Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

74 results about "Micropterus" patented technology

Micropterus is a genus of freshwater fish in the sunfish family (family Centrarchidae) of order Perciformes. The species of this genus are known as the black bass. The black bass are sometimes erroneously called black trout, but the name trout more correctly refers to certain members of the salmon family.

Micropterus salmoides compound feed and preparation method thereof

ActiveCN102132782ANatural attractantRich in growth-promoting factorsFood processingClimate change adaptationAnimal scienceFish oil
The invention relates to a micropterus salmoides compound feed, and in particular relates to a micropterus salmoides compound feed used for improving the growth performance of micropterus salmoides and improving the meat quality of the micropterus salmoides. The micropterus salmoides compound feed comprises the following components in parts by weight: 26-33 parts of Manhattan fish meal, 10-16 parts of bean pulp, 5-13 parts of peanut cakes, 8-10 parts of corn protein powder, 18-20.5 parts of high gluten flour, 1-3 parts of cuttlefish paste, 2-3 parts of molasses yeast, 0-1 part of table salt, 0.5-1.5 parts of monocalcium phosphate, 1-2 parts of fish oil, 1-2 parts of soyabean lecithin, 1-2 parts of vitamin premix compound and 1-2 parts of mineral substance premix compound. The invention takes the molasses yeast as a raw material of the feed for the first time, so that the binding property of the feed is improved, the cracked yeast cell wall is contained, the nonspecific immunity of themicropterus salmoides can be improved, the disease-resistant capability is enhanced, and the meat quality of the micropterus salmoides is obviously improved.
Owner:GUANGDONG EVERGREEN FEED INDAL

Micropterus salmonides culture method

The invention discloses a micropterus salmonides culture method. The method comprises the following steps of culture pond preparation, preparation before stocking, net cage grading, grading feeding, water quality management and catching. According to the micropterus salmonides culture method, the culture mode that culture ponds are combined with culture net cages is adopted, a good growth environment is provided for the growth of micropterus salmonides. Through a scientific and reasonable feed proportion, comprehensive nutrition is provided for the growth of the micropterus salmonides. The methods of grading culture and gradient feeding are adopted, and therefore the situation is effectively avoided that the micropterus salmonides kill each other because of overlarge differences among individuals in the feeding process, the survival rate of fish fry is increased, and the economic benefits of culturists are guaranteed.
Owner:漯河市源汇区水产渔政站

Compound feed for micropterus salmoids

InactiveCN101015330AImprove protectionComposition has no significant effectClimate change adaptationAnimal feeding stuffFish oilFodder
The invention relates to a fish fodder which comprises the following constituents (by weight percent): white fish meal 40.0-45.0, red fish meal 5.0-10.0, soybean waste 12.0-15.0, peanut bran 9.0-10.0, brewer's yeast 5.0-10.0, high grade flour 10.0-15.0, sea fish oil 4.0-5.0, soyabean oil 1.0-2.0, choline chloride 0.3-0.6, composite vitamins 0.5-1.0, mixed mineral salts 4.0-5.0, and the nutriment compositions include crude protein 48.25, and crude fat 11.56, ash 15.69 and water 5.89.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

SNP (single nucleotide polymorphism) marker related to rapid growth of micropterus salmoide L. 'excellent bass No. 1' and application of SNP marker

The invention discloses an SNP (single nucleotide polymorphism) marker related to rapid growth of micropterus salmoide L. 'excellent bass No. 1' and application of the SNP marker. The SNP marker is respectively shown as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3; the 658th base of SEQ ID NO.1 is C or A from 5' terminal, and the growth speed of CC individuals is obviously higher than that of AA individuals; the 327th base of SEQ ID NO.2 is A or G from 5' terminal, and the growth speed of AA individuals is obviously higher than that of GG individuals; and the 121th base of SEQ ID NO.3 is A or G from 5' terminal, and the growth speed of the AA individuals is obviously higher than that of the GG individuals. According to the application of the three SNP markers discovered in the invention, the parental line selection blindness of the micropterus salmoide L. 'excellent bass No. 1' can be greatly reduced, and micropterus salmoide L. individuals with high growth speed and genetic stability can be rapidly obtained.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Micropterus salmonides compound feed and preparation method thereof

