Molecular marker for identifying genetic sex of micropterus salmoides and application

A molecular marker, largemouth bass technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc. Fast, easy to widely popularize and use, purposeful effect

Active Publication Date: 2021-11-12
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Similar to most fish species, the sex of largemouth bass is indistinguishable by external characteristics until the reproductive season, and to date there has been little research related to the genetic sex of largemouth bass

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for identifying genetic sex of micropterus salmoides and application
  • Molecular marker for identifying genetic sex of micropterus salmoides and application
  • Molecular marker for identifying genetic sex of micropterus salmoides and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Obtaining SNPs Related to Genetic Sex Identification of Largemouth Bass

[0026] According to the genome data of largemouth bass, resequencing analysis was performed on female largemouth bass and male largemouth bass, and a large number of SNP molecular markers were found between male and female fish. Some of the SNP molecular markers were screened at random, and the information of one of the SNP molecular markers in the genomes of male and female individuals is shown in Table 1.

[0027] Table 1 SNP molecular marker information screened

[0028]

Embodiment 2

[0029] Example 2 PCR product sequencing verification SNP site accuracy

[0030] The genome sequence of largemouth bass is shown in SEQ ID NO: 1, wherein the 226th base is C or G, there are two genotypes CC and CG, and the 392nd base is A or T, there are two genotypes AA and AT:

[0031] TGTGGTGTTATGTACATGCGGTGGATTTGGTATGCAGTATAAACAATATAAAATATTT GAAATAAGTGTTAACAGCTCTGAAAGAGAGAATGATGAATAAATAACCAGTAAACAGGT GCTGATTAGAGGCAGAGTTACTGGGTTACTGCACAGGAATTGTTCCTGCCACTGTGAGT CAGAGTCAGCTGTTCATCAGAGTGATGGCTTGTGGGAAGGAACTGTCCC[C / G]GAGTCT GTTGGTTTTGGCGTACAGTGCTCTGTAGCGCCTACCAGAGGGGAGGAGCTGGAACAGG TCGTGTCCGGGGTGAGATGGATCTGCAGTGATGTTTCCTGCCAGTTTCCTGACTCTGGA AATGTAGAAGTCCCGACTGTCCGTTGTAGTCTGCTCCTGTCC[A / T]TTGACAGACAGACA ATCTAAGGGGCCAGCTCAGTTGTAGGAAATTCAGTTTCATACCTGTGTTAAACACAGGG GGCCATCGTCCCTTATAATGACTCACCCGTACGCACCTCTATTTTTTGGGTAAAGAAAAT CCATGAGGAGACTTAACCTACAGAGTGGCATTTTGTTCAGGACCTTCAGGTG(SEQ IDNO:1)。

[0032] In this example, 30 largemouth bass samples from 3 populations (with genetic sex deter...

Embodiment 3

[0042] Example 3 SNaPshot SNP typing verifies the accuracy of SNP sites

[0043] The accuracy of the above-mentioned SNP site is identified by the SNaPshot method, including the following steps:

[0044] In this experiment, 74 largemouth bass samples from 5 populations (with genetic sex determined) were used for sex identification. Group 1 is the group of largemouth bass "You Bass No. 1" reserved in the Pearl River Fisheries Research Institute (8 males and females each), and Group 2 is the group "You Bass No. 3" raised by farmers in Foshan City (8 males and females each). 3 is the breeding group (8 females and 8 males) of Liyang Aquatic Products Company in Yangshan County, Qingyuan City in 2020; Group 4 is the breeding group (8 females and 8 males) of Guangdong Liangshi Aquatic Seed Industry Co., Ltd. Yingde Base; and 5 is the breeding group in 2020 Collected largemouth bass "Taiwan, China" breeding population samples (5 males and 5 females).

[0045] 1) Primer sequence

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a molecular marker for identifying genetic sex of micropterus salmoides and application. The nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1. DNA fragments with gender differences are screened from the micropterus salmoides, the SNP molecular marker with the genome sequence of SEQ ID NO: 1 is used for genetic sex identification of the micropterus salmoides, and detection primers are designed according to the different fragments, so that the sex of the micropterus salmoides can be quickly and accurately distinguished. By utilizing an SNP locus disclosed by the invention, the heredity of the micropterus salmoides can be quickly identified in production, and the SNP locus has an important application value in the aspect of unisexual breeding of the micropterus salmoides and also has an important application prospect in sex determination gene positioning and sex determination mechanism research. Compared with previous dissection detection or genital hole observation, the technology has the advantages of being high in purposiveness and accuracy, easy in operation, rapid in detection, small in damage to a fish body and easy to popularize.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to molecular markers and applications for identifying the genetic sex of largemouth bass. Background technique [0002] Largemouth bass (Micropterus Salmodes L.), commonly known as California perch, is native to freshwater lakes and rivers in North America. It has the advantages of no intermuscular spines, delicious meat, rapid growth, and short breeding cycle. Since it was introduced into my country in 1983, after more than 30 years of development, it has become an important freshwater aquaculture species in my country. In recent years, its breeding area has shown a trend of shifting from south to north and from coastal to inland, with the most obvious increase in Hunan, Hubei, Henan and other places. However, while the largemouth bass farming industry is developing rapidly, it is also facing some key problems in the industry. In Guangdong, where the tempera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6879C12N15/11
CPCC12Q1/6888C12Q1/6879C12Q2600/156Y02A40/81
Inventor 李胜杰周家辉杜金星姜鹏雷彩霞
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap