Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

341 results about "Vibrio" patented technology

Vibrio is a genus of Gram-negative bacteria, possessing a curved-rod (comma) shape, several species of which can cause foodborne infection, usually associated with eating undercooked seafood. Typically found in salt water, Vibrio species are facultative anaerobes that test positive for oxidase and do not form spores. All members of the genus are motile and have polar flagella with sheaths. Vibrio species typically possess two chromosomes, which is unusual for bacteria. Each chromosome has a distinct and independent origin of replication, and are conserved together over time in the genus. Recent phylogenies have been constructed based on a suite of genes (multilocus sequence analysis).

Kit and method for detecting Bibrio Parahemolyticus using loop-mediated equal-temperature amplification technology

The invention relates to a kit checking vibrio parahaemolyticus with mediated isothermal amplification technology and the method. Said kit comprises LAMP reacting liquid A, downstream inner primer DNA polymerase B and coloured solution; and the upstream inner primer in LAMP reacting liquid A is tctggtcagcaagcagcagttttttcgccgaccacatttctca; downstream inner primer is acccgtactatccaactgcgcttttggcgcgtacttagcaagg; upstream outer primer is ccaagcgtttcgtcacca; downstream outer primer is caaagctttgtgcgaactcg. The checking method comprises extracting bacteria DNA, mediated isothermal amplification for vibrio parahaemolyticus, and coloring detection. The invention is characterized by fast speed, strong specificity, high sensitivity and low cost.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Method used for simultaneous detection of three food-borne pathogenic bacteria based on multicolor upconversion fluorescence labeling

The invention provides a method used for simultaneous detection of three food-borne pathogenic bacteria based on multicolor upconversion fluorescence labeling. According to the method, three upconversion materials with differentiable fluorescence spectrums are used for forming multicolor upconversion fluorescent nanoprobes via respective connection with aptamers of staphylococcus aureus, vibrio parahaemolyticus, and salmonella, and complementary oligonucleotide single chains of the aptamers are connected with magnetic nanoparticles so as to form nano-composites. When bacteria to be tested are in a detection system, double chain unwinding is realized because of specific binding of the pathogenic bacteria with corresponding aptamers; it is possible to realize simultaneous quantitative determination of staphylococcus aureus, vibrio parahaemolyticus, and salmonella by monitoring upconversion fluorescence signal strength at 477nm, 550nm, and 660nm, detection linear range ranges from 50 to 1000000cfu / ml, and detection limits are 25cfu / ml, 10cfu / ml, and 15cfu / ml respectively. The method is used for detection of pathogenic bacteria, is high in sensitivity, is rapid and convenient, and can be used for detection of the three pathogenic bacteria in food such as milk and shrimp meat; and results are accurate and reliable.
Owner:JIANGNAN UNIV

Pathogenic microorganism DNA detecting chip and preparation method and application thereof

The invention relates to a pathogenic microorganism DNA detection chip and the chip comprises a carrier and a nucleic acid probe on the carrier. The nucleic acid probe is provided with a target detection probe used for detecting target gene of pathogenic microorganism. The pathogenic microorganism comprises but not limits to vibrio cholerae, pathogenic escherichia coli, campylobacter jejuni, Yersinia enterocolitica, parahemolytic vibrio, salmonella, and shigella and Listeria monocytogenes. The invention also relates to a preparation method of the pathogenic microorganism DNA detection chip and provides applications of the pathogenic microorganism DNA detection chip in detection of pathogenic microorganism. Also a pathogenic microorganism DNA detection chip kit is provided.
Owner:ICDC CHINA CDC

Hydroxybutyrate and poly-hydroxybutyrate as components of animal feed or feed additives

