Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

459 results about "Forward primer" patented technology

Forward primers are usually attached to one of the strands to allow DNA synthesis towards the reverse primer. The reverse primer is designed to attach to the complementary strand to synthesize DNA in the reverse direction — towards the forward primer.

Kit for visually detecting H5 subtype avian influenza virus based on RPA-CRISPR / Cas12b system and application

The invention discloses a kit for visually detecting an H5 subtype avian influenza virus based on an RPA-CRISPR / Cas12b system and application of the kit, and belongs to the technical field of molecular detection. The kit comprises an RT-RPA (Reverse Transcription-Recombinase Polymerase Amplification) primer pair and sgRNA1 The RT-RPA primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2; and the nucleotide sequence of the sgRNA1 is as shown in SEQ ID NO. 7. According to the kit, nucleic acid amplification and detection are synchronously completed through a tubular reaction system, the detection sensitivity reaches 1 copy / mu L, the coincidence rate with fluorescent RT-PCR is 100%, and no cross reaction exists on H7, H9, NDV and IBV. The kit does not need a complex instrument, is suitable for rapid screening on a basic level site, and provides an efficient solution for prevention and control of avian influenza.
Owner:CHINESE ACAD OF INSPECTION & QUARANTINE

Primer group for detecting pangolin plague virus, kit and application

The invention relates to a primer group for detecting pangolin plague virus, a kit and application, and relates to the technical field of gene engineering. The primer group comprises a forward primer ORF1-F and a reverse primer ORF1-R. The forward primer ORF1-F and the reverse primer ORF1-R. On the basis of the primer group, the E gene in the conserved region of the pangolin plague virus can be specifically recognized, so that the primer group is combined with an RAA amplification system and a detection system, and detection is rapidly completed within a short time under the constant-temperature condition.
Owner:GUANGZHOU ZOO (BRANDED AS GUANGZHOU WILDLIFE RES CENT)

Specific detection target PsRrp8 of phytophthora sojae as well as detection primer and application thereof

The invention discloses a specific detection target PsRrp8 of phytophthora sojae, a DNA (deoxyribonucleic acid) sequence of the specific detection target PsRrp8 is shown as SEQ ID NO.1. The invention further provides a primer combination for detecting the phytophthora sojae, the primer combination comprises a forward primer and a reverse primer, the sequence of the forward primer PsRrp8-qPCR-F1 is shown as SEQ ID NO.2, and the sequence of the reverse primer PsRrp8-qPCR-R1 is shown as SEQ ID NO.3. The invention further provides a kit for detecting the phytophthora sojae. The lowest detectable DNA concentration of the detection primer combination provided by the invention on the phytophthora sojae (P.sojae) is 0.332 pg.L <-1 >, which indicates that the quantitative detection technology has high sensitivity. The method can be successfully applied to phytophthora detection of phytophthora root rot disease field plants, phytophthora sojae can be rapidly detected, and a new technical means is provided for early warning of diseases.
Owner:SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY +1

Method for identifying limestone associated and granite associated dragon tree Hainan germplasm resources

The invention relates to the technical field of molecular markers, and particularly provides an identification method for limestone associated and granite associated dragon tree Hainan germplasm resources. According to the identification method, the amplification primer pair provided by the invention is used for detecting specific SNP loci, and two habitat types of Dracaena Hainanensis are distinguished according to SNP polymorphism. The amplification primer pair comprises a forward primer 5 'AAAGAACTAACAACAAAATCC3'and a reverse primer 5' TTCCTCGTCTCACATTCCC3 ', the limestone associated dracaena Hainanensis is subjected to base mutation at the 148th site of an amplification fragment to obtain' A ', and the granite associated dracaena Hainanensis is subjected to base mutation at the 148th site of the amplification fragment to obtain' G '. The method disclosed by the invention is simple, rapid and accurate, and provides technical support for classification identification and molecular breeding selection of related dracaena dracaena resources.
Owner:SANYA RESEARCH INSTITUTE OF HAINAN ACADEMY OF AGRICULTURAL SCIENCES (HAINAN EXPERIMENTAL ANIMAL RESEARCH CENTER) +1

KASP primer group for detecting typing of rice flowering time regulation gene OsMYB8 and application of KASP primer group

