2210 results about "Forward primer" patented technology

The present invention is directed to methods, reagents, kits, and compositions for identifying and quantifying target polynucleotide sequences. A linker probe comprising a 3′ target specific portion, a loop, and a stem is hybridized to a target polynucleotide and extended to form a reaction product that includes a reverse primer portion and the stem nucleotides. A detector probe, a specific forward primer, and a reverse primer can be employed in an amplification reaction wherein the detector probe can detect the amplified target polynucleotide based on the stem nucleotides introduced by the linker probe. In some embodiments a plurality of short miRNAs are queried with a plurality of linker probes, wherein the linker probes all comprise a universal reverse primer portion a different 3′ target specific portion and different stems. The plurality of queried miRNAs can then be decoded in a plurality of amplification reactions.

The present teachings provide methods, compositions, and kits for reverse transcribing and amplifying small nucleic acids such as micro RNAs. High levels of multiplexing are provided by the use of a zip-coded stem-loop reverse transcription primer, along with a PCR-based pre-amplification reaction that comprises a zip-coded forward primer. Detector probes in downstream decoding PCRs can take advantage of the zip-code introduced by the stem-loop reverse transcription primer. In some embodiments, further amplification is achieved by cycling the reverse transcription reaction. The present teachings also provide compositions and kits useful for performing the reverse transcription and amplification reactions described herein.

In one aspect, the present invention provides methods for amplifying a microRNA molecule to produce DNA molecules. The methods each include the steps of: (a) using primer extension to make a DNA molecule that is complementary to a target microRNA molecule; and (b) using a universal forward primer and a reverse primer to amplify the DNA molecule to produce amplified DNA molecules. In some embodiments of the method, at least one of the forward primer and the reverse primer comprise at least one locked nucleic acid molecule.

The invention discloses a method and primers for detecting mi ribonucleic acid (miRNA) and application of the method. The method comprises the following steps of: performing reverse transcription on the miRNA in a sample by using a reverse transcription primer formed by specific basic groups and Oligo (dT); and performing real-time polymerase chain reaction (PCR) quantitative detection on the miRNA by using a specific forward primer, a general reverse primer and a general probe. The invention has the characteristics that: the sensitivity and the specificity of the method are obviously higher than those of the conventional method; high-throughput analysis can be performed; and the method is simply and quickly operated, is low in cost, and can be widely used for early diagnosis and prediction of critical diseases such as tumors and the like.

The invention relates to a novel Universal RT-coupled PCR strategy for the specific detection and accurate quantitation of mRNA. Claimed and disclosed are novel Universal reverse transcription (RT) primers, a specific primer mix containing the Universal RT-primers, a transcript specific forward primer and a reverse PCR primer identical to a unique tag sequence, and methods and kits thereof for avoiding the amplification of genomic DNA and / or pseudogenes.

One-step RT-PCR methods, compositions and kits for the detection and quantification of small RNAs in a sample are disclosed. The one-step RT-PCR approach involves polyadenylation of a small RNA followed by reverse transcription with a first primer containing a poly(T) sequence and at least two 3′ nucleotides complementary to the 3′ terminal end nucleotides of the small RNA, to produce a cDNA. This may be followed by PCR amplification using the same first primer as the revere primer and a second, forward primer in which a portion of its sequence is complementary to the 3′ terminal end of the cDNA. This may be then followed by detection and / or quantification of the amplified product.

The present invention is directed to methods, reagents, kits, and compositions for detecting target polynucleotide sequences, especially small target polynucleotides such as miRNAs, between two samples. A pair of linker probes can be employed in two different reactions to query a particular species of target polynucleotide. A pair of detector probes, a single forward primer specific for the target polynucleotide, and a reverse primer can be employed in an amplification reaction to query the difference in expression level of the target polynucleotide between the two samples. In some embodiments a plurality of small miRNAs are queried with a plurality of linker probes. The plurality of queried miRNAs can then be decoded in a plurality of amplification reactions.