This invention relates to the use of hydroxybutyrate and poly hydroxybutyrate as components of animal feed or feed additives, as well as to compositions, feed additives and feed containing them. The inventors surprisingly found that hydroxybutyrate and poly-hydroxybutyrate, preferably 3-hydroxybutyrate and poly-3-hydroxybutyrate, have a great potential for use in animal feed for modulation of the gut flora. More precisely, it has been found that poly-3-hydroxybutyrate or a microbial strain capable for producing poly-3-hydroxybutyrate can be used as a potential growth promoter or gut flora modulator by releasing SCFA, preferably 3-hydroxy butyric acid, in the gut micro flora. Further, the inventors found that 3-hydroxybutyrate and poly-3-hydroxybutyrate have a great potential for suppressing or inhibiting pathogenic bacteria in the gastro intestinal tract, e.g. have a antimicrobial activity against strains of Vibrio, E. coli and Salmonella.
Owner:UNIV GENT

Oligonucleotide probe kit for detecting common intestine trac kpathogenic bacteria and its use

The present invention belongs to the field of microbe detecting technology. The oligonucleotide probe for detecting common intestinal tract pathogenic bacteria is designed on 16S rRNA and 23S rRNA of bacteria, ipaH of dysentery bacillus giant plasmid, VipR of Salmonella typhi and other gene sequence, has length of 25-50 bp, and relatively high sensitivity and specificity. The oligonucleotide probe is suitable for detection based on nucleic acid hybridization principle, especially detection based on gene chip principle. Under certain use condition, it can detect Listeria, parahemolutic vibrio, Campylobacter, etc. It may be used in many aspects, such as disease diagnosis, environment detection, food poisoning detection, etc.
Owner:RADIOLOGY INST ACAD OF MILITARY MEDICINE SCI PLA

Vibrio qinghaiensis Q67 based long-term microplate toxicity analyzing method of environmental pollutant

The invention discloses a vibrio qinghaiensis Q67 based long-term microplate toxicity analyzing method of environmental pollutants. The long-term microplate toxicity analyzing method is established by using the vibrio qinghaiensis Q67 as a tested organism and introducing time factors into the toxicity concentration-effect relationship of the traditional compound on the basis of a microplate toxicity analyzing method. The vibrio qinghaiensis Q67 based long-term microplate toxicity analyzing method of the environmental pollutants is characterized by adopting a specific microplate design and sampling scheme and a microplate culture medium suitable for the growth of the vibrio qinghaiensis Q67, measuring the long-term toxicity effect of the environmental pollutants on the vibrio qinghaiensis Q67 and repeatedly measures the toxicity of the same pollutant through multiple plates to ensure the statistical significance of an experimental result. By measuring the long-term toxicity of a part of the environmental pollutants on the vibrio qinghaiensis Q67, compared with short-term toxicity, the long-term toxicity of the tested environmental pollutants is discovered to be obviously higher than the short-term toxicity of the tested environmental pollutants, wherein the difference of the long-term toxicity and the short-term toxicity of antibiotics is most significant. The invention can actually reflect the toxicity of a site compound having specific action on compounds and more reasonably evaluate the toxicity of the pollutants.
Owner:TONGJI UNIV

Food-originated pathogenic bactenium quick detection gene chip and its application

The present invention provides a gene chip for quickly detecting pathogens from food source, discloses the preparation method of said gene chip and provides 26 oligonucleotide probe sequences for detection. Said gene chip can quickly, accurately and high-effectively detect and identify the class of the pathogens in food, and its detection range includes staphylococcus aureus, Shiga's bacillus, salmonella, colibacillus 0157, bacillus proteus, mononuclear hyperplastic listerella, enterocolitis yersinia, aeruginous pseudomonads, vibrio parahaemolyticus, vibrio cholerae, bacillus cereus, beta hemolytic streptococcus, coconut fermentation pseudomonads, boticin, vibrio jejuni and bacillus perfringens, etc.
Owner:INST OF HYGIENE & ENVIRONMENTAL MEDICINE PLA ACAD OF MILITARY MEDICAL

Primers and method of detecting bacteria

The first primer of the invention is a primer which, when used in PCR under appropriate conditions, serves to detectably amplify 16S rRNA-encoding DNAs of bacteria of the Escherichia, Salmonella and Vibrio genera, but when used in PCR under the same conditions, does not serve to detectably amplify either chloroplast 16S rRNA-encoding DNAs or mitochondrial 16S rRNA-encoding DNAs. The second primer of the invention is a primer which, when used in PCR under appropriate conditions, serves to detectably amplify 16S rRNA-encoding DNAs of Staphylococcus aureus and Bacillus cereus, but when used in PCR under the same conditions, does not serve to detectably amplify either chloroplast 16S rRNA-encoding DNAs or mitochondrial 16S rRNA-encoding DNAs.
Owner:NISSIN YORK