The invention belongs to the technical field of genetic breeding, and particularly relates to a KASP primer group for detecting the typing of a rice flowering time regulation gene OsMYB8 and application of the KASP primer group. The KASP primer group comprises a first forward primer, a second forward primer and a reverse primer; the nucleotide sequence of the first forward primer is as shown in SEQ ID NO. 10; the nucleotide sequence of the second forward primer is as shown in SEQ ID NO. 11; the nucleotide sequence of the reverse primer is as shown in SEQ ID NO. 12. The primer group disclosed by the invention can be used for rapidly and accurately identifying the genotype of the rice OsMYB8 gene, and can be applied to molecular marker-assisted breeding of OsMYB8 gene plants.
Owner:ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES +1

Sweet waxy corn molecular detection system based on sh1 gene InDel marker and application thereof

The invention relates to the technical field of crop molecular breeding and detection, in particular to a sweet waxy corn molecular detection system based on an sh1 gene InDel marker and application of the sweet waxy corn molecular detection system, the sweet waxy corn molecular detection system is composed of a forward primer, a reverse primer and a transposon specific primer, and the sequences are shown as SEQ ID NO: 1-3. The sh1 gene InDel marker-based sweet waxy corn molecular detection system provided by the invention can be used for corn sh1 gene Mu insertion rapid detection and / or corn molecular marker-assisted sweet waxy corn breeding. By adopting a sweet waxy corn molecular detection system based on the sh1 gene InDel marker, the accuracy rate is 98.7%. And the detection cost of each sample is 0.15 dollars, and compared with the traditional SSR marking technology, the cost is reduced to 3% of that of the traditional SSR marking technology. From DNA extraction to final result interpretation, the whole detection process takes 3 hours.
Owner:JIANGSU ACAD OF AGRI SCI

KASP molecular marker for soybean plant height identification and application of KASP molecular marker

The invention is suitable for the technical field of soybean breeding, and provides a KASP molecular marker for soybean plant height identification and application of the KASP molecular marker. The KASP molecular marker is based on an SNP variation site of a Glyma. 19G206100 gene between two parents of Chinese flat stem soybean and F02, the mutation position of the Glyma. 19G206100 gene is the 312th basic group on a CDS sequence, C of a reference genome is mutated into G, the 104th amino acid on a protein sequence is mutated into lysine from asparagine, and the 104th amino acid on the protein sequence is mutated into lysine from asparagine. The primer of the KASP molecular marker comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO.1-2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3. The invention further discloses a kit for detecting the KASP molecular marker. The KASP molecular marker is developed on the basis of the polymorphic site of Gm19G206100 in germplasm resources, the marker has the advantages of being high in resolution ratio and easy to detect, can be applied to plant height selection of early generations of soybean cross breeding, has the effects of reducing the breeding scale, reducing the workload and improving the breeding efficiency, and has important application value in production.
Owner:JILIN UNIVERSITY

Primer / probe composition for capillary electrophoresis analysis, detection method and application

The invention provides a primer / probe composition for capillary electrophoresis analysis, a detection method and application. The primer / probe composition comprises a forward primer, a reverse primer and a nucleic acid probe, the 5'end of the nucleic acid probe carries a fluorescent label, and both the forward primer and the reverse primer do not carry the fluorescent label. Different targets are identified by detecting the nucleic acid probe, so that the length of an amplification product is not limited, only the nucleic acid probe carries a fluorescence signal without generating a non-specific fluorescence signal, the generation of a supersaturated fluorescence signal can be effectively prevented by using the nucleic acid probe with a specific concentration, the fluorescence signals among different targets do not interfere with each other, and the detection sensitivity is high. And multicolor fluorescence can be used at the same time.
Owner:NINGBO HEALTH GENE TECHNOLOGIES CO LTD

Primer group, kit and method for detecting ATXN3 gene (CAG) n trinucleotide repetition number

