A method and apparatus for detecting live nuclear proteins
By delivering plasmid probes into the nucleus of living cells using a nano-electroporation molecular delivery method, and utilizing the nuclear localization and specific recognition region of the peptide probes, efficient and safe detection of proteins in the nuclear nucleus of living cells was achieved. This method solves the problems of low efficiency and poor accuracy in traditional methods and provides an analytical platform for the study of proteins in the nuclear nucleus of living cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIHANG UNIV
- Filing Date
- 2022-04-13
- Publication Date
- 2026-06-26
AI Technical Summary
Existing methods for analyzing proteins in the nuclear cavity of live cells cannot effectively cross the nuclear membrane for analysis. Traditional methods suffer from low efficiency, poor accuracy, and significant cell damage.
A nano-electroporation molecular delivery method was used to deliver plasmid probes into living cells. The plasmid probes were transcribed into peptide probes inside the cells, which entered the cell nucleus through nuclear localization signals and specific recognition regions, and were detected by releasing fluorescent signals through the merging of fluorescent proteins.
It achieves efficient, safe, and uniform detection of nuclear proteins in live cells, accurately identifies and tracks the expression of nuclear proteins, and correlates them with cell migration behavior, providing an analytical platform for the study of nuclear proteins in live cells.
Smart Images

Figure CN114689873B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioanalytical technology, specifically relating to a method and apparatus for detecting proteins in the nucleus of living cells. Background Technology
[0002] Nucleus proteins are primarily involved in gene regulation, translation, and expression. Abnormal changes in their expression levels are often associated with the occurrence or development of diseases, such as tumor formation and metastasis. Monitoring the dynamics of specific nuclear proteins in living cells and correlating them with cellular behavior can provide reliable evidence for deciphering the invasive behavior of cancer cells. However, analyzing proteins within the nucleus of living cells requires overcoming not only the cytoplasmic membrane barrier but also the protective nuclear membrane, which undoubtedly poses a significant obstacle to the study of proteins within the nucleus of living cells.
[0003] Traditional methods for analyzing proteins in the cell nucleus, including Western blot, ELISA, mass spectrometry, and immunoprecipitation, involve identifying proteins obtained after cell lysis, and therefore cannot analyze the behavior of living cells.
[0004] Currently, there are two main methods for analyzing proteins within the nucleus of live cells: methods based on small-molecule fluorescent dyes and methods dependent on plasmid expression. Small-molecule fluorescent dyes, through artificial synthesis and screening, can specifically label certain proteins. Due to their small molecular weight, these dyes easily cross the cell membrane's double barrier and enter the nucleus to label and track nuclear proteins. However, this method is limited by the scarcity of known small-molecule fluorescent dyes, restricting its ability to analyze proteins for which no specific small-molecule dyes are available. With the deepening research into biomolecular mechanisms, the structures and interactions between proteins are becoming increasingly clear. Based on this, plasmid expression-dependent protein analysis methods, which involve artificially delivering gene plasmids into cells to induce the expression of fluorescently tagged proteins for tracking, are the main technology for live-cell protein analysis. However, this also means that this method cannot label and identify the expression levels of pre-existing proteins within the cell. Furthermore, due to the large molecular weight of plasmids, additional delivery methods are often required to improve the efficiency of plasmid entry into the cell membrane. Commonly used plasmid delivery methods, such as liposomes, still face challenges in achieving efficient delivery. While extending the incubation time improves delivery efficiency to some extent, it also increases cell damage due to the use of harmful chemical reagents. Furthermore, the passive fusion of liposomes with the cell membrane leads to random drug delivery between cells, ultimately compromising the accuracy of protein expression level detection.
[0005] In summary, the present invention provides a technique for detecting proteins in the nucleus of live cells, aiming to alleviate at least one of the aforementioned problems. Summary of the Invention
[0006] In view of this, the present invention provides a method for detecting proteins in the nucleus of living cells, as detailed below.
