1166 results about "Aptamer" patented technology

The invention provides a nucleic acid aptamer for specific recognition of morphine and application of the nucleic acid aptamer, and belongs to the technical field of biosensing and detection. The nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO: 1. The screening method is based on a Capture-SELEX technology and comprises the key steps that streptavidin magnetic beads are used for fixing an ssDNA library, estradiol, deabietic acid and totarol are introduced to serve as reverse screening substances so as to remove non-specific sequences, and finally the high-specificity aptamer is obtained through high-throughput sequencing and affinity determination. The dissociation constant of the aptamer and morphine is 127.31 nM, and the aptamer shows high affinity and high specificity. The invention further relates to application of the aptamer in preparation of a sensor and a kit for detecting morphine, and a new technical means is provided for rapid detection of morphine.

The invention discloses a method for detecting the concentration of cyclosporine in blood through fluorescence and electrochemical double signals, and belongs to the technical field of biochemical analysis and medical detection. Aiming at the technical problems of insufficient sensitivity and high false positive rate of traditional single-signal detection of blood concentration of cyclosporine, the method comprises the following steps: activating carboxyl microspheres by a coupling agent, fixing double-stranded DNA (deoxyribonucleic acid) formed by a cyclosporine aptamer and an initiator chain, inducing the initiator to release by using a cyclosporine sample, realizing strand displacement through an A2-PEI composite system, and detecting the blood concentration of cyclosporine by using an A < 2 >-PEI composite system. DNA modified cadmium telluride quantum dots are respectively adopted to detect fluorescence signals, eATRP electrochemical signal amplification is carried out to detect electrochemical signals, concentration values obtained by the two signals are verified, and an average value is taken as a result. The method can accurately capture low-concentration cyclosporine signals in blood, eliminates interference of a single method, is mainly used for accurately monitoring the blood concentration of cyclosporine, and provides a reliable detection means for medication safety and curative effect control of cyclosporine in clinical scenes such as organ transplantation.

The invention discloses a staphylococcus aureus biosensor based on a nucleic acid aptamer and a preparation method of the staphylococcus aureus biosensor. Three fluorine atoms (F) are introduced into the 5'end, the 3 'end and the middle position of an aptamer 2' F3-(5 '3'm DNA) sequence (SEQ ID NO: 1) for modification, so that the binding force of the aptamer and graphene is remarkably enhanced, the signal stability and the anti-interference capability of the biosensor are remarkably improved, non-specific fluorescence leakage can be effectively blocked, and reliable guarantee is provided for complex sample detection. According to the present invention, with the cooperation of the graphene oxide quenching substrate, the high-sensitivity detection of the staphylococcus aureus is achieved, the detection limit of the sensor within 5 min can achieve 5 cells / mL, the sensitivity is high, the specificity on the complex sample is more than 95.4%, and the sensor is suitable for the food safety rapid screening and the clinical diagnosis.

The invention belongs to the technical field of immunoassay and biosensing detection, and particularly relates to a preparation method and application of an antibiotic electrochemical luminescence sensor based on a double-enhancement strategy. According to the invention, a bifunctional metal organic gel is used as a substrate, a graphite-phase carbon nitride quantum dot is used as a luminous body, and a self-assembly split aptamer walker is combined to construct the electrochemical luminescence sensor for sensitive detection of antibiotics. The sensor has the advantages of extremely high specificity and sensitivity, wide detection range, low detection limit and strong anti-interference performance, and has important scientific significance and application value in detection of antibiotic residues in the environment.

The invention discloses a neutralizing nucleic acid aptamer for targeted inhibition of a B cell activating factor and application of the neutralizing nucleic acid aptamer in treatment of systemic lupus erythematosus. The neutralizing aptamer disclosed by the invention can be used for efficiently inhibiting the combination of BAFF and specific receptors on a B cell membrane, including a BAFF receptor (BAFF-R), a human calcium regulatory cyclophilin ligand interaction molecule (TACI) and a B cell maturation antigen (BCMA), so that the proportion of plasma cells, plasma mother cells and hair growth center B cells is reduced, and finally, the generation and secretion of autoantibodies are reduced; the compound has a targeted therapeutic effect on systemic lupus erythematosus. Compared with an existing biological agent for neutralizing BAFF, the neutralizing nucleic acid aptamer has the advantages of being high in specificity, high in affinity, easy to synthesize, low in immunogenicity, low in cost, capable of being designed and programmed and the like, is a potential novel nucleic acid preparation for SLE targeted therapy, and has a good clinical transformation application prospect.

