1809 results about "Aptamer" patented technology

Described herein are variations of an analyte monitoring system, including an analyte monitoring device. For example, an analyte monitoring device may include a skin-penetrating microneedle array for use in measuring analyte, such as in a continuous manner. The microneedle array may include, for example, at least one microneedle comprising a working electrode comprising an analyte-sensing aptamer that selectively and reversibly binds to analyte. The working electrode comprises at least one thiol-based passivation molecule that provides protection of the working electrode from, by way of example, foulants and interferents. For example, a sensor may be configured to generate a signal that is indicative of a concentration of an analyte in a fluid, the sensor comprising a working electrode comprising an electrode material, a biorecognition layer disposed at least partially on the electrode material and comprising a biorecognition element that selectively and reversibly binds to an analyte, and an at least partially desiccated hydrogel disposed on the biorecognition layer. For example, a working electrode may be configured to generate a signal indicative of a concentration of an analyte in a fluid, the working electrode comprising an electrode material, a biorecognition element disposed on the electrode material that selectively binds to the analyte, wherein the biorecognition element is functionalized with a redox-active molecule and is configured to change conformation upon binding the analyte to move the redox-active molecule, closer to, or further from, the electrode material, and a passivation element comprising a zwitterionic peptide disposed on the electrode material.

The present invention discloses a nucleic acid aptamer binding to CD117 protein and its application, wherein the nucleic acid aptamer has a nucleotide sequence that has at least 60% homology with any one of SEQ ID NO.1 to SEQ ID NO.2 and binds to CD117 protein. The nucleic acid aptamer of the present invention has a small molecular weight, stable structure and chemical properties, is easy to store and label, is easy to modify, and can be artificially synthesized in a short period of time. The nucleic acid aptamer obtained by the present invention can be used for CD117 protein detection, purification or imaging, and can also be used to prepare drugs for diagnosis or treatment of abnormal expression of CD117 protein, such as purification to obtain high-sensitivity and high-specificity detection of CD117 protein, and has broad application prospects.

The invention belongs to the technical field of biological detection, and particularly relates to a disease marker fluorescence instant detection method based on protein scaffold DNA-Cu2 + functional nanospheres, which comprises the following steps: combining an insulin-like growth factor 1 (IGF-1) aptamer or cortisol aptamer, protein-DNA and DNA-metal ions; the protein scaffold DNA-Cu < 2 + > multifunctional integrated nanospheres are synthesized by a one-step method at room temperature. Based on the function integration of the nanosphere, one-step detection of IGF-1 or cortisol is realized, a plurality of analysis modes including fluorescence detection and smartphone-RGB are provided by combining a test strip and smartphone red, green and blue (RGB) analysis technologies, and a rapid and sensitive disease marker instant detection method is constructed. Finally, rapid and convenient detection of multiple markers in hundreds of clinical samples of multiple diseases is realized, and a new solution is provided for paper-based fluorescence POCT.

The invention provides a nucleic acid aptamer for specific recognition of morphine and application of the nucleic acid aptamer, and belongs to the technical field of biosensing and detection. The nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO: 1. The screening method is based on a Capture-SELEX technology and comprises the key steps that streptavidin magnetic beads are used for fixing an ssDNA library, estradiol, deabietic acid and totarol are introduced to serve as reverse screening substances so as to remove non-specific sequences, and finally the high-specificity aptamer is obtained through high-throughput sequencing and affinity determination. The dissociation constant of the aptamer and morphine is 127.31 nM, and the aptamer shows high affinity and high specificity. The invention further relates to application of the aptamer in preparation of a sensor and a kit for detecting morphine, and a new technical means is provided for rapid detection of morphine.

The invention discloses a nucleic acid aptamer of enrofloxacin and ciprofloxacin, an enzyme sensor and application thereof, and belongs to the technical field of nucleic acid aptamers. The nucleotide sequence of the nucleic acid aptamer for the enrofloxacin and the ciprofloxacin is shown as SEQ ID NO.3. The invention also discloses application of the nucleic acid aptamer for the enrofloxacin and the ciprofloxacin in detection of the enrofloxacin and the ciprofloxacin. The enzyme sensor comprises the following components: nucleic acid aptamers of enrofloxacin and ciprofloxacin, an auxiliary chain H1, an auxiliary chain H2, an auxiliary chain H3, copper sulfate and a TMB (Tetramethylbenzidine) developing solution. The enzyme sensor is applied to detection of enrofloxacin and ciprofloxacin. The nucleic acid aptamer of the enrofloxacin and the ciprofloxacin is obtained through optimization and transformation and has higher affinity to a target, the Kd value of the nucleic acid aptamer to the enrofloxacin is 15 nM, and the Kd value of the nucleic acid aptamer to the CIP is 123 nM. The enzyme sensor disclosed by the invention can realize specific recognition of ENR and CIP, is high in sensitivity and has a wide application prospect.