[0007] A method for detecting proteins in the nucleus of live cells includes the following steps: 1) Plasmid probes P1 and P2 are delivered into live cells using a nano-electroporation molecular delivery method. Plasmid probe P1 carries a nuclear localization gene, a specific recognition gene 1, and a fluorescent protein gene 1, and plasmid probe P2 carries a nuclear localization gene, a specific recognition gene 2, and a fluorescent protein gene 2; 2) Plasmid probes P1 and P2 are transcribed into mRNA in the live cells and then further translated into polypeptide probes T1 and T2. Polypeptide probe T1 includes a nuclear localization signal region, a specific recognition region 1, and a fluorescent protein region 1, and polypeptide probe T2 includes a nuclear localization signal region, a specific recognition region 2, and a fluorescent protein region 2; 3) The nuclear localization signal region allows polypeptide probes T1 and T2 to enter the cell nucleus. The specific recognition regions 1 and 2 bind to the target protein, and the fluorescent protein regions 1 and 2 of the bound polypeptide probe merge into a complete fluorescent protein and release a fluorescent signal.
[0008] Furthermore, the target protein is a nuclear protein; the nuclear protein includes MDM2 and CDK2.
[0009] Furthermore, the nuclear localization signal regions of the polypeptide probes T1 and T2 include the full length and / or fragments thereof shown in SEQ ID NO.1.
[0010] SEQ ID NO.1:
[0011] GATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTA
[0012] Furthermore, the specific recognition regions of the polypeptide probes T1 and T2 may optionally include the full length and / or fragments thereof shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and / or SEQ ID NO.5.
[0013] SEQ ID NO.2:
[0014] CCTCTGAGCCAGGAGACATTTTCAGACCTGTGGAAACTACTT
[0015] SEQ ID NO.3:
[0016] ATGGTGCGCAGGTTCTTGGTGACCCTCCGGATTCGGCGCGCGTGCGGC
[0017] SEQ ID NO.4:
[0018] CCGGTGAAGCGGAGGCTGGACCTG
[0019] SEQ ID NO.5:
[0020] AGTGCTAAGAGAAGACTCTTTGGA
[0021] Furthermore, the delivery of nano-electroporated molecules can be provided by a nano-electroporated chip containing a nanoscale through-hole film.
[0022] Another aspect of the present invention provides an apparatus for detecting proteins in the nucleus of living cells, as detailed below.
[0023] An apparatus for detecting proteins in the nuclear cavity of live cells includes: 1) plasmid probes P1 and P2, wherein the plasmid probes P1 and P2 carry a nuclear localization gene, a specific recognition gene, and a fluorescent protein gene, wherein the specific recognition gene is transcribed and translated into the full length and / or fragments thereof shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and / or SEQ ID NO.5; and 2) a nanoelectroporation chip arranged to deliver the two plasmid probes into the interior of a live cell.
[0024] After the plasmid probe enters the cell, the cell itself transcribes it into mRNA, which is then translated into two polypeptide complexes, forming a combined probe. The combined probe, transcribed from the gene carried by the plasmid probe, contains three functional regions: a nuclear localization region, a specific recognition region, and a fluorescent protein region. Using the probe's nuclear localization signal sequence, the combined probe is delivered into the nucleus of a living cell. It binds to the target nuclear protein through the specific recognition polypeptide, and finally, the two fluorescent protein fragments merge to release a fluorescent signal, thus completing protein detection within the living cell nucleus.
[0025] The specific recognition region sequence is linked to the nuclear localization region sequence and the fluorescent protein fragment sequence; the specific sequence selection depends on the target nuclear protein to be detected, and it is designed based on the binding domains of other proteins that can specifically bind to the target nuclear protein; its function is to recognize and specifically bind to different sites of the target nuclear protein, thereby bringing the fluorescent protein fragments closer together and causing the fluorescent protein fragments to merge into a complete fluorescent protein.
[0026] Furthermore, the device also includes a cell migration microchannel arranged to track protein regulation and cell migration behavior within the nucleus of living cells.
[0027] Furthermore, the nanoelectroporation chip contains at least one thin film, which has a through-hole with a diameter of 800 nm for focusing an electric field, so as to achieve perforation of the cell membrane under the action of a pulsed electric field and accelerate the entry of the plasmid probe into the cell through the through-hole thin film and the perforated cell membrane.
[0028] Furthermore, the cell migration microchannels have a marker at equal intervals of length to identify cell locations.
[0029] As a preferred embodiment, the length is 20 μm.
[0030] Furthermore, the cell migration microchannel has a 1mm diameter vent at its end for regulating the ventilation within the microchannel. Specifically, this vent is closed during probe delivery and opens after probe delivery is complete, connecting the microchannel to the atmosphere. The number of vents corresponds to the number of cell migration microchannels.