The application discloses a malachite green label-free proportional biosensor based on multi-dimensional cutting aptamer, which comprises the following steps: (1) a performance-improved malachite green aptamer sequence; (2) a label-free proportional malachite green sensor sequence; and (3) malachite green detection. The biosensor is constructed by using various aptamer sequences, and the ideal sensing effect can be realized through the competition balance principle. The label-free proportional sensor can present a good linear relationship in the range of 5nM-4muM, and has a low detection limit of nanomolar level, which indicates that the sensor has good malachite green detection potential and can meet the application requirements.

The invention discloses a preparation method and application of a photo-thermal biosensor for tumor cell quantification and vitality dual-index liquid biopsy. Phosphatidylserine (PS) is exposed by enriching and cracking tumor cells, is identified and combined by an aptamer Apt2, and is driven to be separated from Apt2-Cu2-xTe NSs; after magnetic separation, separated supernatant is subjected to photo-thermal detection; the photo-thermal signal intensity is positively correlated with the number of cells, so that quantitative detection is realized; during cell apoptosis, PS is turned out of the membrane, Apt2-Cu2-xTe NSs is combined with the surface of the membrane, separated supernatant is subjected to photo-thermal detection after magnetic separation, and the photo-thermal signal enhancement amplitude is in negative correlation with cell activity. The platform has the advantages of POCT characteristics, low cost and portability, and a new tool is provided for precise tumor diagnosis and treatment.

The invention provides a nucleic acid aptamer and a screening method thereof, the aptamer is of an oligonucleotide DNA structure, the nucleotide sequence of the nucleic acid aptamer is the nucleotide sequence of any DNA fragment as shown in SEQ ID NO: 1-9, and the nucleic acid aptamer can specifically target cardiac muscle cells (CMs). According to the invention, a new strategy can be provided for clinical treatment of cardiovascular diseases, and meanwhile, bioactive molecules such as microRNA (miRNA), small interfering RNA (small interfering RNA, siRNA), lipidosome, microspheres, microcapsules and the like can be carried to be used as an intracellular drug delivery tool.

The invention relates to a nucleic acid aptamer for specifically recognizing tilmicosin as well as screening and application of the nucleic acid aptamer, and belongs to the technical field of food safety detection and biosensing. Aiming at the defects of the existing method for detecting tilmicosin residues in food, the invention provides a high-affinity and high-specificity nucleic acid aptamer obtained by screening based on a graphene oxide index enrichment ligand systematic evolution technology. The aptamer is obtained by multiple rounds of screening from a random single-stranded DNA library through a GO-SELEX technology, and a core sequence Apt-2-1 with the length of 33 nt is finally obtained through sequence analysis and structure optimization. The aptamer shows excellent binding capacity to tilmicosin, the dissociation constant reaches 9.82 nM, and the aptamer has good specificity. The nucleic acid aptamer provided by the invention can be used for constructing a rapid and sensitive tilmicosin residue detection method, and has important application value in monitoring of livestock and poultry products and food safety.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention belongs to the technical field of biological medicine, and particularly relates to an LYTAC molecule for targeted degradation of GPC3 and a preparation method and application of the LYTAC molecule. The LYTAC molecule is composed of a target TfR1 nucleic acid aptamer and a target GPC3 nucleic acid aptamer, wherein the nucleotide sequence of the targeted TfR1 nucleic acid aptamer is as shown in SEQ ID NO: 1; the nucleotide sequence of the targeted GPC3 nucleic acid aptamer is as shown in SEQ ID NO: 2. According to the present invention, the research results show that the GPC3 protein content is not affected by the single TfR1 nucleic acid aptamer or the GPC3 nucleic acid aptamer, and the LYTAC molecule can significantly reduce the GPC3 protein content on the surfaces of Hep3B and HepG2 cells. The LYTAC molecule induces GPC3 protein degradation through a lysosome way, then proliferation and migration of liver cancer cells are inhibited, liver cancer treatment is achieved, and the LYTAC molecule has wide application prospects.