High-content liquid povidone-iodine

The invention relates to antisepsis and anti-inflammation medicaments, and particularly relates to high-content liquid povidone-iodine. The liquid povidone-iodine is prepared from the following raw materials in percentage by weight: 5.2-12.24 percent of iodine, 10-24 percent of polyvinylpyrrolidone, 2-4.8 percent of potassium iodide, 0.1-0.24 percent of potassium iodate, 15-36 percent of ethanol and the balance of water. The high-content liquid povidone-iodine is a reddish brown viscous liquid, is easily dissolved in water, has stable performance, strong sterilization efficacy and no irritation, is suitable for sterilization of operating parts and skin-mucosa or sterilization of aquatic water, can be used for preventing and treating bacteriosis of aquatic animals caused by vibrio, aeromonas hydrophila, edwardsiella tarda and the like and sterilizing the environment of livestock and poultry housings, plays a role in killing multiple bacteria, spores, viruses, fungi and the like, thus being a good iodine containing medical bactericide and epidemic prevention sanitizer.
Owner:SHENLONG APPL TECHN TAIYUAN CITY SHANXI PROV

Method for constructing specific pathogen-free penaeid shrimp culture system

The invention relates to a method for constructing a specific pathogen-free penaeid shrimp culture system, which comprises the steps of adopting comprehensive treatment of culture water for avoiding the entry of pathogens; introducing selected oocystis borgei into a penaeid shrimp culture pond for constructing a good microalgae community structure, and using a microalgae-controlled water environment to reduce the concentration of injurious factors, such as ammonia nitrogen, nitrite nitrogen and the like in a water body, improving the water quality, eliminating stress factors, improving the content of dissolved oxygen in the water and leading the environment of the water body to be in the good dynamic balance state for a long time. A system of the oocystis borgei, rhodopseudanonas palustris and phycomycete is utilized for inhibiting the growth of vibrios during the early stage, the middle stage and the late stage of culture; and schmackeria dubin is utilized to intake microalgae, thereby controlling the number of the microalgae in the water body and eliminating the adverse impacts of rapid proliferation of the microalgae on a culture environment. Penaeid shrimps have the advantages of specific pathogen-free property, rapid growth, strong disease resistance, strong stress resistance, short culture period, large and uniform formed size, high output, good investment efficiency and the like.
Owner:GUANGDONG OCEAN UNIVERSITY

Method for detecting acute biological toxicity of sewage

The invention specifically relates to a method for detecting acute biological toxicity of sewage, belonging to the field of environmental water detection. A method for accurately detecting the acute biological toxicity of a sewage sample can be established by the following steps of: extracting and concentrating organic matter in a sewage sample, removing the interference of inorganic matter, and finally detecting by using fresh water luminous bacteria Qinghai vibrio Q67. The method can provide accurate final results, is stable and has good reproducibility. The method is the effective improvement of the traditional method.
Owner:XI'AN UNIVERSITY OF ARCHITECTURE AND TECHNOLOGY

Novel vibrionaceae vibrio bacterial strain and application thereof

The invention relates the vibrionaceae vibrio strain and its application. The invention relates the vibrionaceae vibrio strain from gulfweed, and the output of algin lyase made by the vibrionaceae vibrio strain is 2-37 times than that of algin lyase made with now technology. The algin lyase can be used to make algin oligosaccharide.
Owner:OCEAN UNIV OF CHINA