The present invention provide a process for sequence-specific nucleic acid amplification capable of improving the detection sensitivity and increasing the signal. In particular, the present invention provides a reagent for nucleic acid amplification containing at least one member selected from the group consisting of EDTA, NTA, UDA, CyDTA, DTPA, GEDTA, TTHA and their salts, specifically a reagent for nucleic acid amplification comprising, in addition to the at least one compound, a forward primer having a DNA sequence homologous to a sequence of a target RNA; a reverse primer having a DNA sequence complementary to a sequence of the target RNA and having a promoter for RNA polymerase attached to its 5' end; ribonucleotides; deoxyribonucleotides; a reverse transcriptase or RNA-directed DNA polymerase; a RNase H; a DNA polymerase or a reverse transcriptase having DNA-directed DNA polymerase activity; and a RNA polymerase. The present invention also provides a process for nucleic acid amplification characterized by carrying out a nucleic acid amplification reaction in the presence of at least one member selected from the group consisting of EDTA, NTA, UDA, CyDTA, DTPA, GEDTA, TTHA and their salts.

The invention discloses a primer applied to amplicon sequencing library construction and a method for constructing an amplicon sequencing library. The primer consists of a forward primer and a reverse primer, and the forward primer and the reverse primer comprise a joint sequence, a sequencing primer sequence and a target fragment amplification primer sequence from a sequence from the 5' end to the 3' end. According to the primer provided by the invention, the joint sequence, the sequencing primer sequence and the target fragment amplification primer sequence are integrated on a pair of primers, so that library construction can be finished in one step by utilizing the primer. The sequencing library quality and library construction efficiency are improved, the constructed amplicon sequencing library can perform high-throughput sequencing due to the joint sequence and the sequencing primer sequence used on a conventional sequencing platform by utilizing a common reagent for on-board sequencing, and the phenomena that an extra sequencing primer is provided and the mixed sequencing primers of the PHiX library are changed are avoided.

The invention relates to a novel Universal RT-coupled PCR strategy for the specific detection and accurate quantitation of mRNA. Claimed and disclosed are novel Universal reverse transcription (RT) primers, a specific primer mix containing the Universal RT-primers, a transcript specific forward primer and a reverse PCR primer identical to a unique tag sequence, and methods and kits thereof for avoiding the amplification of genomic DNA and / or pseudogenes.

The invention discloses a method and a device for gene sequencing of a plurality of mixed DNA (Deoxyribonucleic Acid) or RNA (Ribonucleic Acid) sequences, which is mainly characterized by adding random labels at two ends of each DNA or RNA template sequence before establishing a bank. The method comprises the following steps of: mixing a first forward primer containing the random label and a connector, a first reverse primer and the DNA sequences, performing multiple PCR (Polymerase Chain Reaction) amplification on two PCR circulations, and purifying the PCR product to obtain a first DNA product; mixing the first DNA product, a second forward primer containing a sample indexing sequence and the connector, and a second reverse primer, performing PCR reaction to obtain a second PCR product; purifying to obtain a second DNA product; and sequencing the second DNA product to obtain a sequencing result of each DNA sequence. According to the method disclosed by the invention, by introducing the random labels to each DNA molecule, the sequencing precision is improved, the error rate of the sequencing is obviously reduced, and the copy number of each DNA is precisely detected.

The invention provides an inherited metabolic disease screening method and a reagent kit. The method includes the steps that following libraries are built, according to each encoding sequence of inherited metabolic disease associated disease-causing genes and the principle of sequence reverse complement, from 5' to 3', a probe sequence with the length being 120 bp starts to be designed from the first basic group, and besides, 60 bp superposition exists between every two adjacent probe sequences; a TAGGTGTGTAGGCGC sequence and a GTCAGCTAGTACGCA sequence are added to the 5' end and the 3' end of each probe sequence respectively; by the adoption of the oligonucleotide in-situ synthesis technology, large-scale synthesis of oligonucleotides is carried out on a chip; the oligonucleotides on the chip are eluted through ammonia water and dissolved in water to form an oligonucleotide mixture; through the PCR method, forward primers (TTAGATAGGTGTGTAGGCGC) and reverse primers (TAAGGTGCGTACTAGCTGAC) provided with biotin labels at the 5' ends are adopted, the oligonucleotide mixture is amplified, and an inherited metabolic disease associated disease-causing gene DNA probe library with the biotin labels is formed.