The invention relates to a primer group, a kit and a method for detecting an ATXN3 gene (CAG) n trinucleotide repetition number, and belongs to the technical field of gene detection. The technical problem to be solved by the invention is to provide the primer group for detecting the n trinucleotide repetition number of the ATXN3 gene (CAG). The primer group comprises a first primer pair and a second primer pair, a forward primer sequence of the first primer pair is as shown in SEQ ID NO. 1, and a reverse primer sequence of the first primer pair is as shown in SEQ ID NO. 2; a forward primer sequence of the second primer pair is as shown in SEQ ID NO. 3, and a reverse primer sequence of the second primer pair is as shown in SEQ ID NO. 4. Through the design of the two pairs of primers, complementary verification is achieved, the detection result is comprehensive and reliable, the technical defects of first-generation sequencing and second-generation sequencing on long-fragment and high-GC-content repetitive sequence detection are overcome, the detection cost is low, the detection period is short, and the primer pair is suitable for clinical detection service.
Owner:THE WEST CHINA SECOND UNIV HOSPITAL OF SICHUAN

Molecular marker related to slash pine paper pulp, DNA fragment, kit and application thereof

The invention discloses a molecular marker related to slash pine paper pulp, a DNA (deoxyribonucleic acid) fragment, a kit and application of the molecular marker, the SNP molecular marker is S1641460596 and is located at the 641460596 site of a slash pine chromosome 1; the polymorphism of the SNP site is G / A, the genotype of the SNP site of the slash pine with the long wood fiber length is GG, and the genotype of the SNP site of the slash pine with the short wood fiber length is GA or AA. The DNA fragment of the gene is located in a Pel1G156900 gene region of a slash pine genome, and the nucleotide sequence of the gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2. The kit comprises a forward primer and a reverse primer which are used for amplifying the DNA fragment related to the slash pine paper pulp; the nucleotide sequence of the forward primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.4; the molecular marker, the DNA fragment and the kit are used for related phenotype identification, early prediction, breeding and the like of slash pine paper pulp, and the problems of late identification, long breeding period, low breeding efficiency and the like of existing slash pine paper pulp characters can be solved.
Owner:RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY

Primer group for detecting salmonella pullorum based on RAA-LFD technology and application of primer group

The invention belongs to the technical field of molecular biological detection, and particularly relates to a primer group for detecting salmonella pullorum based on an RAA-LFD technology and application of the primer group. The invention provides a primer group for detecting salmonella pullorum based on an RAA-LFD technology. The primer group comprises a forward primer, a reverse primer and a probe, the sequence of the forward primer is as shown in SEQ ID NO. 1; the sequence of the reverse primer is as shown in SEQ ID NO. 2; the sequence of the probe is based on SEQ ID NO.3, wherein the original base G of the 31st base of the SEQ ID NO.3 is replaced by an idSp group. According to the specific primer based on the RAA-LFD technology, the phenomenon of false positive caused by generation of primer dimers is avoided, the specificity is high, and the sensitivity is high. The primer group provided by the invention can be used for detecting salmonella pullorum and related strains, and only the salmonella pullorum is positive, so that the primer group shows good specificity.
Owner:SHIHEZI UNIVERSITY +1

MNP marker site, primer group and kit for identifying multiple pathogens in sewage and application of MNP marker site, primer group and kit

The invention provides an MNP marker site, a primer group and a kit for identifying multiple pathogens in sewage and application of the MNP marker site, the primer group and the kit. The MNP marker site comprises at least one of MNP-1 to MNP-19, the primer group comprises at least one of a first primer pair to a nineteenth primer pair, and a forward primer of the first primer pair, a reverse primer of the first primer pair to a forward primer of the nineteenth primer pair and a reverse primer of the nineteenth primer pair are sequentially shown as SEQ ID NO: 1 to SEQ ID NO: 38 in a sequence table. The invention provides MNP marker sites for identifying multiple pathogens in sewage, a primer group, a kit and application, the primer group aims at 19 MNP marker sites, 1-3 marker sites are detected for each pathogen, the pathogens in the multiple types of sewage can be identified, the comprehensive, efficient and accurate detection effect is achieved, and the primer group is suitable for identifying the multiple pathogens in the sewage.
Owner:JIANGHAN UNIVERSITY