Sanhuang supper micropowder as well as preparing method and application thereof

The invention relates to the field of fish medicine preparations, in particular to Sanhuang supper micropowder as well as a preparing method and applications thereof. The supper micropowder comprises in percentage by weight as follows: 25-35% of baical skullcap roots, 25-35% of amur cork tree bark, 25-35% of rhubarb and 5-10% of indigowoad leaves. The Sanhuang supper micropowder has effects of clearing heat, cooling blood, resisting viruses and detoxifying, plays powerful antibacterial, disinfection and antiviral roles in water bodies and pathogenic bacteria of aqueous animal (gills, body surfaces and the like) tissue and is particularly used for mainly treating bacterial enteritis caused by pseudomonas, vibrio, aeromonas hydrophila and Edwardsiella in the aqueous animals. Tests prove that the Sanhuang wall-breaking supper micropowder can improve and treat white excrement enteritis of penaeus vannamei boone and septicemia of Micropterus salmoides to a certain extent, can enhance the aeromonas hydrophlia infection resistance of the Micropterus salmoides and is a novel fish medicine for effectively protecting intestinal tracts and preventing bacterial enteritis in the aqueous animals, and the use amount can be significantly decreased by 2-3 times.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI +1

Cyclinasinensis purification reproduction and culture method

The invention discloses a cyclinasinensis purification reproduction and culture method. The method includes the processes of temporary culture of parent clams, spawning of the parent clams, trochophore hatching, D-larvae and post-larvae culture and juvenile clam culture. Microbial preparations are thrown in during the process of temporary culture of the parent clams, a chitosan decontamination agent is thrown in during the process of spawning of the parent clams, the microbial preparations are thrown in during the course of trochophore hatching, microalgae preparations are thrown in during the course of D-larvae and post-larvae culture, and juvenile clams are fed with tetraselmis in the period of juvenile clam culture till grown-up cyclinasinensis is harvested. Purification substances are thrown in the whole period from temporary culture of the parent clams to larvae culture and juvenile clam culture for purifying meat, pollution of contaminants is avoided from the source, healthiness, greenness and non-pollution in the culture process are guaranteed, the contaminants such as heavy metal, petroleum and nitrofuran derivatives in bodies of the grown-up cyclinasinensis are reduced significantly, and good effect on removal of escherichia coli, sphingomonaspaucimobilis, vibrio, aeromonassalmonicida and the like is achieved, and the grown-up cyclinasinensis completely conforming to food security can be cultured.
Owner:OCEAN UNIV OF CHINA +1

Scylla paramamosain anti-lipopolysaccharide factor, and preparation method and application thereof

The invention relates to genetic engineering of Scylla paramamosain, and provides a Scylla paramamosain anti-lipopolysaccharide factor, and a preparation method and application thereof. The preparation method comprises the following steps: building a recombinant expression vector for the Scylla paramamosain anti-lipopolysaccharide factor; introducing the recombinant expression vector into host cells, and carrying out induced expression on the host cells to obtain an expression product; and separating and purifying the expression product to obtain a recombinant protein, namely the Scylla paramamosain anti-lipopolysaccharide factor. The Scylla paramamosain anti-lipopolysaccharide factor has obvious growth inhibition and sterilization effects on Gram-negative bacteria such as Shigella flexneri, Vibrio alginolyiicus, Vibrio parahaemolyticus, Pseudomonas stutzeri and Pseudomonas fluorescens and Gram-positive bacteria such as Corynebacterium glutamicum, and has a potential application value in the preparation of antibacterial medicaments and antimicrobial additives for animal feed.
Owner:XIAMEN UNIV

Gene chip for detecting six kinds of diarrhea pathogens and its prepn process and kit

The present invention relates to one kind of gene chip for detecting six kinds of diarrhea pathogens, and the gene chip includes solid carrier and oligonucleotide probe fixed on the carrier. The oligonucleotide probe includes DNA or cDNA segments selected from nucleotide sequences corresponding to the genomes of Shigella, haemorrhagic colibacillus, invasive colibacillus, Vibrio parahaemolyticus, Vibrio cholreae and salmonella. The said chip together with sample treating reagent, hybridizing reagent, color reagent and the specification constitutes the detection kit. The present invention has high detection efficiency and high detection accuracy.
Owner:IPE BIOTECHNOLOGY CO LTD