The invention relates to the technical field of high-flux sequencing and discloses a database-building method for amplicon sequencing. The database-building method comprises the following steps of 1, object region enrichment based on PCR amplification: designing primer sequences aiming at an object region of genome DNA of a sample to be detected, wherein ends 5' of a forward primer and a reverse primer in the primer sequences are provided with random base sequences and linking sequences, carrying out PCR amplification and recovering the PCR product, and 2, sequencing linker introduction based in PCR amplification: carrying out mixing on the PCR product obtained by the step 1, designing primer sequences comprising sequences complementary with the linking sequences obtained by the step 1, carrying out PCR amplification on the mixture, and recovering the PCR product so that a DNA database for amplicon sequencing is obtained. The database-building method reduces building time and cost of the DNA database for amplicon sequencing, reduces error of bioinformatics analysis of the sequencing result and improves accuracy and authenticity of the analysis result.

The invention belongs to the technical field of food quality and safety detection and particularly relates to a method for rapidly detecting pork, beef, mutton and chicken components in food at the same time through animal genomic DNA (deoxyribonucleic acid) extraction, primer design and UP-M-PCR (universal primers-multiplex-PCR). The four meat components can be distinguished rapidly at the same time according to differential sites of mitochondrial cytochrome b of the animal by using the forward primer sharing and reverse primer specificity strategy and an M-PCR system including five primers. The result shows that the method has the advantages that the detection limit can be up to the pictogram level, the components of the reaction system are free from cross interference and the meat products on market can be detected, verified and distinguished accurately by sampling 80 meat products randomly according to the specificity of the four target meat components. In a word, the invention provides a specific, sensitive and practical multiplex PCR method for rapidly screening four common meat components in food at the same time.

The invention discloses a long-chain recombination human bone pattern generating protein-2 and preparing method and application, which is characterized by the following: utilizing gene project technique to grow the protein in the expressing system of escherichia coli and bacillus subtilis; adopting human bone sarcoma cell mRNA to do reverse transcription to obtain the cDNA as form; augmenting nucleotide sequence of entire 114 amino acids naturally from carboxyl end; adding a segment of nucleotide in front of the first codon of primer 5' end; increasing a segment of polypeptide at N end corresponding to amino acid sequence; obtaining long-chain rhBMP-2 gene with molecular weight at 30KD and purity over 95%.

The invention relates to a B-raf gene mutation detection kit. The B-raf gene mutation detection kit comprises quality-control primer probe internal-standard mixed liquor and detection primer probe internal-standard mixed liquor, wherein the quality-control primer probe internal-standard mixed liquor comprises a quality-control primer pair, a B-raf gene specific probe, an internal-standard primer pair, an internal-standard specific probe and an internal-standard template, and the detection primer probe internal-standard mixed liquor comprises a B-raf gene V600E mutation detection specific primer pair, a B-raf gene specific probe, an amplification blocking nucleic acid sequence, an internal-standard primer pair, an internal-standard specific probe and an internal-standard template. The B-raf gene mutation detection kit has the advantages that an amplification refractory mutation system is combined with a wild type amplification blocking nucleic acid sequence with a phosphorylated terminal, deoxyinosine is introduced into detection of a B-raf gene V600E mutation detection specific ARMS (amplification refractory mutation system) forward primer to enable quality-control PCR (polymerase chain reaction) and detection PCR to be performed for detection of samples parallelly, and each reaction system can have an internal-standard system capable of effectively avoiding false negative and intra-assay variation; the B-raf gene mutation detection kit is low in cost, high in sensitivity and more capable of controlling intra-assay and inter-assay variation.