The invention relates to micropterus salmonides compound feed and a preparation method thereof and belongs to the technical field of feed processing. The compound feed is prepared from the following components in parts by weight: 300-400 parts of fish meal, 200-300 parts of soybean meal, 100-250 parts of peanut meal, 200-250 parts of refined flour, 15-20 parts of monocalcium phosphate, 3-5 parts of choline chloride, 8-10 parts of a mineral substance premix, 2-4 parts of a vitamin premix, 1.5-2.5 parts of spiral seaweeds, 0.8-1.2 parts of silybum marianum and 0.8-1.2 parts of curcumin. The preparation method comprises the following steps: crushing the fish meal, the soybean meal and the peanut meal and sieving, and uniformly mixing with residual raw materials; then crushing and sieving the mixture in an ultrafine crusher; and after blending and granulating, drying, cooling, packaging and bagging to prepare the micropterus salmonides compound feed. With the adoption of the compound feed, the immunological competence of micropterus salmonides can be effectively improved and a physiological metabolism problem of the micropterus salmonides is solved; fatty livers are prevented so that the survival rate is improved; the feed can completely replace frozen and fresh seafood and can be used for feeding and culturing in a whole process, so that the pollution to a water body environment, caused by the fact that the frozen and fresh seafood is used for culturing, is solved; and the micropterus salmonides compound feed has relatively high economic benefits and remarkable social benefits.
Owner:GUANGDONG SHUANGHU FEED CO LTD

Starch-free starter compound feed for micropterus salmonides fries

The present invention discloses a starch-free starter compound feed for micropterus salmonides fries. The compound feed comprises the following components in percentages by mass: 55-65% of Peruvian steam fishmeal, 10-20% of soybean protein concentrate, 4-8% of pure kelp powder, 5-7% of a squid paste, 1-1.5% of soybean phospholipid oil, 3-6% of fish oil, 2-2.5% of calcium dihydrogen phosphate, 0.2-0.3% of lysine, 0.1-0.15% of methionine, 0.3-0.8% of choline chloride, 0.2-0.4% of compound multiple vitamin for micropterus salmonides and 1.6-1.8% of compound multiple minerals for the micropterus salmonides. The starter compound feed can meet long-term food intake, does not cause problems of abnormal liver metabolisms of fries, etc., and at the same time can significantly improve growth speed and survival rate of the fries.
Owner:广东大北农水产科技有限公司

Micropterus salmoides mixed feed with yeast hydrolysate replacing fish meal

InactiveCN104664167ALow costImprove liver disease problemsAnimal feeding stuffHydrolysatePea protein
The invention provides a micropterus salmoides mixed feed with yeast hydrolysate replacing fish meal. The micropterus salmoides mixed feed comprises 15-22 percent of the fish meal, 10-15 percent of pea protein powder, 10-15 percent of bean pulp, 1-5 percent of krill powder, 10-15 percent of gluten, 1-5 percent of phospholipid, 5-10 percent of fish oil, 1-5 percent of premix, 15-25 percent of flour, 1-5 percent of wheat middling, 0.5-3 percent of lysine, 0.1-1 percent of methionine, 0.1-1 percent of threonine and 1-8 percent of the yeast hydrolysate. The use amount of the fish meal is decreased, the cost is reduced, and the economic benefit of a farmer is increased; in addition, the ratio of liver weight and body weight can be reduced, and the intestinal and liver functions of micropterus salmoides are improved.
Owner:广东雅琪生物科技股份有限公司

Method for inhibiting iridovirus proliferation in RAS system micropterus salmoides culture process