Novel vibrionaceae vibrio bacterial strain and application thereof

The invention relates the vibrionaceae vibrio strain and its application. The invention relates the vibrionaceae vibrio strain from sea-tangle, and the output of algin lyase made by the vibrionaceae vibrio strain is 2-5 times than that of algin lyase made with now technology. The algin lyase can be used to make algin oligosaccharide.
Owner:OCEAN UNIV OF CHINA

Gene of novel alginate endolyase, engineering bacterium and application

The invention discloses recombinant alginate lyase, an engineering bacterium thereof and a method for preparing alginate oligosaccharide through hydrolysis. The method is characterized by screening an alginate lyase gene AlgM according to a strain Vibrio sp.BZM-1 newly isolated from seaweeds; constructing an expression vector pHBM905BDM-AlgM containing the gene, and converting pichia sp GS115 competent cells to obtain a single copy gene engineering bacterium; and constructing, culturing and verifying the multi-copy gene engineering bacterium to prepare recombinant alginate lyase through high-efficiency expression, and producing alginate oligosaccharide by hydrolyzing sodium alginate with alginate lyase. The recombinant alginate lyase gene engineering bacterium GS115 / AlgM4 (CCTCC No:M2015500) containing four copies has a higher expression level. The activity of recombinant alginate lyase is as high as 31000U / mL.
Owner:BINZHOU MEDICAL COLLEGE

Wound vibrio quantitative detecting test strip

The invention discloses a primer, a probe, a wound vibrio detecting method and a detecting kit for wound vibrio detection in aquatic products. The target gene of the primer and probe combined site is vvhA350 site-800 site of the cytolysin structure gene of the wound vibrio. The wound vibrio in the aquatic products is quantitatively detected by a wound vibrio quantitative detecting test strip, comprising detecting test paper and reaction buffer solution, wherein the detecting test paper consists of a sample absorbing zone, a result scanning window and a terminal indicating window. The invention is characterized in that the marking object is the epitropous phosphor particle, has the advantages of quantitative detection, good sensitivity, stability and safety, and can quantitatively detect the wound vibrio in the aquatic products.
Owner:NINGBO BOAO BIOENG

Safe food preservative

The invention belongs to the technical field of food processing, and particularly relates to safe food preservative. The safe food preservative comprises, by mass, 2-7 parts of gingko leaf extractives, 4-9 parts of lysozyme, 12-15 parts of chitosan, 3-7 parts of spice extractives, 4-10 parts of protamines and 80-100 parts of water. According to the safe food preservative, the main inhibiting objects are pseudomonades, micrococcus, bacilli, enterobacteriaceae, vibrios, halobacterium, mycete and the like, and the application range is wide in beverages, seasoning, cooked wheaten food, cakes, sausages, canned fruit, various melons and fruits, vegetables and the like.
Owner:SICHUAN HUIQUAN CANNED FOOD

Recombinant microorganisms and uses thereof

The present invention relates to recombinant strains of Vibrio spp, which are unable to utilize the amino sugar N-acetylglucosamine (GlcNAc) as a sole carbon source. This inability to utilize GlcNAc severely impairs the colonization property of the recombinants. The present invention also provides compositions comprising these recombinant strains for use in pharmaceuticals and in providing immunity.
Owner:NAT INST OF PLANT GENOME RES ORG

Compound micro-ecological preparation for degrading nitrite in culture pond and application

The invention discloses a compound micro-ecological preparation for degrading nitrite in a culture pond and application. The invention discloses a microorganism preparation for degrading the nitrite in a shrimp pond and inhibiting pathogenic bacteria, in particular relates to the compound micro-ecological preparation for degrading the nitrite, and belongs to the technical field of culture. The micro-ecological preparation, which contains mixed powder and small granules, is prepared by selecting pseudomonas, bacillus amyloliquefaciens and bacillus subtilis which have a denitrification effect, and taking wheat bran, zeolite powder and corn starch as auxiliary materials. According to the compound micro-ecological preparation disclosed by the invention, on one hand, a small molecular carbon source is introduced into a water body, so that the metabolic activity of original denitrifying bacteria and heterotrophic nitrification bacteria of the pond is enhanced; on the other hand, microorganism bacteria play a role on a pond bottom and a water body at the same time through adsorbents with different specific gravities, so that the release of ammonia nitrogen and the nitrite at the pond bottom is reduced; thirdly, the bacillus amyloliquefaciens is utilized, so that the quantity of pathogenic bacteria including vibrio and the like can be inhibited while the water quality is improved, and furthermore, fish diseases are reduced.
Owner:无锡中水渔药有限公司 +1