[0031] Beneficial effects
[0032] This invention provides a technology and device for detecting proteins in the nucleus of live cells. By delivering a probe plasmid into a live cell, the cell itself transcribes the probe plasmid into mRNA, which is then further translated into a two-peptide probe combination. Using the nuclear localization signal sequence of this probe combination, the probe is delivered into the nucleus of the live cell. Furthermore, the peptides in its specific recognition region bind to the target nuclear protein. This binding brings the fluorescent protein fragment closer to the target protein, and finally, the two fluorescent protein fragments merge into a complete fluorescent protein to release a fluorescent signal (the presence of a single fluorescent protein cannot release a fluorescent signal), thus completing the detection of proteins in the nucleus of live cells.
[0033] Because plasmid probes have large molecular weights and negative charges that repel cell membranes, the device provided by this invention includes a nanoelectroporation molecular delivery chip, which offers advantages such as high delivery efficiency, safety, uniformity, and controllability, enabling the delivery of probe plasmids into living cells. This invention compared the delivery uniformity of nanoelectroporation molecular delivery (NEP) with that of liposomes, finding that the uniformity of cell fluorescence intensity after NEP delivery was significantly better than that after liposome delivery.
[0034] In addition, the device provided by the present invention also includes a cell-addressable microchannel, which can be used to observe and track the migration position of cells after plasmid probe delivery is completed in living cells, and simultaneously analyze the expression of nuclear proteins. The opening time of the microchannel can be uniformly controlled through the vent. The migration speed of cells can be estimated from the migration distance and time, and the mechanism by which nuclear proteins in living cells regulate cell migration behavior can be inferred.
[0035] In summary, the live cell nuclear protein detection technology and device provided by this invention offer a one-stop analysis platform for studying the expression level and function of live cell nuclear proteins, and have high universality and innovation. Attached Figure Description
[0036] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.
[0037] Figure 1 The following is a schematic diagram of the principle of the live cell nuclear protein detection technology in one embodiment of the present invention: 1. The probe plasmid is introduced into the cell using nanoelectroporation molecular delivery technology; 2. The probe plasmid is transcribed into mRNA in the cell nucleus; 3. The mRNA is translated into a combinatorial probe in the cytoplasm; 4. The combinatorial probe binds to the target protein in the cell nucleus and releases green fluorescence (NLS, nuclear localization signal).
[0038] Figure 2 A live cell nuclear protein detection device provided in one embodiment of the present invention: A is the overall structure of the device; B is a physical diagram of the device; C is an assembly diagram of the device;
[0039] Figure 3 This is a structural diagram of a nano-electroporated molecule delivery device provided in one embodiment of the present invention;
[0040] Figure 4 A shows the fluorescence ratio and delivery controllability of FITC-labeled plasmids delivered into A549 cells at different voltages;
[0041] Figure 4 B shows the fluorescence ratio and delivery controllability of FITC-labeled plasmids delivered into HeLa cells at different voltages;
[0042] Figure 5 A demonstrates the high delivery efficiency of the nanoelectroporation molecular delivery (NEP) device for delivering plasmid probes into living cells, as well as the high cell viability after delivery, compared to traditional liposome-based delivery methods.
[0043] Figure 5 B demonstrates the high delivery uniformity of the NEP device for plasmid probes into living cells compared to traditional liposome-based delivery methods.
[0044] Figure 6A shows fluorescent images of the combined probe specifically labeling the MDM2 protein in the cell nucleus: Control, cells not transfected with the probe plasmid; P1, cells delivered with P1 from the combined probe; P2, cells delivered with P2 from the combined probe; CP, cells delivered with the combined probe; +MDM2+CP, cells delivered with the MDM2 plasmid first to increase the level of MDM2 protein expression, then delivered with the combined probe; +siRNA+CP, cells delivered with the MDM2 siRNA first to decrease the level of MDM2 protein expression, then delivered with the combined probe.
[0045] Figure 6 B shows the results of statistical analysis of intracellular fluorescence intensity in 100 cells: Control, cells were not transfected with probe plasmid; +MDM2+CP, cells were first delivered with MDM2 plasmid to increase the level of MDM2 protein expression, and then delivered with the combined probe; +siRNA+CP, cells were first delivered with MDM2 siRNA to decrease the level of MDM2 protein expression, and then delivered with the combined probe.
[0046] Figure 7 This is a schematic diagram of the structure of a microfluidic channel for cell migration.