The present invention discloses a combination of different nucleic acid aptamers with 291 known targets. By performing sequencing analysis on the nucleic acid aptamer sequences of this combination through single-cell high-throughput sequencing technology, a cell atlas targeting mononuclear cells derived from the peripheral blood of patients with cholangiocarcinoma can be constructed. The nucleic acid aptamers covered by this combination have high specific affinity for their molecular targets. After extending adapters commercialized for sequencing platforms at both ends of the nucleic acid aptamer sequences respectively, by performing high-throughput sequencing on the nucleic acid aptamer sequences with sequencing adapters bound to the surface of mononuclear cells, high-throughput analysis of biomarkers on the surface of mononuclear cells derived from the peripheral blood of patients with cholangiocarcinoma can be achieved, thereby constructing a cell atlas of mononuclear cells derived from the peripheral blood of cholangiocarcinoma.

The invention discloses a magnetic field sensitive type metal ion nucleic acid aptamer as well as a screening method and application thereof, and relates to the technical field of nucleic acid aptamer screening. According to the invention, divalent cobalt ions with paramagnetism are taken as a research object, on the basis of compatibility of GO-SELEX, an HM-SELEX method is successfully developed in a 9Tesla steady-state strong magnetic field, efficient screening of magnetic sensitive metal ion aptamers is promoted, and nucleic acid aptamers with magnetic field adjustable binding characteristics are found for the first time, so that the method has the advantages of high efficiency, high sensitivity, high sensitivity and the like. The sequence of the cobalt ion nucleic acid aptamer is as shown in SEQ ID NO. 1-7. The invention also provides reference for the development of magnetic genetics, disease diagnosis and treatment and related sensors related to metal ions and magnetic fields, and fills the blank of such methods.

The invention provides a modified nucleic acid aptamer and application thereof. On the first aspect, the invention provides a modified nucleic acid aptamer, the nucleic acid aptamer is a nucleic acid aptamer Sgc8, and the nucleotide sequence of the nucleic acid aptamer Sgc8 is SEQ ID NO: 1; one end of the nucleic acid aptamer is extended through a polynucleotide fragment, and fluorescent molecular modification is carried out on the extended tail end of the polynucleotide fragment; the nucleotide sequence of the polynucleotide fragment is TTTTT. According to the invention, the base sequence with a certain length is added between the fluorescent molecule and the aptamer, so that the interference of the fluorescent molecule on an aptamer recognition structural domain can be effectively avoided, and the recognition and imaging efficiency is improved.

The invention discloses a method for detecting the concentration of cyclosporine in blood through fluorescence and electrochemical double signals, and belongs to the technical field of biochemical analysis and medical detection. Aiming at the technical problems of insufficient sensitivity and high false positive rate of traditional single-signal detection of blood concentration of cyclosporine, the method comprises the following steps: activating carboxyl microspheres by a coupling agent, fixing double-stranded DNA (deoxyribonucleic acid) formed by a cyclosporine aptamer and an initiator chain, inducing the initiator to release by using a cyclosporine sample, realizing strand displacement through an A2-PEI composite system, and detecting the blood concentration of cyclosporine by using an A < 2 >-PEI composite system. DNA modified cadmium telluride quantum dots are respectively adopted to detect fluorescence signals, eATRP electrochemical signal amplification is carried out to detect electrochemical signals, concentration values obtained by the two signals are verified, and an average value is taken as a result. The method can accurately capture low-concentration cyclosporine signals in blood, eliminates interference of a single method, is mainly used for accurately monitoring the blood concentration of cyclosporine, and provides a reliable detection means for medication safety and curative effect control of cyclosporine in clinical scenes such as organ transplantation.