Primer group, kit and method for identifying mango variety Katt

The invention provides a primer group, a kit and a method for identifying a mango variety Katt, and belongs to the field of germplasm resource identification. The primer group is composed of four primer pairs, each primer pair is composed of a forward primer and a reverse primer, and the forward primer of the first primer pair, the reverse primer of the first primer pair, the forward primer of the fourth primer pair and the reverse primer of the fifth primer pair are sequentially shown as SEQ ID NO: 1 to SEQ ID NO: 8 in a sequence table. According to the primer group and the corresponding method provided by the embodiment of the invention, the uncertainty of variety identification based on external morphological characteristics of mangoes can be overcome, the mango variety Katt can be accurately identified, the operation is simple and convenient, the cost is low, the efficiency is high, and the result is visual and reliable.
Owner:YUNNAN INST OF TROPICAL CROPS

PRIMER FOR AMPLIFYING CLOSELY LINKED MOLECULAR MARKER OF POWDERY MILDEW RESISTANCE GENE PmDR803 OF TRITICUM CARTHLICUM AND APPLICATION THEREOF

Disclosed is a primer for amplifying a closely linked molecular marker of a powdery mildew resistance gene PmDR803 of Triticum carthlicum. The molecular marker primer includes a forward primer HENU629-F and a reverse primer HENU629-R, where the nucleotide sequence of the forward primer HENU629-F is shown as SEQ ID NO:1, and the nucleotide sequence of the reverse primer HENU629-R is shown as SEQ ID NO:2. The molecular marker primer provided by the present disclosure can be applied in detection and identification of the gene PmDR803, auxiliary identification of a powdery mildew resistance trait of wheat, and molecular marker-assisted selection breeding.
Owner:CROP RES INST SHANDONG ACAD OF AGRI SCI +2

Primer group for high myopia gene detection, application of primer group, kit and high myopia gene detection method

The invention provides a primer group for high myopia gene detection, application of the primer group, a kit and a high myopia gene detection method, and relates to the technical field of gene detection. Nucleic acid sequences of the primer group for high myopia gene detection are shown as SEQ ID NO.1-296, and every two primers sequentially form a forward primer and a reverse primer according to the sequence numbers of the nucleotide sequences from small to large. The primer group is high in specificity and sensitivity, 89 high-myopia genes and 166 loci can be detected through one-time PCR amplification in the same tube, the detection efficiency of the high-myopia genes is effectively improved, meanwhile, the detection cost is reduced, and convenience is provided for prediction of high-myopia susceptible people.
Owner:BEIJING ZHIDE MEDICAL LAB CO LTD

Amplification primer of KASP marker on D03 chromosome for cotton high lint percentage variety breeding

The invention discloses an amplification primer of a KASP marker on a D03 chromosome for cotton high lint breed breeding, which comprises a forward primer F1 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, a reverse primer F2 with an FAM fluorescent marker, and a reverse primer F2 with an FAM fluorescent marker, the sequence of the forward primer F2 is shown as SEQ ID No. 2; and the sequence of the reverse primer is shown as SEQ ID No.3. The method can effectively distinguish genotypes with obvious lint content difference, and provides a useful tool for molecular marker-assisted selection in cotton breeding.
Owner:ZHEJIANG FORESTRY UNIVERSITY

SNP (Single Nucleotide Polymorphism) molecular marker related to watermelon clausena lansium character and application of SNP molecular marker

The invention belongs to the field of molecular biology, and discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to watermelon clausena lansium traits as well as a primer, a kit, application and a method for identifying the related traits, the primer of the SNP marker for identifying the watermelon clausena lansium traits comprises a forward primer F and a reverse primer R; the nucleotide sequences of the forward primer F and the reverse primer R are shown as'primer sequences'. The primer of the SNP marker for watermelon clausena lansium character identification can rapidly identify watermelon clausena lansium characters in the seedling stage, and can effectively solve the problems of low phenotypic identification result reliability, time consumption, high cost, high difficulty and the like.
Owner:安徽省农业科学院蔬菜研究所

Detection method for detecting infectious bronchitis virus

The invention discloses a primer pair and a fluorescent probe for detecting an infectious bronchitis virus as well as application and a detection method of the primer pair and the fluorescent probe, and relates to the technical field of biological virus detection. Wherein the nucleotide sequence of a forward primer in the primer pair is as shown in SEQ ID No.1, the nucleotide sequence of a reverse primer is as shown in SEQ ID No.2, and the nucleotide sequence of the fluorescent probe is as shown in SEQ ID No.3; the 5'end of the fluorescent probe is modified by FAM, and the 3 'end of the fluorescent probe is modified by TAMRA. By implementing the kit, IBV of various genotypes can be accurately detected, and a good basis is provided for early diagnosis of IBV.
Owner:LINGNAN MODERN AGRI SCI & TECH GUANGDONG PROVINCIAL LAB ZHAOQING BRANCH CENT

