Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

272 results about "Vibrio alginolyticus" patented technology

Vibrio alginolyticus is a Gram-negative marine bacterium. It is medically important since it causes otitis and wound infection. It is also present in the bodies of animals such as pufferfish, where it is responsible for the production of the potent neurotoxin, tetrodotoxin.

Six oligonucleotide sequences and application thereof

The invention relates to six oligonucleotide sequences and an application thereof, relating to the recognition detection of vibrio alginolyticus. The invention provides six oligonucleotide sequences capable of inactivating the recognition detection of vibrio alginolyticus, a preparation method and an application thereof. The oligonucleotide sequence has the characteristics of being quick in detection, simple in operation, superior to that of antibody and the like in stability, and the preparation method is easy and relatively short in preparation period. The six oligonucleotide sequences comprise oligonucleotide sequences of SEQ ID No.1-6, and the recognition detection of vibrio alginolyticus can be inactivated by adopting one of the oligonucleotide sequences. The preparation method comprises the following steps: synthesizing an ssDNA oligonucleotide library used for filtering; carrying out SELEX filtering after the oligonucleotide library is mixed with inactivated vibrio alginolyticus till the affinity is not raised obviously; then cloning and sequencing; and selecting a highly copied ssDNA thereof to carry out verification of affinity specificity and determination of affinity constants so as to obtain corresponding an aptamer. The six oligonucleotide sequences can be used for recognition detection of inactivated vibrio alginolyticus.
Owner:JIMEI UNIV

Vibrio bacteriophage and bactericidal composition preparation method and application thereof

The invention relates to a Vibrio bacteriophage and a bactericidal composition preparation method and application thereof, belonging to the field of biotechnology. The bacteriophage composition comprises Vibrio alginolyticus bacteriophage vB_ValS_PcR-1 (accession number being CCTCC NO: M 2018391), Vibrio harveyi vB_VhaM_PcB-1G (accession number being CCTCC NO: M 2018392) and Vibrio parahaemolyticus phage vB_VhaP_OW (accession number being CCTCC NO: M 2015577). A high-potency culture product can be obtained after host actions, the composition is good in stability at room temperature, has a widehost splitting range, can efficiently inhibit growth of main pathogenic vibrios such as vibrio alginolyticus, vibrio harveyi, vibrio parahaemolyticus, can be applied as a biological antimicrobial agent for vibrio contamination control in food and aquaculture.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof

The invention discloses three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as a preparation method and an application thereof and relates to identification and detection of vibrio alginolyticus. The oligonucleotide sequences comprise SEQ ID No. 1-3 (sequence identity number 1-3). The method comprises the following steps: synthesizing an ssDNA (single-stranded deoxyribonucleic acid) oligonucleotide library (5'-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCA CAA GAG GGA GAC CCC AGA GGG-3') for screening; mixing the oligonucleotide library with the vibrio alginolyticus and then performing SELEX (systematic evolution of ligands by exponential enrichment) screening; performing cloning and sequencing on an aptamer-enhanced library after completing the SELEX screening; performing interception in different lengths on high-copy ssDNA emerged in the sequencing result so as to get a series of new sequences, and further constructing complementary sequences of the new sequences; and performing affinity and specificity verification on the obtained new sequences and the complementary sequences thereof so as to get corresponding aptamers.
Owner:JIMEI UNIV

Oligonucleotide sequence for detecting vibrio alginolyticus and application thereof

The invention discloses an oligonucleotide sequence for detecting vibrio alginolyticus and application thereof. The oligonucleotide sequence for detecting vibrio alginolyticus comprises four oligonucleotide sequences, such as SEQIDNo.1, SEQIDNo.2, SEQIDNo.3 and SEQIDNo.4, and the vibrio alginolyticus can be identified and detected by one oligonucleotide sequence. The oligonucleotide sequence disclosed by the invention has the characteristics that the detection is rapid, the operation is simple and the stability of an adaptor is higher than that of an antibody, is easy to prepare and has shorter preparation period.
Owner:JIMEI UNIV

Detection kit and detection method for 9 species of pathogenic organisms in marine products