The invention relates to the technical field of aquatic product culture, in particular to a method for inhibiting iridovirus proliferation in a micropterus salmoides culture process of an RAS system.The method comprises the step of adding citrus flavone extract and black Chinese wolfberry anthocyanin extract into the RAS system. According to the method, the citrus flavone extract and the black Chinese wolfberry anthocyanin extract have a synergistic effect, so that the proliferation of iridovirus is inhibited, and the technical problem that the iridovirus in an RAS culture system causes fishto die due to illness is solved. By implementing the scheme, cultured fishes can be prevented from being infected by iridovirus, the survival rate of aquatic products is increased, the quality of theaquatic products is improved, and economic losses are reduced.
Owner:CHONGQING TECH & BUSINESS UNIV +2

Ultra-low starch micropterus salmoides expanded feed and preparation method thereof

The invention relates to ultra-low starch micropterus salmoides expanded feed which comprises, by weight, 25-28 parts of Japanese-grade fish meal, 18-30 parts of tilapia meal, 5-15 parts of krill meal, 5-9 parts of fermented soybean meal, 3-7 parts of dried porcine soluble, 5-9 parts of strong flour, 1-2 parts of monocalcium phosphate, 5-8 parts of soybean phospholipid oil, 2-5 parts of soybean oil, 2-3 parts of squid visceral ointment extracts, 1-4 parts of fish dissolved pulp, 1.5-2.5 parts of micropterus salmoides vitamin premixed materials, 2.5-3.5 parts of micropterus salmoides mineral substance and other premixed materials and 0.2-0.3 part of emulsifying agents. Starch content of the micropterus salmoides expanded feed is ultra-low (starch is only from materials such as the soybean meal and flour, additional adding is omitted, and the content of the starch is ultra-low), harm to micropterus salmoides health is low, the feed can completely replace iced fresh trash fishes, so thatenvironmental pollution caused by iced fresh materials is reduced, and micropterus salmoides food safety risks are reduced.
Owner:佛山市顺德区旺海饲料实业有限公司

Fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses

The invention provides a fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses, comprising the following steps of: designing and synthesizing primers according to noncoding region sequences of DNA methyltransferase 3' sides of the micropterus salmoides ulcer syndrome viruses, previously amplifying 167 bp snippets: an upstream primer PF: 5'-GCTCGTTCGGTTGTGCTGAC-3', a downstream primer PR: 5'-GTGTCTCCCTGGTAGTCTTTCAAAC-3'; also synthesizing a probe PB: 5'-(FAM)ATCTGTGTAACCGCCCGCCGCAAAG(Eclipse)-3' used for fluorescence detection; and judging the content of virus particles contained in a sample according to detected CT (Computed Tomography) value through template DNA extraction and PCR amplified reaction. The invention has the advantages of fast detection and high detection accuracy.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Micropterus salmonides compound feed for substituting iced and fresh fish baits

The present invention belongs to the technical field of aquaculture feed and especially relates to a micropterus salmonides compound feed for substituting iced and fresh fish baits. The compound feed consists of the following components in mass percentage: 15%-18% of flour and potato starch, 15%-18% of soybean meal, 5%-8% of meat meal, 10%-20% of imported fish meal, 20%-25% of domestic fish meal, 3% of corn gluten meal, 2% of yeast paste, 2% of squid paste, 1%-2% of refined fish oil, 2%-3% of soybean oil, 1%-2% of calcium dihydrogen phosphate, 0.2%-0.5% of multivitamin, 1% of compound mineral, 0.1%-0.3% of choline chloride, and 0.2% of yeast cell wall polysaccharide, and the sum of each individual component is 100%. The highly concentrated micropterus salmonides feed improves survival and growth rate, reduces the dosage of drugs, and reduces farming costs in the application of micropterus salmonides breeding technology.
Owner:四川斯特佳饲料有限公司

Pond greenhouse efficient micropterus salmoides fry cultivation and domestication method