The invention relates to the technical field of gene detection, in particular to a CRISPR (Clustered regularly interspaced short palindromic repeats) / Cas12 one-step nucleic acid detection method and a2019-nCoV detection kit. The 2019-nCoV detection kit comprises crRNA, Cas protein, a primer, a buffer system and single stranded DNA reporter molecules; the primer is obtained as follows: 5'-TTTN-3'sequence is sought in a to-be-detected target molecule area, a forward primer is designed in the position near 5' area 0-200bp, a reverse primer is designed in the position near 3' area 25-200bp, theobtained primer is subjected to chemical modification to prevent decomposition of DNA enzyme or Cas12 protein after activation. The method has the benefits that compared with existing PCR-based nucleic acid detection technologies, the nucleic acid detection method and the 2019-nCoV detection kit can allow synchronous amplification and detection, thus, operation is more convenient.

The invention discloses a loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus. The LAMP kit is composed of LAMP reaction liquid, a standard positive template and a negative quality control standard substance. The LAMP reaction liquid contains a Bst DNA polymerase big fragment, a primer, LAMP10*buffer, dNTPs solution, MgSO4 solution and glycine betaine. The primer is divided into a forward primer and a reverse primer. The LAMP kit has the advantages of being good in specificity, high in sensitivity, rapid and convenient, high in repeatability, capable of judging results by using eyes and the like, can conduct rapid qualitative detection on vibrio parahaemolyticus in industrial foods, and can replace continuously-used traditional culture method and serological diagnosis method.

The invention relates to a PCR primer for a human breast cancer susceptibility gene BRCA1 and BRCA2 coding sequence based on a NGS technology and application thereof. The PCR primer for the human breast cancer susceptibility gene BRCA1 and BRCA2 coding sequence comprises at least one capturing primer pair, and sequences of a forward primer and a reverse primer of each capturing primer pair respectively comprise a specific sequence and a linker sequence connected with a terminal 5' of the specific sequence. The PCR primer used for amplifying the human breast cancer susceptibility gene BRCA1 and BRCA2 coding sequence based on the NGS technology and application thereof have the advantages that experiment operations related in the whole method are simple, only a PCR reagent and a primer combination are related, cost is low, and a ditag sequencing linker sequence is introduced for distinguishing different samples, so that high throughput sample sequencing detection can be realized, and gene detection support can be effectively provided for risk assessment on human breast cancer and other BRCA susceptible gene-related hereditary tumours or targeted medication specific to BRCA mutation.

Methods and compositions useful in the detection and identification of species of Candida are disclosed. These species include Candida albicans, Candida glabrata, Candida parapsilosis, and Candida tropicalis, each of which is a causative agent for vaginal candidiasis. The compositions of the invention are combinations of oligonucleotides. These oligonucleotides include pairs of forward and reverse primers for polymerase chain reactions, wherein each primer pair is capable of priming the synthesis of an amplicon specific to one of Candida albicans, Candida glabrata, Candida parapsilosis, and Candida tropicalis, but preferably is not capable of priming the synthesis of an amplicon specific to any of the other three species. In preferred embodiments, the forward primers of the primer pairs have identical sequences, while each reverse primer of the primer pairs has a unique sequence relative to all of the other reverse primers; or the reverse primers of the primer pairs have identical sequences, while each forward primer of the primer pairs has a unique sequence relative to all of the other forward primers. These unique primer sequences account for the species specificity of the resultant amplicons. The oligonucleotides also include probes capable of detecting these amplicons, and sequencing primers for determining, in primer extension reactions, the nucleotide sequences contained within the amplicons. In preferred methods of the invention, a biological sample is tested for the presence of at least one isolate of Candida albicans, Candida glabrata, Candida parapsilosis, and Candida tropicalis by isolating nucleic acid from the sample, attempting a polymerase chain reaction in a mixture containing this nucleic acid and a plurality of these primer pairs, ascertaining whether any amplicon is produced in the mixture using an oligonucleotide probe, and determining the sequence of any resultant amplicon using the sequencing primers. The detection of an amplicon indicates that the sample contains at least one isolate of Candida albicans, Candida glabrata, Candida parapsilosis, or Candida tropicalis, and the nucleotide sequence data is used to determine which of these four Candida species is present.