Application of SNP (Single Nucleotide Polymorphism) site in identifying or screening watermelon fruit shape

The invention discloses application of SNP sites in identifying or screening watermelon fruit shapes, and belongs to the technical field of molecular biology. The SNP site is located at the 727th site of a Cla97C03G066390 gene coding region on a chromosome 3 of a watermelon Watermelon (97103) v2 genome, and the SNP site has G / A polymorphism and is applied to identification or screening of watermelon fruit shapes. The KASP molecular marker primer group for detecting the SNP site comprises specific reverse primers as shown in SEQ ID NO.2 and SEQ ID NO.3, and a universal forward primer as shown in SEQ ID NO.4. The invention also discloses a kit for detecting the KASP molecular marker primer group for detecting the SNP site. The SNP locus and the developed KASP molecular marker primer group can quickly perform genetic typing of watermelon fruit shapes, are accurate and efficient in detection and convenient and stable in amplification, and can be used for molecular marker-assisted selection and watermelon germplasm resource improvement.
Owner:INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Method for constructing nano-antibody coding DNA library and application of nano-antibody coding DNA library

The invention relates to a construction method of a nanometer antibody coding DNA library. The method comprises the following steps: screening animal peripheral blood mononuclear cells (PBMC) by using immunogen to obtain positive cells specifically bound with the immunogen; and amplifying a nucleic acid sample derived from the positive cells so as to obtain a coding DNA library of the nano-antibody, wherein the nano antibody is a nano antibody specifically binding to the immunogen, and wherein the amplification comprises the use of one or more groups of primer pairs, each group of primer pairs of the one or more groups of primer pairs comprising one or more forward primers and one or more reverse primers. A large number of diversified DNA sequences covering a large number of low-abundance sequences are obtained. According to the technical route for rapidly preparing the VHH antibody based on high-throughput sequencing, the high-affinity and high-specificity VHH antibody can be efficiently and rapidly obtained, and the raw material requirement of a high-quality diagnostic reagent is met.
Owner:GUANGZHOU NAT LAB

A molecular marker ahytt8 closely linked to peanut white seed coat and application thereof

The application discloses a molecular marker AhyTT8 closely linked to peanut white seed coat and an application thereof, and belongs to the field of agricultural biotechnology. The AhyTT8 comprises: (1) AhyTT8_all, specific primers are a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer as shown in SEQ ID NO:2; (2) AhyTT8_02 and AhyTT8_12, specific primers are forward primers with nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:5 and reverse primers as shown in SEQ ID NO:4 and SEQ ID NO:6. By using the molecular marker provided in the application, it can be determined whether the white seed coat peanut is caused by a TT8 mutation, the seed coat color of the next generation of harvested materials can be determined in advance by detecting peanut DNA, the breeding efficiency is improved, and new germplasm resources can be quickly obtained.
Owner:SHANDONG ACADEMY OF AGRICULTURAL SCIENCES

Primer group, kit and method for detecting mic gene of cyanobacteria capable of producing 2-methylisoborneol

The invention relates to the technical field of water pollution and water body odor substance detection, in particular to a primer group, a kit and a method for detecting cyanobacteria generating 2-methylisoborneol in a water body based on a recombinase-mediated isothermal nucleic acid amplification (RAA) technology. The primer group is designed based on a mic gene conserved region of the 2-methylisoborneol-producing cyanobacteria, and comprises a forward primer, a reverse primer and a specific probe; the 5'end of the reverse primer is modified with a fluorescent marker, the 5 'end of the probe is modified with biotin, the 3' end of the probe is modified with a phosphorylation group, and nuclease cleavage sites are contained in the probe. The primer group disclosed by the invention can effectively amplify the mic gene of the 2-methylisoborneol, has relatively high specificity and sensitivity, has no cross reaction with cyanobacteria which does not generate the 2-methylisoborneol, and can be combined with lateral flow immunochromatography to be used for on-site rapid detection of the 2-methylisoborneol; the method is of great significance in early warning of excessive content of 2-methylisoborneol in the water body.
Owner:NINGBO WATER ENVIRONMENT GROUP CO LTD +1