The invention discloses a detection kit and a detection method for 9 species of pathogenic organisms in marine products. The kit comprises Taq DNA polymerase with a concentration of 5U / muL and a PCR reaction solution, wherein the PCR reaction solution contains 10 millimols of Tris.HCl, 50 millimols of KCl, 25 millimols of MgCl2, 2.5 millimols of dNTP and primer pairs of the 9 species of pathogenic organisms. The kit and the method can synchronously detect the 9 species of pathogenic organisms and can detect salmonella with a concentration of 11 CFU / mL, staphylococcus aurei with a concentration of 2,000 CFU / mL, monocytogenes with a concentration of 120 CFU / mL, enterohemorrhagic Escherichia coli O157:H76 with a concentration of CFU / mL, comma bacillus with a concentration of 220 CFU / mL, Vibrio parahaemolyticus with a concentration of 60 CFU / mL, Vibrio vulnficus with a concentration of 9 CFU / mL and Vibrio alginolyicus with a concentration of 230 CFU / mL. The detection method short in detection time and simple and quick in operation, and can save a large amount of labor and financial resources and meet requirements for quick detection.
Owner:曹际娟 +2

Bacillus amyloliquefaciens and application thereof in aquaculture

The present invention discloses bacillus amyloliquefaciens and application thereof in aquaculture. The bacillus amyloliquefaciens SIP0902 strain is preserved in the China Center For Type Culture Collection (CCTCC), AND the preservation number is CCTCC NO:M2014323. The bacillus amyloliquefaciens is separated from intestinal tract of penaeus vanmamei, is an endogenous strain, and has strong antagonism to vibrio parahaemolyticus, vibrio anguillarum, vibrio alginolyticus and other 7 kinds of aquatic animal pathogenic vibrios. Bacillus amyloliquefaciens powder prepared from the bacillus amyloliquefaciens can significantly enhance non-characteristic immune function of the penaeus vanmamei, and can improve the pathogen infection resisting ability of prawn.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Chip for gene detection of multiple vibrios at the same time, and detection and use thereof

The present invention relates to a detection chip for performing gene detection to various vibrio and its detection and applications. The invention provides 16S rRNA sequences corresponding to each vibrio of vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, vibrio parahaemolyticus, brilliant vibrio and Fisher vibrio; heat shock protein hsp60 probe sequence; virulence gene probe sequence; 16S rRNA forward primer sequence; 16S rRNA reverse primer sequence; heat shock protein hsp60 forward primer sequence; heat shock protein hsp60 reverse primer sequence; virulence gene forward primer sequence and virulence gene reverse primer sequence. The present invention has specific, sensitive and high-throughput features, can simultaneously detect six kinds of bacteria virulence genes, and the invention will effectively guide the production as an important disease early-warning detection method used in clinical diagnosis of aquatic animals.
Owner:YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

Gene chip of aquatic product cultivation pathogenic bacterium

The invention discloses a gene chip of aquatic product cultivation pathogenic bacterium, comprising a solid phase carrier which is modified chemically, a detection probe and a quality control probe are distributed on the solid phase carrier in a dot matrix way; the detection probe comprises specificity 16S rDNA sequences and / or gyrB gene sequences of vibrio, comma bacillus, vibrio harveyi, vibrio alginolyicus, vibrio anguillarum, vibrio parahemolyticus, nocardia, nacardia seriolea, aeromonas, hydrophilic aeromonas, streptococcus and dolphin streptococcus, which are to be detected, the quality control probe includes PCR positive, chip fixed positive control, chip hybridizing negative control, chip hybridizing positive control and chip hybridizing blank control; the gene chip has the advantages of small volume and high flux, can detect known and unknown germs of the vibrio, the nocardia, the aeromonas and the streptococcus, and can detect specific germs with multiple kinds, and the simpleness and rapidness and specificity of the germs can be detected, and automatic detection can be carried out after detection software is additionally arranged.
Owner:NINGBO UNIV +2