The invention discloses light-driven toxin-enriched composite hydrogel as well as a preparation method and application thereof. The composite hydrogel comprises light-driven hydrogel and detection hydrogel, the light-driven hydrogel is agarose hydrogel doped with Au (at) Ag core-shell nano particles; the detection hydrogel is a double strand formed by an okadaic acid aptamer and a complementary sequence cDNA thereof, and a double strand formed by a domoic acid aptamer and a complementary sequence DNAzyme thereof, the hairpin H1 is used for modifying a quenching group BHQ2 at the 3'end, the hairpin H2 is used for modifying a fluorophore Cy3 at the neck part, the hairpin H3 is used for modifying a fluorophore FAM and a quenching group BHQ1 at the two ends respectively, and the metal ion doped agarose hydrogel is used for catalyzing DNAzyme cyclic shearing; and the photo-thermal driving unit is positioned on the detection function unit. According to the present invention, with the composite system of upper layer photo-thermal enrichment and lower layer dual-signal detection, the rapid and high-sensitivity simultaneous detection of the okadaic acid and the domoic acid is achieved through the combination of the photo-thermal transpiration effect and the HCR and DNAzyme cyclic shearing reaction;

The invention discloses a modular fluorescent RNA aptamer biosensor system, and relates to the field of medicine. Comprising a probe module, an enzyme system, a dye and a reaction buffer solution, the probe module comprises a promoter probe P and a reporter probe R, the enzyme system comprises SplintR ligase and T7RNA polymerase, and the reaction buffer solution comprises a transcription buffer solution and a SplintR ligase buffer solution. The promoter probe P comprises a T7 promoter sequence and a 5 '-phosphorylated upstream recognition region, and the length of the promoter probe P is 10nt. According to the present invention, the ligase-assisted probe assembly and the T7RNA polymerase-mediated fluorescent RNA aptamer transcription are integrated, the simultaneous detection of the multiple circRNA can be achieved without the complex probe labeling, the femtomole-level sensitivity and the excellent single base mutation distinguishing ability in the complex sample are provided, and the real-time fluorescence instrument and the portable device are adapted.

The invention belongs to the technical field of bioengineering, and particularly relates to a nucleic acid aptamer specifically bound with MMLV, and the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO.1 or SEQ ID NO.2; the nucleic acid aptamer capable of being specifically bound with MMLV is obtained through screening on the basis of the SELEX technology, has high affinity for MMLV protein, can be applied to MMLV protein enrichment reagents, MMLV protein separation reagents, MMLV protein detection reagents, test paper and biosensors, and facilitates identification and activity research of the MMLV protein.

The invention discloses a nucleic acid aptamer TET-HeR of tetracycline and application of the nucleic acid aptamer TET-HeR, and belongs to the technical field of nucleic acid aptamers. The nucleic acid aptamer TET-HeR of the tetracycline is a combination of an aptamer TET-A1 and an aptamer TET-C1, the nucleotide sequence of the aptamer TET-A1 is as shown in SEQ ID NO.5, and the nucleotide sequence of the aptamer TET-C1 is as shown in SEQ ID NO.7. The nucleic acid aptamer TET-HeR of the tetracycline is a combination of the aptamer TET-A1 and the aptamer TET-C1. The invention further discloses the application of the nucleic acid aptamer TET-HeR of the tetracycline in detection of the tetracycline. The affinity and dissociation constant of the nucleic acid aptamer TET-HeR of the tetracycline and the tetracycline is 62.7 nM, and the nucleic acid aptamer TET-HeR of the tetracycline has high affinity; the compound has no obvious affinity to tetracycline analogues such as aureomycin and doxycycline, has weak affinity to oxytetracycline, and has good specificity; the method can be used for specific detection of tetracycline.

Described herein are variations of a sensor configured to generate a signal that is indicative of a concentration of an analyte in a fluid. The sensor may include a working electrode comprising an electrode material, a biorecognition layer disposed at least partially on the electrode material and comprising a biorecognition element that selectively and reversibly binds to an analyte, and an at least partially desiccated hydrogel disposed on the biorecognition layer. In some variations, the biorecognition element may be functionalized with a redox-active molecule and is configured to change conformation upon binding the analyte to move the redox-active molecule, closer to, or further from, the electrode material. In some variations, the biorecognition element may be an aptamer.