A KASP molecular marker PH5-KASP based on a SNP site of a corn Zm00001eb259660 gene and application thereof

PendingCN122357786AForward primerGermplasm
This invention relates to the field of plant molecular breeding technology, specifically to a KASP molecular marker PH5-KASP based on the SNP site of the maize Zm00001eb259660 gene and its application. It provides a KASP molecular marker targeting the SNP site at 226029364 bp on maize chromosome 5, which is a functional missense mutation c.485C>T in the coding region of the Zm00001eb259660 gene. The marker consists of two allele-specific forward primers carrying different fluorescent tags and one universal reverse primer, stably distinguishing between C:C and T:T homozygous genotypes, where C:C corresponds to higher plant height and T:T corresponds to lower plant height. This invention offers high marker genotyping accuracy, simple and low-cost detection, and is suitable for large-scale breeding sample detection. It can be used for early identification of maize plant height traits, germplasm screening, and assisted breeding, significantly improving the efficiency of ideal maize plant architecture improvement.
Owner:AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)

Indel molecular marker closely related to soluble sugar content of pepper fruits and application thereof

The invention provides an Indel molecular marker closely related to the soluble sugar content of pepper fruits and application of the Indel molecular marker, and belongs to the technical field of nucleic acid-containing determination methods. The nucleotide sequence of the Indel molecular marker is as shown in SEQ ID NO. 1 in a sequence table; the Indel molecular marker is located at the 5274716 to 5274727 sites of a full-length sequence of a No.3 chromosome of a pepper reference genome. Primers for amplifying the Indel molecular marker comprise a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO.2 in a sequence table, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.3 in the sequence table. The molecular marker can be directly applied to early generation of breeding, destructive sampling of chemical detection is avoided, the breeding cost is remarkably reduced, the breeding period is effectively shortened, and the selection efficiency of pepper molecular marker assisted breeding is greatly improved.
Owner:SHANDONG YONGSHENG AGRI DEV CO LTD

A primer-probe set for differentiating the vaccine and field strains of peste des petits ruminants (PPR) virus

The invention relates to a primer-probe set, comprising a forward primer having the nucleotide sequence of SEQ ID NO:1 and a reverse primer having the nucleotide sequence of SEQ ID NO:2, and a peptide nucleic acid (PNA) probe having the sequence of HEX-OO-(SEQ ID NO:3)-Lysine-BHQ1, which are used for differentiating the Peste des Petits Ruminants (PPR) virus vaccine and field strains and for preventing false positive results arising from the PPR vaccine, as well as to their operating temperatures. Said primer-probe set can differentiate between the vaccine strain containing the nucleotide sequence of SEQ ID NO:4 and the field strain containing the nucleotide sequence of SEQ ID NO:5. Thus, by means of said primer-probe set, false positive results arising from the PPR vaccine are prevented, and accordingly, unnecessary quarantine measures are also avoided.
Owner:PENDIK VETERINER KONTROL & ARASTIRMA ENS MUDURLUGU

Kasp marker EL-5-KASP-387 closely linked with corn ear length and application of Kasp marker EL-5-KASP-387

The invention relates to the technical field of plant molecular breeding, in particular to a Kasp marker EL-5-KASP-387 closely linked with the ear length of corn and application of the Kasp marker EL-5-KASP-387, an Indel functional site corresponding to the Kasp marker is located at the position 184049387 of the fifth chromosome of corn, the polymorphism is- / TGA, and a matched specific primer group is composed of two forward primers and a reverse primer. The major site of the ear length is located through whole genome association analysis, the developed KASP marker can accurately distinguish three genotypes, ear length character identification can be completed in the seedling stage, and the multi-environment weighted matching degree of the genotypes and phenotypes reaches 99.2%. The method does not need gel electrophoresis, has the advantages of high flux and high precision, can greatly shorten the breeding period of the long-ear corn, improves the breeding selection accuracy, and provides efficient technical support for high-yield molecular directional breeding of the corn.
Owner:AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)

Indel molecular marker related to the aroma trait of pumpkin fruit and its application