The invention discloses a colorimetric-fluorescent dual-signal salmonella detection method based on Ag-MoS2 nano-enzyme. The method is characterized by comprising the following steps: mixing a single strand S1, a single strand S2, a single strand S3, a single strand S4, a salmonella aptamer and cDNA (complementary deoxyribonucleic acid) to prepare a multivalent aptamer competitive probe solution; respectively dissolving a hairpin probe H1 and a hairpin probe H2 in PBS (Phosphate Buffer Solution); a step of preparing an Ag-MoS2 nano enzyme composite material; the method comprises the following steps: mixing and incubating a to-be-detected salmonella solution and a multivalent aptamer competitive probe, adding the Ag-MoS2 nano-enzyme composite material for performing CHA amplification reaction, then adding an H2O2 solution and a TMB solution for performing peroxidase catalytic reaction, respectively performing colorimetric method and fluorescence method detection, and calculating to obtain the salmonella concentration in the to-be-detected solution. The kit has the advantages of simplicity, rapidness, high sensitivity, strong specificity, high accuracy and real-time sterilization after detection.

The invention discloses a staphylococcus aureus biosensor based on a nucleic acid aptamer and a preparation method of the staphylococcus aureus biosensor. Three fluorine atoms (F) are introduced into the 5'end, the 3 'end and the middle position of an aptamer 2' F3-(5 '3'm DNA) sequence (SEQ ID NO: 1) for modification, so that the binding force of the aptamer and graphene is remarkably enhanced, the signal stability and the anti-interference capability of the biosensor are remarkably improved, non-specific fluorescence leakage can be effectively blocked, and reliable guarantee is provided for complex sample detection. According to the present invention, with the cooperation of the graphene oxide quenching substrate, the high-sensitivity detection of the staphylococcus aureus is achieved, the detection limit of the sensor within 5 min can achieve 5 cells / mL, the sensitivity is high, the specificity on the complex sample is more than 95.4%, and the sensor is suitable for the food safety rapid screening and the clinical diagnosis.

The invention belongs to the technical field of immunoassay and biosensing detection, and particularly relates to a preparation method and application of an antibiotic electrochemical luminescence sensor based on a double-enhancement strategy. According to the invention, a bifunctional metal organic gel is used as a substrate, a graphite-phase carbon nitride quantum dot is used as a luminous body, and a self-assembly split aptamer walker is combined to construct the electrochemical luminescence sensor for sensitive detection of antibiotics. The sensor has the advantages of extremely high specificity and sensitivity, wide detection range, low detection limit and strong anti-interference performance, and has important scientific significance and application value in detection of antibiotic residues in the environment.

The invention relates to an extracellular vesicle surface protein detection paper-based kit and application thereof, and belongs to the technical field of biology. The technical problems that an existing sEVs detection technology is insufficient in specificity, depends on professional instruments and cannot meet the instant detection requirement are solved. According to the method, sEVs are synergistically captured through double aptamers, the target specificity is improved, signals are amplified in a cascaded mode through hyper-branched rolling circle amplification (HRCA) and a CRISPR / Cas12a system, and visual detection is achieved by detecting FAM-biotin probe separation before and after cutting through a transverse flow test strip. According to the method, interference of free protein is effectively avoided through double-target recognition, and the detection limit is as low as 406 parts / mL; cRISPR and a paper-based technology are combined to realize high sensitivity and instant detection; the system is simple and convenient to operate, does not need professional instruments, is suitable for tumor diagnosis and treatment monitoring of clinical samples, and provides a portable solution for precise medical treatment.

The present invention discloses a nucleic acid aptamer that specifically recognizes DEHP and its application, and belongs to the field of environmental safety biotechnology. The nucleic acid aptamer is any one of the following: (1) a single-stranded DNA sequence such as a nucleotide sequence shown in SEQ ID No.10; (2) a sequence that uses the nucleotide sequence shown in SEQ ID No.10 as a core sequence, is extended or shortened on both sides or on one side, and has the same function as the nucleotide sequence described in (1). The present invention is based on Capture‑SELEX technology, and after 10 rounds of repeated screening, a nucleic acid aptamer SEQ ID No.10 that can bind to DEHP with high affinity and high specificity is finally obtained. The nucleic acid aptamer is applied to the DEHP detection of actual samples, which has important application prospects for the analysis and detection of DEHP in blood samples, cell samples, food and drinking water.