A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences

The invention discloses a group of oligonucleotide sequences capable of synchronous identification of Vibrio harveyi and Vibrio alginolyticus and a preparation method of the oligonucleotide sequences, and relates to identification and detection of Vibrio harveyi and Vibrio alginolyticus. The oligonucleotide sequences comprise SEQ ID No.1-4. The preparation method comprises the following steps: synthesizing an ssDNA (single-stranded deoxyribonucleic acid) oligonucleotide library (5'-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCA CAA GAG GGA GAC CCC AGA GGG-3') for screening; separately mixing the oligonucleotide library with Vibrio harveyi and Vibrio alginolyticus, and carrying out SELEX (systematic evolution of ligands by exponential enrichment) screening; cloning and sequencing the aptamer-rich library; and selecting high-copy ssDNA in the sequencing result, verifying specificity of affinity, and obtaining the corresponding aptamers.
Owner:JIMEI UNIV

Microbial preparation, aquatic feed and aquaculture method

The invention discloses a microbial preparation, an aquatic feed and an aquaculture method and relates to the technical field of aquaculture. The microbial preparation comprises bdellovibrio and probiotic. Optimally, the probiotic is selected from any one of lactobacillus bulgaricus, lactobacillus delbrueckii, enterococcus faecalis, lactobacillus casei, lactobacillus acidophilus, rhodopseudomonaspalustris, clostridium butyricum, bacillus laterosporus, bacillus pumilus, bacillus coagulans, bacillus licheniformis, bacillus subtilis and lactobacillus plantarum. The microbial preparation has thecharacteristics of capability of increasing food intake of aquaculture animals, capability of promoting growth rate, survival rate and immunity of organisms, and the like. Besides, the microbial preparation is capable of effectively preventing and treating the problems of diseases caused by pathogenic bacteria, such as vibrio parahaemolyticus, vibrio harveyi, luminous vibrio, vibrio alginolyticus,vibrio campbellii, vibrio fluvialis, vibrio vulnificus, aeromonas, vibrio cholerae, pseudomonas and salmonella.
Owner:SHANGHAI LYUAO BIOTECH CO LTD

Gene chip for detecting 11 types of common infectious diarrheal disease pathogen and application thereof

The invention relates to a gene chip and an application, which belongs to the biological detection field. The invention designs a set of detection probes by aiming at 11 types of common infectious diarrheal disease pathogen microorganism in clinic, and the gene chip containing the set of the probe. The detection probes comprises a vibrio parahaemolyticus probe, a vibrio vulnificus, a vibrio cholera probe, a vibrio alginolyticus probe, a vibrio furnissii probe, a shigella probe, an escherichia coli probe, an aeromonas probe, a salmonella probe, a campylobacteria probe, and a proteusbacillus vulgaris probe; the above mentioned probe sequence is shown as SEQ ID No: 1-117. The gene chip and probe can detect 11 types of common infectious diarrheal disease pathogen, the detection flux is high, the specialty is strong, the sensitivity is high, and the detection is rapid and effective.
Owner:YANTAI YUHUANGDING HOSPITAL

Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method.

The invention discloses a quadruple fluorescent PCR kit for detection of pathogenic vibrios in a water body and a detection method. According to the method, innovative bacterium enrichment reagent technology, DNA extraction reagent technology, specific fluorescent probe hybridization PCR detection technology and multiplex PCR technology are employed, bacterium enrichment culture of a sample is not needed, false positive interference is minimized as much as possible on the premise that high sensitivity is maintained, and four kinds of vibrios can be detected at one time. The invention mainly has the following beneficial effects: no need for bacterium enrichment of the sample in advance; high sensitivity and good specificity in detection of bacteria; reduction of the false positive incidence in conventional PCR amplification; and realization of rapid, accurate and specific detection of vibrio vulnificus, vibrio alginolyticus, vibrio mimicus and vibrio flurialis at one time.
Owner:NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE

Prepn and usage of outer membrane protein subunit vaccine of seawater fish morbid vibrio

InactiveCN101020051AChemical properties determinedImmunospecific stabilityAntibacterial agentsPharmaceutical non-active ingredientsDiseaseBacteroides
The present invention is preparation and usage of outer membrane protein subunit morbid vibrio vaccine for seawater fish. The vaccine is prepared through extracting two or more of Vibrio alginolyticus, Vibrio Hrveyi, Vibrio vulnificus, Vibrio parahaemolyticus, etc, and adding immunostimulating complex. The vaccine preparing process includes culturing vibrio, extracting outer membrane protein and preparing vaccine. The vaccine containing partial pathogen and no infecting component has stable immunological specificity and no hidden danger of restoring toxici. The vaccine is used in preventing fishes' skin ulcer, eyeball turbidity and other vibrio caused diseases and may be used widely for immunizing seawater fish.
Owner:GUANGDONG OCEAN UNIVERSITY