The invention discloses a fluorescent / colorimetric dual-mode paper-based sensor for detecting cadmium ions in rhizoma polygonati as well as a preparation method and application of the fluorescent / colorimetric dual-mode paper-based sensor, and belongs to the technical field of detection of heavy metal residues in food with homology of medicine and food. PEI-UCNPs and PtNPs are loaded on a paper base and are mixed and reacted with Apt-AMNPs (at) TMB, H2O2, a PBS buffer solution and a solution containing Cd < 2 + >. The Aptamer specifically recognizes and captures Cd < 2 + >, so that the Apt-AMNPs (at) TMB is dissociated, and the TMB is released from holes of the AMNPs; the PtNPs on the paper base catalyzes colorless TMB (Tetramethylbenzidine) to generate blue oxide (oxTMB) under the action of H2O2, and the oxTMB can quench up-conversion fluorescence of PEI-UCNPs through fluorescence inner filtration. When the fluorescence / colorimetric dual-mode paper-based sensor is used for detecting the content of cadmium ions in rhizoma polygonati, the fluorescence / colorimetric dual-mode paper-based sensor has the characteristics of simplicity and convenience in operation, low detection cost, rapidness, specificity, sensitivity, portability and the like, and the fluorescence / colorimetric dual-mode paper-based sensor can be applied to on-site detection of the cadmium ions in rhizoma polygonati.

The invention provides a portable up-conversion aptamer sensor capable of rapidly detecting oxycodone in real time. According to the technical scheme, the preparation method comprises the following steps: S1, preparing up-conversion nanoparticles; s2, carrying out surface functionalization on the up-conversion nanoparticles; and S3, selection and modification of an aptamer. The invention provides a portable up-conversion aptamer sensor for rapidly detecting the content of oxycodone in real time, and the portable up-conversion aptamer sensor can be used for rapidly and visually detecting oxycodone in real time and can be used for detecting the content of oxycodone in urine.

The invention provides a DNA enzyme triple-helix molecular switch detection system adaptive to a personal glucometer as well as a preparation method and application of the DNA enzyme triple-helix molecular switch detection system, and belongs to the technical field of biosensors. The DNA enzyme triple-helix molecular switch disclosed by the invention comprises an aptamer containing two nucleotide arm segments and DNA enzyme covalently coupled with a magnetic bead, two nucleotide arm segments of the aptamer and DNA enzyme form a triple helix structure; the two nucleotide arm segments comprise a nucleotide sequence SEQ ID NO.1 at the 5'end of the aptamer and a nucleotide sequence SEQ ID NO.2 at the 3 'end of the aptamer. According to the invention, the flexibility of an original aptamer is limited by using a terminal fixation strategy, the spatial conformation of the original aptamer is stabilized, the affinity of the aptamer to a target is improved, and the sensitivity of the aptamer to the target is improved by using a triple-helix molecular switch containing DNA enzyme and nano-enzyme-gold nanoparticles. Accurate and sensitive detection of trace pollutants in food is realized by measuring the reduction amplitude of the glucose concentration in the detection liquid through a household glucometer.

The invention discloses a divalent nucleic acid aptamer fluorescence detection method based on an exonuclease I auxiliary target circulation strategy, and belongs to the field of analysis and detection.The divalent nucleic acid aptamer is a repetitive sequence composed of two monovalent nucleic acid aptamers and can form double-stranded DNA through base complementary pairing with complementary strand cDNA of the divalent nucleic acid aptamer, and the divalent nucleic acid aptamer can be used for fluorescence detection of the divalent nucleic acid aptamer. The method comprises the following steps: taking a bivalent nucleic acid aptamer as a template, forming a DNA silver nanocluster (DNA-AgNCs) under the action of silver nitrate and sodium borohydride, and when the target okadaic acid exists, combining the bivalent nucleic acid aptamer with the target, so that cDNA can be replaced from double-stranded DNA by the target. Exonuclease I is added to perform enzyme digestion on the cDNA and the divalent nucleic acid aptamer, so that the fluorescence intensity of the DNA-AgNCs can be rapidly reduced. The content of the okadaic acid can be judged by detecting the change of the fluorescence intensity. The invention provides a simple, convenient, rapid, high-sensitivity and high-specificity detection method for okadaic acid detection based on a divalent nucleic acid aptamer for the first time.

The invention relates to the technical field of food safety detection, in particular to a food crop pathogenic mycotoxin detection method based on double signal amplification. The core of the method is a section of linear lock-type probe containing a mycotoxin specific nucleic acid aptamer, under the condition that target mycotoxin exists in a sample, the aptamer is combined with the mycotoxin, the probe is induced to generate conformational change, and the probe is closed into annular DNA under the catalysis of DNA ligase; then, the circular DNA is used as a template, isothermal rolling circle amplification is carried out through Phi29 DNA polymerase, and a long-chain DNA product containing a large number of repetitive sequences is generated; subsequently, the long-chain product is used as a molecular scaffold, and two kinds of gold nanoparticles of which the surfaces are modified with different complementary probes are cross-linked at the same time, so that the nanoparticles are quickly gathered, the color of the solution is changed from wine red to blue or purple, and convenient visual detection is realized. The method has the outstanding advantages of ultrahigh sensitivity, rapid detection and the like, and is suitable for on-site rapid screening of mycotoxin pollution.