[0047] Figure 8 A shows images of A549 cells migrating in a microfluidic channel: A549, cells untransfected with probe plasmids; A549+MDM2, cells first delivered with MDM2 plasmid to increase MDM2 protein expression, then delivered with a combined probe.
[0048] Figure 8 B shows the statistical distribution of A549 cells and A549 cells with elevated MDM2 protein in the microchannel;
[0049] Figure 8 C shows that the cell migration velocity (CPR) estimated by the cell migration microchannel is consistent with the cell migration velocity obtained by traditional methods using MATLAB algorithms;
[0050] Figure 9 A shows fluorescence images of the combined probe specifically labeling CDK2 protein in the cell nucleus: Control, cells not transfected with the probe plasmid; P1, cells delivered with P1 from the combined probe; P2, cells delivered with P2 from the combined probe; CP, cells delivered with the combined probe; +CDK2+CP, cells delivered with CDK2 plasmid first to increase CDK2 protein expression, then delivered with the combined probe; +siRNA+CP, cells delivered with CDK2 siRNA first to decrease CDK2 protein expression, then delivered with the combined probe.
[0051] Figure 9B shows the results of statistical analysis of intracellular fluorescence intensity in 100 cells: Control, cells were not transfected with probe plasmid; +CDK2+CP, cells were first delivered with CDK2 plasmid to increase CDK2 protein expression level, and then delivered with the combined probe; +siRNA+CP, cells were first delivered with CDK2 siRNA to decrease CDK2 protein expression level, and then delivered with the combined probe. Detailed Implementation
[0052] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0053] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.
[0054] As used in this specification, the term "about" typically means + / -5% of the value, more typically + / -4% of the value, more typically + / -3% of the value, more typically + / -2% of the value, even more typically + / -1% of the value, and even more typically + / -0.5% of the value.
[0055] In this specification, certain embodiments may be disclosed in a range-bound format. It should be understood that this "range-bound" description is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of the range should be considered as having specifically disclosed all possible subranges and independent numerical values within those ranges. For example, range 1... The description of 6 should be considered as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within this range, such as 1, 2, 3, 4, 5, and 6. The above rules apply regardless of the breadth of the range.
[0056] Example 1
[0057] Expression analysis of MDM2 protein in live cell nuclei
[0058] Targeting the nuclear protein MDM2, which is highly associated with tumor cell metastasis, and selecting recognition polypeptide sequences from P53 and P14 proteins that can specifically bind to different sites of MDM2, a composite probe consisting of polypeptide complex 1 (P1) and polypeptide complex 2 (P2) was designed and prepared. Both P1 and P2 consist of three parts: (1) a nuclear localization signal (NLS); (2) a recognition polypeptide; and (3) a fragment of green fluorescent protein (GFP). Figure 1 The probe plasmid was delivered into the cell using a nanoporous molecular delivery device. The specific steps are as follows:
[0059] Step 1: Preparation of probe plasmids
[0060] Step 1.1: Based on the recognition of the MDM2 polypeptide sequence and nuclear localization signal sequence by P1 and P2, the corresponding DNA sequence is obtained and ligated to the pBIFC-VC155 vector and the pBIFC-VN173 vector, respectively.
[0061] The T1-specific recognition polypeptide sequence may optionally include:
[0062] .CCTCTGAGCCAGGAGACATTTTCAGACCTGTGGAAACTACTT
[0063] The T2-specific recognition polypeptide sequence may optionally include:
[0064] .ATGGTGGCCAGGTCTTGGTGACCCTCCGGATTCGGCGCGCGTGCGGC
[0065] Nuclear localization signal sequence:
[0066] GATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAAAGGTA
[0067] Step 1.2: Transform the probe plasmid into competent Escherichia coli (DH5α);
[0068] Step 1.3: Mix the bacterial culture containing the target plasmid with 250 mL of sterile Luria-Bertani medium (containing 50 μg / mL ampicillin) and incubate at 37°C for 16 hours;
[0069] Step 1.4: Centrifuge the bacterial culture at 4 ℃ and 6000 rpm / min for 15 minutes;
[0070] Step 1.5: Extract the target plasmid according to the instructions of the plasmid extraction kit (12362, QIAGEN);
[0071] Step 1.6: The concentration and purity of the obtained probe plasmid were detected using an enzyme-linked immunosorbent assay (ELISA) reader;
[0072] Step 1.7: The probe plasmid sequence was verified by Sanger sequencing.
