Unlock instant, AI-driven research and patent intelligence for your innovation.

Micropterus salmoides gender-related molecular marker

A technology of largemouth bass and molecular markers, which is used in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problem of difficulty in distinguishing male and female largemouth bass.

Inactive Publication Date: 2020-12-22
HUZHOU TEACHERS COLLEGE
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But after the spawning season is over, it is difficult to distinguish between male and female largemouth bass in terms of morphology and behavior

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Micropterus salmoides gender-related molecular marker
  • Micropterus salmoides gender-related molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Screening and verification of male-specific DNA fragments of largemouth bass

[0027] Through the screening method of sex-related AFLP molecular markers, different primer combinations were selected from males and females for screening, and two pairs of primers amplified male and female specific bands. After sequencing analysis, two different DNA fragments of male and female largemouth bass were found. Among them, the specific DNA fragment of male largemouth bass is 268bp in length, and its sequence is SEQ ID NO: 1:

[0028] TATCTATTAACTCCACTCTTTCTATTAGAATGACAAGTATGAGATATGCTCAGCTCTCATATTGCCAAGGCAGCTTTCTCAGTCTTTATGATGATACGACAATGTCAAGAAAAGCAGCATCCA ATTCGTAATTCTCCT TAAACCATTAAACTGTTGTAACATAAATAGTTTAGGTGCCGTCTCCACTATTATTGTTCAACTATTATTCCTACTGTTAACAATAACAAAAATTAAAATTTCTATGAGTCTCCGTGTTGTTATTATTGAATG

[0029] The length of the specific DNA fragment of female largemouth bass is 254bp, and its sequence is SEQ ID NO: 2:

[0030] TATCTATTAACTCCACTCTTTCTATTAGAATGACAAGTAT...

Embodiment 2

[0032] Embodiment 2: Primer design and detection method for detection

[0033] Use the Primerselect function in the molecular biology software Lasergene to design primers for PCR amplification, and determine the sequences of the primers as follows:

[0034] Upstream primer: 5′-TATCTATTAACTCCACTCTTTC-3′

[0035] Downstream primer: 5′-CATTCAATAATAACAACACGGAG-3′;

[0036] In male individuals, the expected length of the amplified product was 268bp, and in female individuals, the length of the amplified fragment was 254bp.

[0037] The male and female largemouth bass whose sex was determined were selected, and after DNA was extracted, the above primer pairs were used for detection.

[0038] Specific steps are as follows:

[0039] 1. DNA extraction of male and female largemouth bass:

[0040] Use the phenol-chloroform method to extract the DNA of largemouth bass fin rays. The extracted samples are identified by 1% agarose gel electrophoresis for their integrity, and their OD val...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a micropterus salmoides gender-related molecular marker. The sequence of a DNA fragment in a male fish is SEQ ID NO: 1, and the sequence of a DNA fragment in a female fish is SEQ ID NO: 2. According to the micropterus salmoides gender-related molecular marker, the DNA fragments with gender difference are screened from micropterus salmoides, and detection primers are designedaccording to the different fragments so that the gender of the micropterus salmoides can be quickly and accurately distinguished; and the provided micropterus salmoides gender identification method has important significance and application value for family establishment, control of the male and female gender ratio of a breeding group and promotion of sustainable and healthy development of the micropterus salmoides breeding industry.

Description

technical field [0001] The invention provides a sex-related molecular marker of largemouth bass, which belongs to the technical field of fish sex identification. Background technique [0002] Largemouth bass (Micropterus salmoides), commonly known as California bass, black bass, belongs to Perciformes (Perciformes), Percoidei (Porcoidei), sunfish family (Cehtrachidae), black bass (Micropterus), native to North America, It is a worldwide game fish. Largemouth bass are divided into two subspecies according to their geographic distribution and morphology of origin: one is the northern subspecies of largemouth bass (M. salmoides salmoides); another is the Florida subspecies of largemouth bass (M. salmoides floridanus) found in southern Florida. Taiwan Province of my country introduced this fish from abroad in the late 1970s, and succeeded in artificial breeding in 1983. In the same year, it was introduced into Guangdong Province. After years of breeding and development, it has...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6879C12N15/11
CPCC12Q1/6879C12Q1/6888C12Q2600/156
Inventor 朱俊杰刘标刘春冬陆国富
Owner HUZHOU TEACHERS COLLEGE