The invention discloses a pond greenhouse efficient micropterus salmoides fry cultivation and domestication method. The pond greenhouse efficient micropterus salmoides fry cultivation and domestication method comprises the following steps of constructing a culture pond, stocking micropterus salmoides fries, and carrying out cultivation and domestication in three stages. According to the pond greenhouse efficient micropterus salmoides fry cultivation and domestication method, the conditions for stocking the micropterus salmoides fries are controlled, constant-temperature living organism baits are artificially cultured through a bait feeding device, and after the micropterus salmoides fries are stocked, the micropterus salmoides fries are cultivated and domesticated step by step in stages through the bait feeding device; and different baits are fed to the micropterus salmoides fries in different stages of cultivation and domestication, the cultivated micropterus salmoides fries are healthy in physique and uniform in specification, the survival rate of micropterus salmoides fry cultivation and the domestication success rate are both 60% or above, large-specification high-quality fry guarantee is provided for small-scale scattered household largemouth bass cultivation, and the method has great practical application and production value.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

Micropterus salmonides aquaculture system and aquaculture method

ActiveCN109197733ASolve the high incidenceSolve the problem of low feeding rateClimate change adaptationPisciculture and aquariaMicroorganismTreatment pond
The invention provides a Micropterus salmonides aquaculture system and aquaculture method. The system comprises a pond, a sewage collection well and a water circulation device; the bottom of the pondis connected with the sewage collection well through a sewage discharging pipe; the sewage collection well is composed of a main well and an auxiliary well; the auxiliary well is located at one side of the main well; the bottom of the auxiliary well is provided with a drain pipe; an isolation filter layer is arranged on the top of the main well; a manure outlet is arranged at the bottom of the main well; the manure outlet is connected with the auxiliary well through a manure outgoing pipe; the tail end of the manure outgoing pipe is higher than the manure outlet at the bottom of the main well;the outlet end of the sewage discharging pipe is connected with a gas exhaust pipe and an auxiliary water outgoing pipe, wherein the gas exhaust pipe and the auxiliary water outgoing pipe have upwards-facing openings; the air exhaust opening of the air exhaust pipe is higher than the isolation filter layer; one side of the lower end portion of the gas exhaust pipe is connected with a main water outgoing pipe; the auxiliary water outgoing pipe is communicated with the auxiliary well; a long pipe is inserted into the opening of the auxiliary water outgoing pipe; the water circulation device includes a pond water pipe, a sewage collection well water pump, a sewage collection well water pipe, a circulating water pump, a microbial treatment tank, and a return pipe; water in the pond and the sewage collection well is pumped to the microbial treatment tank; the water is treated; the treated water is returned to the pond; and therefore, the problem of the discharge of aquaculture wastewater can be solved.
Owner:佛山市顺德区旺海饲料实业有限公司

Micropterus salmoides premix

InactiveCN106260788APrevention of Hepatobiliary SyndromeEasy to purchaseFood processingClimate change adaptationDiseaseMedicine
The invention discloses a micropterus salmoides premix which comprises a traditional Chinese medicine additive. The traditional Chinese medicine additive comprises, by weight, 30-40 parts of narrow-leaved oleaster, 20-30 parts of cockscomb, 15-25 parts of dried orange peel and 10-20 parts of hawthorn. The micropterus salmoides premix can meet nutritional requirements of micropterus salmoides, the digestive absorption function of the micropterus salmoides is improved, physique is enhanced, body immunity is improved, disease incidence rate is reduced, so that optimal growth performance is exerted, and optimal culture benefits are achieved.
Owner:GUANGZHOU NUTRIERA BIOTECH CO LTD +1

Micropterus salmoides fry micro-particle feed and preparation method thereof

The invention discloses a micropterus salmoides fry micro-particle feed and a preparation method thereof. The feed comprises the following raw material components in 1000kg: 290kg-370kg of euphausia superba powder, 130kg-170kg of egg white powder, 110kg-130kg of whitefish powder, 20kg-40kg of tenebrio molitor powder, 140kg of alpha-starch, 100kg of soybean protein concentrate, 50kg of vital gluten, 30kg of fish oil, 20kg of phospholipid oil, 15kg of calcium dihydrogen phosphate, 5.0kg of fish microelements, 2.5kg of choline, 2.0kg of glycine betaine, 1.2kg of bentonite, 1.0kg of fish multi-vitamin, 1.0kg of a mildew preventive, 1.0kg of vitamin C, 0.5kg of carnitine, 0.5kg of an antioxidant and 0.3kg of inositol. The feed has the advantages of low cost, stable yield and quality, and high survival rate of fries and low fry malformation rate, and can completely replace natural biological bait.
Owner:SHANGHAI NONGHAO FEED