[0073] Primer sequences:
[0074] pBIFC-VC155:
[0075] Forward primer: 5'- CGCAAATGGGCGGTAGGCGTG -3';
[0076] Reverse primer: 5'- GAAATTTGGTGATGCTATTGC -3'
[0077] pBIFC-VN173:
[0078] Forward primer: 5'- CGCAAATGGGCGGTAGGCGTG -3';
[0079] Reverse primer: 5'- CCAGCTTGGTTCCCAATAGA -3'
[0080] Through the above preparation steps and related verification, the target probe plasmid can be obtained.
[0081] Step 2: Preparation of the live cell nuclear protein detection device
[0082] Step 2.1: Design the mask using AutoCAD software and then further process and manufacture it.
[0083] Step 2.2: Spin-coat the cleaned silicon wafer with 20μm of negative photoresist (SU8 2025), bake at 65℃ for 3 minutes, and then bake at 95℃ for 5 minutes;
[0084] Step 2.3: Place the silicon wafer on the photolithography machine, align it with the mask, and expose it under ultraviolet light for 12 seconds;
[0085] Step 2.4: Bake the silicon wafer according to the program of 65℃ for 1 minute and 95℃ for 5 minutes;
[0086] Step 2.5: Place the silicon wafer in the developer (YB0163, Byano) and shake slowly for 3 minutes to obtain the formed microchannel mold;
[0087] Step 2.6: Mix the PDMS precursor silicone elastomer base and silicone elastomer curing agent evenly at a ratio of 10:1, pour the mixture into a mold, and cure at 80°C for 1 hour;
[0088] Step 2.7: Peel the PDMS off the mold to obtain the microchannel layer;
[0089] Step 2.8: The sealing layer and the liquid reservoir layer are prepared by drilling holes in the cured PDMS sheet using a punch.
[0090] Step 2.9: Prepare the probe inlet and outlet by drilling holes in the microchannel layer, sealing layer, and reservoir layer;
[0091] Step 2.10: Assemble the microchannel layer, nanoporous membrane (nanopore diameter, 800 nm), sealing layer, reservoir layer and electrode layer (ITO glass) using oxygen plasma bonding to complete the live cell nuclear protein detection device.
[0092] Through the above preparation steps, the following preparation is completed: Figure 2 The device shown is for detecting proteins in the nuclear cavity of live cells.
[0093] Step 3: Detection of intranuclear proteins in live cells
[0094] Step 3.1: Before cell seeding, disinfect the live cell nuclear protein detection device with 75% alcohol, and then irradiate it with ultraviolet light for 30 minutes;
[0095] Step 3.2: The cells to be inoculated are proliferated to 5 × 10⁶. 5 After reaching a cell / chip density, the probe plasmid (5 μg / mL) was injected into the reservoir chamber using a syringe pump. Figure 3 );
[0096] Step 3.3: Use a silver electrode as the positive electrode to connect to the culture medium around the cells, use the ITO glass at the bottom as the negative electrode, and then use an electroporation instrument to provide an external power source for cell electroporation and probe delivery;
[0097] Step 3.4: Electroporation instrument settings: Voltage, 30 volts; Pulse duration, 1 millisecond; Number of pulses, 200; Pulse interval, 0.1 seconds;
[0098] Step 3.5: After incubating the cells in a cell culture incubator at 37°C and 5% carbon dioxide concentration for 12 hours, the chip was placed on a confocal microscope for fluorescence imaging.
[0099] Through the above procedures, it can be confirmed that the fluorescence ratio exhibited by cells varies depending on the voltage at which FITC-labeled plasmids are delivered, indicating that the nanoelectroporation molecular delivery method (NEP) is controllable. Figure 4 A and Figure 4 B) The plasmid probe was successfully delivered into the nucleus of living cells with a delivery efficiency of over 85% and cell viability of over 90%. Figure 5 A). In contrast, commercially available liposomes have lower delivery efficiency (~80%) and higher cell damage (cell viability less than 70%). Figure 5 A). Furthermore, by randomly counting the fluorescence intensity of cells, the delivery uniformity of nanoelectroporation (NEP) and liposomes was compared, revealing that the uniformity of cell fluorescence intensity after NEP delivery was significantly better than that after liposome delivery. Figure 5 B). These data demonstrate that NEP exhibits superior performance in terms of efficiency, cell safety, uniformity, and controllability when delivering high molecular weight plasmids. Using NEP, a probe plasmid was first delivered into the cell; at this point, no green fluorescence was observed in the cell nucleus (B). Figure 6 A) indicates that the GFP fragment does not have the ability to emit fluorescence. However, after delivering the two probe plasmids to cells, green fluorescence appeared in the cell nucleus, confirming that the combined probe successfully located the cell nucleus, and that the GFP fragments on P1 and P2 merged into a complete fluorescent GFP. The combined probe detected a significant increase in fluorescence intensity in the nucleus of cells overexpressing MDM2, while the fluorescence intensity in the nucleus of cells knocked down by MDM2 siRNA was significantly weakened, indicating that the combined probe can specifically recognize the MDM2 protein in the cell nucleus (A). Figure 6 A and Figure 6 B).