A real-time isothermal recombinase-polymerase amplification detection kit for African swine fever viruses is disclosed. A forward primer sequence for detecting the African swine fever viruses through a method provided by the kit is shown as SEQ ID NO:1, a reverse primer sequence is shown as SEQ ID NO:2 and a probe sequence is shown as SEQ ID NO:3. A real-time isothermal recombinase-polymerase amplification method provided by the invention for ASFV detection is simple and convenient in operation, rapid in reaction and low in detection cost, can be used for ASFV detection in a laboratory and on site, particularly ASFV detection in quarantine ports, airports and epidemic disease outbreak sites, and provides a novel and reliable technique support for ASF control in China.

The present invention relates to a detection chip for performing gene detection to various vibrio and its detection and applications. The invention provides 16S rRNA sequences corresponding to each vibrio of vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, vibrio parahaemolyticus, brilliant vibrio and Fisher vibrio; heat shock protein hsp60 probe sequence; virulence gene probe sequence; 16S rRNA forward primer sequence; 16S rRNA reverse primer sequence; heat shock protein hsp60 forward primer sequence; heat shock protein hsp60 reverse primer sequence; virulence gene forward primer sequence and virulence gene reverse primer sequence. The present invention has specific, sensitive and high-throughput features, can simultaneously detect six kinds of bacteria virulence genes, and the invention will effectively guide the production as an important disease early-warning detection method used in clinical diagnosis of aquatic animals.

The invention relates to a primer, probe and reagent kit for identifying Brucella S2 vaccine strains in aerocolloid. The forward primer sequence of Brucella-RPA-LFD is shown as SEQIDNo.1, the backward primer sequence of Brucella-RPA-LFD is shown as SEQIDNo.2, and the probe sequence of Brucella-RPA-LFD is shown as SEQIDNo.3; the forward primer sequence of S2-RPA-LFD is shown as SEQIDNo.4, the backward primer sequence of S2-RPA-LFD is shown as SEQIDNo.5, and the probe sequence of S2-RPA-LFD is shown as SEQIDNo.6. The combination of the RPA-LFD primer and the probe, or the reagent kit, for identifying and diagnosing the Brucella S2 vaccine strains, provided by the invention are high in sensitivity and specificity, and can at least detect 2.5*100 cfu of Brucella or the Brucella S2 vaccine strains.

The invention belongs to the technical field of biology detection and relates to an escherichia coli O1, O2, O18 and O78 serotype detection kit and a detection method thereof. Forward primers of a primer group of the kit are highly conservative escherichia coli O antigen combined relative gene sequences, and backward primers are four serotype specific primers designed on the basis of four O1, O2, O18 and O78 serotype escherichia coli O antigen synthesis relative genes. The detection kit containing the primer group and the detection method of the detection kit have the advantages of being fast, sensitive, specific, low in cost, easy to operate and capable of well overcoming the shortcomings in the current escherichia coli O1, O2, O18 and O78 serotype detection method, can meet the requirements for the current escherichia coli O1, O2, O18 and O78 serotype detection, can be popularized and used easily in a wide range and have wide market prospect and large economic benefit.