Colloidal gold visual detection method for Micropterus salmoides iridovirus and probe for method

The invention discloses a colloidal gold visual detection method for Micropterus salmoides Ranavirus iridovirus and a probe for the method; the method comprises: incubating the probe with colloidal gold to obtain AuNPs-probe; extracting virus DNA in Micropterus salmoides to be detected; mixing the virus DNA with AuNPs-probe, culturing at 37 DEG C, and adding NaCl solution; observing the color change of the mixed solution 2 minutes later; if the color of the mixed solution is still red, determining that the result is negative, and if the color of the mixed solution is gray blue, determining that the result of the sample is positive. The method is simple, low in cost, high in speed and reliable, and is more suitable for on-site detection. The invention provides the effective method for rapiddetection of Micropterus salmoides iridovirus and provides technical guarantee for aquaculture.
Owner:ZHEJIANG GONGSHANG UNIVERSITY

Germ cell hatching method in Micropterus salmoides early breeding process

The invention belongs to the fish breeding field, and specifically relates to a germ cell hatching method in a Micropterus salmoides early breeding process; the hatching method comprises the following steps: setting up a hatching greenhouse, wherein the hatching greenhouse comprises a hatching pond and a greenhouse body arranged on the hatching pond; placing an artificial fish nest attached with germ cells into the hatching pond; setting up a temperature control system in the hatching greenhouse; controlling the hatching pond water temperature to be at 25-28 DEG C. Furthermore, setting up a matching hatching water filter system on the hatching pond upper stream, and setting up a water discharge structure on the hatching pond downstream. Test shows, by setting up the temperature control system in the hatching pond and controlling the hatching pond water temperature to be at 25-28 DEG C, the Micropterus salmoides germ cells can be effectively prevented from getting saprolegniasis, thus greatly improving hatching survival rate of the germ cells. The hatching water filter system can ensure the hatching water quality and prevent hostile organisms from entering the hatching pond; the water discharge structure can be used for replacing water for the hatching pond, or applied in water flow operations.
Owner:安徽长江渔歌渔业股份有限公司

Larval micropterus salmoides food conversion domestication method

The invention relates to a larval micropterus salmoides food conversion domestication method. The method is characterized by comprising the following steps of (1) selecting and setting a domesticationpool; 2) preparing before stocking; 3) putting fries; 4) food conversion domestication, specifically, I, feeding live freshwater rotifers; II, after 1-3 days, mixing frozen rotifers with water for feeding; III, after 1-2 days, carrying out feeding through mixed feed, wherein the mixed feed is obtained by mixing the frozen rotifers with water and artificial compound granular baits according to themass ratio into paste, and sequentially reducing the number of the frozen rotifers according to the proportion of 1: 1, 0.75: 1 and 0.5: 1 until the frozen rotifers are completely replaced by the artificial compound granular baits; and IV, after 1-2 days, carrying out feeding for 1-2 days through the artificial compound granular baits; 5) daily management; and (6) putting fries into a pond, namely transferring the successfully-fed micropterus salmoides fries to an outdoor soil pond for culture, wherein the culture baits are all artificial compound granular baits. According to the method, through continuously adjusting the proportion of the mixed feed for food conversion domestication, the larval micropterus salmoides fries are induced to be fed with the artificial compound granular baitsin an initial stage, the feeding cost is reduced, and the survival rate in the domestication and food conversion process is increased.
Owner:天津市水产研究所