Alginate lyase biosynthesis gene cluster

The invention discloses an alginate lyase biosynthesis gene cluster which comprises five alginate lyase encoding genes: algV1, algV2, algV3, algV4 and algV5.The gene cluster is derived from Vibrio alginolyticus ATCC17749. The contained all gene and protein information related to the alginate lyase biosynthesis, provided by the invention, can help people to understand the biosynthesis mechanism of the alginate lyase so as to provide a great deal of substance and genetic information for the large-scale application of the alginate lyase.
Owner:EAST CHINA UNIV OF SCI & TECH

Marine vibrio multiple PCR reaction reagent kit and detecting method thereof

InactiveCN101067155AFind outFind out avoidMicrobiological testing/measurementAgainst vector-borne diseasesMicrobiologyVibrio DNA
The present invention discloses one kind of multiple PCR reaction reagent kit for detecting marine vibrio and its detection method. The multiple PCR reaction reagent kit includes PCR reaction solution compounded with 10xPCR reaction buffering solution containing Mg2+, dNTP, Hot star Taq enzyme, pathogenetic vibrio DNA primer and sterilized ion solution. The pathogenetic vibrio DNA primer includes DNA primers of three kinds of vibrios. The present invention may be used in detecting these three kinds of vibrios in short time and lowered cost and is favorable to the diagnosis of vibriosis of marine animal.
Owner:NINGBO UNIV

Gene chip for detecting nine pathogenicity vibrios in marine products

The invention relates to a gene chip for detecting nine pathogenicity vibrios in marine products and a kit thereof. The gene chip comprises a solid phase carrier and an oligonucleotide probe, wherein the oligonucleotide probe includes one or more selected from the following nucleotide sequences: 1) DNA sequences selected from genes of a vibrio hollisae, a vibrio vulnificus, a vibrio cholera, a vibrio parahemolyticus, a vibrio harveyi, a vibrio alginolyticus, a vibrio furnissi, a vibrio mimicus and a vibrio damsel, 2) complementary DNA sequences of the DNA sequences selected in the DNA sequences in 1), 3) complementary RNA sequences of the selected DNA sequences in 1) or 2). The kit comprises the gene chips. The gene chip for detecting nine pathogenicity vibrios in marine products and the kit thereof provided by the invention are used for detecting the nine pathogenicity vibrios in marine products, and have the advantages of simplicity in operation, good sensitivity and strong repeatability.
Owner:ZHOUSHAN INST OF CALIBRATION & TESTING FOR QUALITY & TECHNICAL SUPERVISION

Primer group utilizing LAMP to detect vibrio alginolyticus and rapid diagnosis kit employing primer group

The invention relates to a primer group utilizing LAMP to detect vibrio alginolyticus and a rapid diagnosis kit employing the primer group. The primer group comprises F3: CCAGTGGCTTACTCGTTGG, B3: TTCGCGGCCATAAACTCAT, FIP; CGTTCCACTGCCCACCAAACAAGCCCAGCACTGGTATATGC, and BIP: GGCAACCAAACGGACCTTGCCCGATTGATGACGCCCTTAG, and the rapid diagnosis kit comprises the primer group, positive reference substance, LAMP reaction liquid and BstDNAPolymerase polymerase. The primer group and the rapid diagnosis kit have the advantages that the operability is high, the operation speed is high, the result is visual to judge, the detection cost is low, and the experimental device is simple, and only a common water bath kettle or other equipment capable of obtaining stable heat sources is required.
Owner:哈尔滨海关技术中心

