B / HER2 positive, Luminal B / HER2 negative, HER2 positive, HER2 positive-like, triple negative, phyllodes tumor, squamous cell carcinoma, undetermined, normal-like and normal, the method comprising the following steps: (a) a step of determining the expression level of a desired gene; (b) a step of determining the expression level of an internal standard gene, wherein the internal standard gene is at least one selected from the group consisting of ABCF3, FBXW5, MLLT1, FAM234A, PITPNM1, WDR1, NDUFS7 and AP2A1, and the internal standard gene can be used as an internal standard gene in breast cancer tissue or normal breast tissue belonging to any breast cancer subtype selected from the group consisting of Luminal A, Luminal B / HER2 positive, Luminal B / HER2 negative, HER2 positive, HER2 positive-like, triple negative, phyllodes tumor, squamous cell carcinoma, undetermined, normal-like and normal; (c) a step of normalizing the desired gene expression level using the internal standard gene expression level.

2. The gene expression analysis method according to claim 1, wherein The test sample is a sample from a breast cancer patient.

3. Use of the following genes as internal standard genes for gene expression analysis for non-disease diagnosis purposes in breast cancer tissue or normal breast tissue, wherein the breast cancer tissue or normal breast tissue belongs to any breast cancer subtype selected from the group consisting of Luminal A, Luminal B / HER2 positive, Luminal B / HER2 negative, HER2 positive, HER2 positive-like, triple negative, phyllodes tumor, squamous cell carcinoma, cannot be determined, normal-like and normal composition, and the genes consist of at least one gene selected from the group consisting of FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1, and can be used as internal standard genes in biological tissues from breast cancer tissue or normal breast tissue belonging to any breast cancer subtype selected from the group consisting of Luminal A, Luminal B / HER2 positive, Luminal B / HER2 negative, HER2 positive, HER2 positive-like, triple negative, phyllodes tumor, squamous cell carcinoma, cannot be determined, normal-like and normal composition.

4. The use as an internal standard gene according to claim 3, wherein the internal standard gene is used for gene expression analysis in a test sample from a breast cancer patient.

5. Use of the following genes as internal standard genes in a composition for expression analysis for non-disease diagnosis purposes, the composition for expression analysis for non-disease diagnosis purposes of the internal standard genes comprising a tool for determining the expression level of the internal standard gene used for gene expression analysis in breast cancer tissue or normal breast tissue, the breast cancer tissue or normal breast tissue belonging to any breast cancer subtype selected from the group consisting of Luminal A, Luminal B / HER2 positive, Luminal B / HER2 negative, HER2 positive, HER2 positive-like, triple negative, phyllodes tumor, squamous cell carcinoma, undeterminable, normal-like and normal, the internal standard gene consisting of at least one gene selected from the group consisting of FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1, and in the group consisting of Luminal A, Luminal B / HER2 positive, Luminal B / HER2 negative, HER2 positive, HER2 positive-like, triple negative, phyllodes tumor, squamous cell carcinoma, undeterminable, normal-like and normal, the internal standard gene consisting of at least one gene selected from the group consisting of FBXW5, PITPNM1, MLLT1, WDR1, ABCF3, NDUFS7, FAM234A and AP2A1, and in the group consisting of Luminal A, Luminal B / HER2 positive, Luminal Any biological tissue derived from breast cancer tissue or normal breast tissue of any breast cancer subtype in the group consisting of B / HER2 negative, HER2 positive, HER2 positive-like, triple negative, phyllodes tumor, squamous cell carcinoma, undetermined, normal-like and normal can be used as the internal standard gene.

Images