Fish poly-culturing production increasing technology

The invention discloses a fish poly-culturing production increasing technology, and relates to a breeding method of fishes. The technology is characterized by comprising the following step of: selecting two or more of carps, crucians, mandarin fishes, snakeheaded fishes, micropterus salmonoides, silver carps, grass carps, bream fishes or megalobrama amblycephala for poly-culturing. By adopting the poly-culturing method, water quality can be adjusted, disease can be prevented and controlled, the yield of the fishes can be increased without increasing bait casting or increasing investment, the fish breeding benefit is increased, meanwhile, the fish breeding cost is also reduced.
Owner:苏芹

Zero-emission micropterus salmoides temperature-control fry breeding method

The invention discloses a zero-emission micropterus salmoides temperature-control fry breeding method, and belongs to the technical field of aquaculture. The method comprises the steps of site selection and treatment, installation of a filtration device and a heating pipeline, artificial wetland plant cultivation, cleaning and finishing of a fry breeding pond, water temperature control, fry putting, breeding management, large-specification fingerling breeding and the like. Industrial circulating water facilities are utilized, through the combined application of the water temperature control technology and the water quality treatment technology, micropterus salmoides industrial temperature-control fry breeding is carried out in late winter and early spring, after large-specification fingerlings are bred, the fingerlings are bred outdoors in different ponds, and the market specification can be achieved at the end of September. According to the method, the large-specification micropterus salmoides fry can be bred so as to achieve the goal that micropterus salmoides is bred and sold in the market in the current year; besides, feeding of chilled fresh fishes is avoided in the whole breeding process, and the cost can be reduced.
Owner:HUAIYIN TEACHERS COLLEGE

Micropterus salmoides gender-related molecular marker

InactiveCN112111582AGender-accurate distinctionGender distinctionMicrobiological testing/measurementDNA/RNA fragmentationFisheryA-DNA
The invention provides a micropterus salmoides gender-related molecular marker. The sequence of a DNA fragment in a male fish is SEQ ID NO: 1, and the sequence of a DNA fragment in a female fish is SEQ ID NO: 2. According to the micropterus salmoides gender-related molecular marker, the DNA fragments with gender difference are screened from micropterus salmoides, and detection primers are designedaccording to the different fragments so that the gender of the micropterus salmoides can be quickly and accurately distinguished; and the provided micropterus salmoides gender identification method has important significance and application value for family establishment, control of the male and female gender ratio of a breeding group and promotion of sustainable and healthy development of the micropterus salmoides breeding industry.
Owner:HUZHOU TEACHERS COLLEGE

Breeding method for micropterus salmonides in autumn

The invention discloses a breeding method for micropterus salmonides in autumn. The method comprises the following steps: 1) parent selection; 2) cultivation in a cement pond; 3) low-temperature induction; 4) nutrient regulation and control; 5) injection of a gonad modifier; 6) reinforced cultivation of parents; and 7) breeding in autumn. The breeding method provided by the invention adopts the methods such as the cultivation in the cement pond, the low-temperature induction, the nutrient regulation and control, the injection of the gonad modifier and the like, the micropterus salmonides can develop twice a year, after spawning is performed in spring, gonads are matured again in the current year, breeding in autumn is realized, breeding of the micropterus salmonides in autumn is realized for the first time, and the technology of breeding of the micropterus salmonides in autumn is broken.
Owner:金澄福生物科技(苏州)有限公司

Micropterus salmoides standard fry domestication method

The invention discloses a micropterus salmoides standard fry domestication method. The method includes that according to different fry stages, indoor fry ponds in different shapes and areas are selected, wherein the fry release density is 50,000-100,000 fry / cm<3>. A bait feeding method includes: (1) feeding with bait in four times each day; (2) gradually narrowing a feeding range; (3) starting feed domestication from the fifth day, wherein feeds including powder, a B2 material, a B3 material and an F3 material are added sequentially; (4) making the daily feeding quantity account for 10-30% ofthe fry weight; (5) screening. When a climatic environment is unsuitable, an indoor domestication technique is implemented, immunity of the fry is improved, activity is improved as well, and the fry survival rate is increased; by technical key point control of artificial culture of initial feed, artificial compound feed domestication and the like, micropterus salmoides standard fry culture techniques are integrated; by adoption of granulated feed for substituting iced fish in popularization and application to an aquaculture process, a consumption-reduction quality-improvement ecological aquaculture mode is shown, and win-win results of economic benefits and ecological benefits are achieved.
Owner:金澄福生物科技(苏州)有限公司