Pediococcus pentosaceus G11 strain as well as screening and applications thereof

The invention relates to a pediococcus pentosaceus G11 strain as well as screening and applications of the pediococcus pentosaceus G11 strain. The pediococcus pentosaceus G11 strain is preserved in the China Center for Type Culture Collection, and is assigned with the accession number of CCTCC NO:2016248. The pediococcus pentosaceus G11 strain has tolerance to compound sulfamethoxazole and ceftazidime, has antibacterial activity for vibrio parahaemolyticus, aeromonas hydrophila, vibrio alginolyticus, staphylococcus aureus and beta streptococcus, has certain stress resistance and enzyme producing ability, is free of hemocyte solubility, and has no drug tolerance for most antibiotics; the dipping bath experiment proves that the pediococcus pentosaceus G11 strain is harmless to the host, can improve the immunity of the body, has wide application prospects, can be applied to probiotic preparations, and also can be prepared into bacterial powder which is then added into a feed as a feed additive, further, the growth of pathogenic bacteria in the bodies of the animals is inhibited, so that the death rate of animals is reduced, and the pediococcus pentosaceus G11 strain is a probiotic brain worthy of development.
Owner:SHANTOU UNIV

ssDNA nucleic acid aptamer and application thereof in quick detection of vibrio alginolyticus

The invention discloses a ssDNA nucleic acid aptamer capable of specifically recognizing vibrio alginolyticus, a screening method, a detection method and application thereof. A nucleotide sequence ofthe ssDNA nucleic acid aptamer is 5'-CTTCTATCTACATTTCTTTTTCGTCAATTTTTATTCCCTGGCCCACCCTA-3'(SEQ ID NO:1) or 5'-GACGCTTACTCAGGTGTGACTCG-CTTCTATCTACATTTCTTTTTCGTCAATTTTTATTCCCTGGCCCACCCTA-CGAAGGACGCAGATGAAGTCTC-3'(SEQ ID NO:2). The ssDNA nucleic acid aptamer has specificity and high sensitivity to vibrio alginolyticus and has no immunogenicity. The ssDNA nucleic acid aptamer has the advantages of stable structure, easiness in modification and convenience for synthesis and storage and can be applied in quick and accurate detection and diagnosis of vibrio alginolyticus.
Owner:GUANGXI ACAD OF SCI

Oligonucleotides used for detecting vibrio parahaemolyticus and method of detection therewith

PCT No. PCT / JP97 / 00991 Sec. 371 Date Jan. 6, 1999 Sec. 102(e) Date Jan. 6, 1999 PCT Filed Mar. 25, 1997 PCT Pub. No. WO97 / 35970 PCT Pub. Date Oct. 2, 1997An oligonucleotide is provided which has a nucleotide sequence derived from SEQ ID NO:1, characterized in that it contains at least one site capable of amplifying a nucleotide sequence characteristic of Vibrio parahaemolyticus. The oligonucleotide may have a nucleotide sequence not derived from SEQ ID NO:3, or incapable of amplifying nucleotide sequences originating in Vibrio alginolyticus and Vibrio harveyi, and may be represented by SEQ ID NO:5 or SEQ ID NO:6. A method of detecting Vibrio parahaemolyticus in a specimen is also provided which comprises preparing a primer set comprising two of the above oligonucleotides, selectively amplifying therewith a DNA gyrase subunit B gene sequence contained in the specimen as a target, and determining whether or not there is a gyrB unit specific for Vibrio parahaemolyticus in the specimen. Also provided is a primer which reacts specifically with a gyrB gene of Vibrio parahaemolyticus to thereby differentiate and identify the same among other Vibrios and strains other than the genus Vibrio. The Vibrio parahaemolyticus-specific primer serves to detect 285-bp gyrB gene fragments specific for this Vibrio by the PCR method without the necessity for DNA extraction or like operations from bacterial cells.
Owner:NIPPON SUISAN KAISHA LTD

Alkali-resistant vibrio alginolyticus phage and composition thereof and kit, and application thereof

The invention belongs to the technical field of research and development of vibrio alginolyticus phage, and in particular, relates to an alkali-resistant vibrio alginolyticus phage and a composition thereof, and a kit. The vibrio alginolyticus phage is vibrio alginolyticus phage VAP21, and has the preservation number of CCTCC NO:M 2018768. The invention also discloses an application of the vibrioalginolyticus phage, or a vibrio alginolyticus phage composition, or a reagent or kit containing the vibrio alginolyticus phage or the vibrio alginolyticus phage composition in killing and / or preventing vibrio microorganisms. The vibrio alginolyticus phage has wide host range, still has high toxicity to host bacteria at low concentration, good proliferation on non-pathogenic bacteria host and large-scale industrial production, and can provide excellent strain resources for an application of phagotherapy.
Owner:PHAGELUX (NANJING) BIO-TECH CO LTD