[0100] Example 2
[0101] Regulation of cell migration behavior by intracellular proteins in living cells
[0102] The present invention provides a live-cell nuclear protein detection technology and device that maintains good cell viability while detecting nuclear proteins. Through marker-containing microchannels on the device, cell migration behavior can be observed and migration speed calculated, thereby inferring the role of live-cell nuclear proteins in regulating cell migration. In this embodiment, 40 markers are set in the microchannels, with dimensions as shown in the figure. Figure 7 As shown in the annotations. The specific implementation steps are as follows.
[0103] Steps 1-3 are the same as the operation steps in Example 1.
[0104] Step 4: Observation of cell migration behavior;
[0105] Step 4.1: After the cells have completed the delivery of the probe plasmid, they are incubated in the cell culture chamber on the chip for 12 hours;
[0106] Step 4.2: Use a fine needle to pierce the reserved ventilation area to open the microchannel, and continue to culture the cells on the chip for 24 hours;
[0107] Step 4.3: Place the chip in the live-cell workstation of the confocal microscope for cell imaging: In cell migration tracking, microchannel cells are photographed every 10 minutes under 488 nm excitation light and bright field of view;
[0108] Step 4.4: The obtained cell images were analyzed using ImageJ software, and the cell tracking data were analyzed using MATLAB software.
[0109] This embodiment uses A549 cells, a human non-small cell lung cancer cell line. Following the above procedures, it can be observed on the microarray that, within the same timeframe, MDM2-overexpressing cells, compared to control cells (cells without increased MDM2 protein expression), exhibited longer migration displacement. Figure 8 A). By dividing the markers into groups of 10 from the edge (starting point) of the intracellular detection zone to the ventilator of the microchannel, the position of the cell within the microchannel can be statistically determined. Figure 8 (B) Among them, more than 45% of MDM2-overexpressing cells migrated to 20-40 markers, while control cells only migrated to less than 20 markers, indicating that the migration ability of MDM2-overexpressing cells is enhanced. Based on the time spent in the migration observation area and the cell migration distance (number of markers passed × distance between two markers (100 μm), the cell migration speed was estimated, confirming that the migration speed of MDM2-overexpressing cells was significantly higher than that of control cells. This is comparable to the cell migration speed calculated by the MATLAB method, confirming the feasibility of assessing cell migration speed by simply counting the number of markers passed by cells within a specific time in this embodiment. Through the correlation analysis between MDM2 protein expression and cell migration speed, it can be further determined that the MDM2 protein expression level is positively correlated with cell migration speed. The above demonstrates that the live cell nuclear protein detection technology and device of this invention has the ability to analyze the mechanism by which nuclear proteins regulate cell migration behavior.
[0110] MDM2 is a protein expressed in the cell nucleus. Proteins in the cell nucleus are primarily involved in gene regulation, translation, and expression. Aberrant expression of specific nuclear proteins has been found to determine tumorigenesis, drug resistance, and metastasis. Monitoring the dynamics of target nuclear proteins in living cells and correlating them with cellular behavior can deepen our understanding of cellular attack behavior and its fate mechanisms.
[0111] Example 3
[0112] Detection and analysis of CDK2 protein in live cell nuclei
[0113] The specific recognition peptides of the CDK2 protein are derived from the E2F1 and p107 proteins, respectively. As a cyclin-dependent kinase, CDK2 can form a complex (A-CDK2) with cyclin A to regulate the cell cycle. Short peptides in the E2F1 and p107 proteins can bind to the A-CDK2 complex, thereby participating in cell cycle progression.