The application discloses an Indel molecular marker related to a pumpkin fruit taro smell character and application thereof, wherein the sequence of the Indel molecular marker is shown as SEQ ID NO:2. DNA of a pumpkin to be detected is used as a template, a forward primer with a sequence shown as SEQ ID NO:4 and a reverse primer with a sequence shown as SEQ ID NO:5 are used for PCR amplification; if the size of the amplification product is about 5100bp, the pumpkin fruit to be detected has the taro smell; if the size of the amplification product is about 500bp, the pumpkin fruit to be detected does not have the taro smell. The Indel molecular marker and the primer for specifically amplifying the Indel molecular marker can be applied to screening of pumpkin varieties with the taro smell character, or detecting whether the pumpkin varieties have the taro smell, so that the pumpkin taro smell character can be quickly and accurately judged from the genotype, and thus an assisted selection breeding technology system of the pumpkin taro smell character is established.
Owner:INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI

Liver cancer lncRNA HULC detection kit based on CRISPR-Dx technology

The invention relates to the technical field of nucleic acid detection, and discloses a liver cancer lncRNA HULC detection kit based on a CRISPR-Dx technology, and the liver cancer lncRNA HULC detection kit comprises an RT-RPA reaction system and a CRISPR / Dx reaction system; the CRISPR / Dx reaction system comprises crRNA, and the nucleotide sequence of the crRNA is as shown in SEQ ID NO. 1 or SEQ ID NO. 2; the RT-RPA reaction system comprises a forward primer F7-HULC-RPA of which the nucleotide sequence is as shown in SEQ ID NO.4, and a reverse primer R7-HULC-RPA of which the nucleotide sequence is as shown in SEQ ID NO.5, or a reverse primer R8-HULC-RPA of which the nucleotide sequence is as shown in SEQ ID NO.6. The RT-RPA reaction system comprises a forward primer F7-HULC-RPA of which the nucleotide sequence is as shown in SEQ ID NO.3. The kit provided by the invention has the characteristics of high efficiency and rapidness, and the reaction process for detection can be completed only in 10-35 minutes. Compared with a traditional detection means which needs reaction time of several hours, the method has the advantages that the time required by detection is greatly shortened, the detection efficiency is remarkably improved, a powerful guarantee is provided for rapidly obtaining a detection result, and the method has obvious advantages in time cost.
Owner:CHONGQING JIANGJIN DISTRICT CENT HOSPITAL

Streptococcus mutans detection kit and detection method based on anchored CRISPR-Cas12a enhanced paper-based microfluidic chip

The invention relates to the technical field of biological analysis and detection, and particularly discloses a streptococcus mutans detection kit based on an anchored CRISPR-Cas12a enhanced paper-based micro-fluidic chip and a detection method. The detection kit comprises an RAA solution or RAA freeze-dried powder, magnesium acetate or a magnesium acetate solution, TMB or a TMB solution, an RAA forward primer, an RAA reverse primer, a cell lysis buffer, a buffer system and a paper-based micro-fluidic chip. The detection method comprises the following steps: establishing a standard curve and detecting a sample. The detection kit is used for detecting the content of streptococcus mutans and has the characteristics of high efficiency, rapidness, specificity, sensitivity, portability and the like, and the method is simple and convenient to operate, low in detection cost and capable of being applied to on-site detection of streptococcus mutans.
Owner:RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIVERSITY SCHOOL OF MEDICINE HAINAN HOSPITAL (HAINAN BOAO RESEARCH HOSPITAL) +1

A blood mycobacterium tuberculosis complex free nucleic acid detection reagent kit and detection method

The application belongs to the technical field of biological medicine, and particularly relates to a blood Mycobacterium tuberculosis complex free nucleic acid detection kit and a detection method. The application first proposes a kit, wherein a PCR detection reagent group and a CRISPR / Cas12a detection reagent group are arranged in the kit; the PCR detection reagent group comprises a forward primer and a reverse primer which target a complex target; the sequence of the forward primer is overlapped with or complementary to the recognition region of the crRNA sequence, or the sequence of the reverse primer is overlapped with or complementary to the recognition region of the crRNA sequence.
Owner:INNOVITA BIOLOGICAL TECH CO LTD +1