Micropterus salmoides brain cell line and application thereof

The invention discloses a micropterus salmoides brain cell line and application thereof, the micropterus salmoides brain cell line has been preserved in the China Center for Type Culture Collection on March 25, 2021, and the preservation number is CCTCC NO: C202166. The micropterus salmoides brain cell line MSBr is stable in passage, has been successfully passed for more than 65 generations at present, is good in growth state, is wide in application range, not only can be used for virus isolation and identification, pathogen function research, environmental pollutant detection, gene screening and function analysis, fish tumor research and the like, but also can be used for preparing the micropterus salmoides brain cell line MSBr. Meanwhile, the method can also be used for monitoring and diagnosing viral diseases of aquatic animals, investigating and researching epidemiology, developing diagnostic kits for related viral diseases, developing vaccines and the like, and has relatively high application value and social and economic value.
Owner:HUAZHONG AGRI UNIV

Micropterus salmoides fingerling out-of-season cultivation method

The invention discloses a micropterus salmoides fingerling out-of-season cultivation method which comprises the following steps: S1, pond preparation: the area of a pond is 5-8 mu and after pond wateris drained, the thickness of sludge in the pond is kept at 8-12 cm, about 5-15 cm of accumulated water is left in the pond, quick lime is used for cleaning the pond at 100-150 Kg / mu, and after 7-14 days, water is injected into the pond, the water injection depth is 0.8-1.8 m, and a net cage is arranged in the pond. The micropterus salmoides SHUIHUA in autumn are cultured through the net cages, and the survival rate of the SHUIHUA can be effectively increased; secondly, the bait utilization rate can be increased through cultivation in a cement pond, and the fry physique is effectively enhanced; finally, proper growth temperature is provided for the fish fries in winter through a greenhouse and a boiler temperature control technology, and therefore it is guaranteed that the fish fries are kept in a rapid growth state all the time to be cultured into large-size fish fries. The micropterus salmoides large-size fingerling out-of-season breeding technology provides technical support for production of micropterus salmoides large-size fingerlings, and meanwhile has great significance in promoting transformation and upgrading of micropterus salmoides breeding modes in northern areas.
Owner:HUAIYIN TEACHERS COLLEGE

Micropterus salmoides juvenile puffed feed capable of increasing standard fry survival rate and preparation method thereof

The invention relates to micropterus salmoides juvenile puffed feed capable of increasing standard fry survival rate and a preparation method thereof. The feed comprises, by weight, 35-45 parts of Japanese-grade fish meal, 3-12 parts of fermented bean meal, 20-25 parts of high-gluten flour, 2-5 parts of fish oil, 2-7 parts of algin, 1-3 parts of fish dissolved pulp, 5-15 parts of krill powder, 2 parts of micropterus salmoides vitamin premix, 3 parts of micropterus salmoides mineral and other premix, 1-2 parts of Chinese herbal medicine immune preparation mixture and 1 part of live maggot antibacterial peptide magma preparation. The Chinese herbal medicine immune preparation mixture is added into the feed, and flavone and glycoside thereof, organic acid, flavane and polymer thereof contained in hawthorn in the Chinese herbal medicine immune preparation mixture can play an important role in improving food intake of fishes and promoting appetite; herba andrographitis, radix isatidis, cortex eucommiae and herba lysimachiae have antivirus effect, so that the feed has better effect.
Owner:佛山市顺德区旺海饲料实业有限公司