Alginate lyase Alga and coding gene and application thereof

The present invention discloses an alginate lyase Alga genetic sequence and a preparation method and application thereof. Alginate lyase Alga is derived from Vibrio alginolyticus 40B. The present invention provides a process for preparing the novel alginate lyase Alga, a genetic engineering method is used, an alginate lyase Alga coding gene is cloned into an E. coli expression vector to obtain a recombinant E. coli strain capable of heterologous expression of the alginate lyase Alga, and the alginate lyase Alga prepared by heterologous expression of the recombinant E. coli strain has the function of degrading sodium alginate to prepare sodium alginate oligosaccharide. The alginate lyase Alga can be widely used in chemical industry, agriculture, food, feed additives, pharmaceuticals and algae genetic engineering and other fields.
Owner:DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI

Preparation method and application of compound microbial substrate modifier with aquatic pathogen antagonistic characteristic

The invention belongs to the technical field of microorganisms and discloses a preparation method and application of a compound microbial substrate modifier with an aquatic pathogen antagonistic characteristic. Two strains namely bacillus subtilis AB-90008-15 and lactobacillus gasseri 88 are provided, and the compound microbial substrate modifier is obtained by strain activation, fermentation culture, centrifugal strain collection and vacuum drying and grinding. The compound microbial substrate modifier has an antagonistic action on aquatic pathogens such as aeromonas hydrophila, aeromonas sobria, aeromonas veronii, aeromonas caviae, Edwardsiella tarda, listonella anguillarum, vibrio parahaemolyticus and vibrio alginolyticus and is capable of degrading carbonaceous organics and nitrogenousorganics in pond sediment, promoting sediment mineralization, reducing contents of total nitrogen, total phosphorus, nitrite, ammonia nitrogen and COD of aquaculture water, promoting virtuous cycle of waternutrients, preventing accumulation of toxic and harmful substances and improving an aquaculture substrate ecological environment.
Owner:江苏省苏微微生物研究有限公司

Multiplex PCR primer for synchronously detecting vibrio parahaemolyticus and vibrio alginolyticus, and design method thereof

The invention relates to multiplex PCR primer for amplifying sequences of vibrio parahaemolyticus and vibrio alginolyticus, and a design method thereof. The design method comprises the following steps: 1, adopting a primer design software to design a series of multiplex PCR primer compositions for simultaneous amplification of the sequences of the vibrio parahaemolyticus and the vibrio alginolyticus; 2, screening the multiplex PCR primer compositions, and selecting the primer composition with the best amplification effect; 3, carrying out reaction condition selection for the selected best primer composition; 4, carrying out selections of specificity, reproducibility, stability and the like for the established method. According to the present invention, the problem of long separation and detection period of the conventional bacterial during the detection process of the vibrio parahaemolyticus and the vibrio alginolyticus is solved; the vibrio parahaemolyticus and the vibrio alginolyticus are detected synchronously; advantages of rapidness, specificity, sensitivity, cost saving and the like are provided.
Owner:INSPECTION & QUARANTINE TECH CENT OF XIAMEN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

ssDNA aptamer capable of identifying and combining with vibrio alginolyticus and application thereof

The invention discloses an ssDNA aptamer capable of identifying and combining with aquatic pathogenic bacteria, namely vibrio alginolyticus, and a screening method, a detection method and applicationthereof. The nucleotide sequence of the ssDNA aptamer is 5'-ATTTTGCTTTTGCCACTTAT CAACATTTGTTTTTCCGCTTTCGCACTTC-3'(SEQ ID NO:1), or 5'-GACGCTTACTCAGGTGTGACTCG-ATTTTGCTTTTGCCACTTATCAACATTTGTTTTTCCGCTTTCGCACTTC-CGAAGGACGCAGATGAAGTCTC-3'(SEQ ID NO:2). The ssDNA aptamer disclosed by the invention has specificity and high sensitivity to the vibrio alginolyticus, has the advantages of being stable in structure, easy to modify and convenient to synthesize and preserve, and can quickly and accurately detect and diagnose the vibrio alginolyticus.
Owner:GUANGXI ACAD OF SCI

Aptamer-based quantitative vibrio alginolyticus detection method

The invention discloses an aptamer-based quantitative vibrio alginolyticus detection method. The method includes steps: synthesizing aptamers and marking fluorescein; respectively mixing to-be-detected vibrio alginolyticus and vibrio alginolyticus in known concentration with the aptamers; after well mixing, combining vibrio alginolyticus with a detection reagent; after combination is finished, centrifuging, removing supernatant, and washing bacterial precipitates with washing buffer solution; repeating the steps; resuspending the bacterial precipitates with washing buffer solution, and transferring the buffer solution to a new tube; adopting a fluorescence method for determining a fluorescence value of solution in the new tube; performing linear fitting according to the fluorescence valueto obtain a corresponding standard curve and fitting equation, and calculating concentration of the to-be-detected vibrio alginolyticus according to the standard curve. The quantitative detection method for vibrio alginolyticus and inactivated bacteria thereof has advantages of simplicity, convenience, quickness, high recognizability, high repeatability, high accuracy and the like.
Owner:JIMEI UNIV

Gene chip for detecting vibrio harveyi colony and using method of gene chip

The invention discloses a gene chip for detecting a vibrio harveyi colony and a using method of the gene chip. The gene chip is characterized in that nucleotide probes for detecting vibrio alginolyticus, V. campbellii, V. harveyi, V. natriegens, V. parahaemolyticus and V. rotiferianus are immobilized on a chip carrier; the probes of various vibrios use a toxR gene as a target gene; the gene sequences of the various probes are as shown in SEQ ID NO: 11-14; and in a step of PCR amplification on a sample, the gene sequences of a PCR amplification forward primer designed for the toxR gene of various strains of the vibrio harveyi colony and a reverse primer with a digoxin marker are as shown in SEQ ID NO. 15-26. The gene chip disclosed by the invention has the advantage that the gene chip is capable of rapidly and effectively detecting 6 pathogenic vibrios of the pathogenic vibrio harveyi colony in a parallel mode, and the gene chip is high in accuracy and sensitivity and is strong in specificity.
Owner:NINGBO UNIV

No mark gene deletion deoxidated mutant strain of wild Manhu bacteria and its use

A bacterin for fish farming is used to treat vibriosis with reduced toxicity. The vaccine is mainly formed by no marker gene deletion strains with toxicity reduced. It is effective for cross immunization of Rongzao vibrios. The vaccine made from it can effectively be used to prevent testing fishes from diseases caused by vibriosis.
Owner:SHANGHAI HAOSI MARINE BIOTECHNOLOGY CO LTD

Aquaculture creature disease controlling compound vaccine and its preparation method

Disclosed is an aquaculture creature disease controlling compound vaccine which mainly comprises vibrio alginolyticus, bibrio parahemolyticus, vibrio alginolyticus, Aeromonas hydrophila, Aeromonas sobria, Pseudomonas aeruginosa, and Vibrio alginolyticus. The invention also discloses the preparing process for the composite bacterial vaccine.
Owner:DALIAN UNIV

An antibiotic peptide and its coded sequence and use

The present invention provides one kind of antibiotic peptide and its coding polynucleotides and use. The antibiotic peptide contains the amino acid sequence from site 1 to site 25 in the sequence table <400>2 of the sequence table. The polynucleotides coding the antibiotic peptide include the nucleotide sequence of amino acid sequence form site 1 to site 25, from site 1 to site 45 or from -22 site to site 45 in the sequence table <400>2 of the sequence table or their complementary sequences. The antibiotic peptide has obvious killing effect on several kinds of bacteria, and has lowest killing concentration smaller than 10 micro mol / L to algae dissolving vibrio, vibrio vulnificus, parahemolytic vibrio, Pasteuvella multocida, etc. and may be used in preparing antibiotic, especially that for preventing and treating bacterial diseases of aquatics.
Owner:SUN YAT SEN UNIV