Vibrio parahaemolyticus gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology

A subsidiary hemolytic vibrio gene quickly diagnosis reagent box which bases on ring medium conduct constant temperature augment technology and it relates to the bioinstrumentation reagent field. The reagent box is consisted by the di-p-leading object; DNA polymerase; reaction liquid; sample pre-process liquid; fluorescence dye; positive control-liquid and the six liquids lay in the container individually and the leading object has four sleeves. The merits of the reagent box are that: there is no need of the special reagent and device; high specificity; the positive rate can reach above 99.9% and the false positive rate is less 0.1%; high sensitivity; it is easy to identification; it can be identified by the eyes through observing; extensive application: it can be used in quality control with safe and quick detection of the food, medicine, equipage and their primary accessories.
Owner:GUANGZHOU HUAFENG BIOTECH

Vibrio parahaemolyticus tunica externa protein ompK subunit vaccine and preparation method thereof

The invention discloses protein ompK subunit vaccine of assistant haemolysis vibrio extine and a preparation method thereof. The vaccine is PBS solution which converts the recombination protein of the coliform bacteria of recombination prokaryon expression plasmid pET30a-ompK expressed by inducing and after being purified; the concentration of the PBS solution is 0.25-0.5mg / ml. The method has the steps that: firstly, the extraction of an assistant haemolysis vibrio full gene group, the overall length of extine protein ompK DNA and the clone of a mature peptide coded sequence; secondly, the construction of a prokaryon expression plasmid of the ompK mature peptide coded sequence, thirdly, the obtaining way of the recombination ompK protein; fourthly, the detection to the immunity way and the immunity effect of a large yellow croaker with recombination ompK protein. The invention provides the preparation method of the assistant haemolysis vibrio ompK protein subunit vaccine, and simultaneously provides the detection method of the immunity effect of the large yellow croaker with recombination ompK protein, the preparation method is simple, and the usage is convenient.
Owner:ZHEJIANG UNIV

Use of lysozyme and relative pure deriv. or raw liquid for preventing and treating diseases in sea and frech-water breeding

An use of the high-purity product or raw liquid of lysozyme and associated derivative in preventing and treating the diseases caused by vibrio, streptococcus, Edward bacterium, etc of the fish, crab,and shrimp cultured in seawater or fresh water is disclosed.
Owner:长春奇龙生物技术研究所

Novel vibrio parahaemolyticus phage with wide lysis spectrum as well as specific primer and application thereof

The invention discloses a novel vibrio parahaemolyticus phage with a wide lysis spectrum, amplification application thereof and specific amplification primers of the phage, and the phage has a stronglysis effect on vibrio parahaemolyticus, can be specifically amplified by host bacteria, is short in proliferation time and high in fermentation product titer, and a bacteriophage source is provided for industrial production and application of the bacteriophage. The bacteriophage can be used for preparing a medicine for resisting vibrio parahaemolyticus, and a novel medicine is provided for controlling acute hepatopancreas necrosis syndrome caused by vibrio parahaemolyticus infection. After the bacteriophage is splashed on an aquaculture water body for one time, the quantity of vibrio parahaemolyticus in the water body can be obviously reduced; the phage is mixed and fed to penaeus vannamei, or the penaeus vannamei is soaked in the phage, so that infection caused by vibrio parahaemolyticuscan be effectively prevented and treated, and the survival rate of the penaeus vannamei is increased.
Owner:QINGDAO PHAGEPHARM BIO TECH CO LTD