The invention discloses a neutralizing nucleic acid aptamer for targeted inhibition of a B cell activating factor and application of the neutralizing nucleic acid aptamer in treatment of systemic lupus erythematosus. The neutralizing aptamer disclosed by the invention can be used for efficiently inhibiting the combination of BAFF and specific receptors on a B cell membrane, including a BAFF receptor (BAFF-R), a human calcium regulatory cyclophilin ligand interaction molecule (TACI) and a B cell maturation antigen (BCMA), so that the proportion of plasma cells, plasma mother cells and hair growth center B cells is reduced, and finally, the generation and secretion of autoantibodies are reduced; the compound has a targeted therapeutic effect on systemic lupus erythematosus. Compared with an existing biological agent for neutralizing BAFF, the neutralizing nucleic acid aptamer has the advantages of being high in specificity, high in affinity, easy to synthesize, low in immunogenicity, low in cost, capable of being designed and programmed and the like, is a potential novel nucleic acid preparation for SLE targeted therapy, and has a good clinical transformation application prospect.

The invention relates to the technical field of biomedical engineering, and discloses a preparation method of a nano-enzyme SERS (Surface Enhanced Raman Scattering) sensor for detecting diabetic retinopathy, which comprises the following steps: (1) synthesizing a bimetallic gold-palladium nanorod; (2) assembling a gold trioctahedron array; and (3) modifying the surface of the gold-palladium nanorod synthesized in the step (1) with single-stranded DNA1 to prepare a nano-enzyme probe, hybridizing an aptamer of a vascular endothelial growth factor (VEGF) with single-stranded DNA2, modifying the surface of the gold trioctahedron array assembled in the step (2) with the hybridized aptamer, preparing a capture substrate, and constructing the nano-enzyme SERS sensor by the nano-enzyme probe and the capture substrate. In the detection process, the VEGF triggers a competitive recognition mechanism to promote the nano-enzyme probe to be captured by the capture substrate and catalyze tetramethyl benzidine (TMB) to generate oxTMB with a strong SERS signal. The sensor has the advantages of high sensitivity, strong specificity and good accuracy, and can realize rapid quantitative detection of DR biomarkers in serum.

The invention discloses a method for screening a non-natural nucleic acid aptamer of targeted thrombin based on streptavidin magnetic beads and application, and belongs to the technical field of biology. According to the method, an initial screening library is efficiently constructed through a primer extension technology, and a chemical modification SELEX technical process is simplified; a streptavidin magnetic bead separation technology is introduced, so that the screening specificity and efficiency are improved, the screening period is remarkably shortened, and the cost is reduced; by selecting non-natural nucleic acid modification sites and adopting a strategy of combining reverse screening and forward screening, high specificity and affinity of the aptamer are ensured, and limitation of an existing screening method is overcome; the screened non-natural nucleic acid aptamer shows high affinity and excellent stability, the aptamer with a specific structure and function is successfully obtained by optimizing the proportion of nucleoside triphosphate monomers and extension reaction conditions, and a wide application prospect is provided for the fields of drug development, biosensor preparation and the like. A new path is opened up for research and application of the nucleic acid aptamer.

The present invention discloses a nucleic acid aptamer binding to CD5 protein, the sequence of which is shown in SEQ ID NO.1 to SEQ ID NO.6, and by improving the screening conditions, a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling, which can bind to CD5 protein with high affinity, is screened and obtained. The aptamer is measured by surface plasmon resonance (SPR) and dot hybridization experiments to have high affinity and high specificity, and can be used in detection, diagnosis, imaging and treatment, and has broad application prospects.

The application discloses a malachite green label-free proportional biosensor based on multi-dimensional cutting aptamer, which comprises the following steps: (1) a performance-improved malachite green aptamer sequence; (2) a label-free proportional malachite green sensor sequence; and (3) malachite green detection. The biosensor is constructed by using various aptamer sequences, and the ideal sensing effect can be realized through the competition balance principle. The label-free proportional sensor can present a good linear relationship in the range of 5nM-4muM, and has a low detection limit of nanomolar level, which indicates that the sensor has good malachite green detection potential and can meet the application requirements.