The invention belongs to the field of detection, and particularly relates to an electrochemical sensing platform for detecting lead ions and malathion as well as a preparation method and a detection method of the electrochemical sensing platform. The preparation method of the electrochemical sensing platform comprises the steps of designing a three-chain DNA compound, preparing a gold nanoparticle electrode, preparing the electrochemical sensing platform and the like. The electrochemical sensing platform realizes dual detection of lead ions (in a signal enhancement mode) and malathion (in a signal weakening mode) through specific recognition of DNAzyme and an aptamer on the basis of a three-chain DNA compound and a gold nanoparticle electrode. The method has the advantages of no label, high sensitivity (the detection limits respectively reach 5.42 pM and 0.34 pM), strong anti-interference capability and good stability, and is suitable for rapid detection of trace pollutants in environment and food samples.

The invention relates to an aptamer specifically combined with beta-lactoglobulin and application of the aptamer, and belongs to the technical field of biological detection. According to the aptamer and the preparation method thereof, a binding domain base, participating in recognition, of the aptamer is predicted through molecular docking firstly, then the binding domain base is subjected to directional mutation, the aptamer with the recognition performance improved is obtained, the affinity of the aptamer to beta-lactoglobulin is 10.6 nM, and the aptamer has no recognition capacity on alpha-lactalbumin, casein, bovine serum albumin, immune globulin G, lactose and the like and can be used for preparing the aptamer with the recognition performance improved. Therefore, the aptamer disclosed by the invention has good sensitivity and specificity on the beta-lactoglobulin. On the basis, a fluorescence polarization method is directly constructed by utilizing the characteristic that the beta-lactoglobulin is a biomacromolecule, when the beta-lactoglobulin exists, an aptamer marked by a fluorophore FAM recognizes the beta-lactoglobulin to form an aptamer beta-lactoglobulin compound, and the fluorescence polarization value is relatively large, so that the beta-lactoglobulin compound can be used for identifying the beta-lactoglobulin. Therefore, the specific detection of the low-concentration beta-lactoglobulin is realized.

The invention discloses an aptamer-modified lipid nano delivery platform as well as a preparation method and application thereof, and belongs to the field of biomedicine. The platform is prepared by taking DPPC, DOTAP and cholesterol as basic lipid components, Ce6 as a sound-sensitive agent and Flt3L as an immune agonist, controlling the particle size through gradient extrusion, and coupling cholesterol with an EpCAM aptamer for surface modification. The method has the core advantages that active targeting enrichment of tumors is realized by virtue of the aptamer, tumor cell immunogen cell death (ICD) is induced in combination with a sonodynamic therapy (SDT), and damage-related molecular patterns (DAMPs) are released; meanwhile, Flt3L is released in a tumor microenvironment, collection and activation of type 1 classical dendritic cells (cDC1) are specifically promoted, an'endogenous cDC1 vaccine 'is constructed, and CD8 + T cell mediated anti-tumor immune response is enhanced. Experiments prove that the platform can significantly improve the cDC1 infiltration level of a tumor site, effectively inhibit the progress of prostate cancer (PCa), and provide a new normal form for immune'cold tumor 'treatment.

The invention relates to the isolation and characterisation of one or more aptamers against staphylococcal C-S lyase. The invention also provides aptamers, aptamer-conjugates, and minimal functional fragments thereof which may be used to inhibit the activity of said lyases and thereby inhibit Staphylococcus associated malodour.

The invention designs a preparation method of a magnetic molecular imprinting-aptamer sandwich fluorescence sensor for detecting kanamycin. And the magnetic molecular imprinting composite material Fe3O4 (at) UiO-66 (at) MIP with a specific adsorption target object KANA is prepared. When a detection target object KANA exists, the Fe3O4-coated UiO-66-coated MIP can rapidly and specifically capture the KANA in a short time. Then, a DNA single-stranded aptamer marked with FAM is added, after the aptamer and KANA captured on the surface of the Fe3O4 at-UiO-66 at-MIP are subjected to specific recognition and magnetic separation again, an aptamer probe can enter sediment along with the magnetic composite material Fe3O4 at-UiO-66 at-MIP, the fluorescence intensity of supernate is reduced, and quantitative analysis is conducted according to the fluorescence difference value delta F. When the KANA does not exist, the aptamer cannot enter the precipitate, so that the fluorescence signal intensity is not changed. Double recognition is formed through specific binding of an MIP imprinting cavity and the aptamer, matrix interference is reduced by means of fluorescence characteristics and magnetic separation capacity, the method has the advantages of being high in adsorption capacity, specific in recognition, high in sensitivity, wide in detection range, good in selectivity and the like, and rapid and accurate detection of KANA in a complex sample can be achieved.