The invention discloses an InDel molecular marker for identifying clubroot-resistant QTL (quantitative trait locus) located on Chinese cabbage A03 chromosome and application thereof. The invention provides a method for identifying or auxiliarily identifying whether a Chinese cabbage is a clubroot-resistant Chinese cabbage, which comprises the following steps: carrying out amplification by using genome DNA (deoxyribonucleic acid) of the Chinese cabbage to be identified as a template, a single-stranded DNA disclosed as SEQ ID No.2 as a forward primer and a single-stranded DNA disclosed as SEQ ID No.3 as a reverse primer; detecting the size of the amplification product; and determining whether the Chinese cabbage to be identified is a clubroot-resistant Chinese cabbage according to the size of the amplification product: if the amplification product of the Chinese cabbage to be identified contains a 201bp strip, the Chinese cabbage to be identified is a clubroot-resistant Chinese cabbage or candidate clubroot-resistant Chinese cabbage; and if the amplification product of the Chinese cabbage to be identified does not contain any 201bp strip, the Chinese cabbage to be identified is a non-clubroot-resistant Chinese cabbage or non-candidate clubroot-resistant Chinese cabbage.

The invention discloses an onion cytoplasm male sterility SCAR marker, wherein the length of the specific fragment of the SCAR marker is 339bp, and the nucleotide sequence thereof is shown as SEQ ID No.2. The invention further discloses a primer of the SCAR maker, wherein the forward primer is Zt339-u:5'-GTTCTCAAGCAGATTCCGCAC-3', and the reverse primer is Zt339-d:5'-AGGACCAAACCGAGAGTGAGC-3'. Quick and accurate selection for onion cytoplasm fertility can be realized by using the obtained SCAR marker, thereby quickening the seed selection for new breed strain of onion cytoplasm male sterility, and establishing novel onion coenospecies parent selection system; first-filial generation breeds with independent intellectual property are selected and bred, thereby solving the difficult problems that conventional seeds are mainly used in the current production in China and large sums of foreign exchange is used for buying foreign coenospecies.

The invention discloses a sturgeon sexuality difference molecular marker and an application thereof; the marker has the nucleotide sequence shown in SEQ ID NO.1; a DNA sequence shown in the SEQ ID NO.1 is detected by PCR primers, and according to a PCR detection result, the sturgeon sexuality is identified; a forward primer F of the PCR primers is 5'-CACACTGATGCTCTACATGT-3', a reverse primer R is 5'-AGGCTGGACAGTGATGCTGT-3', and the forward primer F and the reverse primer R are respectively shown in SEQ ID NO.2 and SEQ ID NO.3. The invention provides a nucleic acid fragment for detecting the sturgeon sexuality and the PCR primers for detecting the molecular marker related to sturgeon; the molecular marker is not limited by the age of the sturgeon, is accurate and reliable, is easy to operate, and has important application value in production.

The invention relates to feature sequences and a molecular specificity tag primer of a pair of high-specificity feature sequences of carya illinoensis variety Nacono, a molecular specificity tag primer, and a method capable of being used for fast identifying the carya illinoensis variety Nacono. The molecular specificity tag primer has the sequence that a forward primer is 5'-GTCACTTCCCTTTCTCGGCA-3', and a reverse primer is 5'-CCCCGGGTGCAGGTATAAAA-3'. The molecular specificity tag primer provided by the invention can be used for performing fast early-stage identification on the carya illinoensis variety Nacono; the method is simple, fast and accurate, and belongs to an irreplaceable molecular technique for distinguishing the carya illinoensis variety through appearance features.

The invention relates to a multiplex PCR (polymerase chain reaction) primer, a probe and a gene chip for detecting the bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus. The multiplex PCR primer and probe have the nucleotide sequences shown by SEQ ID No.1 to SEQ ID and No.9. The gene chip comprises a solid-phase carrier, a sample application quality control probe, a positive hybrid quality control probe and a multiplex PCR primer for detecting the bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus and the corresponding probe. In the invention, the forward primers of three viruses are marked with fluorescence, a gene chip detection technology carrying three viruses in animal fur is established based on multiplex RT-PCR (reverse transcription-polymerase chain reaction), and the RNA virus in the fur can be sensitively and specifically detected with high flux; the three viruses are screened at the same time in detection once, and the situation that a specific method is required for each virus before is changed, thereby saving the diagnosis time, meeting the needs for quick detection of mass imported / exported fur samples of the exit-entry inspection and quarantine departments and the fur import and export enterprises, and realizing relatively high application values.