The invention belongs to the technical field of biological medicine, and particularly relates to a recombinant RNA aptamer as well as a preparation method and application thereof. The recombinant RNA aptamer is obtained by taking active tRNA as a bracket, embedding an RNA aptamer and expressing in escherichia coli. The sequence of the active tRNA is a sequence which is similar to a human cysteine tRNA sequence by 90% or more, and the human cysteine tRNA sequence is shown as SEQ ID NO. 1; the RNA aptamer is directly embedded at an active tRNA anticodon, and the embedded sequence is a sequence with the similarity of more than 50% with the SEQ ID NO.2 sequence. According to the production method of the recombinant RNA aptamer, various RNA aptamers can be conveniently and quickly prepared, and the produced and prepared recombinant RNA aptamer can be used for preparing a medicine for treating arthritis and meets the requirements of scientific research and medicine research and development.

The invention belongs to the field of biomedical treatment, and particularly discloses a series of cancer cell early detection probes, a kit and a detection method. Aiming at the problems of low sensitivity, poor specificity, complex operation, long detection period and the like of the existing cancer cell detection means, various innovative probes are invented. Ten probes such as a quantum dot FRET probe based on a nucleic acid aptamer and a gold nano-cluster-antibody composite probe have different characteristics, and accurate recognition and detection of cancer cell markers are achieved through unique design principles such as aptamer screening, nano-material modification and a signal amplification strategy. Through synergistic comparison, the sensitivity of the probes is greatly improved, the lower detection limit is as low as 0.3-1.5 pg / mL and is improved by 30%-60% compared with that of a traditional method, the specificity and accuracy are high, the detection time is shortened to 1-2 hours, the sample demand is low, and the probes also have diagnosis and treatment integration and multi-mode imaging functions, and provide powerful support for early diagnosis and treatment of cancers.

The invention provides a bifunctional nano-enzyme SERS (Surface Enhanced Raman Scattering) detection platform for ultrasensitively detecting mi RNA (Ribonucleic Acid) related to cerebral infarction and a preparation method, and relates to the technical field of biomedical engineering. The preparation method comprises the following steps: synthesizing gold nanorods (AuNRs) by using a seed growth method, and growing Pt on the surface of a product to prepare gold platinum nanorods (Au (at) Pt NRs); the preparation method comprises the following steps: synthesizing gold nano hexagonal plates (AuNHs) by using a seed growth method, and preparing an AuNHs array through oil-water interface self-assembly; and modifying an aptamer complementary chain (H1) on the Au (at) Pt NRs obtained in the step (1) through an Au-S bond. And combining the assembled AuNHs array with a nucleic acid aptamer (cDNA) corresponding to mi R-106a-5p to functionalize the assembled AuNHs array in the step (2), so as to construct an SERS (Surface Enhanced Raman Scattering) detection platform. The target mi R-106a-5p can be specifically combined with cDNA, so that Au (at) Pt NRs carrying H1 are separated from the surface of an AuNHs array, TMB oxidation is reduced, and SERS signals are remarkably reduced. And according to SERS signal intensity, substituting the SERS signal intensity into a linear regression equation to realize quantitative detection of mi RNA.

The invention discloses a preparation method and application of a photo-thermal biosensor for tumor cell quantification and vitality dual-index liquid biopsy. Phosphatidylserine (PS) is exposed by enriching and cracking tumor cells, is identified and combined by an aptamer Apt2, and is driven to be separated from Apt2-Cu2-xTe NSs; after magnetic separation, separated supernatant is subjected to photo-thermal detection; the photo-thermal signal intensity is positively correlated with the number of cells, so that quantitative detection is realized; during cell apoptosis, PS is turned out of the membrane, Apt2-Cu2-xTe NSs is combined with the surface of the membrane, separated supernatant is subjected to photo-thermal detection after magnetic separation, and the photo-thermal signal enhancement amplitude is in negative correlation with cell activity. The platform has the advantages of POCT characteristics, low cost and portability, and a new tool is provided for precise tumor diagnosis and treatment.

The invention provides a nucleic acid aptamer and a screening method thereof, the aptamer is of an oligonucleotide DNA structure, the nucleotide sequence of the nucleic acid aptamer is the nucleotide sequence of any DNA fragment as shown in SEQ ID NO: 1-9, and the nucleic acid aptamer can specifically target cardiac muscle cells (CMs). According to the invention, a new strategy can be provided for clinical treatment of cardiovascular diseases, and meanwhile, bioactive molecules such as microRNA (miRNA), small interfering RNA (small interfering RNA, siRNA), lipidosome, microspheres, microcapsules and the like can be carried to be used as an intracellular drug delivery tool.

Compositions comprising aptamers capable of specifically binding to a surface protein of Clostridium difficile spore are provided. A method for detecting, enriching, separating, and / or isolating Clostridium difficile spores is provided.

The invention relates to a nucleic acid aptamer for specifically recognizing tilmicosin as well as screening and application of the nucleic acid aptamer, and belongs to the technical field of food safety detection and biosensing. Aiming at the defects of the existing method for detecting tilmicosin residues in food, the invention provides a high-affinity and high-specificity nucleic acid aptamer obtained by screening based on a graphene oxide index enrichment ligand systematic evolution technology. The aptamer is obtained by multiple rounds of screening from a random single-stranded DNA library through a GO-SELEX technology, and a core sequence Apt-2-1 with the length of 33 nt is finally obtained through sequence analysis and structure optimization. The aptamer shows excellent binding capacity to tilmicosin, the dissociation constant reaches 9.82 nM, and the aptamer has good specificity. The nucleic acid aptamer provided by the invention can be used for constructing a rapid and sensitive tilmicosin residue detection method, and has important application value in monitoring of livestock and poultry products and food safety.

The invention discloses an RNA (Ribonucleic Acid) aptamer and application thereof in improving the salt tolerance of rice. The aptamer sequence eApt-2 with high affinity to eIF4A is obtained through enrichment by using a phylogenetic screening technology of the nucleic acid aptamer, and the aptamer sequence eApt-2 can inhibit the RNA helicase activity of eIF4A and selectively block a 5'cap-dependent translation initial process. After the eApt-2 coding sequence is introduced into a rice cell, the transgenic rice shows significantly enhanced salt tolerance under a salt stress condition: the growth condition is improved, and the biomass and the photosynthetic efficiency are both higher than those of a control plant. Compared with a traditional strategy of improving the salt tolerance through gene overexpression or knockout, the method does not need permanent modification of animal and plant genomes, accurate and reversible regulation and control of translation initiation factors are carried out through aptamers, optimization of stress response protein synthesis is achieved, and higher specificity and safety are achieved. The invention provides a novel and efficient technical approach for cultivating salt-tolerant crops, and has a wide application prospect.

The invention discloses a lateral flow chromatography test strip for detecting perfluorooctanoic acid by combining gold nanoparticles, a nucleic acid aptamer and an antibody. According to the test strip, a nucleic acid aptamer marked by gold nanoparticles is combined with PFOA molecules to form a nucleic acid aptamer with a G-quadruplex structure, and then the nucleic acid aptamer with the G-quadruplex structure is specifically recognized and captured by an anti-BG4 antibody, so that specific visual detection of perfluorooctanoic acid is realized. After a sample is injected, a G-quadruplex structure formed by the PFOA and the nucleic acid aptamer acts with the anti-BG4 antibody coated on the test strip, so that the gold nanoparticles are agglomerated to generate a chromogenic reaction, the signal intensity can be detected by naked eyes or reading equipment, the visual detection limit is 10 mu M, and the equipment detection limit is 304 nM. The test strip has the advantages of high detection speed, high specificity and high sensitivity, and is suitable for field detection and rapid screening. Compared with a traditional method, the method realizes simple, convenient and economical detection of PFOA, and has a wide application prospect.

The invention discloses a liquid gate graphene transistor sensor for rapidly detecting a cell factor IFN-gamma, and a preparation method and application thereof. The sensor adopts an IFN-gamma aptamer to modify a gate on a liquid gate graphene field effect transistor (SSGT); during detection, after the aptamer on the grid captures an IFN-gamma target substance, the configuration is changed, the charge is changed, and then the Dirac point of a transfer curve is shifted, so that the target substance is detected respectively, and detection of IFN-gamma is finally realized by establishing a concentration model of a target system. According to the invention, the disadvantages of complex flow, insufficient adaptability in a multi-sample environment, lack of real-time monitoring capability and the like of the traditional detection means are solved, the rapid detection of one or more cytokines in blood can be realized through the combination and disassembly of the grids, the rapid detection method can be used for cell experiment detection and animal experiment detection, and the rapid detection method has a certain practical value.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.