[0114] The specific recognition regions of the two polypeptide combo probes T1 and T2 may optionally include the full length and / or fragments thereof shown in SEQ ID NO.4 and SEQ ID NO.5.
[0115] SEQ ID NO.4:
[0116] CCGGTGAAGCGGAGGCTGGACCTG
[0117] SEQ ID NO.5:
[0118] AGTGCTAAGAGAAGACTCTTTGGA
[0119] The procedure for detecting CDK2 protein is similar to that for MDM2, and the results are as follows: Figure 9 As shown.
[0120] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention. sequence list <110> Beijing University of Aeronautics and Astronautics <120> A method and device for detecting intranuclear proteins in live cells <140> 2022103849170 <141> 2022-04-13 <160> 5 <170> SIPOSequenceList 1.0 <210> 1 <211> 72 <212> DNA <213> artificial sequence <220> <223> unknown <400> 1 60. sightseeing sightseeing aagagaaagg ta <210> 2 <211> 42 <212> DNA <213> artificial sequence <220> <223> unknownl <400> 2 cctctgagcc aggagacatt ttcagacctg tggaaactac tt <210> 3 <211> 48 <212> DNA <213> artificial sequence <220> <223> unknown <400> 3 atggtgcgca ggttcttggt gaccctccgg attcggcgcg cgtgcggc <210> 4 <211> 24 <212> DNA <213> artificial sequence <220> <223> unknown <400> 4 ccggtgaagc ggaggctgga cctg <210> 5 <211> 24 <212> DNA <213> artificial sequence <220> <223> unknown <400> 5 agtgctaaga gaagactctt tgga 24
Claims
1. A method for detecting intranuclear proteins in live cells and observing cell migration behavior for non-diagnostic purposes, characterized in that, The method is based on a device for detecting proteins in the nuclear cavity of live cells, the device comprising: 1) Plasmid probes P1 and P2, wherein plasmid probe P1 carries a nuclear localization gene, a specific recognition gene 1, and a fluorescent protein gene 1, and plasmid probe P2 carries a nuclear localization gene, a specific recognition gene 2, and a fluorescent protein gene 2; plasmid probes P1 and P2 are transcribed and translated into polypeptide probes T1 and T2 in living cells, wherein polypeptide probe T1 includes a nuclear localization signal region, a specific recognition region 1, and a fluorescent protein region 1, and polypeptide probe T2 includes a nuclear localization signal region, a specific recognition region 2, and a fluorescent protein region 2, wherein the specific recognition region 1 and the specific recognition region 2 are transcribed and translated from the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 or SEQ ID NO. 4 and SEQ ID NO. 5, respectively; 2) A nanoelectroporation chip, configured to deliver the two plasmid probes into living cells; The device also includes a cell migration microchannel arranged to track protein regulation and cell migration behavior within the nucleus of living cells; the cell migration microchannel has a marker at equal intervals to identify cell location; the cell migration microchannel has a vent hole with a diameter of 1 mm at its end; The method includes the following steps: 1) Plasmid probes P1 and P2 were delivered into living cells using a nano-electroporation molecular delivery method; 2) The plasmid probes P1 and P2 are transcribed into mRNA in the living cells, and then further translated into polypeptide probes T1 and T2; 3) The nuclear localization signal region enables the polypeptide probes T1 and T2 to enter the cell nucleus. The specific recognition region 1 and specific recognition region 2 bind to the target protein, respectively. The fluorescent protein region 1 and fluorescent protein region 2 of the bound polypeptide probe merge into a complete fluorescent protein and release a fluorescent signal. 4) Pierce the ventilation hole to open the microchannel, and the live cells continue to be cultured on the device; 5) Observe cell migration behavior.
2. The method as described in claim 1, characterized in that, The target protein is a protein expressed in the cell nucleus; the protein expressed in the cell nucleus includes MDM2 and CDK2.
3. The method as described in claim 1, characterized in that, The nuclear localization signal regions of the polypeptide probes T1 and T2 are obtained by transcription and translation of the sequence shown in SEQ ID NO.
1.
4. The method as described in claim 1, characterized in that, The nanoelectroporation chip contains at least one thin film with a through-hole of 800 nm in diameter for focusing an electric field, so as to achieve perforation of the cell membrane under the action of a pulsed electric field and accelerate the entry of the plasmid probe into the cell through the through-hole thin film and the perforated cell membrane.
5. The method as described in claim 1, characterized in that, The vent is used to regulate the ventilation state within the microchannels of the device.