Molecular marker for identifying genetic sex of micropterus salmoides and application
A molecular marker, largemouth bass technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc. Fast, easy to widely popularize and use, purposeful effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Obtaining SNPs Related to Genetic Sex Identification of Largemouth Bass
[0026] According to the genome data of largemouth bass, resequencing analysis was performed on female largemouth bass and male largemouth bass, and a large number of SNP molecular markers were found between male and female fish. Some of the SNP molecular markers were screened at random, and the information of one of the SNP molecular markers in the genomes of male and female individuals is shown in Table 1.
[0027] Table 1 SNP molecular marker information screened
[0028]
Embodiment 2
[0029] Example 2 PCR product sequencing verification SNP site accuracy
[0030] The genome sequence of largemouth bass is shown in SEQ ID NO: 1, wherein the 226th base is C or G, there are two genotypes CC and CG, and the 392nd base is A or T, there are two genotypes AA and AT:
[0031] TGTGGTGTTATGTACATGCGGTGGATTTGGTATGCAGTATAAACAATATAAAATATTT GAAATAAGTGTTAACAGCTCTGAAAGAGAGAATGATGAATAAATAACCAGTAAACAGGT GCTGATTAGAGGCAGAGTTACTGGGTTACTGCACAGGAATTGTTCCTGCCACTGTGAGT CAGAGTCAGCTGTTCATCAGAGTGATGGCTTGTGGGAAGGAACTGTCCC[C / G]GAGTCT GTTGGTTTTGGCGTACAGTGCTCTGTAGCGCCTACCAGAGGGGAGGAGCTGGAACAGG TCGTGTCCGGGGTGAGATGGATCTGCAGTGATGTTTCCTGCCAGTTTCCTGACTCTGGA AATGTAGAAGTCCCGACTGTCCGTTGTAGTCTGCTCCTGTCC[A / T]TTGACAGACAGACA ATCTAAGGGGCCAGCTCAGTTGTAGGAAATTCAGTTTCATACCTGTGTTAAACACAGGG GGCCATCGTCCCTTATAATGACTCACCCGTACGCACCTCTATTTTTTGGGTAAAGAAAAT CCATGAGGAGACTTAACCTACAGAGTGGCATTTTGTTCAGGACCTTCAGGTG(SEQ IDNO:1)。
[0032] In this example, 30 largemouth bass samples from 3 populations (with genetic sex deter...
Embodiment 3
[0042] Example 3 SNaPshot SNP typing verifies the accuracy of SNP sites
[0043] The accuracy of the above-mentioned SNP site is identified by the SNaPshot method, including the following steps:
[0044] In this experiment, 74 largemouth bass samples from 5 populations (with genetic sex determined) were used for sex identification. Group 1 is the group of largemouth bass "You Bass No. 1" reserved in the Pearl River Fisheries Research Institute (8 males and females each), and Group 2 is the group "You Bass No. 3" raised by farmers in Foshan City (8 males and females each). 3 is the breeding group (8 females and 8 males) of Liyang Aquatic Products Company in Yangshan County, Qingyuan City in 2020; Group 4 is the breeding group (8 females and 8 males) of Guangdong Liangshi Aquatic Seed Industry Co., Ltd. Yingde Base; and 5 is the breeding group in 2020 Collected largemouth bass "Taiwan, China" breeding population samples (5 males and 5 females).
[0045] 1) Primer sequence
[...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com