Method for separating purified bdellovibrio from active sludge

The invention discloses a method for separating purified bdellovibrio from active sludge. By virtue of key techniques of host bacteria screening and active sludge pretreatment and technical steps such as preparation of a culture medium and a culture solution and optimization of culture conditions and the like, efficient bdellovibrio is separated and purified from a homologous sludge sample by optimization of a series of key steps by virtue of gram negative bacteria which are obtained in active sludge as host bacteria for separating and purifying bdellovibrio. The invention not only puts forwards a method for successfully separating the efficient bdellovibrio from the active sludge of a municipal wastewater treatment plant for the first time, but also the culture period of the method is remarkably shortened, so that the defects that the existing conventional method is unstable in bdellovibrio separating effect, long in culture period, tedious in operation and the like.
Owner:SOUTHEAST UNIV

Microorganisms as carriers of nucleotide sequences coding for antigens and protein toxins, process of manufacturing and uses thereof

A Escherichia, Salmonella, Yersinia, Vibrio, Listeria, Shigella, or Pseudomonas bacterium that has the following components: (I) a polynucleotide encoding a heterologous antigenic determinant that induces a CTL response against a tumor cell; (II) a polynucleotide encoding a heterologous protein toxin or toxin subunit; and (III) (a) a polynucleotide encoding a transport system that expresses the products of (I) and (II) on the outer surface of the bacterium or that secretes products of (I) and (II) from the bacterium; and (IV) a polynucleotide that activates the expression of one or more of (I). (II), and / Or (III) in the bacterium wherein polynucleotides (I), (II), (III) and (IV) are different from each other and polynucleotides (I), (II) and (III) encode proteins that are different from each other.
Owner:SOCIUM THERAPEUTICS INC

Method for testing biotoxicity of oil-field wastewater by employing vibrio qinghaiensis Q67

ActiveCN106755286ASolve the problem of not being able to express the biological toxicity of oil production wastewaterExperimental results are stableMicrobiological testing/measurementBioindicator SpeciesLuminous intensity
The invention discloses a method for testing biotoxicity of oil-field wastewater by employing vibrio qinghaiensis Q67. The oil-field wastewater is taken as test wastewater, the vibrio qinghaiensis Q67 is taken as a bioindicator and a 96-pore microwell plate is taken as a carrier; by adopting a 96-pore microwell plate analyzing method, the luminous intensity is detected by adopting a microwell plate spectraphotometer; and the luminescent inhibition rate is calculated by using the luminous intensity of an experiment group and a control group and Zn(NO3)2 is set as a toxic reference substance, thereby judging the biotoxicity of the oil-field wastewater. According to the method, the toxicity of the oil-field wastewater is detected and analyzed by using a microplate method; and the comprehensive toxicity of the oil-field wastewater is judged through calculating the luminescent inhibition rate of luminescent bacteria; the problem that conventional physicochemical indexes cannot represent the biotoxicity of the oil-field wastewater is solved; the method is fast, sensitive and convenient to popularize and apply; the selected toxic reference substance Zn(NO3)2 is steady in experiment result, low in price and medium in toxicity.
Owner:GUILIN UNIVERSITY OF TECHNOLOGY

Medicine for treating hemorrhage and fin rot of aquatic animals

InactiveCN101112429ATo achieve the purpose of killing germsEasy to solveAntibacterial agentsOrganic active ingredientsDiseaseTreatment effect
The present invention relates to a drug to treat the diseases of aquatic animals, which is the drug to treat the bleeding and gill-rot diseases of the aquatic animals. The present invention solves the problem that the treatment effects of the traditional drugs in the prior art for the diseases of the aquatic animals are not obvious. The invention is composed of 400 to 1000 parts of jingganmycin and traditional Chinese pharmaceutical excipients, the traditional Chinese pharmaceutical excipients are composed of one or any two or all of 100 to 400 parts of lightyellow sophora root, 200 to 400 parts of rhubarb and 100 to 500 parts of hairyvein agrimonia herb and bud by weight ratio. The drug of the present invention has good treatment effects on bleeding disease, gill-rot and other diseases in the aquatic animals, which also has good prevention and treatment effects especially for the bleeding disease caused by vibrio spp in hot season, furthermore, the cured diseases are not liable to recurrence.
Owner:王安林