The invention relates to the field of veterinary drug residue detection, in particular to a fluorescence sensor based on DNA molecular machine mediated split Cas12a and application of the fluorescence sensor to ofloxacin detection, the fluorescence sensor comprises a system A, a system B and a system C. According to the final concentration of each system, the system A comprises an AP / CP double-stranded compound and a 20 mM Tris-HCl buffer solution 1, the system B comprises a double-stranded compound, an sRNA probe and a 10 mM Tris-HCl buffer solution 2, and the system C comprises a DNA molecular machine mediated split Cas12a. The system C comprises a Cas12a / hRNA compound, a pDNA / psG43 signal probe, ThT and a 20 mM Tris-HCl buffer solution; aP in the AP / CP double-chain compound is an aptamer of ofloxacin, and AP and CP in the AP / CP double-chain compound are paired and connected through complementary base pairing; the sequences of AP, CP, PS, SS, sRNA, hRNA, pDNA and psG43 are respectively as shown in SEQ ID NO.1-SEQ ID NO.8. The invention also discloses a kit for detecting the content of the protein. According to the application, the nucleic acid aptamer of ofloxacin is utilized, based on a DNA molecular machine and SCas12a as a signal amplification technology and sulfo-modified G43 as a fluorescent signal probe, even if the content of ofloxacin in a sample is extremely low, detection can be accurately realized.

The invention discloses an engineered artificial vesicle and application of the engineered artificial vesicle in multiple in-situ detection of urine exosome miRNA, and belongs to the field of biosensors. The method comprises the following steps: constructing planar framework nucleic acid simultaneously modified with cholesterol and an aptamer through annealing reaction; a molecular beacon with a fluorophore is designed according to a target gene sequence, and the molecular beacon and a double-strand specific nuclease (DSN) system are jointly encapsulated in an artificial vesicle; the engineered artificial vesicles and a sample to be detected are incubated, the fluorescence modified molecular beacons can specifically recognize target genes, cyclic cutting and signal amplification are achieved under DSN mediation, and the broken molecular beacons release fluorescence signals; all fluorescence signals in the vesicles are collected through a fluorescence imaging technology, and a characteristic fluorescence spectrum of the to-be-detected sample is obtained. According to the present invention, the miRNA heterogeneity analysis at the single vesicle level and the precise multi-target detection of bladder cancer and other diseases can be achieved, and the problems of low throughput, target number limitation and the like of the existing vesicle in-situ detection are effectively overcome.

The present disclosure provides an aptamer capable of inhibiting the activity of a strand-displacing DNA polymerase, the aptamer including: an oligonucleotide region 1 comprising a sequence in which a sequence X1a is linked to the 3'-end of a first sequence or the sequence X1a is linked to the 3'-end of a mutant sequence of the first sequence; and an oligonucleotide region 2 comprising a sequence in which a sequence X1b is linked to the 5'-end of a second sequence or the sequence X1b is linked to the 5'-end of a mutant sequence of the second sequence. The present disclosure also provides: a composition and a kit each containing the aptamer; and a method for amplifying a nucleic acid using the composition or the kit.

The invention discloses a liver cancer diagnostic kit for sequencing by combining a DNA logic gate with an aptamer, belongs to the field of diagnostic kits, and particularly relates to an AND gate logic operation double strand consisting of DNA sequences of cT1, cT2, cT35 and I, and an amplification reagent containing S-II, W, F, F-Cy5, M1 and M1-Cy3 based on entropy driven amplification reaction. After the PBMC is extracted from whole blood, the kit can be used for logically analyzing whether target proteins corresponding to the aptamers Apt51, GR-30 and IBA exist on the PBMC at the same time or not, so that early screening of the liver cancer is realized. A specific target of a liver cancer patient is found through aptamer single-cell high-throughput sequencing, and the kit can effectively distinguish healthy people from cancer patients.