Aquatic feed mixing, processing and granulating device for micropterus salmoides

The invention discloses an aquatic feed mixing, processing and granulating device for micropterus salmoides. A workbench is provided, and supporting columns are fixedly arranged on the lower portionsof the four corners of the workbench correspondingly. A supporting plate is fixedly arranged on the workbench. A crushing cylinder and a mixing cylinder are sequentially and fixedly arranged on one side of the upper end of the supporting plate from top to bottom, a first motor and a first feeding opening are fixedly formed in the crushing cylinder, a rotating shaft of the first motor extends intothe crushing cylinder and is fixedly provided with a first transmission shaft, and a spiral crushing blade is fixedly arranged on the outer wall of the first transmission shaft. The invention has thebeneficial effects that granulated granules can be dried, so that the granules are not easy to adhere together, the quality of the granulated granules can be guaranteed, the micropterus salmoides is balanced in nutrition after being eaten by the micropterus salmoides due to uniform mixing of the raw materials, the growth of the micropterus salmoides is facilitated, the operation is simple, the automation degree is high, and the workload of workers is greatly reduced.
Owner:福建大昌盛饲料有限公司

Ultralow temperature cryopreservation and recovery method of Micropterus salmoides sperm

The invention provides an ultralow temperature cryopreservation and recovery method of Micropterus salmoides sperm, which comprises the following steps: (1) collecting seminal fluid, (2) selecting anti-freezing liquid, (3) diluting and balancing sperms, (4) refrigerating sperms, (5) unfreezing and recovering sperms. The method provided by the invention has the advantages of short operation time, good induction effect, little toxicity effect, little damage degree, high survival rate, etc., and has important theoretical meanings and application values for germplasm preservation, genetic breeding, sustainable culture and disease control and other aspects. The invention also provides a purpose of ultralow temperature cryopreservation and recovery method of Micropterus salmoides sperm.
Owner:SUZHOU MUNICIPAL SHENHANG ECO TECH DEV CO LTD

Micropterus salmoides out-of-season breeding and large-scale fry large-scale breeding method

The invention provides a micropterus salmoides out-of-season breeding and large-scale fry large-scale breeding method. The method comprises the following steps of 1, population breeding of parents; 2, carrying out first-time intensified cultivation on micropterus salmoides breeding parents; 3, simulating overwintering treatment; 4, carrying out second-time intensified cultivation on the micropterus salmoides breeding parents; 5, prenatal ripening acceleration and artificial spawning induction; 6, artificial incubation; and 7, large-scale fry breeding. According to the method, key technologies such as the population breeding of the parents, two-time intensified breeding, illumination and low-temperature treatment, artificial ripening and spawning induction are adopted, the parents with robust physique are screened and bred, spawning induction breeding can be achieved twice a year, specifically, after spawning in spring, parent fish gonads can be mature again in the current year under proper breeding condition, so that out-of-season breeding and aquaculture are achieved; the out-of-season breeding and large-scale fry large-scale breeding of the micropterus salmoides are completed on a large-scale for the first time, out-of-season large-scale fry of the micropterus salmoides are bred, the out-of-season large-scale fry of the micropterus salmoides are obvious in growth advantage and high in stress resistance, and balanced marketing of the micropterus salmoides from August to October in the next year can be achieved.
Owner:HUAZHONG AGRI UNIV

MSRV (micropterus salmoides rhabdovirus) egg yolk antibody

The invention discloses an MSRV (micropterus salmoides rhabdovirus) egg yolk antibody. The antibody is prepared with the following method: (1) MSRV is obtained from micropterus salmoides infected withthe MSRV through separation and culture; (2) the MSRV is inactivated; (3) laying hens of 180-190 day ages are immunized with the inactivated MSRV as an antigen, eggs of immunized laying hens are collected, and the egg yolk antibody is extracted and purified from egg yolk of the eggs. The antibody neutralizes the MSRV effectively to terminate virus infection, provides an effective passive immunitypreparation for prevention and control of the virus later and has great significance in decreasing virus carrying rate of parents and increasing survival rate of chicks.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES